|
Originally published In Press as doi:10.1074/jbc.M101365200 on March 21, 2001
J. Biol. Chem., Vol. 276, Issue 21, 18216-18222, May 25, 2001
Repression of Dpp Targets by Binding of Brinker to Mad Sites*
Heidi
Kirkpatrick,
Kirby
Johnson , and
Allen
Laughon§
From the Laboratory of Genetics, University of Wisconsin, Madison,
Wisconsin 53706
Received for publication, February 13, 2001, and in revised form, March 20, 2001
 |
ABSTRACT |
Signaling by decapentaplegic (Dpp), a
Drosophila member of the transforming growth factor (TGF)
superfamily of growth factors, has recently been shown to activate
targets such as vestigial (vg) indirectly
through negative regulation of brinker (brk). Here we show that the Brk protein functions as a repressor by binding
to Dpp response elements. The Brk DNA binding activity was localized to
an amino-terminal region containing a putative homeodomain. Brk bound
to a Dpp response element of the Ultrabithorax (Ubx) midgut enhancer at a sequence that overlaps a binding
site for the Smad protein, Mothers Against Dpp (Mad). Furthermore, Brk
was able to compete with Mad for occupancy of this binding site. This
recognition of overlapping binding sites provides a potential
explanation for why the G/C-rich Mad binding site consensus differs the
Smad3/Smad4 binding site consensus. We also found that the Dpp response
element from Ubx was more sensitive than the vg
quadrant enhancer to repression by Brk. This difference correlates with
short-range activation of Ubx by Dpp in the visceral mesoderm, whereas vg exhibits a long-range response to Dpp
in the wing imaginal disc, indicating that Brk binding sites may play a
critical role in limiting thresholds for activation by Dpp.
Finally, we provide evidence that Brk is capable of functioning as an active repressor. Thus, whereas Brk and Mad compete for regulation of Ubx and vg, Brk may regulate
other Dpp targets without direct involvement of Mad.
 |
INTRODUCTION |
Members of the transforming growth factor (TGF) superfamily of growth factors perform a multitude of functions in
regulating cell growth and differentiation (1-4). The nuclear
effectors of these pathways are the Smad transcription factors (5). The activin/TGF pathways trigger activation of Smad2 and Smad3, whereas the bone morphogenetic protein
(BMP)1 pathways utilize
Smad1, Smad5, and Smad8. Each of these receptor-activated Smads is
phosphorylated in response to signaling, leading to assembly of
complexes with Smad4 and translocation to the nucleus, where association with cofactors results in regulation of target genes (6-9).
Signaling by the Drosophila TGF family member
Decapentaplegic (Dpp) plays an important role in patterning of the
dorsal-ventral axis, visceral mesoderm, endoderm, wing, leg, and eye
(10-16). An important feature of Dpp signaling is its ability to
trigger the activation of target genes at different thresholds,
allowing cells to interpret position along a Dpp gradient (12, 17). The
best understood example of this is the primoridia of the wing, where
spalt (sal), optomotor blind
(omb), and vestigial (vg) are expressed in progressively wider patterns in response to a postulated gradient of extracellular Dpp protein (18-22). This graded Dpp activity emanates from a strip of Dpp-expressing cells that bisects the
wing imaginal disc (23). Dpp signaling triggers phosphorylation of the
founding member of the Smad family, Mothers Against Dpp (Mad) (24-27).
Activated Mad associates with the Smad4 homolog, Medea (28-31) and
directly regulates target genes such as vg, Ubx, and tinman (tin) (32-34). Mad binds to GC-rich
sites with the consensus sequence GCCGNCGC (32), whereas
vertebrate Smad3 and Smad4 bind preferably to two or three tandem
copies of the 4-bp Smad box sequence, GTCT (35, 36). The Mad consensus
bears a limited resemblance to an inverted pair of Smad boxes, but it
is not clear why the two sequences differ. The Mad consensus may extend
to the vertebrate BMP-responsive Smads because Smad1 acts through a
Mad-like site to activate the Smad6 gene (37, 38). One
possibility is that the Mad consensus reflects involvement of a
cofactor, consistent with the general dependence of Smads on cofactors
(39, 40).
An unexpected twist to the Dpp regulatory cascade came to light with
the discovery of brinker (brk), a gene that is
negatively regulated by Dpp and, in turn, functions as a negative
regulator of Dpp targets (41-44). In the wing imaginal disc, Dpp
targets such as sal, omb, and vg are
expressed ectopically in brk / clones.
Ectopic expression of these genes occurs even in cells where a
brk clone overlaps a clone mutant for Mad or
the Dpp receptor thickveins (tkv). These results
revealed that Dpp activates targets indirectly through repression of
brk, which has recently been shown to occur in conjunction
with the Mad cofactor, Schnurri (45, 46). However, the Dpp response
elements of vg, Ubx, and tin have been
shown to be dependent on Mad binding sites for the ability to direct Dpp-dependent reporter expression (32-34). Together, these
observations suggest that Dpp activates targets by two distinct
mechanisms: 1) direct activation by Smads and 2) indirect activation by
repression of brk. The Brk protein contains a potential
homeodomain and is localized to the nucleus (43), consistent with its
functioning as a repressor. Brk antagonized BMP2 signaling when
expressed ectopically in Xenopus embryos, suggesting that it
may be a conserved feature of Dpp/BMP pathways (41).
Here, we report that Brk protein binds and represses the Dpp response
elements of vg and Ubx. We show that a previously
identified Mad site is actually a composite Mad·Brk site and show
that Mad and Brk are capable of competing for binding to this site.
These observations suggest an explanation for why the Mad binding site consensus differs from that of Smad3 and Smad4. In addition, we found
that a Dpp response element from Ubx is more sensitive to Brk repression than an element from the vg quadrant
enhancer. These results correlate with the respective short and long
range thresholds of Ubx and vg and indicate that
Brk binding sites may play an important role in setting thresholds for
activation by Dpp. Our results concur with other recent reports that
Brk functions as a DNA-binding repressor (47-49).
 |
EXPERIMENTAL PROCEDURES |
Plasmids--
All reporter plasmids were based on the
vector hsplacCasper (50). VgMD2-lacZ was a gift from A. Hudson and
S. Carroll and contained two tandem copies of the core Dpp response
element, TAGCCTGCCGTCGCGATTCGACAACTTTGGCCGGCACGTTGGCGAGTGTGCCATGCATGCTGATGA, separated by a 25-bp linker and inserted between the BamHI
sites of hsplacCasper. The 2×Ubx-lacZ reporter described in Figs. 1 and 4 contained two tandem copies of the core Dpp response element, AATTGGACTGGCGTCAGCGCCGGCGCTG, inserted between the EcoRI and
KpnI sites of hsplacCasper. The 2×UbxM11 and 2×UbxM13
plasmids described in Fig. 4 were identical to 2×Ubx except for the
base substitutions indicated in Fig. 4A. 4×Suh-lacZ was a
gift from C. Nelson and S. Carroll and contained the synthetic
sequence,
AATTGTTCTCACGGATCCAAAGGTTCTCACGAGATCTGTTCTCACGGATCCAAAGGTTCTCACGGAATTCGGATC, inserted between the EcoRI and KpnI sites of
hsplacCasper. 6×Brk4×Suh-lacZ was derived from 4×Suh-lacZ by
insertion between the EcoRI and KpnI sites of the
synthetic sequence, AATTAGCACCGGCGCTGTACAGCGCCGGCGCTAATTAGCGCCGGCGCTGTAC.
Effector plasmids for activated Tkv, Brk, Smad3, Smad4, activated
ActR1B, Su(H), and activated Notch were based on the actin5C promoter
vector pPacPL. Effector plasmids for Mad and Med were a gift from R. Padgett (27) and were based on the metallothionine promoter vector
pMK33. pPac-Brk was generated by cloning a 3.4-kb Brk cDNA (gift
from C. Rushlow) between the BamHI and NotI sites of pPacPL. In addition to the Brk coding region, the resulting plasmid
contains ~500 bp of the 5'-untranslated region (UTR) and ~800 bp of
3'-UTR. The pPacSu(H) and pPacNact plasmids were a gift
from T. Wittkopp and S. Carroll.
To create an MBP·Brk fusion protein, polymerase chain reaction
was used to position an EcoRI site 3-bp upstream of the Brk initiator ATG. The resulting clone was used to create MBP·Brk by
insertion between the EcoRI and HindII sites of
pMAL2C. MBP·BrkHD was generated by deleting sequences between a
PstI site 517-bp downstream from the Brk ATG and a
HindII site at the 3'-end of the cDNA.
Transfections and Reporter Assays--
Transfections of
Drosophila S2 cells were carried out as described previously
(36). A chemiluminescent -galactosidase assay was performed on cell
extracts using the GalactoStar assay system (Tropix, Inc.) according to
the supplier's instructions. For sets of transfections involving the
use of cDNAs cloned into the pMK33 metallothionine promoter vector,
CuSO4 was added to cultures 24 h after transfection to
a final concentration of 0.3 mM. S.D. was calculated from
the results of triplicate assays.
Purification of Fusion Proteins and Band Shift
Assays--
MBP·Brk fusion proteins were expressed,
affinity-purified using amylose-agarose, and used in band shift assays
as previously described (36) with modification of the binding buffer
(3% Ficoll, 20 mM Tris, pH 7.5, 0.1 M NaCl, 1 mM dithiothreitol, 0.01% Nonidet P-40, 0.5 mg/ml bovine
serum albumin, 0.02% green food coloring), an increase in reaction
volume to 50 µl (5-µl loaded) and use of smaller format (10 × 8 × 0.15 cm) 5% polyacrylamide gels. Purification of the
MBP·BrkHD used for the band shift assay shown in Fig. 1C included an additional step of incubating affinity-immobilized protein
with 5 µg/ml RNase A, 125 units/ml exonuclease III, and 12.5 units/ml
DNase I for 1 h at room temperature as a means of reducing
contaminating nucleic acid.
 |
RESULTS |
Brinker Represses Dpp Response Elements--
Dpp activates
expression of vg in cells of the Drosophila wing
imaginal disc through the quadrant enhancer, which is located within
the vg fourth intron (22). The quadrant enhancer contains two Mad binding sites, both of which contribute to Dpp-responsive expression (32, 51). Two copies of a 60-bp fragment containing these
adjacent sites (referred to as 2×MD2) are sufficient to activate a
lacZ reporter in an essentially normal quadrant
pattern.2 It was previously
shown that clones of homozygous mutant
brk /brk cells in wing
imaginal discs of brk /+ heterozygous larvae
express vg ectopically when they occur outside the wing
primordia (43), demonstrating that brk normally prevents vg expression from extending to hinge and notum regions that
surround the wing proper. Limitation of 2×MD2-lacZ
expression to the wing primordia suggests that brk might
repress through the MD2 element, although it is also possible
that control is indirect by means of an intermediate wing-specific
transcription factor such as Scalloped or Drifter (51, 52).
To determine whether Brk represses the MD2 element, we cotransfected
Drosophila S2 cells with the 2×MD2-lacZ reporter
and varying amounts of effector plasmids that express brk, Mad,
Med, and an activated version of the type I Dpp receptor,
thickveins (tkvQD) (Fig.
1A, left panel).
Reporter expression was induced ~4-fold by expression of
Mad, Med, and tkVQD, and this was
blocked by cotransfecting 10 ng of pPac-brk plasmid. Levels
of pPac-brk up to 0.4 ng had no effect. This result shows
that Brk is capable of repressing vg through a small
Smad-responsive target element.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1.
Brk differentially represses and binds the
Dpp response elements of vg and
Ubx. A, -galactosidase reporter
assays showing that vg-lacZ and Ubx-lacZ reporters are repressed by Brk
in Drosophila S2 cells. (+) indicates 10 ng each of effector
plasmids for Mad, Med, and activated Tkv. B, diagrams of the
full-length (Brk) and truncated (BrkHD) Brinker
proteins showing positions of the putative homeodomain (HD),
PMDLS motif, and intervals enriched in glutamine (Q),
histidine (H), or alanine (A) (adapted from Ref.
42). C, band shift assays showing binding of MBP·Brk,
MBP·BrkHD, and MBP·MadNL to Ubx and vg DNA
probes. Probe sequences are shown in Fig. 2. Indicated amounts of
protein preparation were included in 50-µl binding reactions together
with 10 11 M of the indicated probe.
Arrows indicate bound and free DNA complexes. D,
band shift assay showing competition of unlabeled Ubx and
vg probes for binding of labeled Ubx probe to
MBP·Brk. Each 50-µl binding reaction contained 3 ng of MBP·Brk
protein preparation and 10 11 M labeled
Ubx probe.
|
|
Expression of vg throughout the wing primordia at a distance
from the source of Dpp may reflect a relatively low sensitivity to
brk. In contrast, Ubx responds to Dpp in the
visceral mesoderm only in those cells that actually express
Dpp. We tested whether Brk contributes to this short range
Dpp responsiveness of Ubx by determining whether Brk could
repress the Ubx midgut enhancer element (53) in S2 cells. A
lacZ reporter driven by two copies of a 30-bp fragment from
the Dpp response element of Ubx was co-transfected with
combinations of effector plasmids expressing Mad + Med + tkvQD, or Brk
(Fig. 1A, right panel). The 2×Ubx-lacZ reporter behaved much like 2×MD2-lacZ in response to Mad + Med + tkvQD, but required only 0.08 ng of pPac-brk to be
repressed. Thus, in this transient transfection system, the
Ubx element was about 100-fold more sensitive than
vg MD2 to repression by Brk. This result fits with the
expectation that Brk affects target gene sensitivity to Dpp.
Brinker Binds to Dpp Response Elements--
Two bacterially
produced Brk fusion proteins were generated and tested by means of the
band shift assay for the ability to bind to DNA of the Ubx
Dpp response element. MBP·Brk was a fusion of full-length Brk to the
C terminus of maltose-binding protein, whereas MBP·BrkHD contained an
amino-terminal fragment harboring a putative homeodomain (Fig.
1B). Both were prepared from bacterial lysates by affinity
purification with amylose beads. Despite the inclusion of a protease
inhibitor mixture during purification, fractionation on an
SDS-polyacrylamide gel showed that the major protein in both
preparations was a ~52-kDa degradation product, with only minor
amounts of the larger apparent primary products (data not shown). This
52-kDa size suggests that both fusion proteins were susceptible to
cleavage just C-terminal to the putative homeodomain. Consistent with
this interpretation, both preparations bound to the Ubx DNA probe (Fig.
1C; probe sequence given in Fig.
2A), whereas non-fused MBP
lacked detectable binding activity (not shown). Approximately 4 ng of
either preparation was sufficient to shift half of the Ubx probe. This
corresponds to a dissociation constant of 10 9
M, a value that is in the range commonly observed for
homeodomain-DNA interactions (54). Both Brk fusion protein preparations
yielded multiple shifted bands, indicating that binding occurred at
more than one site. In parallel, the MBP·BrkHD preparation was tested for binding to a vg probe comprising most of the MD2 element
(Fig. 1C, right panel; probe sequence given in
Fig. 2A). Forty ng of MBP·BrkHD was required to shift half
of the vg probe, about ten times the amount needed to shift
half the Ubx probe. As a second means of measuring the relative
affinities of MBP·Brk for the Ubx and vg
sequences, unlabeled preparations of the same Ubx and vg double-stranded oligos were used to compete for binding
of labeled Ubx probe by a low concentration of MBP·Brk
(Fig. 1D). A 50% reduction in binding of probe was observed
with a ~10-fold excess of Ubx competitor or a ~300-fold
excess of vg competitor. Thus, as determined by either
method, the low affinity of Brk for the vg probe relative to
the Ubx probe correlates with the lower relative sensitivity
of the vg MD2 element to repression by Brk in the
transfected cell reporter assay. In contrast, a Mad fusion protein,
MBP·MadNL (MH1 domain + linker), bound the Ubx and
vg probes with approximately equal affinities (Fig.
1C, right panel). Together, these results suggest
that differences in the Dpp response thresholds of Ubx and
vg may be primarily a function of differential affinity for
Brk rather than for Mad.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
Brk binds to a GGCGCT motif that overlaps a
Mad binding site. A, at left is shown an
alignment of Mad binding sites within Dpp response elements of
vg and Ubx, and the sequence of a band shift
probe containing one copy of the putative Brk binding site, GGCGCT
(capital letters). Dotted arrows mark degenerate
Smad boxes; solid arrows mark the putative Brk sites in
Ubx. To the right is a band shift assay showing
binding of MBP·Brk to the GGCGCT probe. The indicated amounts of
protein are per 50-µl binding reaction, and probe concentration is
10 11 M. Arrows indicate bound and
free DNA complexes. B, example of a competition band shift
assay showing that GGCGCT competitor is ~20-fold more effective than
the M1 competitor (M1 sequence differs by a single G > A
substitution, i.e. AGCGCT). Each 50-µl binding reaction
contained the indicated concentration of unlabeled competitor DNA along
with 3 ng of MBP·Brk protein preparation and 10 11
M labeled GGCGCT probe. C, results of
competition band shift assays comparing the affinity of MBP·Brk for
the GGCGCT probe (wildtype) and for a series of single base
pair substitutions, M1-M9. Assays were performed in parallel as
described for B. Ratios of bound/free probe were calculated
from measurements made with a phosphorimager. Relative binding
affinities were derived from competitor concentrations that reduce the
bound/free ratio of labeled probe by 50%, i.e. an ordinate
value of 0.5. The resulting values were used to calculate
fold-reduction in binding affinity for each mutant competitor relative
to the GGCGCT (WT) competitor.
|
|
The Ubx Element Contains Overlapping Binding Sites for Mad and
Brinker--
Binding of MBP·Brk to the Ubx and
vg probes generated multiple bands, possibly indicating that
Brk bound to more than one site. The Ubx element contains an
inverted repeat of GGCGCT (Fig. 2A, solid arrows)
that overlaps a previously identified Mad binding site
(boxed). Whereas the Mad site embedded in this repeat
resembles the vg Mad site, the repeat as a whole is only
matched at 7 of 12 positions in vg. We tested MBP·Brk for
the ability to bind one copy of this sequence in a DNA probe that was
otherwise divergent in sequence from the Ubx element (Fig.
2A, left panel). MBP·Brk bound to the GGCGCT
probe with affinity that was similar to its affinity for the
Ubx probe (Fig. 2A, right panel) and
yielded a single major shifted band at about the same position as the lower most band observed with the Ubx probe. Although two
weak upper bands were also observed with the GGCGCT probe, overall, these results are consistent with high affinity interaction of MBP·Brk with just one site in the GGCGCT probe.
To investigate the specificity of Brk for the GGCGCT sequence, the
effects of single base pair substitutions were determined. This was
done measuring the ability of unlabeled "wildtype" (GGCGCT) and
mutant DNAs to compete with the labeled GGCGCT probe. Fig. 2B shows a gel comparing the ability of GGCGCT and
AGCGCT (mutant M1) probes to compete away binding
of MBP·Brk to labeled GGCGCT probe. Note that the M1 competitor was
tested over a 10-fold higher concentration range than the GGCGCT
competitor. Measurements of bound and free probe DNA from this gel and
from parallel band shift assays using eight other mutant competitors
were used to generate the binding curves shown in Fig. 2C.
The concentration of competitor resulting in an ordinate value of 0.5 provides a relative measure of affinity for the competitor DNA. The
results are tabulated below the graph in Fig. 2C. In all,
five mutants exhibited an ~20-fold reduction in the binding affinity,
whereas the least critical position contributed as much as 3-fold to
binding affinity. These results indicate that Brk makes base-specific contacts across the entire GGCGCT sequence.
The GGCGCT repeat in the Ubx element overlaps a Mad binding
site that can be modeled as consisting of two degenerate Smad boxes
(Fig. 2A), suggesting that Brk may compete with Mad for binding. This could not be determined unequivocally using the Ubx probe because MBP·Mad and MBP·Brk complexes had
nearly identical mobilities in the band shift assay. However, the
GGCGCT probe formed a complex with MBP·Mad that was easily resolved
from the main complex formed with MBP·Brk; with this probe, it was
clear that formation of MBP·Brk complexes correlated with reduced
binding of MBP·Mad (Fig. 3). In
contrast, the same amount of MBP·Brk did not reduce binding of
MBP·Mad to the M7 probe (Fig. 3), evidence that MBP·Brk reduced the
level of MBP·Mad binding by competition rather than by
sequence-independent inhibition.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 3.
Brk competes with Mad for binding to the
Ubx Dpp response element. Shown are two band
shift assays demonstrating that 3 ng of MBP·Brk preparation competes
effectively for binding of MBP·MadNL to the GGCGCT probe but does not
compete effectively for binding to the M7 probe. Probe sequences are
shown in Fig. 2. Indicated nanogram amounts of protein were included in
50-µl binding reactions together with 10 11
M of the indicated probe. Arrows indicate bound
and free DNA complexes.
|
|
Repression by Brinker Is Disrupted by Mutation of Its Binding
Sites--
To determine whether the Brk binding sites identified using
the band shift assay are actually required for repression, the Ubx element was mutated to disrupt Brk binding. Each of
three GGCG(C/T) sequences was changed to GTCG or to GGCGA (Fig.
4A, top), both of
which dramatically reduce Brk binding but still allow Mad to bind (Fig.
4A, bottom panels). Introduction of the same
triple-substitutions into the 2×Ubx-lacZ reporter resulted in an
~100-fold decrease in sensitivity to repression by cotransfected pPac-Brk (Fig. 4B, compare 0.08 ng of pPac-Brk in top
panel with 10 ng in lower two panels). These results
demonstrate that Brk binding sites are required for repression and
confirm that the sequence specificity characterized in band shift
experiments is also observed in cells.

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 4.
Weakened Brk binding in vitro
correlates with disrupted repression of
Ubx. A, band shift assay showing the
effects of multiple base substitutions on Brk binding affinity. The
base substitutions contained in the UbxM11 and UbxM13 probes are shown
above images of band shift assays comparing these probes to the
wild-type Ubx probe for binding of MBP·Brk (upper
gel) or MBP·MadNL (lower gel). The indicated amounts
of protein are per 50-µl binding reaction, and probe concentration is
10 11 M. Both mutants reduced MBP·Brk
binding affinity, whereas M13 had no effect on MBP·MadNL binding.
Compared with wild-type and M13, binding of MBP·MadNL to M11 yielded
a similar bound/free ratio at 300 ng of protein but greatly reduced
ratios between 10 and 100 ng. The mechanism responsible for this
apparently cooperative effect remains to be determined. B,
reporter assays showing that two copies of UbxM11 and UbxM13 exhibited
~100-fold-reduced sensitivity to co-expressed Brk relative to two
copies of the wild-type Ubx sequence. +, 10 ng each of Mad, Med, and
activated Tkv effector plasmids.
|
|
Brinker Is Capable of Active Repression--
The overlap of Mad
and Brk binding sites in the Ubx midgut element suggests
that Brk might repress Dpp targets by simply competing with Mad for
occupancy of an enhancer element. However, repressors generally
function by quenching the activating potential of transcription factors
bound nearby or by means of long range interfering effects on the
general transcription machinery (55). To determine whether Brk is
capable of functioning as an active repressor, we positioned Brk
binding sites adjacent to sites for the unrelated Notch-responsive activator, Suppressor of Hairless [Su(H)] and monitored reporter expression in response to cotransfected Brk, Su(H), and activated Notch
effector plasmids (Fig. 5). Brk
completely prevented activation by Su(H), whereas a control reporter
containing only Su(H) sites was repressed only 2-4-fold, an effect
that may have been caused by the presence of a single Brk binding site
adjacent to the hsp70 TATA box. Given this ability of Brk to
function as a generic active repressor, it is reasonable to speculate
that Brk might control a subset of Dpp targets without direct
involvement of Mad.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
Brk can function as an active repressor.
Shown are reporter assays demonstrating that Brk can effectively
repress activation by Su(H) through non-overlapping binding sites
(6×Brk/ 4×Suh-lacZ). In comparison, the 4×Suh-lacZ control plasmid
lacking Brk binding sites is less sensitive to Brk, although it still
exhibits 2-4-fold repression. The basis for this basal response to Brk
is not clear; however, we note that the hsp70 promoter
sequence contained in the hsplacCasper reporter vector does have an
apparent Brk site, GGCGCT, located 5-bp upstream from the TATAAA
sequence.
|
|
 |
DISCUSSION |
We have shown that Brk acts on two Dpp targets by binding to
functional Mad sites. Mutational analysis indicates that Brk and Mad
compete for binding to overlapping sites, but that the sequence
specificity of Brk is distinct from that of Smads. Thus we were able to
identify mutations that disrupt Brk repression of Ubx with
little effect on activation by Mad. This is consistent with the results
of previous experiments that demonstrated that Mad sites were required
for activation of several Dpp targets (32-34).
The overlap of Brk sites may explain why the Mad binding site consensus
differs from the consensus identified for Smad3 and Smad4 (Fig.
6). The Mad consensus aligns perfectly
with an inverted pair of GGCGCT Brk binding sites, as they occur in the
Ubx element (Fig. 6). It is also apparent that the Mad
consensus can be modeled as a pair of degenerate Smad boxes that align
with a pair of Smad boxes arranged as AGAC GTCT, an orientation that is
inverted in comparison to the Smad3-Smad4 consensus, GTCT AGAC. These
alignments suggest that the Mad consensus reflects dual utilization by
Brk and Mad-Med complexes. Whereas Mad-Med complexes also recognize the
Smad3/Smad4 consensus, Brk does
not.3 In contrast,
competition of Mad and Brk for binding to GCCGNCGC-type sites places targets under the control of both positive and negative branches of the Dpp pathway. Such dual control may be important in
generating target response thresholds that span a wide range of Dpp
levels. Smad1 activation of the human Smad6 promoter through a Mad-like binding site (37) suggests that a vertebrate Brk homolog
might compete with Smad1, Smad5, or Smad8 for regulation of certain BMP
targets.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 6.
Model for overlap of Brk and Mad binding
sites. The optimal arrangement of inverted Smad boxes, as
determined for binding by Smad1, Smad3, and Smad4, is aligned with an
inverted arrangement similar to the Mad binding site consensus and to
the Brk sites of the Ubx midgut enhancer. Bases that match
the Mad consensus are boxed. Arrows above the
first two lines mark Smad boxes, those below the bottom line, the
inverted Brk binding sites.
|
|
How can the requirement for Mad binding sites in certain Dpp targets be
reconciled with experiments showing that Dpp targets, including
vg, become independent of Dpp signaling in cells lacking functional brk? If Brk alone acts on such sites, mutations
that disrupt Brk binding should result in elevated or ectopic
expression rather than reduction. The conclusion that Mad acts on such
Dpp targets only indirectly through Brk is based on the assumption that
Dpp signaling is blocked completely in brk /
cells that are also mutant for tkv7 or
Mad1.2 (41-43). However, the type I Dpp
receptor encoded by saxophone, while normally insufficient
in the absence of tkv, provides a low level of signaling in
response to Dpp (56) that may become adequate when target response
thresholds are reduced by the absence of Brk. Similarly, whereas the
hypomorphic activity of the Mad1.2 allele is
normally inadequate, it may suffice in the absence of Brk. Thus, a low
level of Dpp signaling could still be required even without Brk.
Whereas convergent target specificity intertwines Brk and Mad function,
as an active repressor, Brk is also capable of functioning independently of Mad. Thus whereas Dpp targets are subject to competition between Mad and Brk, others may respond to Mad and Med only
indirectly through their cascading affects on the expression of
brk. The Dpp response elements of such genes may contain Brk binding sites arranged in a way that precludes binding by Mad/Med complexes, or such elements may simply lack nearby binding sites for
Mad/Med cofactors.
 |
ACKNOWLEDGEMENTS |
We thank Christine Rushlow, Angela Hudson,
Craig Nelson, Trisha Wittkopp, Sean Carroll, and Richard Padgett for
generously providing plasmids used in this study.
 |
FOOTNOTES |
*
This work was supported by a grant from the National Science
Foundation (to A. L.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Current address: Dept. of Pharmacology, University of Wisconsin,
Medical Sciences Center, 1300 University Ave., Madison, WI 53706.
§
To whom correspondence should be addressed. Tel.: 608-262-2456;
Fax: 608-262-2976; E-mail: alaughon@facstaff.wisc.edu.
Published, JBC Papers in Press, March 21, 2001, DOI 10.1074/jbc.M101365200
2
A. Hudson and S. Carroll, personal communication.
3
A. Laughon, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
BMP, bone
morphogenetic protein;
bp, base pair(s);
MBP, maltose-binding protein;
Dpp, decapentaplegic;
Mad, Mothers Against Dpp;
Brk, Brinker;
UTR, untranslated region.
 |
REFERENCES |
| 1.
|
Hogan, B. L.
(1996)
Curr. Opin. Genet. Dev.
6,
432-438
|
| 2.
|
Whitman, M.
(1998)
Genes Dev.
12,
2445-2462
|
| 3.
|
Massague, J.,
Blain, S. W.,
and Lo, R. S.
(2000)
Cell
103,
295-309
|
| 4.
|
Schier, A. F.,
and Shen, M. M.
(2000)
Nature
403,
385-389
|
| 5.
|
Massague, J.
(1998)
Ann. Rev. Biochem.
67,
753-791
|
| 6.
|
Massague, J.,
and Wotton, D.
(2000)
EMBO J.
19,
1745-1754
|
| 7.
|
Wrana, J. L.
(2000)
Cell
100,
189-192
|
| 8.
|
Itoh, S.,
Itoh, F.,
Goumans, M. J.,
and ten Dijke, P.
(2000)
Eur. J. Biochem.
267,
6954-6967
|
| 9.
|
Miyazono, K.,
ten Dijke, P.,
and Heldin, C. H.
(2000)
Adv. Immunol.
75,
115-157
|
| 10.
|
Spencer, F. A.,
Hoffmann, F. M.,
and Gelbart, W. M.
(1982)
Cell
28,
451-461
|
| 11.
|
Irish, V.,
and Gelbart, W.
(1987)
Genes Dev.
1,
868-879
|
| 12.
|
Ferguson, E.,
and Anderson, K.
(1992)
Cell
71,
451-461
|
| 13.
|
Immergluck, K.,
Lawrence, P.,
and Bienz, M.
(1990)
Cell
62,
261-268
|
| 14.
|
Panganiban, G. E.,
Reuter, R.,
Scott, M. P.,
and Hoffmann, F. M.
(1990)
Development
110,
1041-1050
|
| 15.
|
Podos, S. D.,
and Ferguson, E. L.
(1999)
Trends Genet.
15,
396-402
|
| 16.
|
Raftery, L. A.,
and Sutherland, D. J.
(1999)
Dev. Biol.
210,
251-268
|
| 17.
|
Wharton, K. A.,
Ray, R. P.,
and Gelbart, W. M.
(1993)
Development
117,
807-822
|
| 18.
|
Posakony, L.,
Raftery, L.,
and Gelbart, W.
(1991)
Mech. Dev.
33,
69-82
|
| 19.
|
Zecca, M.,
Basler, K.,
and Struhl, G.
(1995)
Development
121,
2265-2278
|
| 20.
|
Nellen, D.,
Burke, R.,
Struhl, G.,
and Basler, K.
(1996)
Cell
85,
357-368
|
| 21.
|
Lecuit, T.,
Brook, W. J.,
Ng, M.,
Calleja, M.,
Sun, H.,
and Cohen, S. M.
(1996)
Nature
381,
387-393
|
| 22.
|
Kim, J.,
Sebring, A.,
Esch, J. J.,
Kraus, M. E.,
Vorwerk, K.,
Magee, J.,
and Carroll, S. B.
(1996)
Nature
382,
133-138
|
| 23.
|
Masucci, J. D.,
and Hoffmann, F. M.
(1993)
Dev. Biol.
159,
276-287
|
| 24.
|
Raftery, L. A.,
Twombly, V.,
Wharton, K.,
and Gelbart, W. M.
(1995)
Genetics
139,
241-254
|
| 25.
|
Sekelsky, J. J.,
Newfeld, S. J.,
Raftery, L. A.,
Chartoff, E. H.,
and Gelbart, W. M.
(1995)
Genetics
139,
1347-1358
|
| 26.
|
Newfeld, S. J.,
Chartoff, E. H.,
Graff, J. M.,
Melton, D. A.,
and Gelbart, W. M.
(1996)
Development
122,
2099-2108
|
| 27.
|
Maduzia, L. L.,
and Padgett, R. W.
(1997)
Biochem. Biophys. Res. Commun.
238,
595-598
|
| 28.
|
Raftery, L. A.,
and Wisotzkey, R. G.
(1996)
Ann. New York Acad. Sci.
785,
318-320
|
| 29.
|
Das, P.,
Maduzia, L. L.,
Wang, H.,
Finelli, A. L.,
Cho, S. H.,
Smith, M. M.,
and Padgett, R. W.
(1998)
Development
125,
1519-1528
|
| 30.
|
Hudson, J. B.,
Podos, S. D.,
Keith, K.,
Simpson, S. L.,
and Ferguson, E. L.
(1998)
Development
125,
1407-1420
|
| 31.
|
Inoue, H.,
Imamura, T.,
Ishidou, Y.,
Takase, M.,
Udagawa, Y.,
Oka, Y.,
Tsuneizumi,
Tabata, T.,
Miyazono, K.,
and Kawabata, M.
(1998)
Mol. Biol. Cell
9,
2145-2156
|
| 32.
|
Kim, J.,
Johnson, K.,
Chen, H. J.,
Carroll, S.,
and Laughon, A.
(1997)
Nature
388,
304-308
|
| 33.
|
Szuts, D.,
Eresh, S.,
and Bienz, M.
(1998)
Genes Dev.
12,
2022-2035
|
| 34.
|
Xu, X.,
Yin, Z.,
Hudson, J. B.,
Ferguson, E. L.,
and Frasch, M.
(1998)
Genes Dev.
12,
2354-2370
|
| 35.
|
Zawel, L.,
Dai, J. L.,
Buckhaults, P.,
Zhou, S. B.,
Kinzler, K. W.,
Vogelstein, B.,
and Kern, S. E.
(1998)
Mol. Cell
1,
611-617
|
| 36.
|
Johnson, K.,
Kirkpatrick, H.,
Comer, A.,
Hoffmann, F. M.,
and Laughon, A.
(1999)
J. Biol. Chem.
274,
20709-20716
|
| 37.
|
Ishida, W.,
Hamamoto, T.,
Kusanagi, K.,
Yagi, K.,
Kawabata, M.,
Takehara, K.,
Sampath, T. K.,
Kato, M.,
and Miyazono, K.
(2000)
J. Biol. Chem.
275,
6075-6079
|
| 38.
|
Kusanagi, K.,
Inoue, H.,
Ishidou, Y.,
Mishima, H. K.,
Kawabata, M.,
and Miyazono, K.
(2000)
Mol. Biol. Cell
11,
555-565
|
| 39.
|
Massague, J.,
and Chen, Y. G.
(2000)
Genes Dev.
14,
627-644
|
| 40.
|
Attisano, L.,
and Wrana, J. L.
(2000)
Curr. Opin. Cell Biol.
12,
235-243
|
| 41.
|
Minami, M.,
Kinoshita, N.,
Kamoshida, Y.,
Tanimoto, H.,
and Tabata, T.
(1999)
Nature
398,
242-246
|
| 42.
|
Jazwinska, A.,
Kirov, N.,
Wieschaus, E.,
Roth, S.,
and Rushlow, C.
(1999)
Cell
96,
563-573
|
| 43.
|
Campbell, G.,
and Tomlinson, A.
(1999)
Cell
96,
553-562
|
| 44.
|
Jazwinska, A.,
Rushlow, C.,
and Roth, S.
(1999)
Development
126,
3323-3334
|
| 45.
|
Marty, T.,
Muller, B.,
Basler, K.,
and Affolter, M.
(2000)
Nat. Cell Biol.
2,
745-749
|
| 46.
|
Torres-Vazquez, J.,
Warrior, R.,
and Arora, K.
(2000)
Dev. Biol.
227,
388-402
|
| 47.
|
Sivasankaran, R.,
Vigano, M. A.,
Muller, B.,
Affolter, M.,
and Basler, K.
(2000)
EMBO J.
19,
6162-6172
|
| 48.
|
Zhang, H. L.,
Levine, M.,
and Ashe, H. L.
(2001)
Genes Dev.
15,
261-266
|
| 49.
|
Rushlow, C.,
Colosimo, P. F.,
Lin, M. C.,
Xu, M.,
and Kirov, N.
(2001)
Genes Dev.
15,
340-351
|
| 50.
|
Nelson, H. B.,
and Laughon, A.
(1993)
Roux's Arch. Dev. Biol.
202,
341-354
|
| 51.
|
Certel, K.,
Hudson, A.,
Carroll, S. B.,
and Johnson, W. A.
(2000)
Development
127,
3173-3183
|
| 52.
|
Halder, G.,
Polaczyk, P.,
Kraus, M. E.,
Hudson, A.,
Kim, J.,
Laughon, A.,
and Carroll, S.
(1998)
Genes Dev.
12,
3815-3820
|
| 53.
|
Thuringer, F.,
Cohen, S. M.,
and Bienz, M.
(1993)
EMBO J.
12,
2419-2430
|
| 54.
|
Gehring, W. J.,
Qian, Y. Q.,
Billeter, M.,
Furukubo-Tokunaga, K.,
Schier, A. F.,
Resendez-Perez, D.,
Affolter, M.,
Otting, G.,
and Wuthrich, K.
(1994)
Cell
78,
211-223
|
| 55.
|
Mannervik, M.,
Nibu, Y.,
Zhang, H.,
and Levine, M.
(1999)
Science
284,
606-609
|
| 56.
|
Haerry, T.,
Ongkar, K.,
O'Connor, M.,
and Wharton, K.
(1998)
Development
125,
397-3987
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Mann, R. Bodmer, and P. Pandur
The Drosophila homolog of vertebrate Islet1 is a key component in early cardiogenesis
Development,
January 15, 2009;
136(2):
317 - 326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-C. Yao, S. Phin, J. Cho, C. Rushlow, K. Arora, and R. Warrior
Multiple modular promoter elements drive graded brinker expression in response to the Dpp morphogen gradient
Development,
June 15, 2008;
135(12):
2183 - 2192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Estella and R. S. Mann
Logic of Wg and Dpp induction of distal and medial fates in the Drosophila leg
Development,
February 15, 2008;
135(4):
627 - 636.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gao and A. Laughon
Decapentaplegic-responsive Silencers Contain Overlapping Mad-binding Sites
J. Biol. Chem.,
September 1, 2006;
281(35):
25781 - 25790.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Bangi and K. Wharton
Dual function of the Drosophila Alk1/Alk2 ortholog Saxophone shapes the Bmp activity gradient in the wing imaginal disc
Development,
September 1, 2006;
133(17):
3295 - 3303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. B. Chen, J. Shen, Y. T. Ip, and L. Xu
Identification of phosphatases for Smad in the BMP/DPP pathway
Genes & Dev.,
March 15, 2006;
20(6):
648 - 653.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Massague, J. Seoane, and D. Wotton
Smad transcription factors
Genes & Dev.,
December 1, 2005;
19(23):
2783 - 2810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gao, J. Steffen, and A. Laughon
Dpp-responsive Silencers Are Bound by a Trimeric Mad-Medea Complex
J. Biol. Chem.,
October 28, 2005;
280(43):
36158 - 36164.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Xu, N. Kirov, and C. Rushlow
Peak levels of BMP in the Drosophila embryo control target genes by a feed-forward mechanism
Development,
April 1, 2005;
132(7):
1637 - 1647.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-H. Lee and M. Frasch
Nuclear integration of positive Dpp signals, antagonistic Wg inputs and mesodermal competence factors during Drosophila visceral mesoderm induction
Development,
March 15, 2005;
132(6):
1429 - 1442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Winter and G. Campbell
Repression of Dpp targets in the Drosophila wing by Brinker
Development,
December 15, 2004;
131(24):
6071 - 6081.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Zirin and R. S. Mann
Differing strategies for the establishment and maintenance of teashirt and homothorax repression in the Drosophila wing
Development,
November 15, 2004;
131(22):
5683 - 5693.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. M. Brugger, A. E. Merrill, J. Torres-Vazquez, N. Wu, M.-C. Ting, J. Y.-M. Cho, S. L. Dobias, S. E. Yi, K. Lyons, J. R. Bell, et al.
A phylogenetically conserved cis-regulatory module in the Msx2 promoter is sufficient for BMP-dependent transcription in murine and Drosophila embryos
Development,
October 15, 2004;
131(20):
5153 - 5165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Kwon, R. Hays, J. Fetting, and T. V. Orenic
Opposing inputs by Hedgehog and Brinker define a stripe of hairy expression in the Drosophila leg imaginal disc
Development,
June 1, 2004;
131(11):
2681 - 2692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Cook, B. Biehs, and E. Bier
brinker and optomotor-blind act coordinately to initiate development of the L5 wing vein primordium in Drosophila
Development,
May 1, 2004;
131(9):
2113 - 2124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Barrio and J. F. de Celis
Regulation of spalt expression in the Drosophila wing blade in response to the Decapentaplegic signaling pathway
PNAS,
April 20, 2004;
101(16):
6021 - 6026.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Reim, H.-H. Lee, and M. Frasch
The T-box-encoding Dorsocross genes function in amnioserosa development and the patterning of the dorsolateral germ band downstream of Dpp
Development,
July 15, 2003;
130(14):
3187 - 3204.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Klinedinst and R. Bodmer
Gata factor Pannier is required to establish competence for heart progenitor formation
Development,
July 1, 2003;
130(13):
3027 - 3038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Nibu, K. Senger, and M. Levine
CtBP-Independent Repression in the Drosophila Embryo
Mol. Cell. Biol.,
June 1, 2003;
23(11):
3990 - 3999.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chen and D. M. McKearin
A discrete transcriptional silencer in the bam gene determines asymmetric division of the Drosophila germline stem cell
Development,
March 15, 2003;
130(6):
1159 - 1170.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Saller, A. Kelley, and M. Bienz
The transcriptional repressor Brinker antagonizes Wingless signaling
Genes & Dev.,
July 15, 2002;
16(14):
1828 - 1838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kusanagi, M. Kawabata, H. K. Mishima, and K. Miyazono
alpha -Helix 2 in the Amino-terminal Mad Homology 1 Domain Is Responsible for Specific DNA Binding of Smad3
J. Biol. Chem.,
July 20, 2001;
276(30):
28155 - 28163.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|