![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 21, 18303-18312, May 25, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2-Chimaerin, a Non-protein Kinase
C Phorbol Ester Receptor*
,
,
,
¶
From the
Center for Experimental Therapeutics and
Department of Pharmacology, University of Pennsylvania School of
Medicine, Philadelphia, Pennsylvania 19104-6160 and
§ Georgetown Institute for Cognitive and Computational
Science, Georgetown University Medical Center,
Washington, D.C. 20007
Received for publication, December 18, 2000, and in revised form, February 13, 2001
| |
ABSTRACT |
|---|
|
|
|---|
The novel phorbol ester receptor The phorbol ester tumor promoters are the most common tools for
the activation of protein kinase C
(PKC)1 in biological systems.
These natural compounds exert a variety of effects in cells, which have
been largely attributed to the calcium-dependent classical
PKCs (cPKC One of the important novel concepts that has emerged in the past few
years is that PKC isozymes are not the only receptors for the phorbol
esters and related derivatives. In fact three novel families of phorbol
ester receptors unrelated to PKCs have been isolated. These novel
phorbol ester receptors, which lack a kinase domain in their structure,
include the chimaerin isoforms, Caenorhabditis elegans
Unc-13 and its mammalian homologs (Munc13 isoforms), and RasGRP. These
proteins have in common a single copy of the C1 domain, a 50/51-amino
acid motif that is duplicated in tandem in cPKC and nPKCs, which is the
binding site for the phorbol esters and diacylglycerol (DAG) in these
PKCs (4, 6, 7). It has recently been reported that chimaerins, Unc-13, and RasGRP bind phorbol esters and related analogs with high affinity in vitro, thereby suggesting that a single copy of the C1
domain is sufficient to confer binding responsiveness. In all cases
phorbol ester binding is phospholipid-dependent, and acidic
phospholipids are the most efficient cofactors for reconstitution of
binding (8-11). The identification of these "nonkinase" phorbol
ester receptors suggests that phorbol esters and related analogs may regulate cellular pathways independently of the activation of PKC isozymes.
Chimaerins are a novel family of phorbol ester receptors with Rac
GTPase-activating protein (GAP) activity and therefore accelerate the
hydrolysis of GTP to GDP leading to Rac inactivation. Chimaerins comprise at least four isozymes ( One of the hallmarks for the activation of cPKCs and nPKCs by phorbol
esters is their change in subcellular localization or "translocation." Translocation of PKC isozymes is a complex process that not only involves lipid-protein interactions mediated by the C1
domain and other motifs, but it is also dictated by protein-protein associations that may play a key role in determining function specificity for each PKC isozyme (12, 13). The aim of this study is to
investigate whether chimaerins are subject to subcellular redistribution or translocation by phorbol ester analogs. The results
presented in this paper show that chimaerins are subject to subcellular
translocation by phorbol ester derivatives. Using a series of deletion
mutants of Materials--
PMA, 4 Cell Culture--
COS-1 cells were cultured in Dulbecco's
modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 µg/ml streptomycin at 37 °C in a
humidified 5% CO2 atmosphere.
Generation of
To construct pEGFP- Expression of
Cells were harvested into lysis buffer (50 mM Tris-HCl, pH
7.4, 5 mM EGTA, 5 µg/ml 4-(2-aminoethyl)-benzenesulfonyl
fluoride, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 µg/ml pepstatin A) and lysed by sonication. Separation of cytosolic
(soluble) and particulate fractions was performed by
ultracentrifugation as described previously (8, 17). Equal amounts of
protein (10 µg) for each fraction were subjected to
SDS-polyacrylamide gel electrophoresis and transferred to
nitrocellulose membranes that were immunostained with different
antibodies. The following antibodies were used: anti-PKC Visualization of GFP-
For staining of the Golgi network, COS-1 cells transfected with the
GFP-expression vectors were incubated with BODIPY TR ceramide (2 µg/ml) for 30 min at 37 °C. After incubation, cells were washed twice with PBS and then treated with phorbol esters for 30 min. Cells
were then washed and fixed with 3.7% formaldehyde. Slides were mounted
using Vectashield and viewed with a Bio-Rad MRC-1024ES laser scanning
confocal microscope. The confocal images were processed using Confocal
AssistantTM, version 4.02. All the images shown are
individual middle sections of projected Z series mounting.
Modeling Studies--
A newly developed q jumping molecular
dynamics simulation method, which has been used to successfully predict
the PKC-ligand receptor complex (19), was used to predict the binding
model of thymeleatoxin in complex with
The three-dimensional structure of Determination of Rac-GAP Activity--
To determine GTPase
activity of Association of Translocation of
Phorbol ester derivatives and related analogs have unique binding
properties for discrete PKC isozymes, and recent studies have shown
that different derivatives have differential properties for
translocating PKC isozymes (28, 29). Our previous in vitro studies on structure-activity analysis revealed striking differences in
binding potency between Studies with Deletion Mutants of Translocation of Different Chimaerin Isoforms by PMA--
All
chimaerin isoforms have in common a single C1 domain. The homology
between the C1 domains of Molecular Modeling of Thymeleatoxin Binding to PKC
Furthermore, although the residue at position 9 is hydrophilic in
nature in PKC C1b domains, a positively charged Arg residue is present
in position 9 of Localization Studies Using GFP-tagged
Recent studies by the Blumberg lab (28, 29) have shown a distinct
pattern of redistribution of PKC isozymes depending on the phorbol
ester analog used, suggesting that the PKC activator plays a key role
in determining intracellular localization. We decided to evaluate
whether a similar mechanism takes place for
In the next set of experiments we evaluated the localization of the
To determine the nature of the perinuclear compartment to which
Rac-GAP Activity of PMA Promotes the Association of In this study we have demonstrated that chimaerin isoforms, like
cPKCs and nPKCs, are positionally regulated by phorbol esters. Translocation of chimaerins by phorbol esters is dependent on the
chimaerin C1 domain and independent of PKC activation. We have
previously demonstrated that these RacGAP proteins bind phorbol esters
and DAG with low nanomolar affinity (8, 17). Like PKCs, phorbol ester
binding to chimaerins is dependent on phospholipids as cofactors, which
suggests that association to membranes may be crucial for regulating
its activity and/or association to targets. In that regard, it was
previously shown that the GAP activity of We have identified the C1 domain in chimaerins as the minimum domain
required for phorbol ester binding and subcellular redistribution in
cells. It is therefore clear that a single C1 domain is sufficient for
binding of phorbol esters. These results support those from previous
experiments using single C1 domains of PKCs, which show that this
50-amino acid domain is sufficient for ligand binding (30, 32, 33).
Moreover, experiments using a single C1 domain of PKC It is interesting that Our experiments using different ligands show important differences in
their potencies for translocating In summary, the chimaerin isoforms represent a novel class of phorbol
ester receptors that are subject to subcellular translocation by
phorbol esters and related analogs through their C1 domain. The unique
pharmacological properties and distinct localization of each receptor
highlights the complexity of phorbol ester pharmacology and DAG
signaling, as well as makes questionable the use of phorbol esters as
specific ligands for PKC isozymes. The elucidation of the cellular
functions of the novel chimaerin receptors will benefit from the
rationale design of specific pharmacological agents.
2-chimaerin
is a Rac-GAP protein possessing a single copy of the C1 domain, a
50-amino acid motif initially identified in protein kinase C (PKC)
isozymes that is involved in phorbol ester and diacylglycerol
binding. We have previously shown that, like PKCs,
2-chimaerin binds
phorbol esters with high affinity in a
phospholipid-dependent manner (Caloca, M. J.,
Fernandez, M. N., Lewin, N. E., Ching, D., Modali, R., Blumberg, P. M., and Kazanietz, M. G. (1997) J. Biol. Chem. 272, 26488-26496). In this paper we report that like
PKC isozymes,
2-chimaerin is translocated by phorbol esters from the
cytosolic to particulate fraction. Phorbol esters also induce
translocation of
1 (n)- and
1-chimaerins, suggesting common
regulatory mechanisms for all chimaerin isoforms. The subcellular
redistribution of
2-chimaerin by phorbol esters is entirely
dependent on the C1 domain, as revealed by deletional analysis and
site-directed mutagenesis. Interestingly,
2-chimaerin translocates
to the Golgi apparatus after phorbol ester treatment, as revealed by
co-staining with the Golgi marker BODIPY-TR-ceramide. Structure
relationship analysis of translocation using a series of PKC
ligands revealed substantial differences between translocation of
2-chimaerin and PKC
. Strikingly, the mezerein analog
thymeleatoxin is not able to translocate
2-chimaerin, although it
very efficiently translocates PKC
. Phorbol esters also promote the
association of
2-chimaerin with Rac in cells. These data suggest
that chimaerins can be positionally regulated by phorbol esters and
that each phorbol ester receptor class has distinct pharmacological
properties and targeting mechanisms. The identification of selective
ligands for each phorbol ester receptor class represents an important
step in dissecting their specific cellular functions.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
,
I,
II, and
) or calcium-independent novel PKCs
(nPKC
,
,
, and
). Unlike cPKCs and nPKCs, the third class
of PKC isozymes or atypical PKCs (aPKC
and PKC
/
) is phorbol ester-unresponsive. Phorbol esters also target PKCµ (PKD), a
kinase related to PKC that has unique substrate specificity and
regulation (1-4). The heterogeneity in the phorbol ester responses is
probably related to the multiple phorbol ester receptors present in
each cell type. An additional level of complexity in the phorbol ester responses is conferred by the unique pharmacological profile of each
phorbol ester analog. In fact, ligands for PKCs not only include the
typical diterpene phorbol esters but also a large number of unrelated
structural analogs such as nonphorbol ester diterpenes
(e.g. mezereins, octahydromezerein, and thymeleatoxin), macrocyclic lactones (e.g. bryostatins), and indole
alkaloids (e.g. indolactams and teleocidins). The
differential effects of phorbol ester analogs in cellular models
suggest unique modes of interaction with different phorbol ester
receptor classes and may explain the heterogeneous properties of the
ligands (4-7).
1- or n-,
2-,
1-, and
2-chimaerins) that are alternative spliced variants from the
-
and
-chimaerin genes (14-16). The C1 domain in chimaerin isozymes
has ~40% homology with those of PKC isozymes. Using the radioligand
[3H]phorbol 12,13-dibutyrate, we have reported that
2-chimaerin is a high affinity receptor for phorbol esters in
vitro (8). Competition assays revealed that different ligands have
unique patterns of recognition for different phorbol ester receptors. In fact, although DAGs and indolactams have similar affinities for PKCs
and
2-chimaerin, thymeleatoxin (a mezerein analog) has ~60 times
less affinity for
2-chimaerin (8). Therefore, it is likely that
specific residues within individual C1 domains are critical for
conferring binding specificity. Limited information is available on the
ligand binding properties of these novel phorbol ester receptors. The
regulation, localization, and function of the chimaerins are largely unexplored.
2-chimaerin, we determined that translocation is entirely
dependent on the ligand binding to the C1 domain. Interestingly, we
found that upon stimulation with different analogs,
2-chimaerin
translocates to the Golgi apparatus. These data indicate that the
chimaerin family of phorbol ester receptors has unique ligand
recognition properties and suggests that phorbol esters have the
potential to regulate additional targets in addition to PKC isozymes.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-PMA, thymeleatoxin,
(
)-octylindolactam V, 12-deoxyphorbol 13-phenyacetate, and GF 109203X
were purchased from LC Laboratories (Woburn, MA). Bryostatin 1 was a
kind gift from Dr. Peter M. Blumberg (NCI, National Institutes of
Health). BODIPY-TR-ceramide was obtained from Molecular Probes, Inc.
(Eugene, OR). Cell culture reagents and media were obtained from Life
Technologies, Inc.
2-Chimaerin Expression Vectors--
A
1.4-kilobase XhoI-MluI fragment comprising the full-length
2-chimaerin was ligated into the mammalian expression vector pCR3
to generate pCR3
-
2-chimaerin, as we have previously
described elsewhere (8). To generate a GFP construct for
2-chimaerin (pEGFP-
2-chimaerin), a 1.4-kilobase
EcoRI-EcoRI fragment was isolated from
pCRII-
2-chimaerin (8) and subcloned in-frame into the GFP plasmid
pEGFP-C3 (CLONTECH; Ref. 17). Deletion mutants of
2-chimaerin were generated by PCR using from pEGFP-
2-chimaerin as
a template. The following oligonucleotides were used (EcoRI and SalI restriction sites are underlined):
CATGAATTCATGCGTCTCCTCTCC and
AGATGTCGACGGCAGTCATTGGGAAC (amino acids 1-262), for
pEGFP-
2-N-C1; GAGGAATTCCACAACTTTAAGGTCC and
AGATGTCGACGGCAGTCATTGGGAAC (amino acids 213-262), for
pEGFP-
2-C1; GAGGAATTCCACAACTTTAAGGTCC and GCGCGTCGACATTAGAATAAAACGTCTTCG (amino acids
213-466), for pEGFP-
2-C1-GAP. The PCR products were ligated into
pCRII using the TA cloning kit (Invitrogen). The corresponding
EcoRI and SalI fragments were isolated and
subcloned into the GFP plasmid pEGFP-C2 (CLONTECH). The construct pEGFP-
2-GAP was generated by PCR from
pACG2T-
2-chimaerin (8) using the following oligonucleotides:
CGCACGCGTGAATAAAACGTCTTCGTTTTCTATTAA and
AGCCTCCAGATGGTGGTAGACATATGCATTCGGGAA. The PCR product was ligated into
pCRII, and a fragment comprising the GAP domain (amino acids 291-466)
was isolated by digestion with EcoRI and ligated in frame
into pEGFP-C2 to generate pEGFP-
2-GAP.
1-chimaerin, the full-length cDNA for
1-chimaerin (18) was used as a template, and EcoRI
and XhoI sites were created by PCR (restriction sites
underlined), using the following oligonucleotides:
CCGGAATTCATGCCATCCAAAGAGTCTTGGTC and CCGCTCGAGCTAAAATAAAATGTCTTC. The insert was ligated in
frame into pEGFP-C2.
1-Chimaerin was isolated from human testis
cDNA (CLONTECH) by PCR using the following
oligonucleotides: GTCAGGCTCGAGGGATCCATGCTTTGCACGTCTCCCGTC (XhoI site underlined) and
CGCACGCTGAAACAGAACATCTTCGTTTTCTATTAA. The
1-chimaerin
cDNA was subcloned into pCRII vector, and a
XhoI-EcoRI fragment from that plasmid was
subcloned into pEGFP-C3 to generate pEGFP-
1-chimaerin. Generation of
the mutant C246A-
2-chimaerin and the plasmid
pEGFP-C246A-
2-chimaerin was described elsewhere (17). In all cases,
constructs were sequenced by the dideoxy chain termination method.
2-Chimaerin in COS-1 Cells and Subcellular
Fractionation--
Mammalian expression vectors for chimaerins or
deletion mutants were transfected into COS-1 cells in 6-well plates
using LipofectAMINE (Life Technologies, Inc.) according to the
manufacturer's protocol. 48 h after transfection, cells were
treated with different concentrations of phorbol ester analogs.
Experiments were performed in the presence of the PKC inhibitor GF
109203X (5 µM), added 30 min before and during the
incubation with the phorbol ester analogs, as we have previously
described (8).
antibody
(1:3,000; Upstate Biotechnology Inc., Lake Placid, NY),
anti-
2-chimaerin antibody (1:1,000), and anti-GFP antibody
(1:25,000). The intensity of the bands was determined by densitometry
using a Scanner Control, version 1.00 (Molecular Dynamics, Inc.,
Sunnyvale, CA). Densitometric analysis was performed under conditions
that yielded a linear response.
2-Chimaerin Translocation by Fluorescent
Microscopy--
COS-1 cells were transfected with the GFP expression
vectors using FuGENE (Roche Molecular Biochemicals), according to the manufacturer's protocol. After 48 h, cells were treated with the phorbol ester analogs and fixed with 3.7% formaldehyde.
Photomicrographs were taken with an Olympus fluorescent microscope.
2-chimaerin. The major
advantage of this program is its ability to include both the ligand and receptor flexibility in the docking simulation. The q jumping algorithm
has been implemented in the CHARMM program, as described previously
(19, 20). The q jumping procedure was carried out using a CHARMM
script. The CHARMM force field (21) was used to describe the structure
of the receptor, and all the necessary parameters for thymeleatoxin
were generated by using the QUANTA program (Molecular Simulations Inc.,
San Diego, CA).
2-chimaerin C1 domain was modeled
based upon the x-ray structure of PKC
C1b, as described previously
(17, 22). Starting from the phorbol 13-acetate structure in the x-ray
crystal data (22), the initial conformation of thymeleatoxin was
generated by QUANTA. All the appropriate hydrogen atoms were added to
the ligand and minimized. In the docking simulation, the ligand was
allowed to be fully flexible, and all the side chains of the residues
8-12 and 20-27, which form the ligand binding site in
2-chimaerin,
were allowed to be flexible; everything else in the receptor was fixed
in our docking simulation. Then, the MD simulations described
above were carried out in vacuum, using the following q jumping
parameters: q = 1.02-1.03,
= 800 and
PJ = 0.1. The q jumping MD simulations were
carried out at T = 300 K, using the constant
temperature algorithm of Berendsen et al. (23). The SHAKE
algorithm (24) was used to fix all the bonds containing hydrogen with a
time step of 1 fs. For energy evaluations, a
distance-dependent dielectric model was employed with the
nonbonding interactions truncated at 8 Å. Finally nuclear Overhauser
effect constraints consisting of a central atom of the ligand,
and each
-carbon atom in the
2-chimaerin residues 10 and 24 was
introduced to prevent the ligand from escaping from the binding site
completely. With the MD protocol, we performed several independent MD
runs for 1-2 ns, and the binding mode was determined from the lowest
minimum energy conformation from each of the MD trajectories. Then, the resulting complex structures were further refined by a minimization consisting of 5000 steps of adopted Newton-Raphson method.
2-chimaerin, recombinant purified Rac was first
incubated at 30 °C for 10 min with [
-32P]GTP (60 µCi/nmol; Amersham Pharmacia Biotech) in loading buffer (50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.1 mM dithiothreitol, and 0.5 µM
MgCl2). The loading reaction was stopped by the addition of
MgCl2 (final concentration, 10 mM). Purified
2-chimaerin (expressed in Sf9 cells) was then incubated with
loaded Rac in reaction buffer (50 mM Tris-HCl, pH 7.5, 0.1 mM dithiothreitol, 10 mM MgCl2, 1 mg/ml bovine serum albumin, 1 mM GTP) at 15 °C, and Rac
GTPase activity was determined in filters by measuring the reduction in
Rac-bound radioactivity (25). To determine the effect of phospholipids
on GAP activity, purified
2-chimaerin was preincubated with 100 µg/ml of phospholipids (variable proportions of phosphatidylserine, and the remaining lipid is neutral phosphatidylcholine) for 45 min at
30 °C in reaction buffer, prior to adding the loaded Rac. Experiments were performed in duplicate. In general, duplicate determinations differed by <10%. Expression and purification of recombinant
2-chimaerin from Sf9 cells is described elsewhere (8).
2-Chimaerin and Rac--
COS-1 cells were
co-transfected with pCR3
-
2-chimaerin and pEBG-Rac (a
mammalian expression vector for GST-Rac) or pEBG (empty vector for
expression of GST alone). pEBG vectors were a kind gift of Dr. Margaret
M. Chou (University of Pennsylvania School of Medicine). 48 h
after transfection cells were treated with GF 109203X (5 µM) for 30 min and then for 1 h with PMA (3 µM). After treatment, cells were harvested into lysis
buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 5 mM MgCl2, 0.1 mM dithiothreitol, 5 µg/ml 4-(2-aminoethyl)-benzenesulfonyl fluoride, 5 µg/ml
leupeptin, 5 µg/ml aprotinin, and 1 µg/ml pepstatin A), and the
lysates were then incubated with glutathione-Sepharose 4B beads
(Amersham Pharmacia Biotech) for 2 h at 4 °C. Beads were
extensively washed with lysis buffer, resuspended in Laemmli's sample
buffer, and boiled. Samples were subjected to 12% SDS-polyacrylamide
gel electrophoresis, transferred to nitrocellulose membranes, and then
probed with anti-
2-chimaerin antibody (1:1000). Aliquots of total
lysates were also probed with an anti-
2-chimaerin antibody (1:1000)
and an anti-GST antibody (Amersham Pharmacia Biotech; 1:1,000).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
2-Chimaerin by Phorbol Ester
Derivatives--
We have previously shown that
2-chimaerin, a
RacGAP protein, is a high affinity phorbol ester receptor. Our previous
work revealed that
2-chimaerin binds [3H]phorbol
12,13-dibutyrate in a phospholipid-dependent fashion with
an affinity that is in the same range as cPKCs and nPKCs (8). Cells
were transfected with the mammalian expression vector pCR3
-
2-chimaerin, and high levels of expression of
2-chimaerins were observed 48 h later, as judged by Western
blot analysis and by assessing phorbol ester binding levels (8). To
assess the effects of phorbol esters on the subcellular distribution of
2-chimaerin, cells were treated with PMA and then subjected to
subcellular fractionation. The levels of
2-chimaerin in soluble
(cytosolic) and particulate fraction were then determined by Western
blot. These experiments were carried out in the presence of the PKC inhibitor GF 109203X (5 µM) to rule out any involvement
of PKCs in the effect of phorbol esters, as we have previously
described (8, 17). Fig. 1 shows that PMA
induced translocation of
2-chimaerin from the soluble to the
particulate fraction in a dose-dependent manner. A GFP
fusion construct for
2-chimaerin was also generated and responds to
PMA in a similar fashion as the nonfused construct, suggesting that, as
previously described for PKC isozymes (26-29), the GFP tag does not
affect responsiveness to phorbol esters. As expected, nonfused GFP
protein was unresponsive to PMA.

View larger version (21K):
[in a new window]
Fig. 1.
Translocation of
2-chimaerin by PMA. A, COS-1 cells
were transfected with pCR3
-
2-chimaerin (top panel),
pEGFP-
2-chimaerin (middle panel), or pEGFP (bottom
panel). 48 h later cells were treated with different
concentrations of PMA for 1 h in the presence of the PKC inhibitor
GF 109203X (5 µM). Cells were then fractionated by
ultracentrifugation. Soluble and particulate fractions were subjected
to Western blot analysis using an anti-
2-chimaerin antibody
(top panel) or an anti-GFP antibody (middle and
bottom panels). The molecular mass of
2-chimaerin is 50 kDa, and that of GFP-
2-chimaerin is 78 kDa. B,
densitometric analysis of the immunoreactivity in the soluble
fractions. Results are the means ± S.E. of three independent
experiments and are expressed as percentages of the values observed in
control cells.
,
2-chimaerin;
, GFP-
2-chimaerin;
,
GFP.
2-chimaerin and PKC isozymes. In fact, although phorbol esters and 12-deoxyphorbol esters have ~10-fold lower affinity for
2-chimaerin than for PKC
, indole alkaloids (indolactams) have similar binding potency, and mezerein derivatives such as the tumor promoter thymeleatoxin show ~60-fold less affinity for
2-chimaerin (8). To explore the structure-activity for translocation of
2-chimaerin, we investigated the effect of four different analogs on the subcellular redistribution of this novel receptor and compared it with PKC
(Fig.
2). The macrocyclic lactone bryostatin 1, an analog with an atypical spectrum of biological responses compared
with the typical phorbol esters, was the most potent agent at inducing
translocation of
2-chimaerin. The ED50 for translocation
is ~30 nM. Bryostatin 1 is somewhat more potent in
translocating PKC
(ED50 ~3 nM). The
12-deoxyphorbol ester derivative 12-deoxyphorbol 13-phenyacetate and
the indole alkaloid (
)-octylindolactam V both induced translocation
of
2-chimaerin. Despite the similar potency in vitro for
binding recognition,2
(
)-octylindolactam V was very poor at inducing translocation of
2-chimaerin when compared with PKC
. Strikingly, the mezerein derivative thymeleatoxin was totally ineffective at inducing
translocation of
2-chimaerin even at a concentration of 10 µM. On the other hand, thymeleatoxin fully translocated
PKC
at a concentration of 10 nM, suggesting that this
derivative is a selective agent for translocation of PKC.

View larger version (33K):
[in a new window]
Fig. 2.
Translocation of
2-chimaerin by different analogs. COS-1 cells
were transfected with pCR3
-
2-chimaerin and 48 h later
treated for 1 h with different concentrations of the analogs
indicated in the figure. Experiments were done in the presence of the
PKC inhibitor GF 109203X (5 µM). After subcellular
fractionation, soluble, and particulate fractions were subjected to
Western blot using antibodies for either
2-chimaerin or PKC
.
A, representative Western blots. B, densitometric
analysis of the soluble fractions. Results are expressed as
percentages of the values observed in control cells and represent the
means ± S.E. of three or four independent experiments.
,
PKC
;
,
2-chimaerin.
2-Chimaerin: Translocation
Dependence on the C1 Domain--
The C1 domains in PKCs are the
binding sites for phorbol esters and related derivatives and are
essential for mediating the subcellular redistribution of PKCs. To
ascertain whether the C1 domain in
2-chimaerin mediates its
translocation after phorbol ester treatment, we constructed a series of
deletion mutants for
2-chimaerin in pEGFP vector. The following
constructs were generated (Fig.
3A): GFP-
2-N-C1 (from N
terminus to C1-domain), GFP-
2-C1 (C1 domain alone), GFP-
2-C1-GAP
(from C1 domain to C terminus), and GFP-
2-GAP (GAP domain alone).
Cells were transfected with each of these constructs and subsequently
treated with PMA. Western blot analysis of soluble and particulate
fractions after subcellular fractionation revealed that PMA induced the
translocation of GFP-
2-C1 and GFP-
2-C1-GAP from soluble to
particulate fraction, as observed with the full-length
2-chimaerin
(Fig. 3B). On the other hand, no changes in subcellular
localization were observed after deletion of the C1 domain, as revealed
by the absence of translocation of GFP-
2-GAP after PMA treatment.
Unexpectedly, a deleted version of
2-chimaerin expressing only the
N-terminal region and C1 domain (GFP-
2-N-C1) was found at the
particulate fraction even in the absence of PMA treatment. The
involvement of the C1 domain in translocation was confirmed by
site-directed mutagenesis of the C1 domain. A point mutant of
2-chimaerin in which Cys in position 246 was replaced by Ala was
generated and expressed as a GFP fusion protein
(GFP-C246A-
2-chimaerin). Position 246 corresponds to the third Cys
in the C1 domain, which is essential for the coordination of
Zn2+, as determined in structural studies in C1 domains of
PKCs (22). In a previous study we have determined that this
2-chimaerin mutant does not bind phorbol esters (17). In agreement
with our results with the deletion mutants, GFP-C246A-
2-chimaerin does not translocate in response to PMA. All together, these results unambiguously indicate that the C1 domain mediates the translocation of
2-chimaerin.

View larger version (42K):
[in a new window]
Fig. 3.
Analysis of translocation of
2-chimaerin deletion mutants. COS-1 cells were
transfected with the following constructs. A, pEGFP
(row 1), pEGFP-
2-N-C1 (row 2), pEGFP-
2-C1
(row 3), pEGFP-
2-C1-GAP (row 4),
pEGFP-
2-chimaerin (row 5), pEGFP-
2-GAP (row
6), or pEGFP-C246A-
2-chimaerin (row 7). After
48 h cells were treated with PMA (3 µM, 1 h) in
the presence of the PKC inhibitor GF 109203X (5 µM) and
subjected to subcellular fractionation. B, representative
Western blots of total, soluble, and particulate fractions, using an
anti-GFP antibody are shown. Two additional experiments gave similar
results.
- and
-chimaerins is ~94%. Like
2-chimaerin,
1-chimaerin (n-chimaerin) is a high affinity phorbol
ester receptor in vitro, and it binds
[3H]phorbol 12,13-dibutyrate in a
phospholipid-dependent manner with an affinity that is
similar to that of PKC isozymes (18). To evaluate whether multiple
chimaerin isozymes respond to PMA, we transiently expressed
1-,
1-, and
2-chimaerins in COS-1 cells and monitored subcellular
distribution in each case after PMA treatment. Fractionation of
untreated cells revealed that 25 and 45% of the
1- and
1-chimaerin immunoreactivity was present in the soluble fraction
(cytosol), compared with 85% for
2-chimaerin. After PMA treatment,
the immunoreactivity in the soluble fraction is substantially reduced
in all cases (Fig. 4). Unlike
2-chimaerin, an increase in the particulate fraction for
1- and
1-chimaerins was not evident, probably because most of the
immunoreactivity is already present in the particulate fraction before
stimulation. Remarkably, as observed with
2-chimaerin, thymeleatoxin
did not induce any significant changes in the levels of soluble
1-chimaerin. Only a small fraction of
1-chimaerin was
translocated by thymeleatoxin when compared with PMA. Therefore,
thymeleatoxin is a much more potent agent in translocating PKC
than
chimaerin isoforms, as we have demonstrated in Fig. 2.

View larger version (26K):
[in a new window]
Fig. 4.
Multiple chimaerin isozymes are translocated
by PMA. COS-1 cells were transfected with pEGFP,
pEGFP-
1-chimaerin, pEGFP-
1-chimaerin, or pEGFP-
2-chimaerin.
After 48 h cells were treated with PMA (P) or
thymeleatoxin (T) (1 µM, 1 h) in the
presence of GF109203X (5 µM). After subcellular
fractionation by ultracentrifugation, soluble and particulate fractions
were subjected to Western blot analysis using either an anti-GFP or
anti-PKC
antibody. The molecular masses of GFP-
1-chimaerin,
GFP-
1-chimaerin, and GFP-
2-chimaerin are 61, 59, and 78 kDa,
respectively. Two additional experiments gave similar experiments.
C, Control.
C1b and
2-Chimaerin C1 Domains--
The reduced binding affinity of
2-chimaerin for thymeleatoxin and the marked differences in
translocation between PKC
and
2-chimaerin suggest that each
receptor may interact differently with this ligand. We therefore
decided to perform a molecular modeling analysis of the C1 domains of
PKC
and
2-chimaerin in complex with thymeleatoxin. For the
purposes of this study, we use the C1b domain of PKC
(Fig.
5). X-ray crystallographic studies of
PKC
C1b domain and our previous molecular modeling and site-directed mutagenesis analysis have clearly demonstrated that the binding of
ligands to PKC C1 domains is governed by two important interactions, namely hydrogen bonding and hydrophobic interactions (22, 30). Thymeleatoxin forms an identical hydrogen bond network with PKC
C1b
and
2-chimaerin, suggesting that the selectivity between PKC
and
2-chimaerin for thymeleatoxin is not due to different hydrogen
bonding interactions. In the predicted binding models, thymeleatoxin is
in close contact with a number of hydrophobic residues, including
residues at positions 11, 20, 22, and
24.3 Although the residues at
positions 11 and 24 (Pro and Leu) are conserved between PKC
C1b and
2-chimaerin C1 domains, the residues at positions 20 and 22 are Leu
in PKC
C1b and Phe in
2-chimaerin. The residue at position 22 is
Tyr in PKC
C1b but is replaced by Trp in
2-chimaerin.
Importantly, a Leu residue is conserved at position 20 among all the
PKC C1b domains. Thus, these different hydrophobic residues at
positions 20 and 22 in PKC
C1b and
2-chimaerin may explain
differences in binding recognition for thymeleatoxin.

View larger version (57K):
[in a new window]
Fig. 5.
Docking of thymeleatoxin to the
PKC
C1b and
2-chimaerin C1 domains.
2-chimaerin. Based upon the x-ray structure of
PKC
C1b in complex with phorbol 13-acetate, it was proposed that a
primary mechanism of PKC translocation and activation upon ligand
binding is the transformation of a predominant hydrophilic surface to a
hydrophobic surface, thus allowing the effective insertion into the
membrane (22). The presence of a positively charged Arg residue at
position 9 in
2-chimaerin makes the surface less hydrophobic upon
ligand binding and may make
2-chimaerin intrinsically less capable
of translocation than PKCs, as supported by our current results. Thus,
the inability of thymeleatoxin to translocate
2-chimaerin may be due
to the combination of the weaker binding affinity for thymeleatoxin
binding to the C1 domain of
2-chimaerin (8) and the intrinsic weaker
ability of
2-chimaerin to translocate to the membrane.
2-Chimaerin and Its
Mutants--
PKC isozymes translocate to different intracellular
compartments upon activation with phorbol esters and related
derivatives. Evaluation of subcellular localization of
GFP-
2-chimaerin by fluorescence microscopy revealed that this novel
phorbol ester receptor was distributed in the cytoplasm. No nuclear
staining was observed. Upon PMA stimulation, a significant fraction of GFP-
2-chimaerin distributed to a perinuclear region. We also observed faint plasma membrane staining upon PMA treatment (Figs. 6A and
7). No translocation was observed upon
treatment of cells with the inactive PMA isomer 4
-PMA (Fig.
6A). Similar results were observed in immunofluoresence
studies with
2-chimaerin nonfused to GFP using an
anti-
2-chimaerin antibody (data not shown).

View larger version (62K):
[in a new window]
Fig. 6.
Subcellular localization of
2-chimaerin and mutants. COS-1 cells were
transfected with pEGFP-
2-chimaerin (A) or the different
2-chimaerin mutants (B) in pEGFP vector. Cells were
treated 48 h later with different analogs (3 µM, 30 min) in the presence of the PKC inhibitor GF109203X (5 µM). Cells were then fixed with 3.7% formaldehyde and
visualized by fluorescent microscopy. A representative experiment is
shown. Two additional experiments gave similar results.

View larger version (29K):
[in a new window]
Fig. 7.
Localization of
2-chimaerin in the Golgi. COS-1 cells were
transfected with pEGFP-
2-chimaerin and 48 h later treated with
PMA (3 µM, 30 min). Cells were then fixed with 3.7%
formaldehyde and visualized by confocal microscopy. A, green
fluorescent signal from GFP-
2-chimaerin. B, red
fluorescent signal from BODIPY TR ceramide. C,
overlapped images. A representative experiment is shown. Two additional
experiments gave similar results.
2-chimaerin. Experiments
using bryostatin 1, the 12-deoxyphorbol ester 12-deoxyphorbol
13-phenyacetate, and (
)-octylindolactam V revealed similar
perinuclear localization of
2-chimaerin in all cases (Fig.
6A). In agreement with our Western blot studies, thymeleatoxin was unable to translocate GFP-
2-chimaerin to the perinuclear region, thereby confirming the lack of an effect for this derivative.
2-chimaerin mutants previously described. In agreement with the
fractionation analysis (Fig. 3), the point mutant C246A-
2-chimaerin retained its cytoplasmatic localization after PMA treatment (Fig. 6B). Likewise, the
2-chimaerin GAP domain was
unresponsive to PMA. The presence of a functional C1 domain confers
responsiveness, as shown with GFP-
2-C1-GAP. Interestingly, the
mutant expressing the N-terminal region of
2-chimaerin
(GFP-
2-N-C1) was localized to the perinuclear region either in the
absence or presence of PMA treatment. This is in agreement with the
Western blot results showing that this mutant was fully localized to
the particulate fraction even in the absence of phorbol ester treatment
(Fig. 3).
2-chimaerin translocated after phorbol ester treatment, cells were
treated with BODIPY TR ceramide, a red fluorescent probe that
specifically labeled the Golgi network. This probe has been previously
used to determine the Golgi localization of PKC
after activation
(27). We evaluated co-localization of GFP-
2-chimaerin before and
after PMA treatment. As illustrated in Fig.
8, GFP-
2-chimaerin shows some degree
of co-localization with the Golgi marker in the absence of PMA
treatment. However, a marked increase in co-localization in the
perinuclear region was observed after PMA treatment, as judged by
superposition of the images. The mutant GFP-
2-N-C1, which was
localized to the perinuclear region even in the absence of PMA,
co-localized with BODIPY TR ceramide without and with PMA treatment
(data not shown). Our results demonstrate that PMA induces the
translocation of
2-chimaerin to the Golgi network.

View larger version (10K):
[in a new window]
Fig. 8.
Rac-GAP activity of
2-chimaerin. A, purified Rac was
incubated with [
-32P]GTP, and then purified
2-chimaerin (8) was added to loaded Rac. GTP hydrolysis was measured
4 min after the addition of
2-chimaerin. The reaction was carried
out at 15 °C as described in Ref. 25. Results are expressed as the
percentages of [
-32P]GTP remaining relative to that in
the absence of
2-chimaerin. B, GTP hydrolysis was
assessed after 4 min (at 15 °C) in the presence of 100 µg/ml
phospholipid vesicles having variable proportions of phosphatidylserine
(the remaining phospholipid is neutral phosphatidylcholine) and 1 ng/µl
2-chimaerin. Two additional experiments gave similar
results.
2-Chimaerin--
It has previously been
demonstrated that
1-chimaerin has RacGAP activity, and, therefore,
it accelerates the hydrolysis of GTP from Rac (31). As shown in Fig.
8A,
2-chimaerin also accelerates the hydrolysis of GTP
from Rac in a concentration-dependent manner. No effect of
2-chimaerin on Cdc42 or RhoA was observed (data not
shown).4 Interestingly, when
we performed similar assays in the presence of phospholipid vesicles,
we observed a marked increase in GAP activity of
2-chimaerin (1 ng/µl) as the concentration of phosphatidylserine in the vesicles
increases (Fig. 8B). Phosphatidyserine did not induce any
changes in GTP hydrolysis in the absence of
2-chimaerin (data not
shown). A similar effect was observed with other acidic phospholipds,
such as phosphatidic acid, but not with neutral phospholipids, such as
phosphatidylethanolamine.4 Therefore, the Rac-GAP activity
of chimaerins is regulated by its association to lipids.
2-Chimaerin to Rac--
We
hypothesize that regulation of
2-chimaerin by phorbol esters may
promote its association to Rac. A similar model has been documented for
PKC isozymes, where phorbol esters promote translocation of PKCs and
their association to PKC regulatory proteins and substrates (4). To
evaluate the association of Rac with
2-chimaerin, COS-1 cells were
co-transfected with expression vectors for GST-Rac (or GST alone) and
2-chimaerin. GST-Rac (or GST) from cell extracts was then bound to
glutathione-Sepharose 4B beads, and the presence of
2-chimaerin in
the beads was evaluated by Western blot with an anti-
2-chimaerin
antibody (Fig. 9). Association of Rac
with
2-chimaerin was not detected in nonstimulated cells. In
contrast, treatment of COS-1 cells with PMA for 1 h markedly
increased the amount of
2-chimaerin associated to GST-Rac. No
association to GST alone was found either in the absence or presence of
PMA. Therefore, phorbol esters promote the association of
2-chimaerin with its effector Rac in cells.

View larger version (16K):
[in a new window]
Fig. 9.
Association of
2-chimaerin and Rac. COS-1 cells were
transfected with different vectors as described in the figure. 48 h after transfection cells were treated for 1 h with PMA (3 µM) in the presence of the PKC inhibitor GF 109203X (5 µM). Cells were lysed and incubated with
glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) for 2 h at 4 °C to bind GST or GST-Rac. Beads were washed with lysis
buffer, resuspended in Laemmli's sample buffer and boiled. Samples
were subject to Western blot and probed with either an
anti-
2-chimaerin antibody or an anti-GST antibody. Similar results
were observed in two additional experiments.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1-chimaerin is activated
by acidic phospholipids such as phosphatidylserine (31). In this paper
we have observed a similar activation of
2-chimaerin by this acidic
phospholipid. Therefore, as described for cPKCs and nPKCs, the
association of
2-chimaerin to membrane phospholipids regulates its
activity. In preliminary experiments we observed that phorbol esters do
not promote RacGAP activity of
2-chimaerin in vitro and
that they do not change the phosphatidylserine requirement for GAP
activity.4 Although a small degree of activation of RacGAP
activity by phorbol esters has been reported for
1-chimaerin (31),
our results suggest that phorbol esters are responsible for targeting
2-chimaerin to membranes rather than triggering its allosteric
activation. Our observation that
2-chimaerin associates with Rac
upon phorbol ester treatment suggests that translocation of
2-chimaerin may be a key event in the regulation of Rac activity. We
have also observed that
2-chimaerin does not affect GTP hydrolysis
from Cdc42 or RhoA, and in addition it inhibits Rac-GTP levels upon stimulation of the EGF receptor in COS-1 cells, an indication that
2-chimaerin has RacGAP activity not only in vitro but
also in cells.4
fused to GFP
have shown that this domain was capable of translocating to membranes
(35). The notion that a single C1 domain is sufficient to confer
translocation is supported by studies showing that functional
inactivation of a single C1 domain in PKC
or PKC
renders mutant
PKCs that are still able to translocate upon phorbol ester stimulation
(36, 37). However, these mutants having a single functional C1 domain
require higher phorbol ester concentration for translocation, as
observed with
2-chimaerin. Therefore, two C1 domains may account for
the full responsiveness for PKC translocation by phorbol esters. Our
studies do not rule out the possibility that the reduced sensitivity of
2-chimaerin for translocation compared with PKCs is related to the
absence of other domains present in PKC that are involved in
protein-lipid and/or protein-protein interaction, such as the C2 domain.
2-chimaerin associates with a perinuclear
compartment upon phorbol ester activation. Co-staining with a specific
Golgi marker reveals a Golgi localization for
2-chimaerin. It has
been previously reported that PKC
and PKC
translocate to the
Golgi network upon treatment with phorbol esters or DAGs (28, 38-41).
Translocation of PKC
to the Golgi is mediated by its C1 domains (38)
and involves the association with the coatomer protein
'-COP, a
Golgi protein that acts as an intracellular receptor for PKC
(39).
Interestingly, the novel phorbol ester receptor Munc13 also
translocates from the cytosol to the Golgi apparatus after phorbol
ester stimulation (42). In support of our localization studies, it was
reported that
1-chimaerin regulates Golgi stability during
interphase (43). Others have also described the requirement of a
PKC-like molecule without phosphorylating activity for the production
of post-Golgi vesicles (44). Association of PKCs to other organelles
including mitochondria, lysosomes, and endoplasmic reticulum has also
been reported (45-47). In analogy with the models proposed for PKC
isozymes, translocation of chimaerins may involve protein-protein
interaction mechanisms. In fact, we have recently isolated a chimaerin
interacting protein (Tmp21 or p23) using the yeast two-hybrid
system.5 This protein is
expressed in the Golgi apparatus and endoplasmic reticulum. Remarkably,
the association of
2-chimaerin and p23 in cells is markedly enhanced
by phorbol ester treatment, suggesting that mechanisms of
protein-protein interaction similar as those described for PKC isozymes
can dictate the intracellular localization of chimaerins. It may be
possible that, upon activation, a conformational change in
2-chimaerin occurs that exposes the protein-protein interacting
sites, as also described for PKC isozymes. The domain in chimaerins
interacting with p23 is in the N-terminal region,5 which
may explain the constitutive association of the mutant
2-N-C1 to the
perinuclear region. It is important to mention that a large pool of
intracellular Rac, the target for chimaerins, is located in a
perinuclear region and kept in an inactive state (48). An attractive
hypothesis is that chimaerins may play a role in the maintenance of
this small GTP-binding protein in an inactive, GDP-bound state at the
perinuclear compartment. These important issues are currently being
investigated in our laboratory.
2-chimaerin. We have previously
reported that PKC ligands have a unique pattern for binding to this
RacGAP protein (8). Remarkably, each receptor class (i.e.
PKC isozymes, Unc-13, RasGRP, and chimaerins) interacts differently
with phorbol esters and related analogs (6, 8, 9, 11, 49). Clearly,
specific residues within the individual C1 domains confer unique
properties to each receptor class. This is not surprising, because
marked differences in ligand selectivity have been shown for individual
C1 domains. Potent ligands for one C1 domain may be either weak ligands
or may not bind at all to other C1 domains, such as the C1 domains of
PKC
, Vav, or Raf (6, 50, 51). These striking differences have been
reported even for the C1a and C1b domain of a single PKC isozyme, such as PKC
, PKC
, or PKCµ, providing strong evidence that C1 domains are nonequivalent (6). Structural and biochemical studies with individual C1 domains have confirmed that these marked differences for
ligand recognition exist, as described for unrelated ligands such as
indolactams, DAGs, and certain phorbol ester analogs (17, 34, 50,
52). In fact, a detailed structure-activity analysis of
2-chimaerin
revealed unique binding properties for this novel phorbol ester
receptor. The 60-fold difference in binding affinity for thymeleatoxin
between PKC
and
2-chimaerin is the highest reported so far for
two individual phorbol ester receptors. Although mutagenesis studies
within the
2-chimaerin C1 domain have yet to be done, our modeling
analysis with thymeleatoxin has revealed distinct binding recognition
for PKC
and
2-chimaerin. It is also remarkable that thymeleatoxin
is very potent in translocating PKC
but poorly translocates
chimaerin isoforms. To our knowledge, this is the first example of a
selective ligand for phorbol ester receptors, a finding that will be
valuable for dissecting the biological functions of each receptor class.
| |
FOOTNOTES |
|---|
* This work was supported by American Cancer Society Grant RPG-97-092-04-CNE and National Institutes of Health Grant RO1-CA74197-01.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Center for Experimental Therapeutics, University of Pennsylvania School of Medicine, 816 Biomedical Research Bldg. II/III, 421 Curie Blvd., Philadelphia, PA 19104-6160. E-mail: marcelo@spirit.gcrc.upenn.edu.
Published, JBC Papers in Press, February 14, 2001, DOI 10.1074/jbc.M011368200
2
Binding affinities of (
)-octylindolactam V for
PKC
and
2-chimaerin, as determined by the polyethylene glycol
precipitation method (8), are 0.5 ± 0.1 nM
(n = 3) and 1.4 ± 0.1 nM
(n = 3), respectively (M. J. Caloca and M. G. Kazanietz, unpublished observations).
3
For the purposes of this paper, we numbered the
residues in the C1 domains from 1 to 50, as reported in Ref. 34.
Residue 1 in
2-chimaerin C1 domain corresponds to position 213. Residue 1 in PKC
C1b domain corresponds to position 102.
4 M. J. Caloca and M. G. Kazanietz, manuscript in preparation.
5 H.-B. Wang and M. G. Kazanietz, submitted for publication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PKC, protein kinase C; cPKC, classical PKC; nPKC, novel PKC; DAG, diacylglycerol; GAP, GTPase-activating protein; MD, molecular dynamics; PMA, phorbol 12-myristate 13-acetate; PCR, polymerase chain reaction; GFP, green fluorescent protein; GST, glutathione S-transferase.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Nishizuka, Y. (1995) FASEB. J. 9, 484-496 |
| 2. | Mellor, H., and Parker, P. J. (1998) Biochem. J. 332, 281-292 |
| 3. | Newton, A. C. (1997) Curr. Opin. Cell Biol. 9, 161-167 |
| 4. | Ron, D., and Kazanietz, M. G. (1999) FASEB. J. 13, 1658-1676 |
| 5. | Blumberg, P. M. (1991) Mol. Carcinog. 4, 339-344 |
| 6. | Kazanietz, M. G., Caloca, M. J., Eroles, P., Fujii, T., Garcia-Bermejo, M. L., Reilly, M., and Wang, H. (2000) Biochem. Pharmacol. 60, 1417-1424 |
| 7. | Kazanietz, M. G. (2000) Mol. Carcinog. 28, 5-11 |
| 8. | Caloca, M. J., Fernandez, M. N., Lewin, N. E., Ching, D., Modali, R., Blumberg, P. M., and Kazanietz, M. G. (1997) J. Biol. Chem. 272, 26488-26496 |
| 9. | Kazanietz, M. G., Lewin, N. E., Bruns, J. D., and Blumberg, P. M. (1995) J. Biol. Chem. 270, 10777-10783 |
| 10. | Ebinu, J. O., Bottorff, D. A., Chan, E. Y., Stang, S. L., Dunn, R. J., and Stone, J. C. (1998) Science 280, 1082-1086 |
| 11. | Lorenzo, P. S., Behshti, M., Pettit, G. R., Stone, J. C., and Blumberg, P. M. (2000) Mol. Pharmacol. 57, 840-846 |
| 12. | Jaken, S., and Parker, P. J. (2000) Bioessays 22, 245-254 |
| 13. | Mochly-Rosen, D., and Gordon, A. S. (1998) FASEB. J. 12, 35-42 |
| 14. | Hall, C., Sin, W. C., Teo, M., Michael, G. J., Smith, P., Dong, J. M., Lim, H. H., Manser, E., Spurr, N. K., Jones, T. A., and Lim, L. (1993) Mol. Cell. Biol. 13, 4986-4998 |
| 15. | Leung, T., How, B.-E., Manser, E., and Lim, L. (1993) J. Biol. Chem. 268, 3813-3816 |
| 16. | Leung, T., How, B.-E., Manser, E., and Lim, L. (1994) J. Biol. Chem. 269, 12888-12892 |
| 17. | Caloca, M. J., García-Bermejo, M. L., Blumberg, P. M., Lewin, N. L., Kremmer, E., Mischak, H., Wang, S., Nacro, K, Bienfait, B., Marquez, V. E., and Kazanietz, M. G. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 11854-11859 |
| 18. | Areces, L. B., Kazanietz, M. G., and Blumberg, P. M. (1994) J. Biol. Chem. 269, 19553-19558 |
| 19. | Pak, Y., and Wang, S. (2000) J. Phys. Chem. B 104, 354-359 |
| 20. | Brooks, B. R., Bruccoleri, R. E., Olafson, B. D., States, D. J., Swaminathan, S., and Karplus, M. (1993) J. Comput. Chem. 4, 187-217 |
| 21. | MacKerell, A. D., Jr., Bashford, D., Bellott, M., Dunbrack, R. L., Jr., Evanseck, J. D., Field, M. J., Fisher, S., Gao, J., Guo, H., Ha, S., Joseph-McCarthy, D., Kuchnir, L., Kuczera, K., Lau, F. T. K., Mattos, C., Michnick, S., Ngo, T., Nguyen, D. T., Prodhom, B., Reiher, W. E., III, Roux, B., Schlenkrich, M., Smith, J. C., Stote, R., Straub, J., Watanabe, M, Wiorkiewicz-Kuczera, J., Yin, D., and Karplus, M. (1998) J. Phys. Chem. B 102, 3586-3616 |
| 22. | Zhang, G., Kazanietz, M. G., Blumberg, P. M., and Hurley, J. H. (1995) Cell 81, 917-924 |
| 23. | Berendsen, H. J. C., Postma, J. P. M., van Gunsteren, W. F., Di Nola, A., and Haak, J. R. (1984) J. Chem. Phys. 81, 3684-3690 |
| 24. | Ryckaert, J. P., Ciccotti, G., and Berendsen, H. J. C. (1977) J. Comput. Phys. 23, 327-341 |
| 25. | Garrett, M. D., Self, A. J., van Oers, C., and Hall, A. (1989) J. Biol. Chem. 264, 10-13 |