|
Originally published In Press as doi:10.1074/jbc.M006533200 on February 13, 2001
J. Biol. Chem., Vol. 276, Issue 21, 17754-17761, May 25, 2001
Presence and Activation of Nuclear Phosphoinositide 3-Kinase
C2 during Compensatory Liver Growth*
Aleksandra
Sin i §,
Aleksandra
Aleksandrova §,
Alan P.
Fields¶,
Stefano
Volinia , and
Hrvoje
Banfi **
From the Department of Physiology and Croatian
Institute for Brain Research, School of Medicine, University of Zagreb,
Salata 3, Zagreb 10,000, Croatia, the ¶ Sealy Center for
Cancer Cell Biology, University of Texas Medical Branch, Galveston,
Texas 77555-1048, and the Dip. di Morfologia ed Embriologia,
Universita degli Studi, Via Fossato di Mortara 64/b, Ferrara 44100, Italy
Received for publication, July 21, 2000, and in revised form, January 31, 2001
 |
ABSTRACT |
Highly purified liver nuclei incorporated
radiolabeled phosphate into phosphatidylinositol 4-phosphate
(PtdIns(4)P), PtdIns(4,5)P2, and
PtdIns(3,4,5)P3. When nuclei were depleted of their
membrane, no radiolabeling of PtdIns(3,4,5)P3 could be
detected showing that within the intranuclear region there are no class
I phosphoinositide 3-kinases (PI3K)s. In membrane-depleted nuclei
harvested 20 h after partial hepatectomy, the incorporation of
radiolabel into PtdIns(3)P was observed together with an increase in
immunoprecipitable PI3K-C2 activity, which is sensitive to
wortmannin (10 nM) and shows strong preference for PtdIns
over PtdIns(4)P as a substrate. On Western blots PI3K-C2 revealed a
single immunoreactive band of 180 kDa, whereas 20 h after partial
hepatectomy gel shift of 18 kDa was noticed, suggesting that observed
activation of enzyme is achieved by proteolysis. When intact
membrane-depleted nuclei were subjected to short term (20 min) exposure
to µ-calpain, similar gel shift together with an increase in
PI3K-C2 activity was observed, when compared with the nuclei
harvested 20 h after partial hepatectomy. Moreover, the
above-mentioned gel shift and increase in PI3K-C2 activity could be
prevented by the calpain inhibitor calpeptin. The data presented in
this report show that, in the membrane-depleted nuclei during the
compensatory liver growth, there is an increase in PtdIns(3)P formation
as a result of PI3K-C2 activation, which may be a calpain-mediated event.
 |
INTRODUCTION |
The phosphorylation and hydrolysis of phosphoinositol lipids is a
major pathway for the generation of a diverse set of second messenger
signaling molecules. A phosphatidylinositol-based
phosphorylation/hydrolysis cycle has been identified in the plasma
membrane, which plays a critical role in the activation of several
serine/threonine protein kinases, including protein kinase C
(PKC)1 and protein kinase B
(PKB) or Akt. Although the presence and activation of phospholipase C
(PLC) in the cell nucleus has been extensively documented (1-3), the
presence of phosphoinositide 3-kinase (PI3K) has been shown only
recently (4-7). On the basis of their structure and in
vitro activity, PI3K isozymes have been divided into three classes
termed I, II, and III (8). Class I enzymes utilize PtdIns, PtdIns(4)P
and PtdIns(4,5)P2, as a substrate in vitro to
produce their 3-phospolipid products from which
PtdIns(3,4)P2 and PtdIns(3,4,5)P3 are able to
activate PKB in vivo (9-11). In the cell nucleus both
subclasses of class I have been shown to exist, subclass IA, which
binds p85-adaptor that facilitates translocation to
phosphotyrosine-containing signaling complexes, and subclass IB, which
contains the G-protein-activated enzyme p110 (4-7). Class II PI3K
enzymes are distinguished from other PI3K isozymes by the presence of
two tandem domains at their carboxyl terminus. The first one is termed
a phox homology domain, and the function of this domain is rather
unclear (12), whereas the second is the C2 domain, which is a
phospholipid-binding domain that can confers a Ca2+
sensitivity (13). All three members of the class II PI3K enzymes (PI3K-C2 , PI3K-C2 , and PI3K-C2 ) are able to phosphorylate
PtdIns and PtdIns(4)P in in vitro assays, but the mechanism
of their activation and the function of their 3-phosphoinositide
products in vivo are poorly understood. However, PI3K-C2
plays a signaling role downstream of monocyte chemotactic peptide
receptor (14) and insulin receptor (15) and is concentrated in the
trans-Golgi network and present in clathrin-coated vesicles (16). In
the platelets, PI3K-C2 is activated in response to stimulation of integrin receptors by fibrinogen (17), whereas both PI3K-C2 and
PI3K-C2 are downstream signaling targets of activated epidermal growth factor and platelet-derived growth factor receptors (18). Although PI3K-C2 and PI3K-C2 share a wide tissue distribution, PI3K-C2 expression is restricted primarily to hepatocytes and is
enhanced during the liver regeneration (19, 20). Class III PI3K
contains only a single enzyme termed Vps34p, which in yeast regulates
vacuolar trafficking through generation of PtdIns(3)P (21, 22). Using a
well described model of the liver regeneration in which we have
previously demonstrated the activation of PLC with accompanied
translocation of PKC to the nucleus (23), the present study was
undertaken to investigate the metabolism of 3-phosphorylated
phosphoinositides in the light of the recently demonstrated
compartmentalization of inositol lipids in the isolated liver
nuclei (24).
 |
EXPERIMENTAL PROCEDURES |
Reagents were obtained from the following sources: EGTA, EDTA,
HEPES, Tris, leupeptin, phenylmethylsulfonyl fluoride,
phosphatidylserine, Triton X-100, Na+ deoxycholate, protein
A-Sepharose, SDS, and aprotinin from Sigma Chemical Co., St. Louis MO;
inositol lipids from Eschlon Research Laboratories, Salt Lake City, UT;
wortmannin, µ-calpain, and calpeptin from Calbiochem, Nottingham, UK;
[ -32P]ATP, [35S]methionine,
[35S]cysteine, and enhanced chemiluminescence kit from
Amersham Pharmacia Biotech, Bucks, UK. All other chemicals were of
analytical grade.
Male Wistar rats (150-250 g of body wt) were used in all experiments.
When partial hepatectomy was performed two-thirds of the liver was
surgically removed (23).
Purification of Liver Nuclei--
Livers were collected on ice,
washed twice in solution B (10 mM HEPES (pH 7.5), 5 mM MgCl2, 25 mM KCl) and 14 g
(wet wt) was homogenized in 28 ml of the same solution using a
power-driven pestle. To this was added 4.9 ml of solution C (10 mM HEPES (pH 7.5), 2 mM MgCl2, 2.4 M sucrose), to give a final concentration of sucrose of
0.25 M. This was then mixed by inversion with solution D
(10 mM HEPES (pH 7.5), 2 mM MgCl2,
2.3 M sucrose; 90 ml), to gave a final sucrose
concentration of 1.62 M. A 7.5-ml cushion of solution D was
then layered carefully below 23 ml of the final (1.62 M
sucrose) liver homogenate. The samples were then spun at 106,000 × g for 30 min at 4 °C in a Beckman SW27 rotor. The pellet at the bottom of the cushion was considered to be the nuclear fraction and was vigorously resuspended in 5 ml of solution A (10 mM HEPES (pH 7.5), 2 mM MgCl2, 0.25 M sucrose). The fractions were then pooled and washed twice
with 25 ml of solution A before being pelleted at 165 × g for 6 min at 4 °C and finally being resuspended to 4 ml
in this solution (24). The purity of nuclei was estimated by the
determination of marker enzymes (leucine arylamidase,
Na+-K+-ATPase, succinate:cytochrome
c oxidoreductase, KCN-resistant NADH oxidoreductase, and
5-nucleotidase) and by electron microscopy (23, 24).
Preparation of Membrane-depleted Nuclei--
A quantitative
removal of the nuclear envelope was performed with the non-ionic
detergent Triton X-100. A 0.5-ml aliquot of nuclei in solution A was
mixed with 20 ml of ice-cold final resuspension buffer (5 mM Tris (pH 7.4), 5 mM MgCl2, 1.5 mM KCl, 1 mM EGTA, 0.29 M sucrose)
and left for 20 min. Triton X-100 was added to this buffer before
addition of the nuclei to yield a final concentration of 0.04% (w/v).
The nuclei were pelleted at 165 × g for 6 min (4 °C), and the supernatant was removed. The pellet was carefully resuspended in solution A (5 ml), and a cushion carefully laid beneath
it (10 mM HEPES (pH 7.5), 2 mM
MgCl2, 0.5 M sucrose; 10 ml), and centrifuged
at 165 × g for 6 min (4 °C). This was assumed to
remove any residual Triton X-100. The supernatant was removed, and the
final pellet was resuspended in 0.5 ml of solution A (24).
Preparation of Cell Lysate, Cytosolic Fraction, and Postnuclear
Membranes--
Cell lysate was prepared by homogenization of liver
tissue in solution B as stated above. Cytosolic fraction was prepared by homogenization in solution B, and afterward samples were spun at
106,000 × g for 90 min at 4 °C in a Beckman SW 27 rotor, and clear supernatant was considered to be cytosolic fraction.
Preparation of postnuclear membranes was achieved by centrifugation of
supernatant, which remained above cushion after the nuclear fraction
has been obtained. The supernatant was diluted in solution B to give a final concentration of 162 mM sucrose and spun at
106,000 × g for 90 min at 4 °C in a Beckman SW 27 rotor. The resultant pellet was considered to contain postnuclear membranes.
Labeling of Inositol Lipids with
[ -32P]ATP--
For the in vitro labeling
of inositol lipids with [ -32P]ATP nuclei (total
protein 100 µg) were resuspended in 90 µl of buffer containing 10 mM HEPES (pH 7.5), 5 mM MgCl2, 1.5 mM KCl, 1 mM EGTA, and 0.25 M
sucrose. The samples were preincubated for 2 min at 30 °C to
hydrolyze any remaining endogenous ATP. Then 10 µl of phosphorylation
mixture (40 µCi of [ -32P]ATP, 2 µl of 5 mM non-radiolabeled ATP, made up to 10 µl with the
above-mentioned buffer) was added. Incubation was carried out for 5 min
at 30 °C and terminated by the addition of 1 ml of
chloroform/methanol (1:1) (24). For exogenous lipid phosphorylation, radiolabeling was carried out as above, except that the nuclei were
resuspended in 40 µl of the above-mentioned buffer and made up to 90 µl with lipid vesicles. These consisted of different inositol lipids
in the concentration of 50 mM and PtdSer (100 mM). The vesicles of each single inositol lipid and PtdSer
were formed by sonication. Incubation was carried out and terminated as
described above. Lipids were extracted and deacylated, and the
separation of all the glycerophosphoinositides was achieved using an
HPLC high resolution 5 µM Partisphere SAX column
(Whatman) with a discontinuous gradient up to 1 M
(NH4)2HPO4 × H2PO4 (pH 3.8) exactly as described in a
previous study (25).
Immunonoprecipitation of PI3K-C2 --
PI3K-C2
isoform-discriminant polyclonal antisera against the first 331-amino
acid portion of PI3K-C2 (26), expressed in Escherichia
coli as an amino-terminally fused glutathione
S-transferase protein, were raised in rabbits as described
previously (17). These antisera were used for all immunoprecipitations
and Western blots directed at PI3K-C2 . Native or membrane-depleted
nuclei were resuspended in 0.5 ml of buffer containing 50 mM Tris (pH 7.6), 150 mM NaCl, 1% Triton X-100
(w/v), 0.5% Na+ deoxycholate (w/v), 0.1% SDS (w/v), 2 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, and
1 µg/ml leupeptin and spun at 100,000 × g for 90 min
at 4 °C. PI3K-C2 was immunoprecipitated overnight from 450 µl
of supernatants with antibody and protein A-Sepharose.
Immunoprecipitates were washed once with the above-mentioned buffer,
then three times with 5 mM HEPES/2 mM EDTA (pH
7.5) and then the phosphorylation assay was carried out as described
above for exogenous lipid phosphorylation.
Western Blot Analysis of PI3K-C2 --
Proteins for
electrophoresis were prepared so that the concentration of each sample
was 50 µg/25 µl of sample loading buffer (27), and electrophoresis
was carried out using a Bio-Rad Minigel apparatus at an acrylamide
concentration of 5% (w/v) or 12% (w/v) when expressed amino-terminal
fragments of PI3K-C2 and PI3K-C2 were run. After electrophoresis,
the proteins were transferred to nitrocellulose using a Bio-Rad
wet-blotting system. The blot was blocked with a buffer containing 4%
(w/v) dried milk, 20 mM Tris, 140 mM NaCl,
0.05% (v/v) Tween 20. It was then probed for 2 h with primary
antibody (1:1000), then washed with a blocking buffer and incubated
with the secondary antibody conjugated to horseradish peroxidase.
Visualization was carried out using the ECL kit (Amersham Pharmacia Biotech).
Expression of the Recombinant Amino-terminal Fragment of
PI3K-C2 --
The amino-terminal fragment of PI3K-C2 was
amplified using PCR and a human liver cDNA library. Two nested
pairs of oligonucleotides were used to produce a PCR template suitable
for use in the STP3 in vitro transcription translation
system (Novagen). The first PCR reaction produces a 1239-bp fragment
from the 5'-region of PI3K-C2 (5'-AACGGATCCAAATCCTAATGAAT at +18 and
3'-TCTGATGAGTGTTAAGAGACATTG at +1233). A T7 RNA polymerase promoter was
incorporated in the sense primer of the second pair of oligonucleotides
(GGATCCTAATACGACTCACTATAGGAACAGACCACCATGAAGCAGTATGAACACCAAG) along with
a 3'-stop codon in the antisense primer (TCAAAACTGACTGTGGTCCTCTTC) used
in the nested PCR. The protein expressed in the in vitro translation system spans the amino-terminal portion of PI3K-C2 from
amino acid 17 to amino acid 387, the region that overlaps to the
antigenic portion of PI3K-C2 previously used as immunogen (28).
35S-Labeled methionine and cysteine were used to
detect the in vitro translated PI3K-C2 amino terminus.
Statistical Evaluation--
The data are shown as means ± S.E. For statistical analyses, the Student's t test for
unpaired samples at the level of significance of 0.05 was used.
 |
RESULTS |
Assessment of Nuclear Purity--
The purity of isolated nuclei
was estimated by the determination of marker enzymes (see
"Experimental Procedures") and by electron microscopy (results not
shown). Most marker enzymes were at levels so low that quantification
was difficult, and electron microscopy showed no other obvious
components present. The exception in this respect was for endoplasmic
reticulum KCN-resistant NADH-exidoreductase: the specific activity for
this enzyme in nuclear preparations (original homogenate activity,
0.59 ± 0.04 µmol/mg of protein per ml) was 0.15 ± 0.02, which decreased to 0.08 ± 0.01 when the nuclei were depleted of
membrane using 0.04% Triton X-100. The presence of KCN-resistant NADH
oxidoreductase may be taken as evidence for residual endoplasmic
reticulum contamination that is finally removed by detergent, but it is
equally likely that it is present in the nuclear membrane, which is
also removed by detergent (23, 24).
Phosphorylation of Phosphoinositides in the Whole and
Membrane-depleted Nuclei--
As shown in Figs.
1 and 2A when the
intact nuclei have been labeled for a
short time period (5 min) the radioactivity was found in PtdIns(4)P,
PtdIns(4,5)P2, and PtdIns(3,4,5)P3. As has already been noticed by Lu et al. (4) the formation of
PtdIns(3,4)P2 could only be found when incubation was
carried out for 20 min or longer, therefore, in the present
investigation the incubation time was too short to observe any
PtdIns(3,4)P2 formation. As shown in Fig. 1 the level of
incorporation fell dramatically when the nuclei were depleted of their
membrane, whereas no incorporation could be detected in
PtdIns(3,4,5)P3. This suggests that within the intranuclear
region there are PtdIns and PtdIns(4)P available for phosphorylation,
whereas there is no PtdIns(4,5)P2 or that the 3-kinase is
not present in the nuclei depleted of nuclear membrane. To address this
question, exogenous lipid substrates were added, in the form of
vesicles, to the membrane-depleted nuclei. Addition of exogenous lipid
substrates resulted in the reconstitution of incorporation of phosphate
into PtdIns(4)P and PtdIns(4,5)P2 but not into
PtdIns(3,4,5)P3, suggesting that 3-kinase that utilizes
PtdIns(4,5)P2 as a substrate is not present in the membrane-depleted nuclei.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Incorporation of 32P into
PtdIns(4)P, PtdIns(4,5)P2, and PtdIns(3,4,5)P3
in the intact and membrane-depleted liver nuclei and after addition of
exogenous lipid to the membrane-depleted nuclei. Nuclei were
prepared and radiolabeled as described under "Experimental
Procedures," and the separation of glycerophosphoinositides was
achieved using HPLC high resolution 5 µM Partisphere SAX
column. Intact nuclei (open bars), membrane-depleted nuclei
(gray bars), and membrane-depleted nuclei after addition of
exogenous lipid (black bars) are shown. When exogenous lipid
was added for measurement of incorporation of 32P into
PtdIns(4)P, PtdIns was used as a substrate, for
PtdIns(4,5)P2, PtdIns(4)P was used as substrate, whereas
for PtdIns(3,4,5)P3, PtdIns(4,5)P2 was used as
a substrate and all other details are as described under
"Experimental Procedures." The results are means ± S.E. for
three different experiments, each performed in duplicate. *,
p < 0.05 (Student's t test) with respect
to the intact nuclei. n.d., not detectable.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
HPLC profile of deacylated
phospholipids extracted from 32P-labeled intact nuclei
(A) and the nuclei harvested 20 h after partial
hepatectomy (B). The nuclei were prepared and
radiolabeled, and the separation of glycerophosphoinositides was
achieved as described under "Experimental Procedures."
|
|
Because it is known that there is an increase in nuclear DAG
concentration and PLC activity during the liver regeneration (23, 29),
which peaks around 20 h following partial hepatectomy, the nuclei
harvested at this time point were used for labeling inositol lipids
(Fig. 2). Although the incorporation of radiolabeled phosphate into
PtdIns(4)P, PtdIns(4,5)P2, and PtdIns(3,4,5)P3 did not change, radioactivity in PtdIns(3)P could be found. This was
further documented in the membrane-depleted nuclei and
membrane-depleted nuclei after addition of exogenous lipids
(Fig. 3). Furthermore, this incorporation
of phosphate into PtdIns(3)P is inhibitable by 10 nM
wortmannin, suggesting the existence of 3-kinase in the membrane-depleted nuclei, which is unable to use
PtdIns(4,5)P2 as a substrate, because under the
above-mentioned conditions no radioactivity could be found in
PtdIns(3,4,5)P3.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Incorporation of 32P
into PtdIns(3)P, PtdIns(4)P, PtdIns(4,5)P2, and
PtdIns(3,4,5)P3 in the intact nuclei (A),
membrane-depleted nuclei (B), and membrane-depleted
nuclei after addition of exogenous lipids (C).
The nuclei were prepared and radiolabeled, and the separation of
glycerophosphoinositides was achieved as described under
"Experimental Procedures." The control nuclei (open
bars), nuclei harvested 20 h after partial hepatectomy
(gray bars), the effect of wortmannin (10 nM) on
nuclei harvested 20 h after partial hepatectomy (black
bars) are shown. When exogenous lipid was added for measurement
of incorporation of 32P into PtdIns(4)P and PtdIns(3)P,
PtdIns was used as a substrate; for PtdIns(4,5)P2,
PtdIns(4)P was used as substrate, while for
PtdIns(3,4,5)P3, PtdIns(4,5)P2 was used as a
substrate. All other details are as described under "Experimental
Procedures." The results are means ± S.E. for three
different experiments, each performed in duplicate. *,
p < 0.05 (Student's t test) with respect
to membrane-depleted nuclei harvested 20 h after partial
hepatectomy. n.d., not detectable.
|
|
Immunoprecipitation and Biochemical Characterization of Nuclear
PI3K-C2 --
Polyclonal antisera against the first 331-amino acid
portion of PI3K-C2 used in the immunoprecipitation studies do not
detect class I PI3Ks, Vps34p, PI3K-C2 on Western blots or
immunoprecipitates (17) and were used to further characterize the
observed 3-kinase activity in the membrane-depleted nuclei.
Despite the fact that there is absolutely no homology between
amino-terminal portions of PI3K-C2 and PI3K-C2 (19, 26), it is
important to note that PI3K-C2 is expressed in hepatocytes and that
its expression is enhanced during liver regeneration (19, 20);
therefore, it is crucial that antisera used to immunoprecipitate
PI3K-C2 do not detect PI3K-C2 . As shown in Fig.
4 antisera used for immunoprecipitation and Western blotting of PI3K-C2 were unable to detect the
amino-terminal portion of PI3K-C2 , which overlaps the antigenic
portion of PI3K-C2 used as an immunogen (28).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 4.
SDS-PAGE of amino-terminal fragments of
PI3K-C2 and PI3K-C2
and their Western blot analysis using
anti-PI3K-C2 polyclonal antibody.
Amino-terminal fragments of PI3K-C2 and PI3K-C2 were expressed as
described under "Experimental Procedures," and
35S-labeled methionine and cysteine were used to
detect in vitro translated protein. Protein was subjected to
SDS-PAGE: lane 1, amino-terminal portion of PI3K-C2 ;
lane 2, amino-terminal portion of PI3K-C2 and
polyacrylamide gel was exposed to x-ray film. Then protein was
transferred to nitrocellulose and probed with anti-PI3K-C2 antibody:
lane 3, amino-terminal portion of PI3K-C2 ; lane
4, amino-terminal portion of PI3K-C2 . The position of molecular
mass marker lactic dehydrogenase (36.5 kDa) is indicated on the
left side by the arrow.
|
|
Following partial hepatectomy, an increase in immunoprecipitable
PI3K-C2 activity could be observed in the membrane-depleted nuclei
but not in total cell lysate, cytosolic fraction, or postnuclear membranes (Fig. 5). The time course of
changes in immunoprecipitable PI3K-C2 activity showed its maximum at
20 h after partial hepatectomy and then slowly declining until
32 h (Fig. 6), similar to the increase in nuclear DAG concentration and PLC activity (23, 29). It is
important to note that no PI3K-C2 activity could be found in the
supernatant when the membrane-depleted nuclei were prepared (results
not shown), suggesting that the enzyme is not present in the nuclear
membrane.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Activity of immunoprecipitated
PI3K-C2 in cell lysate, cytosolic fraction,
membrane-depleted nuclei, and postnuclear membranes. Cell lysate,
cytosolic fraction, membrane-depleted nuclei, and postnuclear membranes
were prepared as described under "Experimental Procedures." Kinase
assay was performed using PtdIns as substrate, and all other details
are as described under "Experimental Procedures." The control
samples (open bars) and the samples obtained 20 h after
partial hepatectomy (black bars) are shown. Results are
means ± S.E. for three different experiments, each performed in
duplicate. *, p < 0.05 (Student's t test)
with respect to the control.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 6.
Time course of changes in immunoprecipitable
PI3K-C2 activity in membrane-depleted nuclei
following partial hepatectomy. The membrane-depleted nuclei,
immunoprecipitation of PI3K-C2 , and kinase assay were carried out as
described under "Experimental Procedures" and legend to Fig. 4. The
data are expressed as a percentage of the control level obtained from
three independent experiments assayed in duplicate, where the range of
duplicates is contained within the symbols.
|
|
Because it is known that PI3K-C2 is able to phosphorylate PtdIns but
not PtdIns(4)P in the presence of Ca2+, whereas some
phosphorylation of PtdIns(4)P could be observed in the presence of
Mg2+ (18, 28), in vitro substrate specificity
for immunoprecipitable PI3K-C2 was tested using Mg2+ for
phosphate transfer. As shown in Fig. 7
the basal level of PtdIns phosphorylation is about 4-fold higher than
the phosphorylation of PtdIns(4)P, and this proportion increases to
about 10-fold in the nuclei harvested 20 h after partial
hepatectomy, showing that there is a strong preference for PtdIns over
PtdIns(4)P as a substrate in both basal and stimulated condition.
Because it is known that 10 nM wortmannin completely
inhibit stimulated PI3K-C2 activity (28) whereas the
IC50 for PI3K-C2 inhibition is 32 nM, with
maximal inhibition obtained with 10 µM wortmannin (19), the present observation that stimulated 3-kinase activity is
inhibitable by 10 nM wortmannin further demonstrates that
PI3K-C2 is present in the nuclei and activated during compensatory
liver growth.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 7.
Substrate specificity of immunoprecipitable
PI3K-C2 activity in the control
membrane-depleted nuclei and the nuclei harvested 20 h after
partial hepatectomy and the effect of wortmannin (10 nM). The nuclei were prepared, and the
immunoprecipitation of PI3K-C2 and kinase assay were carried out as
described under "Experimental Procedures" using PtdIns or
PtdIns(4)P as substrates. The control membrane-depleted nuclei
(open bars), membrane-depleted nuclei harvested 20 h
after partial hepatectomy (gray bars), and the effect of
wortmannin (10 nM) on the membrane-depleted nuclei
harvested 20 h after partial hepatectomy (black bars)
are shown. Results are means ± S.E. for three different
experiments, each performed in duplicate. *, p < 0.05 (Student's t test) with respect to the control.
|
|
Proteolytic Activation of PI3K-C2 --
Western blotting of cell
lysates and membrane-depleted nuclei, fractionated by SDS-PAGE on a 5%
gels and probed with antisera raised against PI3K-C2 , revealed a
single immunoreactive band of 180 kDa (Fig.
8). On the other hand, 20 h after
partial hepatectomy a gel shift of 18 kDa was observed only in the
membrane-depleted nuclei, suggesting that the observed activation of
enzyme (Fig. 5) is achieved by proteolysis. It is important to point
out that no proteolytic fragment (Fig. 8) and no increase in enzyme
activity (Fig. 5) were detected in cell lysates that also contain
nuclei. Therefore, this suggests that proteolysis and activation occur only in the absence of the cell membrane and/or cytosolic fractions, which in turn suggests the presence of an "inhibitor" of
proteolysis in the latter cellular fractions. The fact that 50 µg of
protein of total cell lysate and 50 µg of nuclear protein (Fig. 8)
contain virtually the same amount of PI3K-C2 indicates that the vast majority of cellular PI3K-C2 is nuclear. Thus, proteolysis and/or activation of PI3K-C2 appear to require not only the effects of
hepatectomy but also the process of isolating membrane-depleted nuclei.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 8.
Western blot analysis of
PI3K-C2 in cell lysates and membrane-depleted
nuclei. Protein (50 µg) was subjected to SDS-PAGE, transferred
to nitrocellulose, and probed with anti-PI3K-C2 antibody: lane
1, control cell lysate; lane 2, cell lysate obtained
20 h after partial hepatectomy; lane 3, control
membrane-depleted nuclei; lane 4, membrane-depleted nuclei
harvested 20 h after partial hepatectomy. The position of the
molecular mass marker for 2-macroglobulin (180 kDa) is
indicated on the left side by the arrow.
|
|
Previously, we showed that a similar pattern of activation of
PI3K-C2 in platelets could be prevented by calpain inhibitors calpeptin or calpain I inhibitor (17). Therefore, the intact membrane-depleted nuclei were subjected to short term exposure (20 min)
to µ-calpain and similar gel shift together with the increase in
PI3K-C2 activity was observed (Fig.
9), when compared with nuclei harvested
20 h after partial hepatectomy (Figs. 5 and 8). Moreover, the
above-mentioned gel shift and the increase in PI3K-C2 activity could
not be observed when the nuclei were incubated with Ca2+
alone and could be prevented in the presence of calpain inhibitor calpeptin, further suggesting that calpain-mediated proteolysis of the
enzyme may be responsible for its activation.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of calpain on immunoprecipitable
PI3K-C2 activity in membrane-depleted nuclei
(upper panel) and their Western blot analysis
(lower panel). The membrane-depleted nuclei were
subjected to 20-min exposure at 25 °C to µ-calpain (15 µg/ml) in
the presence of 50 µM free Ca2+ concentration
and washed three times in solution A, and then immunoprecipitable
PI3K-C2 activity was measured as described under "Experimental
Procedures" using PtdIns as a substrate. When added, calpain
inhibitor calpeptin (200 µg/ml) was added prior to the exposure of
the membrane-depleted nuclei to calpain. Results are means ± S.E.
for three different experiments, each performed in duplicate. *,
p < 0.05 (Student's t test) with respect
to the control. For Western blot analysis, the same experiments were
performed, and protein (50 µg) was subjected to SDS-PAGE, transferred
to nitrocellulose, and probed with anti-PI3K-C2 antibody: lane
1, control membrane-depleted nuclei; lane 2,
membrane-depleted nuclei exposed to calpain; lane 3,
membrane-depleted nuclei incubated only in the presence of
Ca2+; lane 4, membrane-depleted nuclei incubated
with calpain in the presence of calpeptin. The position of the
molecular mass marker for 2-macroglobulin (180 kDa) is
indicated on the left side by the arrow.
|
|
 |
DISCUSSION |
The presence of both subunits of class I PI3K has been
demonstrated in the cell nuclei. Although the p110 subunit is
translocated to the nuclear membrane from cytosol upon stimulation of
HepG2 cells with serum (7), translocation and precise intranuclear localization of p85 subunit differs with cell types. In HL-60 cells it
is localized in the nuclear matrix during granulocytic or monocytic
differentiation (5, 6), and in PC12 cells intranuclear translocation of
the subunit from cytosol was observed upon the stimulation of cells
with nerve growth factor (30). In osteosarcoma Saos-2 cells the subunit
is distributed not only in cytosol but also in the nucleoplasm and
nucleoli, and after the stimulation of cells with interleukin 1 it also
translocates from cytosol to the nucleus (31). Sonification and
centrifugation of the intact liver nuclei may lead to the distribution
of enzyme in both the soluble fraction and nuclear membranes (4). Using a different approach (preparation of membrane-depleted nuclei by
detergent), the present study confirms the 3-kinase activity in the
nuclear envelope observed above but also shows that within the
intranuclear region there is no such activity, because there was no
radiolabeling of PtdIns(3,4,5)P3 even when the exogenous lipid substrate (PtdIns(4,5)P2) was added. Furthermore,
following partial hepatectomy no increase in the above-mentioned
3-kinase activity in the nuclei could be observed, suggesting that
class I PI3K is not involved in nuclear signaling during compensatory liver growth.
In contrast to class I PI3Ks, which are mainly cytosolic and are
subjected to translocation to the membranes upon cell stimulation (Ref.
32 for review), class II PI3Ks are predominantly associated with
membrane fractions of cells (28, 33) and, therefore, are good
candidates for compartmentalization within the cell nucleus as has been
shown for PtdIns 4-kinase and PtdIns(4)P 5-kinase (34). Indeed, from
the present study it can be concluded that PI3K-C2 is not present in
the nuclear envelope and is probably attached to the nuclear matrix as
has been shown for the above-mentioned kinases (34). It is important to
note that polyclonal antisera against PI3K-C2 could not be used for
immunohistochemical studies2;
therefore, no exact localization of PI3K-C2 in the membrane-depleted cell nuclei could be done. Nevertheless, knowing that in the
membrane-depleted nuclei the concentration of PtdIns is about 20 times
higher than PtdIns(4)P (23) and that in in vitro conditions
with equimolar concentration of substrates, PtdIns(4)P could be
phosphorylated only in the presence of Mg2+ with
substantially less efficiency than PtdIns(present study), it seems
obvious that in vivo PI3K-C2 phosphorylates PtdIns to produce PtdIns(3)P, which has also been observed with purified recombinant enzyme (28).
Interestingly, the increased activation of PI3K-C2 and the formation
of PtdIns(3)P parallels the increase in nuclear PLC activity, DAG
concentration, and translocation of PKC to the nucleus following
partial hepatectomy (23, 29). This indicates that changes in the
nuclear inositol lipid metabolism precede the S-phase of cell cycle and
mitosis, because cells reach the peak of proliferation 22-26 h after
partial hepatectomy (35). Although potential targets for nuclear PKC
include lamins, DNA polymerase, and topoisomerase II (see Refs. 3,
36-38 for reviews), one can only speculate about the function of
PtdIns(3)P in the cell nuclei. The observations that negatively charged
phospholipids can stimulate RNA synthesis by affecting chromatin
organization (39) and that histones H1 and H3 are
PtdIns(4,5)P2-binding proteins (40) indicated the importance of nuclear polyphosphoinositides in transcription events. On
the other hand, intranuclear PtdIns(3)P may be involved in trafficking
events, as has been shown for vesicle trafficking via its interaction
with FYVE finger domain (11, 32).
In platelets, PI3K-C2 is activated following stimulation of the
integrin receptor with fibrinogen, and this activation could be
prevented by calpain inhibitors (17). The present study extends this
observation by showing that short term exposure of enzyme to calpain
resulted in a similar degree of activation compared to the nuclei
harvested 20 h after partial hepatectomy, suggesting that
calpain-mediated proteolysis of the enzyme may be responsible for its
activation. The calpains are predominantly cytoplasmic Ca2+-dependent proteases, and there are two
well-characterized calpain isozymes: m-calpain shows proteolytic
activity at mM Ca2+ concentrations, whereas
µ-calpain is already active at micromolar Ca2+
concentration (41). Nevertheless, both isoforms are likely to be able
to process cellular substrates at physiological Ca2+
concentrations (42). It is important to note that in the isolated liver
nuclei some high molecular mass (120-200 kDa) matrix proteins were
substrates for purified calpains (43), which, together with the
observation that µ-calpain is transported into cell nuclei in an
ATP-dependent fashion (44) and accumulated evidence that there is calcium signaling in the cell nucleus (45, 46), strongly supports the present evidence for calpain-mediated activation of
PI3K-C2 in the nuclei when the cells are subjected to growth and
hyperplasia. It is noteworthy that the deletion of C2 domain of
PI3K-C2 increased the lipid kinase activity (28), and from an amino
acid sequence of the enzyme it could be deduced that calpain-mediated proteolysis may cleave C2 domain, which may result in
the observed gel shift and the activation of the enzyme. On the other
hand, rapid recruitment of PI3K-C2 to a phosphotyrosine-signaling complex containing epidermal growth factor receptor (18) suggests that
there are different mechanisms of enzyme activation, which depend on
the activation of different cellular receptors and/or different
subcellular localization of the enzyme.
In summary, the data presented in this report show that, in the
membrane-depleted nuclei during the compensatory liver growth, there is
an increase in PtdIns(3)P formation as a result of PI3K-C2 activation. Addition of exogenous µ-calpain to native
membrane-depleted nuclei resulted in a similar degree of PtdIns(3)P
formation strongly suggesting that PI3K-C2 activation may be a
calpain-mediated event.
 |
ACKNOWLEDGEMENTS |
We thank Rene Lui for editing the manuscript
before submission and HSM-informatika for editing the figures before submission.
 |
FOOTNOTES |
*
This work was supported by the Ministry of Science of the
Republic of Croatia (to H. B.), by a Fogarty International Research Collaboration Award (to A. P. F. and H. B.), and by the AIRC
(to S. V.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Both authors contributed equally to this work.
**
To whom correspondence should be addressed: Zavod za Fiziologiju,
Medicinski Fakultet, Sveuciliste u Zagrebu, Salata 3, P. O. Box 978, Zagreb 10,001, Croatia. Tel.: 385-1-4590-260; Fax: 385-1-4590-207;
E-mail: hrvoje.banfic@zg.tel.hr.
Published, JBC Papers in Press, February 13, 2001, DOI 10.1074/jbc.M006533200
2
S. Volinia and H. Banfi , unpublished observation.
 |
ABBREVIATIONS |
The abbreviations used are:
PKC, protein kinase
C;
PKB, protein kinase B;
PLC, phospholipase C;
PI3K, phosphoinositide
3-kinase;
PtdIns, phosphatidylinositol;
PtdIns(3)P, phosphatidylinositol 3-phosphate;
PtdIns(4)P, phosphatidylinositol
4-phosphate;
PtdIns(3, 4)P2, phosphatidylinositol
3,4-bisphosphate;
PtdIns(4, 5)P2, phosphatidylinositol
4,5-bisphosphate;
PtdIns(3, 4,5)P3, phosphatidylinositol
3,4,5-trisphosphate;
PtdSer, phosphatidylserine;
DAG, diacylglycerol;
HPLC, high pressure liquid chromatography;
PCR, polymerase chain
reaction;
bp, base pair(s);
PAGE, polyacrylamide gel
electrophoresis.
 |
REFERENCES |
| 1.
|
Divecha, N.,
Banfic, H.,
and Irvine, R. F.
(1991)
EMBO J.
10,
3207-3214
|
| 2.
|
Divecha, N.,
Banfic, H.,
and Irvine, R. F.
(1993)
Cell
74,
405-407
|
| 3.
|
D'Santos, C. S.,
Clarke, J. H.,
and Divecha, N.
(1998)
Biochim. Biophys. Acta
1436,
201-232
|
| 4.
|
Lu, P. J.,
Hsu, A. L.,
Wang, D. S.,
Yan, H. Y.,
Yin, H. L.,
and Chen, C. S.
(1998)
Biochemistry
37,
5738-5745
|
| 5.
|
Marchisio, M.,
Bertagnolo, V.,
Colamussi, M. L.,
Capitani, S.,
and Neri, L. M.
(1998)
Biochem. Biophys. Res. Commun.
253,
346-351
|
| 6.
|
Neri, L. M.,
Marchisio, M.,
Colamussi, M. L.,
and Bertagnolo, V.
(1999)
Biochem. Biophys. Res. Commun.
259,
314-320
|
| 7.
|
Metjian, A.,
Roll, R. L.,
Ma, A. D.,
and Abrams, C. S.
(1999)
J. Biol. Chem.
274,
27943-27947
|
| 8.
|
Domin, J.,
and Waterfield, M. D.
(1997)
FEBS Lett.
410,
91-95
|
| 9.
|
Banfic, H.,
Tang, X.,
Batty, I. H.,
Downes, C. P.,
Chen, C.,
and Rittenhouse, S. E.
(1998)
J. Biol. Chem.
273,
13-16
|
| 10.
|
Banfic, H.,
Downes, C. P.,
and Rittenhouse, S. E.
(1998)
J. Biol. Chem.
273,
11630-11637
|
| 11.
|
Rameh, L. E.,
and Cantley, L. C.
(1999)
J. Biol. Chem.
274,
8347-8350
|
| 12.
|
Ponting, C. P.
(1996)
Protein Sci.
5,
2353-2357
|
| 13.
|
Rizo, J.,
and Sudhof, T. C.
(1998)
J. Biol. Chem.
273,
15879-15882
|
| 14.
|
Turner, S. J.,
Domin, J.,
Waterfield, M. D.,
Ward, S. G.,
and Wastwick, J.
(1998)
J. Biol. Chem.
273,
25987-25995
|
| 15.
|
Brown, R. A.,
Domin, J.,
Arcaro, A.,
Waterfield, M. D.,
and Sheperd, P. R.
(1999)
J. Biol. Chem.
274,
14529-14532
|
| 16.
|
Domin, J.,
Gaidarov, I.,
Smith, M. E. K.,
Keen, J. H.,
and Waterfield, M. D.
(2000)
J. Biol. Chem.
275,
11943-11950
|
| 17.
|
Zhang, J.,
Banfic, H.,
Straforini, F.,
Tosi, L.,
Volinia, S.,
and Rittenhouse, S. E.
(1998)
J. Biol. Chem.
273,
14081-14085
|
| 18.
|
Arcaro, A.,
Zvelebil, M. J.,
Wallasch, C.,
Ullrich, A.,
Waterfield, M. D.,
and Domin, J.
(2000)
Mol. Cell. Biol.
20,
3817-3830
|
| 19.
|
Misawa, H.,
Ohtsubo, M.,
Copeland, N. G.,
Gilbert, D. J.,
Jenkins, N. A.,
and Yoshimura, A.
(1998)
Biochem. Biophys. Res. Commun.
244,
531-539
|
| 20.
|
Ono, F.,
Nakagawa, T.,
Saito, S.,
Owada, Y.,
Sakagami, H.,
Goto, K.,
Suzuki, M.,
Matsuno, S.,
and Kondo, H.
(1998)
J. Biol. Chem.
273,
7731-7736
|
| 21.
|
DeCamilli, P.,
Emr, S. D.,
McPherson, P. S.,
and Novick, P.
(1996)
Science
271,
1533-1539
|
| 22.
|
Volinia, S.,
Dhand, R.,
Vanhaesebroeck, B.,
MacDougall, L. K.,
Stein, R.,
Zvelebil, M. J.,
Domin, J.,
Panaretou, C.,
and Waterfield, M. D.
(1995)
EMBO J.
14,
3339-3348
|
| 23.
|
Banfic, H.,
Zizak, M.,
Divecha, N.,
and Irvine, R. F.
(1993)
Biochem. J.
290,
633-636
|
| 24.
|
Vann, L. R.,
Wooding, F. B. P.,
Irvine, R. F.,
and Divecha, N.
(1997)
Biochem. J.
327,
569-576
|
| 25.
|
Auger, K. R.,
Serunian, L. A.,
and Cantley, L. C.
(1990)
in
Methods in Inositide Research
(Irvine, R. F., ed)
, pp. 159-166, Raven Press Ltd., New York
|
| 26.
|
Brown, R. A.,
Ho, L. K. F.,
Weber-Hall, S. J.,
Shirpley, J. M.,
and Fry, M. J.
(1997)
Biochem. Biophys. Res. Commun.
233,
537-544
|
| 27.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685
|
| 28.
|
Arcaro, A.,
Volinia, S.,
Zvelebil, M. J.,
Stein, R.,
Watton, S. J.,
Layton, M. J.,
Gout, I.,
Ahmadi, K.,
Downward, J.,
and Waterfield, M. D.
(1998)
J. Biol. Chem.
273,
33082-33090
|
| 29.
|
Neri, L. M.,
Ricci, D.,
Carini, C.,
Marchisio, M.,
Capitani, S.,
and Bertagnolo, V.
(1997)
Cell. Signalling
9,
353-362
|
| 30.
|
Neri, L. M.,
Martelli, A. M.,
Borgatti, P.,
Colamussi, M. L.,
Marchisio, M.,
and Capitani, S.
(1999)
FASEB J.
13,
2299-2310
|
| 31.
|
Bavelloni, A.,
Santi, S.,
Sirri, A.,
Riccio, M.,
Faenza, I.,
Zini, N.,
Cecchi, S.,
Ferri, A.,
Auron, P.,
Maraldi, N. M.,
and Marmiroli, S.
(1999)
J. Cell Sci.
112,
631-640
|
| 32.
|
Vanhaesebroeck, B.,
and Waterfield, M. D.
(1999)
Exp. Cell Res.
253,
239-254
|
| 33.
|
Prior, I. A.,
and Clague, M. J.
(1999)
Mol. Cell. Biol. Res. Commun.
1,
162-166
|
| 34.
|
Payrastre, B.,
Nievers, M.,
Boonstra, J.,
Breton, M.,
Verkleij, A. J.,
and Van Bergen en Henegouwen, P. M. P.
(1992)
J. Biol. Chem.
267,
5078-5084
|
| 35.
|
Vitale, M.,
Rizzoli, R.,
Mazzeroti, G.,
Zamai, L.,
Galanzi, A.,
Rizzi, E.,
Manzoli, L.,
Matteucci, A.,
and Papa, S.
(1991)
Cell Prolif.
24,
331-338
|
| 36.
|
Irvine, R. F.,
and Divecha, N.
(1992)
Semin. Cell Biol.
3,
225-235
|
| 37.
|
Fields, A. P.,
and Thompson, L. J.
(1995)
Prog. Cell Cycle Res.
1,
271-286
|
| 38.
|
Murray, N. R.,
Thompson, L. J.,
and Fields, A. P.
(1997)
in
Protein Kinase C
(Parker, P. J.
, and Dekker, L. V., eds)
, pp. 97-120, R. G. Landes Company, Austin, TX
|
| 39.
|
Capitani, S.,
Caramelli, E.,
Felaco, M.,
Miscia, S.,
and Manzoli, F. A.
(1981)
Physiol. Chem. Phys.
13,
153-158
|
| 40.
|
Yu, H.,
Fukami, K.,
Watanabe, C.,
Ozaki, C.,
and Takenawa, T.
(1998)
Eur. J. Biochem.
251,
281-287
|
| 41.
|
Molinari, M.,
and Carafoli, E.
(1997)
J. Membr. Biol.
156,
1-8
|
| 42.
|
Schollmeyer, J. E.
(1988)
Science
240,
911-913
|
| 43.
|
Mellgren, R. L.
(1991)
J. Biol. Chem.
266,
13920-13924
|
| 44.
|
Mellgren, R. L.,
and Lu, Q.
(1994)
Biochem. Biophys. Res. Commun.
204,
544-550
|
| 45.
|
Santella, L.,
and Carafoli, E.
(1997)
FASEB J.
11,
1091-1109
|
| 46.
|
Malviya, A. N.,
and Rogue, P. J.
(1998)
Cell
92,
17-23
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. B. Dail, L. A. Shack, J. E. Chambers, and S. C. Burgess
Global Liver Proteomics of Rats Exposed for 5 Days to Phenobarbital Identifies Changes Associated with Cancer and with CYP Metabolism
Toxicol. Sci.,
December 1, 2008;
106(2):
556 - 569.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Falasca, W. E. Hughes, V. Dominguez, G. Sala, F. Fostira, M. Q. Fang, R. Cazzolli, P. R. Shepherd, D. E. James, and T. Maffucci
The Role of Phosphoinositide 3-Kinase C2{alpha} in Insulin Signaling
J. Biol. Chem.,
September 21, 2007;
282(38):
28226 - 28236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Szivak, N. Lamb, and L. M. G. Heilmeyer
Subcellular Localization and Structural Function of Endogenous Phosphorylated Phosphatidylinositol 4-Kinase (PI4K92)
J. Biol. Chem.,
June 16, 2006;
281(24):
16740 - 16749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Trkulja, V. Crljen-Manestar, H. Banfic, and Z. Lackovic
Involvement of the Peripheral Cholinergic Muscarinic System in the Compensatory Ovarian Hypertrophy in the Rat
Experimental Biology and Medicine,
September 1, 2004;
229(8):
793 - 805.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Didichenko, C. M. Fragoso, and M. Thelen
Mitotic and Stress-induced Phosphorylation of HsPI3K-C2{alpha} Targets the Protein for Degradation
J. Biol. Chem.,
July 3, 2003;
278(28):
26055 - 26064.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Didichenko and M. Thelen
Phosphatidylinositol 3-Kinase C2alpha Contains a Nuclear Localization Sequence and Associates with Nuclear Speckles
J. Biol. Chem.,
December 14, 2001;
276(51):
48135 - 48142.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|