Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M006533200 on February 13, 2001

J. Biol. Chem., Vol. 276, Issue 21, 17754-17761, May 25, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
276/21/17754    most recent
M006533200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sindic', A.
Right arrow Articles by Banfic', H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sindic', A.
Right arrow Articles by Banfic', H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Presence and Activation of Nuclear Phosphoinositide 3-Kinase C2beta during Compensatory Liver Growth*

Aleksandra Sindstrokic'Dagger §, Aleksandra AleksandrovaDagger §, Alan P. Fields, Stefano Volinia||, and Hrvoje Banfic'Dagger **

From the Dagger  Department of Physiology and Croatian Institute for Brain Research, School of Medicine, University of Zagreb, Salata 3, Zagreb 10,000, Croatia, the  Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, Texas 77555-1048, and the || Dip. di Morfologia ed Embriologia, Universita degli Studi, Via Fossato di Mortara 64/b, Ferrara 44100, Italy

Received for publication, July 21, 2000, and in revised form, January 31, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Highly purified liver nuclei incorporated radiolabeled phosphate into phosphatidylinositol 4-phosphate (PtdIns(4)P), PtdIns(4,5)P2, and PtdIns(3,4,5)P3. When nuclei were depleted of their membrane, no radiolabeling of PtdIns(3,4,5)P3 could be detected showing that within the intranuclear region there are no class I phosphoinositide 3-kinases (PI3K)s. In membrane-depleted nuclei harvested 20 h after partial hepatectomy, the incorporation of radiolabel into PtdIns(3)P was observed together with an increase in immunoprecipitable PI3K-C2beta activity, which is sensitive to wortmannin (10 nM) and shows strong preference for PtdIns over PtdIns(4)P as a substrate. On Western blots PI3K-C2beta revealed a single immunoreactive band of 180 kDa, whereas 20 h after partial hepatectomy gel shift of 18 kDa was noticed, suggesting that observed activation of enzyme is achieved by proteolysis. When intact membrane-depleted nuclei were subjected to short term (20 min) exposure to µ-calpain, similar gel shift together with an increase in PI3K-C2beta activity was observed, when compared with the nuclei harvested 20 h after partial hepatectomy. Moreover, the above-mentioned gel shift and increase in PI3K-C2beta activity could be prevented by the calpain inhibitor calpeptin. The data presented in this report show that, in the membrane-depleted nuclei during the compensatory liver growth, there is an increase in PtdIns(3)P formation as a result of PI3K-C2beta activation, which may be a calpain-mediated event.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The phosphorylation and hydrolysis of phosphoinositol lipids is a major pathway for the generation of a diverse set of second messenger signaling molecules. A phosphatidylinositol-based phosphorylation/hydrolysis cycle has been identified in the plasma membrane, which plays a critical role in the activation of several serine/threonine protein kinases, including protein kinase C (PKC)1 and protein kinase B (PKB) or Akt. Although the presence and activation of phospholipase C (PLC) in the cell nucleus has been extensively documented (1-3), the presence of phosphoinositide 3-kinase (PI3K) has been shown only recently (4-7). On the basis of their structure and in vitro activity, PI3K isozymes have been divided into three classes termed I, II, and III (8). Class I enzymes utilize PtdIns, PtdIns(4)P and PtdIns(4,5)P2, as a substrate in vitro to produce their 3-phospolipid products from which PtdIns(3,4)P2 and PtdIns(3,4,5)P3 are able to activate PKB in vivo (9-11). In the cell nucleus both subclasses of class I have been shown to exist, subclass IA, which binds p85-adaptor that facilitates translocation to phosphotyrosine-containing signaling complexes, and subclass IB, which contains the G-protein-activated enzyme p110gamma (4-7). Class II PI3K enzymes are distinguished from other PI3K isozymes by the presence of two tandem domains at their carboxyl terminus. The first one is termed a phox homology domain, and the function of this domain is rather unclear (12), whereas the second is the C2 domain, which is a phospholipid-binding domain that can confers a Ca2+ sensitivity (13). All three members of the class II PI3K enzymes (PI3K-C2alpha , PI3K-C2beta , and PI3K-C2gamma ) are able to phosphorylate PtdIns and PtdIns(4)P in in vitro assays, but the mechanism of their activation and the function of their 3-phosphoinositide products in vivo are poorly understood. However, PI3K-C2alpha plays a signaling role downstream of monocyte chemotactic peptide receptor (14) and insulin receptor (15) and is concentrated in the trans-Golgi network and present in clathrin-coated vesicles (16). In the platelets, PI3K-C2beta is activated in response to stimulation of integrin receptors by fibrinogen (17), whereas both PI3K-C2alpha and PI3K-C2beta are downstream signaling targets of activated epidermal growth factor and platelet-derived growth factor receptors (18). Although PI3K-C2alpha and PI3K-C2beta share a wide tissue distribution, PI3K-C2gamma expression is restricted primarily to hepatocytes and is enhanced during the liver regeneration (19, 20). Class III PI3K contains only a single enzyme termed Vps34p, which in yeast regulates vacuolar trafficking through generation of PtdIns(3)P (21, 22). Using a well described model of the liver regeneration in which we have previously demonstrated the activation of PLC with accompanied translocation of PKC to the nucleus (23), the present study was undertaken to investigate the metabolism of 3-phosphorylated phosphoinositides in the light of the recently demonstrated compartmentalization of inositol lipids in the isolated liver nuclei (24).

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents were obtained from the following sources: EGTA, EDTA, HEPES, Tris, leupeptin, phenylmethylsulfonyl fluoride, phosphatidylserine, Triton X-100, Na+ deoxycholate, protein A-Sepharose, SDS, and aprotinin from Sigma Chemical Co., St. Louis MO; inositol lipids from Eschlon Research Laboratories, Salt Lake City, UT; wortmannin, µ-calpain, and calpeptin from Calbiochem, Nottingham, UK; [gamma -32P]ATP, [35S]methionine, [35S]cysteine, and enhanced chemiluminescence kit from Amersham Pharmacia Biotech, Bucks, UK. All other chemicals were of analytical grade.

Male Wistar rats (150-250 g of body wt) were used in all experiments. When partial hepatectomy was performed two-thirds of the liver was surgically removed (23).

Purification of Liver Nuclei-- Livers were collected on ice, washed twice in solution B (10 mM HEPES (pH 7.5), 5 mM MgCl2, 25 mM KCl) and 14 g (wet wt) was homogenized in 28 ml of the same solution using a power-driven pestle. To this was added 4.9 ml of solution C (10 mM HEPES (pH 7.5), 2 mM MgCl2, 2.4 M sucrose), to give a final concentration of sucrose of 0.25 M. This was then mixed by inversion with solution D (10 mM HEPES (pH 7.5), 2 mM MgCl2, 2.3 M sucrose; 90 ml), to gave a final sucrose concentration of 1.62 M. A 7.5-ml cushion of solution D was then layered carefully below 23 ml of the final (1.62 M sucrose) liver homogenate. The samples were then spun at 106,000 × g for 30 min at 4 °C in a Beckman SW27 rotor. The pellet at the bottom of the cushion was considered to be the nuclear fraction and was vigorously resuspended in 5 ml of solution A (10 mM HEPES (pH 7.5), 2 mM MgCl2, 0.25 M sucrose). The fractions were then pooled and washed twice with 25 ml of solution A before being pelleted at 165 × g for 6 min at 4 °C and finally being resuspended to 4 ml in this solution (24). The purity of nuclei was estimated by the determination of marker enzymes (leucine arylamidase, Na+-K+-ATPase, succinate:cytochrome c oxidoreductase, KCN-resistant NADH oxidoreductase, and 5-nucleotidase) and by electron microscopy (23, 24).

Preparation of Membrane-depleted Nuclei-- A quantitative removal of the nuclear envelope was performed with the non-ionic detergent Triton X-100. A 0.5-ml aliquot of nuclei in solution A was mixed with 20 ml of ice-cold final resuspension buffer (5 mM Tris (pH 7.4), 5 mM MgCl2, 1.5 mM KCl, 1 mM EGTA, 0.29 M sucrose) and left for 20 min. Triton X-100 was added to this buffer before addition of the nuclei to yield a final concentration of 0.04% (w/v). The nuclei were pelleted at 165 × g for 6 min (4 °C), and the supernatant was removed. The pellet was carefully resuspended in solution A (5 ml), and a cushion carefully laid beneath it (10 mM HEPES (pH 7.5), 2 mM MgCl2, 0.5 M sucrose; 10 ml), and centrifuged at 165 × g for 6 min (4 °C). This was assumed to remove any residual Triton X-100. The supernatant was removed, and the final pellet was resuspended in 0.5 ml of solution A (24).

Preparation of Cell Lysate, Cytosolic Fraction, and Postnuclear Membranes-- Cell lysate was prepared by homogenization of liver tissue in solution B as stated above. Cytosolic fraction was prepared by homogenization in solution B, and afterward samples were spun at 106,000 × g for 90 min at 4 °C in a Beckman SW 27 rotor, and clear supernatant was considered to be cytosolic fraction. Preparation of postnuclear membranes was achieved by centrifugation of supernatant, which remained above cushion after the nuclear fraction has been obtained. The supernatant was diluted in solution B to give a final concentration of 162 mM sucrose and spun at 106,000 × g for 90 min at 4 °C in a Beckman SW 27 rotor. The resultant pellet was considered to contain postnuclear membranes.

Labeling of Inositol Lipids with [gamma -32P]ATP-- For the in vitro labeling of inositol lipids with [gamma -32P]ATP nuclei (total protein 100 µg) were resuspended in 90 µl of buffer containing 10 mM HEPES (pH 7.5), 5 mM MgCl2, 1.5 mM KCl, 1 mM EGTA, and 0.25 M sucrose. The samples were preincubated for 2 min at 30 °C to hydrolyze any remaining endogenous ATP. Then 10 µl of phosphorylation mixture (40 µCi of [gamma -32P]ATP, 2 µl of 5 mM non-radiolabeled ATP, made up to 10 µl with the above-mentioned buffer) was added. Incubation was carried out for 5 min at 30 °C and terminated by the addition of 1 ml of chloroform/methanol (1:1) (24). For exogenous lipid phosphorylation, radiolabeling was carried out as above, except that the nuclei were resuspended in 40 µl of the above-mentioned buffer and made up to 90 µl with lipid vesicles. These consisted of different inositol lipids in the concentration of 50 mM and PtdSer (100 mM). The vesicles of each single inositol lipid and PtdSer were formed by sonication. Incubation was carried out and terminated as described above. Lipids were extracted and deacylated, and the separation of all the glycerophosphoinositides was achieved using an HPLC high resolution 5 µM Partisphere SAX column (Whatman) with a discontinuous gradient up to 1 M (NH4)2HPO4 × H2PO4 (pH 3.8) exactly as described in a previous study (25).

Immunonoprecipitation of PI3K-C2beta -- PI3K-C2beta isoform-discriminant polyclonal antisera against the first 331-amino acid portion of PI3K-C2beta (26), expressed in Escherichia coli as an amino-terminally fused glutathione S-transferase protein, were raised in rabbits as described previously (17). These antisera were used for all immunoprecipitations and Western blots directed at PI3K-C2beta . Native or membrane-depleted nuclei were resuspended in 0.5 ml of buffer containing 50 mM Tris (pH 7.6), 150 mM NaCl, 1% Triton X-100 (w/v), 0.5% Na+ deoxycholate (w/v), 0.1% SDS (w/v), 2 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, and 1 µg/ml leupeptin and spun at 100,000 × g for 90 min at 4 °C. PI3K-C2beta was immunoprecipitated overnight from 450 µl of supernatants with antibody and protein A-Sepharose. Immunoprecipitates were washed once with the above-mentioned buffer, then three times with 5 mM HEPES/2 mM EDTA (pH 7.5) and then the phosphorylation assay was carried out as described above for exogenous lipid phosphorylation.

Western Blot Analysis of PI3K-C2beta -- Proteins for electrophoresis were prepared so that the concentration of each sample was 50 µg/25 µl of sample loading buffer (27), and electrophoresis was carried out using a Bio-Rad Minigel apparatus at an acrylamide concentration of 5% (w/v) or 12% (w/v) when expressed amino-terminal fragments of PI3K-C2beta and PI3K-C2gamma were run. After electrophoresis, the proteins were transferred to nitrocellulose using a Bio-Rad wet-blotting system. The blot was blocked with a buffer containing 4% (w/v) dried milk, 20 mM Tris, 140 mM NaCl, 0.05% (v/v) Tween 20. It was then probed for 2 h with primary antibody (1:1000), then washed with a blocking buffer and incubated with the secondary antibody conjugated to horseradish peroxidase. Visualization was carried out using the ECL kit (Amersham Pharmacia Biotech).

Expression of the Recombinant Amino-terminal Fragment of PI3K-C2gamma -- The amino-terminal fragment of PI3K-C2gamma was amplified using PCR and a human liver cDNA library. Two nested pairs of oligonucleotides were used to produce a PCR template suitable for use in the STP3 in vitro transcription translation system (Novagen). The first PCR reaction produces a 1239-bp fragment from the 5'-region of PI3K-C2gamma (5'-AACGGATCCAAATCCTAATGAAT at +18 and 3'-TCTGATGAGTGTTAAGAGACATTG at +1233). A T7 RNA polymerase promoter was incorporated in the sense primer of the second pair of oligonucleotides (GGATCCTAATACGACTCACTATAGGAACAGACCACCATGAAGCAGTATGAACACCAAG) along with a 3'-stop codon in the antisense primer (TCAAAACTGACTGTGGTCCTCTTC) used in the nested PCR. The protein expressed in the in vitro translation system spans the amino-terminal portion of PI3K-C2gamma from amino acid 17 to amino acid 387, the region that overlaps to the antigenic portion of PI3K-C2beta previously used as immunogen (28). 35S-Labeled methionine and cysteine were used to detect the in vitro translated PI3K-C2gamma amino terminus.

Statistical Evaluation-- The data are shown as means ± S.E. For statistical analyses, the Student's t test for unpaired samples at the level of significance of 0.05 was used.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Assessment of Nuclear Purity-- The purity of isolated nuclei was estimated by the determination of marker enzymes (see "Experimental Procedures") and by electron microscopy (results not shown). Most marker enzymes were at levels so low that quantification was difficult, and electron microscopy showed no other obvious components present. The exception in this respect was for endoplasmic reticulum KCN-resistant NADH-exidoreductase: the specific activity for this enzyme in nuclear preparations (original homogenate activity, 0.59 ± 0.04 µmol/mg of protein per ml) was 0.15 ± 0.02, which decreased to 0.08 ± 0.01 when the nuclei were depleted of membrane using 0.04% Triton X-100. The presence of KCN-resistant NADH oxidoreductase may be taken as evidence for residual endoplasmic reticulum contamination that is finally removed by detergent, but it is equally likely that it is present in the nuclear membrane, which is also removed by detergent (23, 24).

Phosphorylation of Phosphoinositides in the Whole and Membrane-depleted Nuclei-- As shown in Figs. 1 and 2A when the intact nuclei have been labeled for a short time period (5 min) the radioactivity was found in PtdIns(4)P, PtdIns(4,5)P2, and PtdIns(3,4,5)P3. As has already been noticed by Lu et al. (4) the formation of PtdIns(3,4)P2 could only be found when incubation was carried out for 20 min or longer, therefore, in the present investigation the incubation time was too short to observe any PtdIns(3,4)P2 formation. As shown in Fig. 1 the level of incorporation fell dramatically when the nuclei were depleted of their membrane, whereas no incorporation could be detected in PtdIns(3,4,5)P3. This suggests that within the intranuclear region there are PtdIns and PtdIns(4)P available for phosphorylation, whereas there is no PtdIns(4,5)P2 or that the 3-kinase is not present in the nuclei depleted of nuclear membrane. To address this question, exogenous lipid substrates were added, in the form of vesicles, to the membrane-depleted nuclei. Addition of exogenous lipid substrates resulted in the reconstitution of incorporation of phosphate into PtdIns(4)P and PtdIns(4,5)P2 but not into PtdIns(3,4,5)P3, suggesting that 3-kinase that utilizes PtdIns(4,5)P2 as a substrate is not present in the membrane-depleted nuclei.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1.   Incorporation of 32P into PtdIns(4)P, PtdIns(4,5)P2, and PtdIns(3,4,5)P3 in the intact and membrane-depleted liver nuclei and after addition of exogenous lipid to the membrane-depleted nuclei. Nuclei were prepared and radiolabeled as described under "Experimental Procedures," and the separation of glycerophosphoinositides was achieved using HPLC high resolution 5 µM Partisphere SAX column. Intact nuclei (open bars), membrane-depleted nuclei (gray bars), and membrane-depleted nuclei after addition of exogenous lipid (black bars) are shown. When exogenous lipid was added for measurement of incorporation of 32P into PtdIns(4)P, PtdIns was used as a substrate, for PtdIns(4,5)P2, PtdIns(4)P was used as substrate, whereas for PtdIns(3,4,5)P3, PtdIns(4,5)P2 was used as a substrate and all other details are as described under "Experimental Procedures." The results are means ± S.E. for three different experiments, each performed in duplicate. *, p < 0.05 (Student's t test) with respect to the intact nuclei. n.d., not detectable.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   HPLC profile of deacylated phospholipids extracted from 32P-labeled intact nuclei (A) and the nuclei harvested 20 h after partial hepatectomy (B). The nuclei were prepared and radiolabeled, and the separation of glycerophosphoinositides was achieved as described under "Experimental Procedures."

Because it is known that there is an increase in nuclear DAG concentration and PLC activity during the liver regeneration (23, 29), which peaks around 20 h following partial hepatectomy, the nuclei harvested at this time point were used for labeling inositol lipids (Fig. 2). Although the incorporation of radiolabeled phosphate into PtdIns(4)P, PtdIns(4,5)P2, and PtdIns(3,4,5)P3 did not change, radioactivity in PtdIns(3)P could be found. This was further documented in the membrane-depleted nuclei and membrane-depleted nuclei after addition of exogenous lipids (Fig. 3). Furthermore, this incorporation of phosphate into PtdIns(3)P is inhibitable by 10 nM wortmannin, suggesting the existence of 3-kinase in the membrane-depleted nuclei, which is unable to use PtdIns(4,5)P2 as a substrate, because under the above-mentioned conditions no radioactivity could be found in PtdIns(3,4,5)P3.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Incorporation of 32P into PtdIns(3)P, PtdIns(4)P, PtdIns(4,5)P2, and PtdIns(3,4,5)P3 in the intact nuclei (A), membrane-depleted nuclei (B), and membrane-depleted nuclei after addition of exogenous lipids (C). The nuclei were prepared and radiolabeled, and the separation of glycerophosphoinositides was achieved as described under "Experimental Procedures." The control nuclei (open bars), nuclei harvested 20 h after partial hepatectomy (gray bars), the effect of wortmannin (10 nM) on nuclei harvested 20 h after partial hepatectomy (black bars) are shown. When exogenous lipid was added for measurement of incorporation of 32P into PtdIns(4)P and PtdIns(3)P, PtdIns was used as a substrate; for PtdIns(4,5)P2, PtdIns(4)P was used as substrate, while for PtdIns(3,4,5)P3, PtdIns(4,5)P2 was used as a substrate. All other details are as described under "Experimental Procedures." The results are means ± S.E. for three different experiments, each performed in duplicate. *, p < 0.05 (Student's t test) with respect to membrane-depleted nuclei harvested 20 h after partial hepatectomy. n.d., not detectable.

Immunoprecipitation and Biochemical Characterization of Nuclear PI3K-C2beta -- Polyclonal antisera against the first 331-amino acid portion of PI3K-C2beta used in the immunoprecipitation studies do not detect class I PI3Ks, Vps34p, PI3K-C2alpha on Western blots or immunoprecipitates (17) and were used to further characterize the observed 3-kinase activity in the membrane-depleted nuclei. Despite the fact that there is absolutely no homology between amino-terminal portions of PI3K-C2gamma and PI3K-C2beta (19, 26), it is important to note that PI3K-C2gamma is expressed in hepatocytes and that its expression is enhanced during liver regeneration (19, 20); therefore, it is crucial that antisera used to immunoprecipitate PI3K-C2beta do not detect PI3K-C2gamma . As shown in Fig. 4 antisera used for immunoprecipitation and Western blotting of PI3K-C2beta were unable to detect the amino-terminal portion of PI3K-C2gamma , which overlaps the antigenic portion of PI3K-C2beta used as an immunogen (28).


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 4.   SDS-PAGE of amino-terminal fragments of PI3K-C2gamma and PI3K-C2beta and their Western blot analysis using anti-PI3K-C2beta polyclonal antibody. Amino-terminal fragments of PI3K-C2gamma and PI3K-C2beta were expressed as described under "Experimental Procedures," and 35S-labeled methionine and cysteine were used to detect in vitro translated protein. Protein was subjected to SDS-PAGE: lane 1, amino-terminal portion of PI3K-C2gamma ; lane 2, amino-terminal portion of PI3K-C2beta and polyacrylamide gel was exposed to x-ray film. Then protein was transferred to nitrocellulose and probed with anti-PI3K-C2beta antibody: lane 3, amino-terminal portion of PI3K-C2gamma ; lane 4, amino-terminal portion of PI3K-C2beta . The position of molecular mass marker lactic dehydrogenase (36.5 kDa) is indicated on the left side by the arrow.

Following partial hepatectomy, an increase in immunoprecipitable PI3K-C2beta activity could be observed in the membrane-depleted nuclei but not in total cell lysate, cytosolic fraction, or postnuclear membranes (Fig. 5). The time course of changes in immunoprecipitable PI3K-C2beta activity showed its maximum at 20 h after partial hepatectomy and then slowly declining until 32 h (Fig. 6), similar to the increase in nuclear DAG concentration and PLC activity (23, 29). It is important to note that no PI3K-C2beta activity could be found in the supernatant when the membrane-depleted nuclei were prepared (results not shown), suggesting that the enzyme is not present in the nuclear membrane.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Activity of immunoprecipitated PI3K-C2beta in cell lysate, cytosolic fraction, membrane-depleted nuclei, and postnuclear membranes. Cell lysate, cytosolic fraction, membrane-depleted nuclei, and postnuclear membranes were prepared as described under "Experimental Procedures." Kinase assay was performed using PtdIns as substrate, and all other details are as described under "Experimental Procedures." The control samples (open bars) and the samples obtained 20 h after partial hepatectomy (black bars) are shown. Results are means ± S.E. for three different experiments, each performed in duplicate. *, p < 0.05 (Student's t test) with respect to the control.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6.   Time course of changes in immunoprecipitable PI3K-C2beta activity in membrane-depleted nuclei following partial hepatectomy. The membrane-depleted nuclei, immunoprecipitation of PI3K-C2beta , and kinase assay were carried out as described under "Experimental Procedures" and legend to Fig. 4. The data are expressed as a percentage of the control level obtained from three independent experiments assayed in duplicate, where the range of duplicates is contained within the symbols.

Because it is known that PI3K-C2beta is able to phosphorylate PtdIns but not PtdIns(4)P in the presence of Ca2+, whereas some phosphorylation of PtdIns(4)P could be observed in the presence of Mg2+ (18, 28), in vitro substrate specificity for immunoprecipitable PI3K-C2beta was tested using Mg2+ for phosphate transfer. As shown in Fig. 7 the basal level of PtdIns phosphorylation is about 4-fold higher than the phosphorylation of PtdIns(4)P, and this proportion increases to about 10-fold in the nuclei harvested 20 h after partial hepatectomy, showing that there is a strong preference for PtdIns over PtdIns(4)P as a substrate in both basal and stimulated condition. Because it is known that 10 nM wortmannin completely inhibit stimulated PI3K-C2beta activity (28) whereas the IC50 for PI3K-C2gamma inhibition is 32 nM, with maximal inhibition obtained with 10 µM wortmannin (19), the present observation that stimulated 3-kinase activity is inhibitable by 10 nM wortmannin further demonstrates that PI3K-C2beta is present in the nuclei and activated during compensatory liver growth.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7.   Substrate specificity of immunoprecipitable PI3K-C2beta activity in the control membrane-depleted nuclei and the nuclei harvested 20 h after partial hepatectomy and the effect of wortmannin (10 nM). The nuclei were prepared, and the immunoprecipitation of PI3K-C2beta and kinase assay were carried out as described under "Experimental Procedures" using PtdIns or PtdIns(4)P as substrates. The control membrane-depleted nuclei (open bars), membrane-depleted nuclei harvested 20 h after partial hepatectomy (gray bars), and the effect of wortmannin (10 nM) on the membrane-depleted nuclei harvested 20 h after partial hepatectomy (black bars) are shown. Results are means ± S.E. for three different experiments, each performed in duplicate. *, p < 0.05 (Student's t test) with respect to the control.

Proteolytic Activation of PI3K-C2beta -- Western blotting of cell lysates and membrane-depleted nuclei, fractionated by SDS-PAGE on a 5% gels and probed with antisera raised against PI3K-C2beta , revealed a single immunoreactive band of 180 kDa (Fig. 8). On the other hand, 20 h after partial hepatectomy a gel shift of 18 kDa was observed only in the membrane-depleted nuclei, suggesting that the observed activation of enzyme (Fig. 5) is achieved by proteolysis. It is important to point out that no proteolytic fragment (Fig. 8) and no increase in enzyme activity (Fig. 5) were detected in cell lysates that also contain nuclei. Therefore, this suggests that proteolysis and activation occur only in the absence of the cell membrane and/or cytosolic fractions, which in turn suggests the presence of an "inhibitor" of proteolysis in the latter cellular fractions. The fact that 50 µg of protein of total cell lysate and 50 µg of nuclear protein (Fig. 8) contain virtually the same amount of PI3K-C2beta indicates that the vast majority of cellular PI3K-C2beta is nuclear. Thus, proteolysis and/or activation of PI3K-C2beta appear to require not only the effects of hepatectomy but also the process of isolating membrane-depleted nuclei.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 8.   Western blot analysis of PI3K-C2beta in cell lysates and membrane-depleted nuclei. Protein (50 µg) was subjected to SDS-PAGE, transferred to nitrocellulose, and probed with anti-PI3K-C2beta antibody: lane 1, control cell lysate; lane 2, cell lysate obtained 20 h after partial hepatectomy; lane 3, control membrane-depleted nuclei; lane 4, membrane-depleted nuclei harvested 20 h after partial hepatectomy. The position of the molecular mass marker for alpha 2-macroglobulin (180 kDa) is indicated on the left side by the arrow.

Previously, we showed that a similar pattern of activation of PI3K-C2beta in platelets could be prevented by calpain inhibitors calpeptin or calpain I inhibitor (17). Therefore, the intact membrane-depleted nuclei were subjected to short term exposure (20 min) to µ-calpain and similar gel shift together with the increase in PI3K-C2beta activity was observed (Fig. 9), when compared with nuclei harvested 20 h after partial hepatectomy (Figs. 5 and 8). Moreover, the above-mentioned gel shift and the increase in PI3K-C2beta activity could not be observed when the nuclei were incubated with Ca2+ alone and could be prevented in the presence of calpain inhibitor calpeptin, further suggesting that calpain-mediated proteolysis of the enzyme may be responsible for its activation.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 9.   Effect of calpain on immunoprecipitable PI3K-C2beta activity in membrane-depleted nuclei (upper panel) and their Western blot analysis (lower panel). The membrane-depleted nuclei were subjected to 20-min exposure at 25 °C to µ-calpain (15 µg/ml) in the presence of 50 µM free Ca2+ concentration and washed three times in solution A, and then immunoprecipitable PI3K-C2beta activity was measured as described under "Experimental Procedures" using PtdIns as a substrate. When added, calpain inhibitor calpeptin (200 µg/ml) was added prior to the exposure of the membrane-depleted nuclei to calpain. Results are means ± S.E. for three different experiments, each performed in duplicate. *, p < 0.05 (Student's t test) with respect to the control. For Western blot analysis, the same experiments were performed, and protein (50 µg) was subjected to SDS-PAGE, transferred to nitrocellulose, and probed with anti-PI3K-C2beta antibody: lane 1, control membrane-depleted nuclei; lane 2, membrane-depleted nuclei exposed to calpain; lane 3, membrane-depleted nuclei incubated only in the presence of Ca2+; lane 4, membrane-depleted nuclei incubated with calpain in the presence of calpeptin. The position of the molecular mass marker for alpha 2-macroglobulin (180 kDa) is indicated on the left side by the arrow.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The presence of both subunits of class I PI3K has been demonstrated in the cell nuclei. Although the p110gamma subunit is translocated to the nuclear membrane from cytosol upon stimulation of HepG2 cells with serum (7), translocation and precise intranuclear localization of p85 subunit differs with cell types. In HL-60 cells it is localized in the nuclear matrix during granulocytic or monocytic differentiation (5, 6), and in PC12 cells intranuclear translocation of the subunit from cytosol was observed upon the stimulation of cells with nerve growth factor (30). In osteosarcoma Saos-2 cells the subunit is distributed not only in cytosol but also in the nucleoplasm and nucleoli, and after the stimulation of cells with interleukin 1 it also translocates from cytosol to the nucleus (31). Sonification and centrifugation of the intact liver nuclei may lead to the distribution of enzyme in both the soluble fraction and nuclear membranes (4). Using a different approach (preparation of membrane-depleted nuclei by detergent), the present study confirms the 3-kinase activity in the nuclear envelope observed above but also shows that within the intranuclear region there is no such activity, because there was no radiolabeling of PtdIns(3,4,5)P3 even when the exogenous lipid substrate (PtdIns(4,5)P2) was added. Furthermore, following partial hepatectomy no increase in the above-mentioned 3-kinase activity in the nuclei could be observed, suggesting that class I PI3K is not involved in nuclear signaling during compensatory liver growth.

In contrast to class I PI3Ks, which are mainly cytosolic and are subjected to translocation to the membranes upon cell stimulation (Ref. 32 for review), class II PI3Ks are predominantly associated with membrane fractions of cells (28, 33) and, therefore, are good candidates for compartmentalization within the cell nucleus as has been shown for PtdIns 4-kinase and PtdIns(4)P 5-kinase (34). Indeed, from the present study it can be concluded that PI3K-C2beta is not present in the nuclear envelope and is probably attached to the nuclear matrix as has been shown for the above-mentioned kinases (34). It is important to note that polyclonal antisera against PI3K-C2beta could not be used for immunohistochemical studies2; therefore, no exact localization of PI3K-C2beta in the membrane-depleted cell nuclei could be done. Nevertheless, knowing that in the membrane-depleted nuclei the concentration of PtdIns is about 20 times higher than PtdIns(4)P (23) and that in in vitro conditions with equimolar concentration of substrates, PtdIns(4)P could be phosphorylated only in the presence of Mg2+ with substantially less efficiency than PtdIns(present study), it seems obvious that in vivo PI3K-C2beta phosphorylates PtdIns to produce PtdIns(3)P, which has also been observed with purified recombinant enzyme (28).

Interestingly, the increased activation of PI3K-C2beta and the formation of PtdIns(3)P parallels the increase in nuclear PLC activity, DAG concentration, and translocation of PKC to the nucleus following partial hepatectomy (23, 29). This indicates that changes in the nuclear inositol lipid metabolism precede the S-phase of cell cycle and mitosis, because cells reach the peak of proliferation 22-26 h after partial hepatectomy (35). Although potential targets for nuclear PKC include lamins, DNA polymerase, and topoisomerase II (see Refs. 3, 36-38 for reviews), one can only speculate about the function of PtdIns(3)P in the cell nuclei. The observations that negatively charged phospholipids can stimulate RNA synthesis by affecting chromatin organization (39) and that histones H1 and H3 are PtdIns(4,5)P2-binding proteins (40) indicated the importance of nuclear polyphosphoinositides in transcription events. On the other hand, intranuclear PtdIns(3)P may be involved in trafficking events, as has been shown for vesicle trafficking via its interaction with FYVE finger domain (11, 32).

In platelets, PI3K-C2beta is activated following stimulation of the integrin receptor with fibrinogen, and this activation could be prevented by calpain inhibitors (17). The present study extends this observation by showing that short term exposure of enzyme to calpain resulted in a similar degree of activation compared to the nuclei harvested 20 h after partial hepatectomy, suggesting that calpain-mediated proteolysis of the enzyme may be responsible for its activation. The calpains are predominantly cytoplasmic Ca2+-dependent proteases, and there are two well-characterized calpain isozymes: m-calpain shows proteolytic activity at mM Ca2+ concentrations, whereas µ-calpain is already active at micromolar Ca2+ concentration (41). Nevertheless, both isoforms are likely to be able to process cellular substrates at physiological Ca2+ concentrations (42). It is important to note that in the isolated liver nuclei some high molecular mass (120-200 kDa) matrix proteins were substrates for purified calpains (43), which, together with the observation that µ-calpain is transported into cell nuclei in an ATP-dependent fashion (44) and accumulated evidence that there is calcium signaling in the cell nucleus (45, 46), strongly supports the present evidence for calpain-mediated activation of PI3K-C2beta in the nuclei when the cells are subjected to growth and hyperplasia. It is noteworthy that the deletion of C2 domain of PI3K-C2beta increased the lipid kinase activity (28), and from an amino acid sequence of the enzyme it could be deduced that calpain-mediated proteolysis may cleave C2 domain, which may result in the observed gel shift and the activation of the enzyme. On the other hand, rapid recruitment of PI3K-C2beta to a phosphotyrosine-signaling complex containing epidermal growth factor receptor (18) suggests that there are different mechanisms of enzyme activation, which depend on the activation of different cellular receptors and/or different subcellular localization of the enzyme.

In summary, the data presented in this report show that, in the membrane-depleted nuclei during the compensatory liver growth, there is an increase in PtdIns(3)P formation as a result of PI3K-C2beta activation. Addition of exogenous µ-calpain to native membrane-depleted nuclei resulted in a similar degree of PtdIns(3)P formation strongly suggesting that PI3K-C2beta activation may be a calpain-mediated event.

    ACKNOWLEDGEMENTS

We thank Rene Lui for editing the manuscript before submission and HSM-informatika for editing the figures before submission.

    FOOTNOTES

* This work was supported by the Ministry of Science of the Republic of Croatia (to H. B.), by a Fogarty International Research Collaboration Award (to A. P. F. and H. B.), and by the AIRC (to S. V.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Both authors contributed equally to this work.

** To whom correspondence should be addressed: Zavod za Fiziologiju, Medicinski Fakultet, Sveuciliste u Zagrebu, Salata 3, P. O. Box 978, Zagreb 10,001, Croatia. Tel.: 385-1-4590-260; Fax: 385-1-4590-207; E-mail: hrvoje.banfic@zg.tel.hr.

Published, JBC Papers in Press, February 13, 2001, DOI 10.1074/jbc.M006533200

2 S. Volinia and H. Banfic', unpublished observation.

    ABBREVIATIONS

The abbreviations used are: PKC, protein kinase C; PKB, protein kinase B; PLC, phospholipase C; PI3K, phosphoinositide 3-kinase; PtdIns, phosphatidylinositol; PtdIns(3)P, phosphatidylinositol 3-phosphate; PtdIns(4)P, phosphatidylinositol 4-phosphate; PtdIns(3, 4)P2, phosphatidylinositol 3,4-bisphosphate; PtdIns(4, 5)P2, phosphatidylinositol 4,5-bisphosphate; PtdIns(3, 4,5)P3, phosphatidylinositol 3,4,5-trisphosphate; PtdSer, phosphatidylserine; DAG, diacylglycerol; HPLC, high pressure liquid chromatography; PCR, polymerase chain reaction; bp, base pair(s); PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Divecha, N., Banfic, H., and Irvine, R. F. (1991) EMBO J. 10, 3207-3214
2. Divecha, N., Banfic, H., and Irvine, R. F. (1993) Cell 74, 405-407
3. D'Santos, C. S., Clarke, J. H., and Divecha, N. (1998) Biochim. Biophys. Acta 1436, 201-232
4. Lu, P. J., Hsu, A. L., Wang, D. S., Yan, H. Y., Yin, H. L., and Chen, C. S. (1998) Biochemistry 37, 5738-5745
5. Marchisio, M., Bertagnolo, V., Colamussi, M. L., Capitani, S., and Neri, L. M. (1998) Biochem. Biophys. Res. Commun. 253, 346-351
6. Neri, L. M., Marchisio, M., Colamussi, M. L., and Bertagnolo, V. (1999) Biochem. Biophys. Res. Commun. 259, 314-320
7. Metjian, A., Roll, R. L., Ma, A. D., and Abrams, C. S. (1999) J. Biol. Chem. 274, 27943-27947
8. Domin, J., and Waterfield, M. D. (1997) FEBS Lett. 410, 91-95
9. Banfic, H., Tang, X., Batty, I. H., Downes, C. P., Chen, C., and Rittenhouse, S. E. (1998) J. Biol. Chem. 273, 13-16
10. Banfic, H., Downes, C. P., and Rittenhouse, S. E. (1998) J. Biol. Chem. 273, 11630-11637
11. Rameh, L. E., and Cantley, L. C. (1999) J. Biol. Chem. 274, 8347-8350
12. Ponting, C. P. (1996) Protein Sci. 5, 2353-2357
13. Rizo, J., and Sudhof, T. C. (1998) J. Biol. Chem. 273, 15879-15882
14. Turner, S. J., Domin, J., Waterfield, M. D., Ward, S. G., and Wastwick, J. (1998) J. Biol. Chem. 273, 25987-25995
15. Brown, R. A., Domin, J., Arcaro, A., Waterfield, M. D., and Sheperd, P. R. (1999) J. Biol. Chem. 274, 14529-14532
16. Domin, J., Gaidarov, I., Smith, M. E. K., Keen, J. H., and Waterfield, M. D. (2000) J. Biol. Chem. 275, 11943-11950
17. Zhang, J., Banfic, H., Straforini, F., Tosi, L., Volinia, S., and Rittenhouse, S. E. (1998) J. Biol. Chem. 273, 14081-14085
18. Arcaro, A., Zvelebil, M. J., Wallasch, C., Ullrich, A., Waterfield, M. D., and Domin, J. (2000) Mol. Cell. Biol. 20, 3817-3830
19. Misawa, H., Ohtsubo, M., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and Yoshimura, A. (1998) Biochem. Biophys. Res. Commun. 244, 531-539
20. Ono, F., Nakagawa, T., Saito, S., Owada, Y., Sakagami, H., Goto, K., Suzuki, M., Matsuno, S., and Kondo, H. (1998) J. Biol. Chem. 273, 7731-7736
21. DeCamilli, P., Emr, S. D., McPherson, P. S., and Novick, P. (1996) Science 271, 1533-1539
22. Volinia, S., Dhand, R., Vanhaesebroeck, B., MacDougall, L. K., Stein, R., Zvelebil, M. J., Domin, J., Panaretou, C., and Waterfield, M. D. (1995) EMBO J. 14, 3339-3348
23. Banfic, H., Zizak, M., Divecha, N., and Irvine, R. F. (1993) Biochem. J. 290, 633-636
24. Vann, L. R., Wooding, F. B. P., Irvine, R. F., and Divecha, N. (1997) Biochem. J. 327, 569-576
25. Auger, K. R., Serunian, L. A., and Cantley, L. C. (1990) in Methods in Inositide Research (Irvine, R. F., ed) , pp. 159-166, Raven Press Ltd., New York
26. Brown, R. A., Ho, L. K. F., Weber-Hall, S. J., Shirpley, J. M., and Fry, M. J. (1997) Biochem. Biophys. Res. Commun. 233, 537-544
27. Laemmli, U. K. (1970) Nature 227, 680-685
28. Arcaro, A., Volinia, S., Zvelebil, M. J., Stein, R., Watton, S. J., Layton, M. J., Gout, I., Ahmadi, K., Downward, J., and Waterfield, M. D. (1998) J. Biol. Chem. 273, 33082-33090
29. Neri, L. M., Ricci, D., Carini, C., Marchisio, M., Capitani, S., and Bertagnolo, V. (1997) Cell. Signalling 9, 353-362
30. Neri, L. M., Martelli, A. M., Borgatti, P., Colamussi, M. L., Marchisio, M., and Capitani, S. (1999) FASEB J. 13, 2299-2310
31. Bavelloni, A., Santi, S., Sirri, A., Riccio, M., Faenza, I., Zini, N., Cecchi, S., Ferri, A., Auron, P., Maraldi, N. M., and Marmiroli, S. (1999) J. Cell Sci. 112, 631-640
32. Vanhaesebroeck, B., and Waterfield, M. D. (1999) Exp. Cell Res. 253, 239-254
33. Prior, I. A., and Clague, M. J. (1999) Mol. Cell. Biol. Res. Commun. 1, 162-166
34. Payrastre, B., Nievers, M., Boonstra, J., Breton, M., Verkleij, A. J., and Van Bergen en Henegouwen, P. M. P. (1992) J. Biol. Chem. 267, 5078-5084
35. Vitale, M., Rizzoli, R., Mazzeroti, G., Zamai, L., Galanzi, A., Rizzi, E., Manzoli, L., Matteucci, A., and Papa, S. (1991) Cell Prolif. 24, 331-338
36. Irvine, R. F., and Divecha, N. (1992) Semin. Cell Biol. 3, 225-235
37. Fields, A. P., and Thompson, L. J. (1995) Prog. Cell Cycle Res. 1, 271-286
38. Murray, N. R., Thompson, L. J., and Fields, A. P. (1997) in Protein Kinase C (Parker, P. J. , and Dekker, L. V., eds) , pp. 97-120, R. G. Landes Company, Austin, TX
39. Capitani, S., Caramelli, E., Felaco, M., Miscia, S., and Manzoli, F. A. (1981) Physiol. Chem. Phys. 13, 153-158
40. Yu, H., Fukami, K., Watanabe, C., Ozaki, C., and Takenawa, T. (1998) Eur. J. Biochem. 251, 281-287
41. Molinari, M., and Carafoli, E. (1997) J. Membr. Biol. 156, 1-8
42. Schollmeyer, J. E. (1988) Science 240, 911-913
43. Mellgren, R. L. (1991) J. Biol. Chem. 266, 13920-13924
44. Mellgren, R. L., and Lu, Q. (1994) Biochem. Biophys. Res. Commun. 204, 544-550
45. Santella, L., and Carafoli, E. (1997) FASEB J. 11, 1091-1109
46. Malviya, A. N., and Rogue, P. J. (1998) Cell 92, 17-23


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Toxicol SciHome page
M. B. Dail, L. A. Shack, J. E. Chambers, and S. C. Burgess
Global Liver Proteomics of Rats Exposed for 5 Days to Phenobarbital Identifies Changes Associated with Cancer and with CYP Metabolism
Toxicol. Sci., December 1, 2008; 106(2): 556 - 569.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Falasca, W. E. Hughes, V. Dominguez, G. Sala, F. Fostira, M. Q. Fang, R. Cazzolli, P. R. Shepherd, D. E. James, and T. Maffucci
The Role of Phosphoinositide 3-Kinase C2{alpha} in Insulin Signaling
J. Biol. Chem., September 21, 2007; 282(38): 28226 - 28236.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Szivak, N. Lamb, and L. M. G. Heilmeyer
Subcellular Localization and Structural Function of Endogenous Phosphorylated Phosphatidylinositol 4-Kinase (PI4K92)
J. Biol. Chem., June 16, 2006; 281(24): 16740 - 16749.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
V. Trkulja, V. Crljen-Manestar, H. Banfic, and Z. Lackovic
Involvement of the Peripheral Cholinergic Muscarinic System in the Compensatory Ovarian Hypertrophy in the Rat
Experimental Biology and Medicine, September 1, 2004; 229(8): 793 - 805.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Didichenko, C. M. Fragoso, and M. Thelen
Mitotic and Stress-induced Phosphorylation of HsPI3K-C2{alpha} Targets the Protein for Degradation
J. Biol. Chem., July 3, 2003; 278(28): 26055 - 26064.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
R. F. Irvine
Nuclear Lipid Signaling
Sci. Signal., September 17, 2002; 2002(150): re13 - re13.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Didichenko and M. Thelen
Phosphatidylinositol 3-Kinase C2alpha Contains a Nuclear Localization Sequence and Associates with Nuclear Speckles
J. Biol. Chem., December 14, 2001; 276(51): 48135 - 48142.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An addition or correction has been published
Right arrow All Versions of this Article:
276/21/17754    most recent
M006533200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sindic', A.
Right arrow Articles by Banfic', H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sindic', A.
Right arrow Articles by Banfic', H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement