JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M011472200 on March 12, 2001

J. Biol. Chem., Vol. 276, Issue 22, 18836-18842, June 1, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/22/18836    most recent
M011472200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shinkai, A.
Right arrow Articles by Loeb, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shinkai, A.
Right arrow Articles by Loeb, L. A.

The Conserved Active Site Motif A of Escherichia coli DNA Polymerase I Is Highly Mutable*

Akeo Shinkai, Premal H. Patel, and Lawrence A. LoebDagger

From the Joseph Gottstein Memorial Cancer Research Laboratory, Department of Pathology, University of Washington, Seattle, Washington 98195-7705

Received for publication, December 20, 2000, and in revised form, March 8, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Escherichia coli DNA polymerase I participates in DNA replication, DNA repair, and genetic recombination; it is the most extensively studied of all DNA polymerases. Motif A in the polymerase active site has a required role in catalysis and is highly conserved. To assess the tolerance of motif A for amino acid substitutions, we determined the mutability of the 13 constituent amino acids Val700-Arg712 by using random mutagenesis and genetic selection. We observed that every residue except the catalytically essential Asp705 can be mutated while allowing bacterial growth and preserving wild-type DNA polymerase activity. Hence, the primary structure of motif A is plastic. We present evidence that mutability of motif A has been conserved during evolution, supporting the premise that the tolerance for mutation is adaptive. In addition, our work allows identification of refinements in catalytic function that may contribute to preservation of the wild-type motif A sequence. As an example, we established that the naturally occurring Ile709 has a previously undocumented role in supporting sugar discrimination.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Escherichia coli DNA polymerase I (pol I)1 is a multifunctional enzyme with roles in DNA replication, DNA repair, and genetic recombination (1). The first recognized and most thoroughly investigated of all DNA polymerases, it is key to our understanding of how DNA polymerases function as protein catalysts and as central enzymes in DNA metabolism. It belongs to one of six families of DNA polymerases, defined on the basis of amino acid sequence comparisons (2-4): family A (e.g. E. coli pol I, Thermus aquaticus (Taq) pol I, Bacillus stearothermophilus pol I, and T7 DNA polymerase), family B (e.g. DNA polymerase alpha  and RB69 DNA polymerase), reverse transcriptase (e.g. human immunodeficiency virus reverse transcriptase, and murine leukemia virus reverse transcriptase), family X (e.g. DNA polymerase beta ), the pol III family, and the UmuC/DinB family (e.g. DNA polymerase eta ). Crystal structures of representative enzymes from the first four families have been determined, revealing a common overall architecture that has been likened to a human right hand, with fingers, thumb, and palm subdomains (5-9). Although the structures of the fingers and thumb subdomains vary considerably, the catalytic palm subdomains are all superimposable (10, 11). The palm subdomain includes two conserved sequences, motif A and motif C, each harboring a catalytically essential aspartic acid residue. Essential roles of motif A in catalysis include interaction with the incoming dNTP and coordination with two divalent metal ions that are required for the polymerization reaction (12-15). Motif A begins at an anti-parallel beta -strand containing predominantly hydrophobic residues and is followed by a turn and an alpha -helix. Although there is considerable variation in the amino acid sequence of the anti-parallel beta -strand, the sequence of the turn and helix, DYSQIELR, is nearly invariant among known prokaryotic family A polymerases (16).2

In a recent study of Taq pol I, we observed substantial mutability of motif A (17). This plasticity was surprising when one considers the essentiality of DNA polymerases and the marked conservation of motif A within prokaryotic DNA polymerases. To determine whether or not the plasticity within motif A was a property of DNA polymerases, we examined the mutability of motif A in E. coli pol I. We found that E. coli pol I also tolerated multiple substitution within motif A. Moreover, the overall pattern and the type of substitutions were similar to those of Taq pol I. Our results indicate that the mutability of motif A has been conserved in natural evolution and support the premise that toleration of mutation may be an important feature for the overall fitness of DNA polymerase active sites.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Construction of the pol I Random Mutant Library-- The pol I gene (polA) of E. coli DH5alpha was amplified by colony polymerase chain reaction with 5'-ATATATATAAGCTTATGGTTCAGATCCCCCAAAATCCACTTATC-3' and 5'-ATATATATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT-3' as primers. The 3-kilobase pair amplified fragment was digested with HindIII and EcoRI and then cloned under the lactose promoter into pHSG576, a low copy number plasmid that has a pol I-independent origin (18), to create pECpol I. Site-directed mutagenesis was performed on pECpol I to introduce silent mutations C to A at position 2,067 and G to C at position 2,214 of the polA gene (19) to create AccI and EagI sites, respectively, that flank the sequence encoding motif A. The resulting plasmid was named pECpol IS. To avoid contamination with incompletely cut vectors when preparing the random library, a nonfunctional stuffer vector, pECpoldum, was constructed by replacing the AccI-EagI 130-base pair fragment of polA with an oligonucleotide fragment (5'-ATACGATCGATCTGCAGCGATCC-3' and 5'-GGCCGGATCGCTGCAGATCGATCGT-3').

The pol I random library was constructed by annealing two single-stranded DNA oligonucleotides containing segments with random sequences: Oligo 1 was a 104-mer corresponding to the sense nucleotides 2,053-2,156, and containing an AccI site for cloning (5'-GAAGGTCGTCGTATACGCCAGGCGTTTATTGCGCCAGAGGATTAT[GTGATTGTCTCAGCGGACTACTCGCAGATTGAACTGCGC]ATTATGGCGCATCTTTCGCG-3'); Oligo 2 was an 89-mer corresponding to antisense strand nucleotides 2,225-2,137 and containing an EagI site (5'-AACACTTCTGCGGCCGTTGCCCGGTGGATATCTTTTCCTTCCGCGAATGCGGTCAGCAAGCCTTTGTCACGCGAAAGATGCGCCATAAT-3'). The bracketed nucleotides in Oligo 1 were synthesized to contain 88% wild-type nucleotide and 4% each of the other three nucleotides at every position. The 20-base pair complementary regions of hybridization are underlined. Oligo 1 and Oligo 2 were annealed at their nonrandom complementary regions by mixing 250 pmol of each in 20 µl of H2O and heating to 95 °C for 5 min, followed by cooling for 2 h to room temperature. The partially duplex oligonucleotide was extended by incubation with 50 units of E. coli pol I Klenow fragment (New England BioLabs, Beverly, MA) for 2 h at 37 °C in a 0.3-ml reaction mixture containing 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 7.5 mM DTT, and 0.5 mM of all four dNTPs. The resulting DNA was digested with AccI and EagI, purified, and inserted into pECpoldum in place of the stuffer fragment. Plasmids containing the random library were transformed into E. coli XLIBlue, and the number of transformed cells was determined by plating an aliquot onto LB agar plates containing 30 µg/ml of chloramphenicol. The remainder of the library was amplified by growing the transformed E. coli XLIBlue in 3 liters of 2× YT medium for 16 h at 37 °C, and the random library, pECpolLib, was then purified.

Genetic Selection for Active Mutants-- E. coli JS200 (recA718polA12) (20, 21) was transformed with plasmids pHSG576, pECpol IS, pECpoldum, and pECpolLib. Thereafter, 1 ml of nutrient broth containing 0.4% NaCl was added, and the cells were incubated for 1 h at 37 °C. A small fraction of the mixture was then plated in duplicate onto nutrient agar plates containing 0.4% NaCl, 12.5 µg/ml tetracycline, and 30 µg/ml chloramphenicol; one plate was incubated at 30 °C, and the other was incubated at 37 °C overnight, and the resulting colonies were counted. Only paired samples containing less than 1,500 colonies at 30 °C were analyzed because dense plating of the cells leads to elevated background at 37 °C.

DNA Sequence Analysis of the Motif A Region-- Plasmids carrying the mutant pol I gene were prepared, and the 0.6-kilobase pair region covering the motif A region was amplified by polymerase chain reaction with 5'-GATACCATGCTGGAGTCCTACATTC-3' and 5'-ACGGCGTTGCTCGCTGGTGACGGTT-3' as primers. Following purification of the polymerase chain reaction product, the AccI-EagI 130-base pair fragment was sequenced by using 5'-TTATCGTCAACCGATCCTAACCTGCA-3' as a primer.

Preparation of E. coli Cell Extracts-- Recombinant E. coli JS200 cells were cultured at 30 °C in 4 ml of 2× YT medium supplemented with 12.5 µg/ml tetracycline and 30 µg/ml chloramphenicol. At the exponential growth phase (A600 = 0.2-0.5), pol I expression was induced with 1 mM isopropyl-beta -D-thiogalactopyranoside. After further incubation for 4 h (A600 = 2), cells from 1.5 ml of culture were collected, washed with 1 ml of 20 mM sodium phosphate (pH 7.2), suspended in 0.1 ml of the same buffer, and 5 µl of 10 mg/ml lysozyme was added. The cells were disrupted by freezing at -80 °C for 16 h and thawing on ice for 2 h. The cell extract was collected by centrifugation at 15,000 rpm for 15 min.

DNA and RNA Polymerase Assays-- DNA polymerase activity was measured at 42 °C for 10 min in 20-µl reaction mixtures containing 0.1 µg of gapped calf thymus DNA (22), 12.5 µM each dNTP, 50 nM [alpha -32P]dTTP (3,000 Ci/mmol; PerkinElmer Life Sciences), and 2 µl of cell extract in 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 7.5 mM DTT. The reaction was terminated by addition of 0.5 ml of 10% trichloroacetic acid followed by 0.1 ml of 0.1 M sodium pyrophosphate. The 32P-labeled DNA was collected onto glass fiber filters, and radioactivity was measured by using scintillation counter as described (23). The assay for RNA polymerase activity was the same, except 12.5 µM rGTP was substituted for dGTP.

Construction of High Copy Number Vectors for HisKlenow(exo-) Expression-- Site-directed mutagenesis was performed on pECpol IS to introduce an A to C transversion at position 1,271, changing the corresponding Asp424 to Ala and inactivating the 3'-exonuclease activity (24). Then, with this plasmid as a template and 5'-CAGACGAACATATGCACCATCATCACCATCACATTTCTTATGACAACTACGTCACCATCCTTGAT -3' and 5'-ATATATATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT-3' as primers, polymerase chain reaction was performed to construct the HisKlenow(exo-) gene. The amplified fragment was digested with NdeI and EcoRI and cloned under the lambda PL promoter of pLEX (Invitrogen, Carlsbad, CA). High expression vectors for mutant pol I proteins were constructed by substituting the 1.1-kilobase pair SacI-EcoRI fragment of the wild-type pol I gene on the expression vector with the corresponding fragment of the mutant gene.

Expression and Purification of HisKlenow(exo-) Proteins-- Recombinant HisKlenow(exo-) proteins were expressed and purified by using the PL Expression System (Invitrogen), and His-Bond kits (Novagen, Madison, WI), respectively, essentially according to the manufacturer's directions. The expression plasmid was introduced into E. coli GI724 (F-, lambda -, lacIq, lacPL8, ampC::Ptrp cI, mcrA, mcrB, INV(rnnD-rnnE)), and cells were grown at 30 °C in 40 ml of induction medium composed of 1× M9 salts, 0.2% casamino acids, 0.5% glucose, 1 mM MgCl2, and 100 µg/ml ampicillin. When an A550 of 0.5 was attained, tryptophan was added to a final concentration of 100 µg/ml, and the culture was incubated at 37 °C for a further 4 h. The cells were collected by centrifugation, washed with 40 ml of phosphate-buffered saline, and suspended in 4 ml of 1× binding buffer (5 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) containing 200 µg/ml lysozyme and 0.5 mM phenylmethylsulfonyl fluoride. Extracts were prepared by freezing at -80 °C for 16 h and thawing on ice for 2 h, followed by centrifugation at 15,000 rpm for 15 min. The extract was then applied to a 1-ml Ni2+-resin column, washed with 10 ml of 1× binding buffer, and eluted with buffer composed of 60 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9. The eluted sample was concentrated to ~1 mg/ml by using a Centricon-30 microconcentrator (Amicon, Beverly, MA), diluted with an equal volume of glycerol containing 2 mM DTT, and stored at -80 °C. Protein concentrations were determined by the method of Bradford (25).

Kinetic Analysis of Nucleotide Incorporation-- A steady-state kinetic analysis was performed based on the method of Boosalis et al. (26). A 47-mer template (3'-GCGCGGCTTAAGGGCGATCGTTATAGCTTAAGGCCTTTAAAGGGCCC-5') was hybridized with one of four 5'-32P end-labeled primers: the 23-mer (5'-CGCGCCGAATTCCCGCTAGCAAT-3'), the 24-mer (5'-CGCGCCGAATTCCCGCTAGCAATA-3'), the 25-mer (5'-CGCGCCGAATTCCCGCTAGCAATAT-3'), or the 26 mer (5'-CGCGCCGAATTCCCGCTAGCAATATC-3'). Primer/template (5 nM) was incubated for 5 min at 37 °C in a reaction mixture containing limiting amounts of HisKlenow(exo-) protein and varying concentrations of each dNTP or rNTP in 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 7.5 mM DTT. The ranges of nucleotide substrate concentrations used were 0.5-10 nM for dNTP incorporation, 0.5-17.5 µM for rNTP incorporation by the wild type and E710D mutant, and 2.5-400 nM for rNTP incorporation by the I709F mutant. Following termination of the reaction by addition of 2.5 µl of formamide solution, the products were analyzed by 14% PAGE and quantified by PhosphorImager analysis (27).

RNA Synthesis-- The 47-mer template and 5'-32P end-labeled 24-mer primer used for kinetic analysis of rNTP incorporation were hybridized and incubated at 37 °C for 5-60 min in 10-µl reaction mixtures containing 50 nM HisKlenow(exo-) protein and 1 µM each of all four rNTPs in 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 0.5 mM MnCl2, 7.5 mM DTT. After the reaction was terminated by the addition of 2.5 µl of formamide solution, the products were analyzed by 14% PAGE followed by autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Creation and Genetic Selection of Motif A Mutants-- We used random sequence mutagenesis to create substitutions within the 13 contiguous amino acids comprising motif A of E. coli pol I (Val700-Arg712). We then selected functional mutants in E. coli JS200 (recA718 polA12), a strain that contains a temperature-sensitive mutation in the pol I gene (polA) and can be propagated at 30 °C but not at 37 °C (20, 21). Recombinant wild-type polA was able to fully complement the temperature-sensitive phenotype, such that E. coli JS200 harboring the plasmid pECpol IS exhibited a 100% survival rate at 37 °C relative to 30 °C. The recombinant strain carrying pECpoldum, a nonfunctional stuffer vector, showed a 0.5% survival rate at 37 °C, indicating that the background for our complementation-based selection assay was 0.5%.

The randomly mutated E. coli pol I library consisted of 500,000 independent clones. DNA sequencing of 26 unselected clones indicated that the average number of amino acid changes within motif A was three. The unselected library included 10% dummy vectors, and 40% of the clones had a deletion and/or insertion within or outside of motif A, which may have been introduced in the process of library construction. Following transformation of the library into E. coli JS200, 8% of the clones formed colonies at 37 °C, relative to 30 °C. After subtracting the background, we estimated that there were 37,500 independent clones encoding active pol I proteins.

Analysis of Selected Motif A Mutants-- To establish the spectrum of mutations that restored growth of E. coli JS200, we randomly picked 280 colonies that grew at 37 °C, assayed the DNA polymerase activity in cell extracts at 42 °C, isolated the plasmids, and sequenced the 0.15-kilobase pair linker portion containing the 39-base pair randomized region. DNA polymerase activity in extracts of E. coli JS200 carrying the parent plasmid pHSG576 or the stuffer vector pECpoldum was 1-4% of that in extracts of cells carrying pECpol IS that expresses wild-type E. coli pol I, indicating that the background polymerase activity is 1-4% (data not shown). We found three clones carrying pECpoldum that exhibited higher activity than clones harboring the original pECpoldum, i.e. 20-25% of wild-type pol I activity; we did not observe complementation when fresh JS200 cells were retransformed by these three stuffer vectors, indicating that the growth observed at 37 °C was likely due to mutation of the host cells. Twelve clones showed very low activity, less than 10% that of clones carrying pECpol IS. Of the 280 total clones, we estimated that 17-18 should represent background, in that 8% of the total library form colonies at 37 °C and 0.5% of the total library are false positives. Therefore, we attributed the 15 clones just described to background and did not analyze them further. Of the remaining 265 clones, 32 had 1 amino acid substitution and 1 had a deletion of 2 amino acids, all of which were outside of motif A; these clones were also not further investigated. No frameshift mutations were observed among the 280 selected clones.

The remaining 232 selected, active mutants harbored one to five amino acid substitutions within motif A. As illustrated in Fig. 1A, the average number of mutations was 1-2. The levels of DNA polymerase activity in extracts of the mutants are shown in Fig. 1B, as a function of the number of amino acid changes. 70% of the 232 mutants retained DNA polymerase activity comparable with that of wild type (within 60%-200%), including almost all of the single mutants and even six of the ten mutants with four amino acid replacements. Moreover, 36% of mutants exhibited activity equal to or greater than the wild type. The number of mutants exhibiting moderate (30-60% of wild type) or low (10-30% of wild type) activity followed a Poisson distribution relative to the number of amino acid substitutions, with a median of two or three amino acid substitutions per clone.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Amino acid substitutions in motif A of 232 genetically selected, active E. coli pol I mutants. Mutations were introduced into the 13 codons encoding motif A in the plasmid-borne pol I gene by using random sequence mutagenesis. Active mutants were then isolated by positive genetic selection for variants that complemented the temperature-sensitive growth phenotype of an E. coli strain harboring a temperature-sensitive endogenous pol I. A, distribution of amino acid substitutions in clones that exhibited >10% of wild-type DNA polymerase activity in an in vitro assay, relative to the number of amino acid changes. B, distribution of DNA polymerase activity in extracts of cells expressing pol I mutants, relative to the number of the amino acid changes. The vertical bars indicate the level of DNA polymerase activity relative to wild type, as follows: black with horizontal stripes, 100%-200%; stippled, 60%-100%; diagonal stripes, 30%-60%; solid, 10%-30%. Wild-type activity is that observed in extracts of cells expressing wild-type pol I.

In Fig. 2 the amino acid substitutions observed in the selected active clones with one (Fig. 2A), two (Fig. 2B), or three to five (Fig. 2C) mutations in motif A are shown; the distribution of mutations was similar in the three groups. Six motif A residues (Val700, Val702, Ser703, Ala704, Ser707, and Gln708) tolerated a wide spectrum of substitutions, whereas six others (Ile701, Tyr706, Ile709, Glu710, Leu711, and Arg712) tolerated predominantly conservative substitutions, and only the catalytically essential residue Asp705 was immutable. Glu710 was substituted solely by Asp, indicating that negative charge at this position may be indispensable for polymerase activity in vivo. DNA polymerase activity in extracts of the 53 different mutants with a single amino acid replacement is indicated in Fig. 3. Interestingly, most single mutants with a replacement within the N-terminal 5 amino acids, which form a strand of the structurally conserved anti-parallel beta -sheet, exhibited higher than wild-type activity. In contrast, activity tended to be reduced when the C-terminal alpha -helix region, whose primary structure is practically invariant in the prokaryotic pol I family, was mutated. Thus, even though both the N- and C-terminal portions of motif A are highly mutable, the effects on catalytic activity differ.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 2.   Amino acid substitutions observed in motif A of selected, active pol I mutants harboring one (A), two (B), or three to five (C) amino acid changes. Amino acid substitutions at each residue are listed in alphabetical order from top to bottom, along with the number of times each substitution was observed.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   DNA polymerase activity of pol I mutants with single amino acid substitutions in motif A. Substitutions at each residue are listed alphabetically from top to bottom, followed by DNA polymerase activity, relative to wild type. Polymerase activity in cell extracts was assayed at 42 °C by measuring the incorporation of [alpha -32P]dTTP into gapped calf thymus DNA. Mutant activities are expressed relative to wild type (1.0), i.e. the activity observed in extracts of cells expressing recombinant wild-type pol I.

Effect of Motif A Mutations on rNTP Discrimination-- The foregoing results indicate that the primary structure of motif A in E. coli pol I is plastic and that mutations in motif A can be associated with a high degree of biologic and catalytic function. To assess how the highly functioning variant pol I might differ from wild type catalytically, we tested all 53 different single mutants shown in Fig. 3 for altered sugar selectivity. We did this by substituting rGTP for dGTP in the standard DNA polymerase assay. Wild-type pol I exhibited poor incorporation of rGTP in this assay, as did all the single mutants except the four having an Ile709 to Met, Asn, Phe, or Ala substitution (Fig. 4 and data not shown). Mutants carrying a I709S substitution, such as I701M/A704G/I709S and V700A/L711V/I709S, also exhibited efficient incorporation of rGTP. In contrast, neither the single mutant E710D nor additional mutants such as I701V/V702I/E710D and I709V/E710D/R712S were effective in incorporating rGTP (data not shown).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4.   Incorporation of ribonucleotides by wild-type and mutant pol I with single amino acid substitutions at I709 or E710. Polymerase activity in cell extracts was measured in assay mixtures containing gapped calf thymus DNA as a template-primer and either four dNTPs (dG, dA, dC, and dT) (diagonally striped bars), three dNTPs (dA, dC, and dT) (open bars), or three dNTPs plus rGTP (solid bars). The amount of [alpha -32P]dTTP incorporated into DNA is shown. dum, cells expressing the noncomplementing dummy plasmid pECpoldum; WT, wild type.

We chose the single mutant I709F, which showed the most efficient rNTP incorporation, for detailed analysis of rNTP discrimination. We also analyzed E710D as a reference enzyme; E710D did not exhibit enhanced rNTP incorporation but has displayed modestly reduced discrimination against rNTPs in other assays (28). To eliminate the possibility of proof-reading by the 3'-5' exonuclease activity of E. coli pol I, we constructed exonuclease-deficient derivatives of the Klenow fragment (24), containing an intact polymerase domain. The wild-type and mutant Klenow fragments were expressed in E. coli as N-terminal hexahistidine fusion proteins (HisKlenow(exo-)) and purified by one-step nickel affinity chromatography. The wild-type, I709F, and E710D preparations each yielded a single band of ~68 kDa in SDS-polyacrylamide gels (Fig. 5); the estimated purity was >= 95% in all cases, and importantly, no bands of 109 kDa (the molecular mass of endogenous pol I) were detected.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 5.   SDS-PAGE analysis of purified Klenow fragment derived from wild-type (WT), I709F, and E710D pol I. Exonuclease-minus Klenow fragments were constructed as described under "Experimental Procedures" and expressed in E. coli as N-terminal hexahistidine fusions. The proteins were purified on nickel resin columns and analyzed by SDS-PAGE followed by Coomassie Brilliant Blue R-250 staining. M, molecular mass markers.

We used a steady-state, gel-based assay employing oligonucleotide primer templates (26) to analyze the kinetics of rNTP incorporation by the purified exonuclease-deficient Klenow fragments. The wild-type and mutant proteins showed typical Michaelis-Menten saturation kinetics when initial velocity was plotted against the concentration of either rNTP or dNTP (data not shown). The parameters Km and Vmax were derived by hyperbolic curve fitting and were used to calculate kcat, catalytic efficiency, and rNTP/dNTP discrimination factors (Table I). The catalytic constant kcat was obtained by dividing Vmax by the enzyme concentration. The catalytic efficiency, expressed as kcat/Km, is a measure of the efficiency of nucleotide incorporation. The discrimination factor dNTP/rNTP, calculated as the ratio of efficiencies for incorporation of dNTP versus the corresponding rNTP, is a measure of intrinsic enzymatic specificity for the correct sugar. As indicated in Table I, the discrimination against rNTPs exhibited by the wild-type enzyme ranged from 650- to 53,000-fold; the discrimination was associated exclusively with elevated Km values for rNTPs, the rate constants for all substrates being essentially the same. The mutant I709F was indistinguishable from wild type with respect to incorporation of dNTPs, in accord with the near wild-type activity in the standard nucleotide incorporation assay employing gapped DNA and all four dNTPs (Fig. 4). However, the ability of the I709F mutant to discriminate against rNTPs is impaired; the observed discrimination factors ranged from 20- to 80-fold less than wild type, virtually entirely because of decreased Km values for rNTPs relative to the wild-type value. These findings indicate that Ile709 in wild-type pol I functions to exclude ribonucleotides from the genome, at least in part via diminished incorporation of rNTPs. As shown below, the I709F mutant also discriminates against extension of incorporated ribonucleotides less efficiently than the wild-type exo- Klenow fragment. In contrast to the I709F mutation, the E710D substitution had little or no effect on either incorporation of dNTPs or discrimination against rNTPs. These observations are in accord with essentially wild-type activity in both the standard DNA polymerase and ribonucleotide incorporation assays.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Kinetic analysis of dNTP and rNTP incorporation by wild-type and mutant exo- Klenow fragments

Exclusion of rNTPs from DNA involves both discrimination against incorporation of rNTPs and discrimination against extension of DNA chains bearing a 3'-terminal ribonucleotide residue. To assess these two factors concurrently, we examined how well the mutant HisKlenow(exo-) proteins were able to incorporate multiple rNTPs sequentially, i.e. to act as RNA polymerases. To do this, we incubated the proteins with a 5'-32P-labeled DNA primer template in the presence of all four rNTPs. As shown in Fig. 6, the wild-type protein added seven residues to the primer, stopping upon the addition of the two uracil residues; only at 60 min was addition of further nucleotides observed. In contrast, the I709F mutant was able to overcome the barrier comprised of two uracil residues, as well as the downstream barrier comprised of three uracil residues. We conclude that the I709F substitution permits not only more efficient incorporation of rNTPs, but more efficient extension as well. The E710D mutant extended the primer at a slightly greater rate than the wild-type protein, indicative of modestly reduced discrimination against extension of 3'-ribonucleotide termini.


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 6.   RNA synthesis by exonuclease-minus HisKlenow fragments derived from wild-type, I709F, and E710D pol I. A 5'-32P-labeled DNA primer template was incubated with either wild-type (WT), I709F, or E710D HisKlenow(exo-) protein (50 nM) and 1 µM each of all four rNTPs at 37 °C for 5, 10, 15, or 60 min. The products were analyzed by 14% PAGE, followed by autoradiography. Lane n, incubation was for 60 min in the presence of 50 nM wild-type enzyme and no rNTPs. Lane d, incubation was for 15 min in the presence of 50 nM wild-type enzyme and 50 µM of each dNTP. Nucleotides to be incorporated are shown at the right.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Motif A is shared among DNA polymerases (2), is an essential part of the polymerase active site (12-15, 29), and is highly conserved among prokaryotic DNA polymerase A family members (16).2 Interestingly, motif A sequences of modern E. coli strains from around the world were recently found to be identical (17), even though the bacteria divide more than 100 times each year (30), at mutation rates of 10-5/nucleotide/division in mutators (31-33) to 10-9/nucleotide/division in nonmutators (34). Despite this conservation in nature, we show here that motif A in E. coli pol I can tolerate a substantial mutational burden, and most of the 13 constituent amino acids are replaceable, yielding highly competent variant polymerases. E. coli strains harboring active mutant pol I that were selected in a genetic complementation system are fit to replicate repetitively, both in liquid broth and on solid agar at 37 °C. These observations are consistent with biochemical data showing that the mutant proteins possess wild type-like DNA polymerase activity in vitro. We found that only one residue, the catalytically essential Asp705, was immutable; the corresponding residue in Taq pol I coordinates with the two metal ligands required for catalysis (13, 15). Substitution of Glu710 was restricted to Asp; in crystals of a closed ternary complex of T7 DNA polymerase complexed with its substrates (13), the glutamate residue equivalent to Glu710 is hydrogen-bonded with a tyrosine residue in the O-helix within the fingers subdomain. We conclude that a Asp residue at position 705 and a negative charge at position 710 are indispensable for maintaining polymerase activity; this conclusion is in agreement with the deleterious effects of the D705A and E710A substitutions on catalysis (35). Both the N- and C-terminal parts of motif A tolerated a wide spectrum of substitutions. DNA polymerase activity associated with single amino acid substitutions within the N-terminal 5 amino acid residues was as high or higher than that of the wild-type enzyme. These residues form part of an anti-parallel beta -sheet structure that is believed to accommodate the triphosphate moiety of the incoming dNTP and may be a potential target for engineering of pol I derivatives with altered properties. In contrast, amino acid substitutions within the C-terminal five residues tended to be associated with reduced activity.

To further assess variation in catalytic properties among the selected active mutants, we screened them for incorporation of ribonucleotides. Among the 53 amino acid substitutions analyzed, we found that certain substitutions at Ile709 (Phe, Met, Ala and Asn) permit more efficient utilization of rNTPs and that the phenylalanine substitution permitted the most extensive incorporation of rNTPs. The corresponding isoleucine to phenylalanine substitution has so far not been found among random sequence substitutions in Taq pol I (17, 27). The I709F substitution essentially converts E. coli pol I from a DNA-dependent DNA polymerase to an enzyme that can effectively use both DNA and RNA substrates. We conclude that isoleucine at position 709 contributes to sugar discrimination by wild-type pol I and that this function may promote conservation of the wild-type motif A sequence. Based on analysis of a structural model of Taq pol I bound with DNA and an rNTP (27), we infer that the ribose ring of the rNTP interacts with Ile709 (specifically, with the methyl group at the beta -carbon). Substitution of Ile709, which is a highly mutable residue, may allow rNTP binding and incorporation by directly altering the position of the incoming nucleotide and/or by indirect effects that introduce a local conformational change in the protein. The neighboring residue, Glu710, has been proposed to function as the "steric gate" that excludes the 2'-hydroxyl group of an incoming rNTP (27, 28). Therefore, alteration of Ile709 might allow repositioning of the Glu710 residue in the chain so that steric exclusion of rNTP is no longer as effective. Interestingly, the E710D substitution previously found to incorporate ribonucleotides (28) had little or no effect on the kinetics of rNTP incorporation in our assay but did confer an increased ability to add multiple rNTP residues to a growing oligomer.

We have shown that motif A in Taq pol I is highly mutable (17) and undertook the present work to examine the extent to which this mutability might be conserved in evolution. As summarized in Fig. 7, the amino acid substitutions observed at each position in E. coli pol I and Taq pol I are quite similar. Amino acids 700-704 in E. coli pol I and the corresponding residues 605-609 in Taq pol I tolerate predominantly hydrophobic substitutions, i.e. 60 and 64% of total substitutions, respectively. Asp705 in E. coli and Asp610 in Taq pol I are nonsubstitutable. Residues 706-709 and 712 in E. coli, and the corresponding residues in Taq pol I tolerate a large number of polar and charged substitutions, i.e. 57 and 67%, respectively. Of the 37 substitutions found in E. coli at these residues, 21 were observed in Taq pol I. Both Ile709 in E. coli pol I and the corresponding isoleucine in Taq pol I contribute to discrimination of the sugar moiety of the incoming nucleotide. Lastly, Glu710 in E. coli and the corresponding Glu615 in Taq pol I are substitutable only by Asp. These results suggest that 1) the structural requirements for nearly wild-type motif A function in vivo are similar and 2) that the observed tolerance for substitutions within motif A is intrinsic and is evolutionarily conserved. We infer that motif A mutability may be adaptive and may promote survival by permitting toleration of a mutational burden at the polymerase active site without major loss of ability to function in replication.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 7.   Similarity of amino acid replacements observed in motif A of active mutants of E. coli pol I (A) and Taq pol I (B). Mutants of each polymerase were selected by using the same functional complementation protocol and bear mutations only within motif A. Substitutions at each locus are listed alphabetically from top to bottom, along with the number of times each mutation was observed. The Taq pol I mutations are those found by Patel and Loeb (17). HP, Po, (+), and (-) denote the number of hydrophobic, polar, positively charged, and negatively charged amino acid residues, respectively. T represents the total number of substitutions observed.

The main difference in mutability between E. coli and Taq pol I involves a tyrosine residue. In the case of Taq pol I, Tyr611 was replaced only by the planar-ringed amino acids, Phe, His, and Trp, whereas substitutions at the corresponding Tyr706 of E. coli pol I were not similarly restricted. In the closed ternary complex of Taq pol I (15), the side chain of Tyr611 projects into a large hydrophobic pocket. We surmise that the side chains of Phe, His, or Trp may perform a space-filling function in a manner comparable with that of Tyr611, thus permitting replacement; such a function might be less important in E. coli pol I, which tolerates other replacements. Another difference in mutability is that the number of positively charged residues, especially at Ser612, Ile614, and Arg617, is greater among the Taq than the E. coli mutants. These residues may facilitate proper folding of Taq pol I while also maintaining polymerase activity at elevated temperatures (17). The optimum growth temperature for T. aquaticus is far higher than for E. coli; hence, the structure of proteins from T. aquaticus would presumably be restricted to ensure thermostability. Such structural constraints might be reflected in the restricted mutability of Tyr611 or the greater prevalence of positively charged replacements.

In conclusion, we reiterate that all DNA polymerases thus far examined appear to share a common overall architecture with superimposable catalytic palm subdomains and a common polymerase mechanism. In view of this conservation of structure and mechanism, we speculate that high mutability of motif A has also been retained throughout evolution so as to promote tolerance of a mutational burden at the polymerase active site with minimal loss of replicative capacity under conditions of changing environmental stresses.

    ACKNOWLEDGEMENTS

We thank Dr. Elinor Adman for helpful discussions and Dr. Ann Blank for critical reading of the manuscript.

    FOOTNOTES

* This work was supported by National Institutes of Health Grants CA78885, CA39903, and CA74184 (to L. A. L.) and by a grant from Kyowa Hakko Kogyo Co., Ltd. (to A. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: The Joseph Gottstein Memorial Cancer Research Lab., Dept. of Pathology, University of Washington, Box 357705, Seattle, WA 98195-7705. Tel.: 206-543-6015; Fax: 206-543-3967; E-mail: laloeb@u.washington.edu.

Published, JBC Papers in Press, March 12, 2001, DOI 10.1074/jbc.M011472200

2 Patel, P. H., Suzuki, M., Adman, E., Shinkai, A., and Loeb, L. A. (2001) J. Mol. Biol., in press.

    ABBREVIATIONS

The abbreviations used are: pol I, DNA polymerase I; Taq, T. aquaticus; DTT, dithiothreitol; exo-, exonuclease-minus; PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kornberg, A., and Baker, T. (1992) DNA Replication , 2nd Ed. , W. H. Freeman and Co., New York
2. Delarue, M., Poch, O., Tordo, N., Moras, D., and Argos, P. (1990) Protein Eng. 3, 461-467
3. Blanco, L., Bernad, A., Blasco, M. A., and Salas, M. (1991) Gene (Amst.) 100, 27-38
4. Friedberg, E. C., Feaver, W. J., and Gerlach, V. L. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5681-5683
5. Ollis, D. L., Brick, P., Hamlin, R., Xuong, N. G., and Steitz, T. A. (1985) Nature 313, 762-766
6. Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1992) Science 256, 1783-1790
7. Sawaya, M. R., Pelletier, H., Kumar, A., Wilson, S. H., and Kraut, T. (1994) Science 264, 1930-1935
8. Wang, J., Sattar, A. K. M. A., Wang, C. C., Karam, J. D., Konigsberg, W. H., and Steitz, T. A. (1997) Cell 89, 1087-1089
9. Steitz, T. A. (1999) J. Biol. Chem. 274, 17395-17398
10. Kunkel, T. A., and Wilson, S. H. (1998) Nat. Struct. Biol. 5, 95-99
11. Kunkel, T. A., and Bebenek, K. (2000) Annu. Rev. Biochem. 69, 497-529
12. Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut, J. (1994) Science 264, 1891-1903
13. Doublié, S., Tabor, S., Long, A. M., Richardson, C. C., and Ellenberger, T. (1998) Nature 391, 251-258
14. Huang, H., Chopra, R., Verdine, G. L., and Harrison, S. C. (1998) Science 282, 1669-1675
15. Li, Y., Korolev, S., and Waksman, G. (1998) EMBO J. 17, 7514-7525
16. Astatke, M., Grindley, N. D. F., and Joyce, C. M. (1998) J. Mol. Biol. 278, 147-165
17. Patel, P. H., and Loeb, L. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5095-5100
18. Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T. (1987) Gene (Amst.) 61, 63-74
19. Joyce, C. M., Kelley, W. S., and Grindley, N. D. F. (1982) J. Biol. Chem. 257, 1958-1964
20. Sweasy, J. B., and Loeb, L. A. (1992) J. Biol. Chem. 267, 1407-1410
21. Witkin, E. M., and Boegner-Maniscalco, V. (1992) J. Bacteriol. 174, 4166-4168
22. Spanos, A., Sedgwick, S. G., Yarranton, G. T., Hübscher, U., and Banks, G. R. (1981) Nucleic Acids Res. 9, 1825-1839
23. Battula, N., and Loeb, L. A. (1974) J. Biol. Chem. 249, 4086-4093
24. Derbyshire, V., Freemont, P. S., Sanderson, M. R., Beese, L., Friedman, J. M., Joyce, C. M., and Steitz, T. A. (1988) Science 240, 199-201
25. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254
26. Boosalis, M. S., Petruska, J., and Goodman, M. F. (1987) J. Biol. Chem. 262, 14689-14696
27. Patel, P. H., and Loeb, L. A. (2000) J. Biol. Chem. 275, 40266-40272
28. Astatke, M., Ng, K., Grindley, N. D. F., and Joyce, C. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3402-3407
29. Brautigam, C. A., and Steitz, T. A. (1998) Curr. Opin. Struct. Biol. 8, 54-63
30. Gibbons, R. J., and Kapsimalis, B. (1967) J. Bacteriol. 93, 510-512
31. Mao, E. F., Lane, L., Lee, J., and Miller, J. H. (1997) J. Bacteriol. 179, 417-422
32. Taddei, F., Radman, M., Maynard-Smith, J., Toupance, B., Gouyon, P. H., and Goddelle, B. (1997) Nature 387, 700-702
33. Oliver, A., Cantón, R., Campo, P., Baquero, F., and Blázquez, J. (2000) Science 288, 1251-1254
34. Drake, J. W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7160-7164
35. Polesky, A. H., Dahlberg, M. E., Benkovic, S. J., Grindley, N. D. F., and Joyce, C. M. (1992) J. Biol. Chem. 267, 8417-8428


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
R. N. Venkatesan, P. M. Treuting, E. D. Fuller, R. E. Goldsby, T. H. Norwood, T. A. Gooley, W. C. Ladiges, B. D. Preston, and L. A. Loeb
Mutation at the Polymerase Active Site of Mouse DNA Polymerase {delta} Increases Genomic Instability and Accelerates Tumorigenesis
Mol. Cell. Biol., November 1, 2007; 27(21): 7669 - 7682.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
A. Shinkai, S. Kira, N. Nakagawa, A. Kashihara, S. Kuramitsu, and S. Yokoyama
Transcription Activation Mediated by a Cyclic AMP Receptor Protein from Thermus thermophilus HB8
J. Bacteriol., May 15, 2007; 189(10): 3891 - 3901.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Loh, J. Choe, and L. A. Loeb
Highly Tolerated Amino Acid Substitutions Increase the Fidelity of Escherichia coli DNA Polymerase I
J. Biol. Chem., April 20, 2007; 282(16): 12201 - 12209.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. N. Venkatesan, J. J. Hsu, N. A. Lawrence, B. D. Preston, and L. A. Loeb
Mutator Phenotypes Caused by Substitution at a Conserved Motif A Residue in Eukaryotic DNA Polymerase {delta}
J. Biol. Chem., February 17, 2006; 281(7): 4486 - 4494.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. A. Smith, D. J. Anderson, and B. D. Preston
Purifying Selection Masks the Mutational Flexibility of HIV-1 Reverse Transcriptase
J. Biol. Chem., June 18, 2004; 279(25): 26726 - 26734.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Niimi, S. Limsirichaikul, S. Yoshida, S. Iwai, C. Masutani, F. Hanaoka, E. T. Kool, Y. Nishiyama, and M. Suzuki
Palm Mutants in DNA Polymerases {alpha} and {eta} Alter DNA Replication Fidelity and Translesion Activity
Mol. Cell. Biol., April 1, 2004; 24(7): 2734 - 2746.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ogawa, S. Limsirichaikul, A. Niimi, S. Iwai, S. Yoshida, and M. Suzuki
Distinct Function of Conserved Amino Acids in the Fingers of Saccharomyces cerevisiae DNA Polymerase {alpha}
J. Biol. Chem., May 23, 2003; 278(21): 19071 - 19078.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Limsirichaikul, M. Ogawa, A. Niimi, S. Iwai, T. Murate, S. Yoshida, and M. Suzuki
The Gly-952 Residue of Saccharomyces cerevisiae DNA Polymerase {alpha} Is Important in Discriminating Correct Deoxyribonucleotides from Incorrect Ones
J. Biol. Chem., May 23, 2003; 278(21): 19079 - 19086.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Xia, L. Chen, T. Sera, M. Fa, P. G. Schultz, and F. E. Romesberg
Directed evolution of novel polymerase activities: Mutation of a DNA polymerase into an efficient RNA polymerase
PNAS, May 14, 2002; 99(10): 6597 - 6602.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. T. Minnick, L. Liu, N. D. F. Grindley, T. A. Kunkel, and C. M. Joyce
Discrimination against purine-pyrimidine mispairs in the polymerase active site of DNA polymerase I: A structural explanation
PNAS, February 5, 2002; 99(3): 1194 - 1199.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Shinkai and L. A. Loeb
In Vivo Mutagenesis by Escherichia coli DNA Polymerase I. ILE709 IN MOTIF A FUNCTIONS IN BASE SELECTION
J. Biol. Chem., December 7, 2001; 276(50): 46759 - 46764.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/22/18836    most recent
M011472200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shinkai, A.
Right arrow Articles by Loeb, L. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shinkai, A.
Right arrow Articles by Loeb, L. A.


</
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS