![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 22, 18836-18842, June 1, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Joseph Gottstein Memorial Cancer Research Laboratory, Department of Pathology, University of Washington, Seattle, Washington 98195-7705
Received for publication, December 20, 2000, and in revised form, March 8, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Escherichia coli DNA polymerase I
participates in DNA replication, DNA repair, and genetic recombination;
it is the most extensively studied of all DNA polymerases. Motif A in
the polymerase active site has a required role in catalysis and is
highly conserved. To assess the tolerance of motif A for amino acid
substitutions, we determined the mutability of the 13 constituent
amino acids Val700-Arg712 by using
random mutagenesis and genetic selection. We observed that every
residue except the catalytically essential Asp705 can be
mutated while allowing bacterial growth and preserving wild-type DNA
polymerase activity. Hence, the primary structure of motif A is
plastic. We present evidence that mutability of motif A has been
conserved during evolution, supporting the premise that the tolerance
for mutation is adaptive. In addition, our work allows identification
of refinements in catalytic function that may contribute to
preservation of the wild-type motif A sequence. As an example, we
established that the naturally occurring Ile709 has a
previously undocumented role in supporting sugar discrimination.
Escherichia coli DNA polymerase I (pol
I)1 is a multifunctional
enzyme with roles in DNA replication, DNA repair, and genetic recombination (1). The first recognized and most thoroughly investigated of all DNA polymerases, it is key to our understanding of
how DNA polymerases function as protein catalysts and as central enzymes in DNA metabolism. It belongs to one of six families of DNA
polymerases, defined on the basis of amino acid sequence comparisons (2-4): family A (e.g. E. coli pol I,
Thermus aquaticus (Taq) pol I, Bacillus
stearothermophilus pol I, and T7 DNA polymerase), family B
(e.g. DNA polymerase In a recent study of Taq pol I, we observed substantial
mutability of motif A (17). This plasticity was surprising when one
considers the essentiality of DNA polymerases and the marked conservation of motif A within prokaryotic DNA polymerases. To determine whether or not the plasticity within motif A was a property of DNA polymerases, we examined the mutability of motif A in E. coli pol I. We found that E. coli pol I also tolerated
multiple substitution within motif A. Moreover, the overall pattern and the type of substitutions were similar to those of Taq pol
I. Our results indicate that the mutability of motif A has been
conserved in natural evolution and support the premise that toleration
of mutation may be an important feature for the overall fitness of DNA
polymerase active sites.
Construction of the pol I Random Mutant Library--
The pol I
gene (polA) of E. coli DH5
The pol I random library was constructed by annealing two
single-stranded DNA oligonucleotides containing segments with random sequences: Oligo 1 was a 104-mer corresponding to the sense nucleotides 2,053-2,156, and containing an AccI site for cloning
(5'-GAAGGTCGTCGTATACGCCAGGCGTTTATTGCGCCAGAGGATTAT[GTGATTGTCTCAGCGGACTACTCGCAGATTGAACTGCGC]ATTATGGCGCATCTTTCGCG-3'); Oligo 2 was an 89-mer corresponding to antisense strand nucleotides 2,225-2,137 and containing an EagI site
(5'-AACACTTCTGCGGCCGTTGCCCGGTGGATATCTTTTCCTTCCGCGAATGCGGTCAGCAAGCCTTTGTCACGCGAAAGATGCGCCATAAT-3'). The bracketed nucleotides in Oligo 1 were synthesized to contain 88% wild-type nucleotide and 4% each of the other three nucleotides at every position. The 20-base pair complementary regions of
hybridization are underlined. Oligo 1 and Oligo 2 were annealed at
their nonrandom complementary regions by mixing 250 pmol of each in 20 µl of H2O and heating to 95 °C for 5 min, followed by
cooling for 2 h to room temperature. The partially duplex
oligonucleotide was extended by incubation with 50 units of E. coli pol I Klenow fragment (New England BioLabs, Beverly, MA) for
2 h at 37 °C in a 0.3-ml reaction mixture containing 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2,
7.5 mM DTT, and 0.5 mM of all four dNTPs. The
resulting DNA was digested with AccI and EagI,
purified, and inserted into pECpoldum in place of the stuffer fragment.
Plasmids containing the random library were transformed into E. coli XLIBlue, and the number of transformed cells was determined
by plating an aliquot onto LB agar plates containing 30 µg/ml of
chloramphenicol. The remainder of the library was amplified by growing
the transformed E. coli XLIBlue in 3 liters of 2× YT medium
for 16 h at 37 °C, and the random library, pECpolLib, was then purified.
Genetic Selection for Active Mutants--
E. coli
JS200 (recA718polA12) (20, 21) was transformed with plasmids
pHSG576, pECpol IS, pECpoldum, and pECpolLib. Thereafter, 1 ml of
nutrient broth containing 0.4% NaCl was added, and the cells were
incubated for 1 h at 37 °C. A small fraction of the mixture was
then plated in duplicate onto nutrient agar plates containing 0.4%
NaCl, 12.5 µg/ml tetracycline, and 30 µg/ml chloramphenicol; one
plate was incubated at 30 °C, and the other was incubated at
37 °C overnight, and the resulting colonies were counted. Only paired samples containing less than 1,500 colonies at 30 °C were analyzed because dense plating of the cells leads to elevated background at 37 °C.
DNA Sequence Analysis of the Motif A Region--
Plasmids
carrying the mutant pol I gene were prepared, and the 0.6-kilobase pair
region covering the motif A region was amplified by polymerase chain
reaction with 5'-GATACCATGCTGGAGTCCTACATTC-3' and
5'-ACGGCGTTGCTCGCTGGTGACGGTT-3' as primers. Following purification of
the polymerase chain reaction product, the
AccI-EagI 130-base pair fragment was sequenced by
using 5'-TTATCGTCAACCGATCCTAACCTGCA-3' as a primer.
Preparation of E. coli Cell Extracts--
Recombinant E. coli JS200 cells were cultured at 30 °C in 4 ml of 2× YT
medium supplemented with 12.5 µg/ml tetracycline and 30 µg/ml
chloramphenicol. At the exponential growth phase
(A600 = 0.2-0.5), pol I expression was
induced with 1 mM
isopropyl- DNA and RNA Polymerase Assays--
DNA polymerase activity was
measured at 42 °C for 10 min in 20-µl reaction mixtures containing
0.1 µg of gapped calf thymus DNA (22), 12.5 µM each
dNTP, 50 nM [ Construction of High Copy Number Vectors for
HisKlenow(exo Expression and Purification of HisKlenow(exo Kinetic Analysis of Nucleotide Incorporation--
A steady-state
kinetic analysis was performed based on the method of Boosalis et
al. (26). A 47-mer template
(3'-GCGCGGCTTAAGGGCGATCGTTATAGCTTAAGGCCTTTAAAGGGCCC-5') was
hybridized with one of four 5'-32P end-labeled primers: the
23-mer (5'-CGCGCCGAATTCCCGCTAGCAAT-3'), the 24-mer
(5'-CGCGCCGAATTCCCGCTAGCAATA-3'), the 25-mer
(5'-CGCGCCGAATTCCCGCTAGCAATAT-3'), or the 26 mer
(5'-CGCGCCGAATTCCCGCTAGCAATATC-3'). Primer/template (5 nM) was incubated for 5 min at 37 °C in a reaction
mixture containing limiting amounts of HisKlenow(exo RNA Synthesis--
The 47-mer template and 5'-32P
end-labeled 24-mer primer used for kinetic analysis of rNTP
incorporation were hybridized and incubated at 37 °C for 5-60 min
in 10-µl reaction mixtures containing 50 nM
HisKlenow(exo Creation and Genetic Selection of Motif A Mutants--
We used
random sequence mutagenesis to create substitutions within the 13 contiguous amino acids comprising motif A of E. coli pol I
(Val700-Arg712). We then selected functional
mutants in E. coli JS200 (recA718 polA12), a
strain that contains a temperature-sensitive mutation in the pol I gene
(polA) and can be propagated at 30 °C but not at 37 °C
(20, 21). Recombinant wild-type polA was able to fully
complement the temperature-sensitive phenotype, such that E. coli JS200 harboring the plasmid pECpol IS exhibited a 100% survival rate at 37 °C relative to 30 °C. The recombinant strain carrying pECpoldum, a nonfunctional stuffer vector, showed a 0.5% survival rate at 37 °C, indicating that the background for our complementation-based selection assay was 0.5%.
The randomly mutated E. coli pol I library consisted of
500,000 independent clones. DNA sequencing of 26 unselected clones indicated that the average number of amino acid changes within motif A
was three. The unselected library included 10% dummy vectors, and 40%
of the clones had a deletion and/or insertion within or outside of
motif A, which may have been introduced in the process of library
construction. Following transformation of the library into E. coli JS200, 8% of the clones formed colonies at 37 °C, relative to 30 °C. After subtracting the background, we estimated that there were 37,500 independent clones encoding active pol I proteins.
Analysis of Selected Motif A Mutants--
To establish the
spectrum of mutations that restored growth of E. coli JS200,
we randomly picked 280 colonies that grew at 37 °C, assayed the DNA
polymerase activity in cell extracts at 42 °C, isolated the
plasmids, and sequenced the 0.15-kilobase pair linker portion
containing the 39-base pair randomized region. DNA polymerase activity
in extracts of E. coli JS200 carrying the parent plasmid
pHSG576 or the stuffer vector pECpoldum was 1-4% of that in extracts
of cells carrying pECpol IS that expresses wild-type E. coli
pol I, indicating that the background polymerase activity is 1-4%
(data not shown). We found three clones carrying pECpoldum that
exhibited higher activity than clones harboring the original pECpoldum,
i.e. 20-25% of wild-type pol I activity; we did not
observe complementation when fresh JS200 cells were retransformed by
these three stuffer vectors, indicating that the growth observed at
37 °C was likely due to mutation of the host cells. Twelve clones
showed very low activity, less than 10% that of clones carrying pECpol
IS. Of the 280 total clones, we estimated that 17-18 should represent
background, in that 8% of the total library form colonies at 37 °C
and 0.5% of the total library are false positives. Therefore, we
attributed the 15 clones just described to background and did not
analyze them further. Of the remaining 265 clones, 32 had 1 amino acid
substitution and 1 had a deletion of 2 amino acids, all of which were
outside of motif A; these clones were also not further investigated. No frameshift mutations were observed among the 280 selected clones.
The remaining 232 selected, active mutants harbored one to five amino
acid substitutions within motif A. As illustrated in Fig.
1A, the average number of
mutations was 1-2. The levels of DNA polymerase activity in extracts
of the mutants are shown in Fig. 1B, as a function of the
number of amino acid changes. 70% of the 232 mutants retained DNA
polymerase activity comparable with that of wild type (within
60%-200%), including almost all of the single mutants and even six of
the ten mutants with four amino acid replacements. Moreover, 36% of
mutants exhibited activity equal to or greater than the wild type. The
number of mutants exhibiting moderate (30-60% of wild type) or low
(10-30% of wild type) activity followed a Poisson distribution
relative to the number of amino acid substitutions, with a median of
two or three amino acid substitutions per clone.
In Fig. 2 the amino acid substitutions
observed in the selected active clones with one (Fig. 2A),
two (Fig. 2B), or three to five (Fig. 2C) mutations in motif A are
shown; the distribution of mutations was similar in the three groups.
Six motif A residues (Val700, Val702,
Ser703, Ala704, Ser707, and
Gln708) tolerated a wide spectrum of substitutions, whereas
six others (Ile701, Tyr706, Ile709,
Glu710, Leu711, and Arg712)
tolerated predominantly conservative substitutions, and only the
catalytically essential residue Asp705 was immutable.
Glu710 was substituted solely by Asp, indicating that
negative charge at this position may be indispensable for polymerase
activity in vivo. DNA polymerase activity in extracts of the
53 different mutants with a single amino acid replacement is indicated
in Fig. 3. Interestingly, most single
mutants with a replacement within the N-terminal 5 amino acids, which
form a strand of the structurally conserved anti-parallel Effect of Motif A Mutations on rNTP Discrimination--
The
foregoing results indicate that the primary structure of motif A in
E. coli pol I is plastic and that mutations in motif A can
be associated with a high degree of biologic and catalytic function. To
assess how the highly functioning variant pol I might differ from wild
type catalytically, we tested all 53 different single mutants shown in
Fig. 3 for altered sugar selectivity. We did this by substituting rGTP
for dGTP in the standard DNA polymerase assay. Wild-type pol I
exhibited poor incorporation of rGTP in this assay, as did all the
single mutants except the four having an Ile709 to Met,
Asn, Phe, or Ala substitution (Fig. 4 and
data not shown). Mutants carrying a I709S substitution, such as
I701M/A704G/I709S and V700A/L711V/I709S, also exhibited efficient
incorporation of rGTP. In contrast, neither the single mutant E710D nor
additional mutants such as I701V/V702I/E710D and I709V/E710D/R712S were
effective in incorporating rGTP (data not shown).
We chose the single mutant I709F, which showed the most efficient rNTP
incorporation, for detailed analysis of rNTP discrimination. We also
analyzed E710D as a reference enzyme; E710D did not exhibit enhanced
rNTP incorporation but has displayed modestly reduced discrimination
against rNTPs in other assays (28). To eliminate the possibility of
proof-reading by the 3'-5' exonuclease activity of E. coli pol I, we constructed exonuclease-deficient
derivatives of the Klenow fragment (24), containing an intact
polymerase domain. The wild-type and mutant Klenow fragments were
expressed in E. coli as N-terminal hexahistidine fusion
proteins (HisKlenow(exo
We used a steady-state, gel-based assay employing oligonucleotide
primer templates (26) to analyze the kinetics of rNTP incorporation by
the purified exonuclease-deficient Klenow fragments. The wild-type and
mutant proteins showed typical Michaelis-Menten saturation kinetics
when initial velocity was plotted against the concentration of either
rNTP or dNTP (data not shown). The parameters Km and
Vmax were derived by hyperbolic curve fitting
and were used to calculate kcat, catalytic
efficiency, and rNTP/dNTP discrimination factors (Table
I). The catalytic constant
kcat was obtained by dividing
Vmax by the enzyme concentration. The catalytic
efficiency, expressed as
kcat/Km, is a measure of the
efficiency of nucleotide incorporation. The discrimination factor
dNTP/rNTP, calculated as the ratio of efficiencies for incorporation of
dNTP versus the corresponding rNTP, is a measure of
intrinsic enzymatic specificity for the correct sugar. As indicated in
Table I, the discrimination against rNTPs exhibited by the wild-type
enzyme ranged from 650- to 53,000-fold; the discrimination was
associated exclusively with elevated Km values for rNTPs, the rate constants for all substrates being essentially the
same. The mutant I709F was indistinguishable from wild type with
respect to incorporation of dNTPs, in accord with the near wild-type
activity in the standard nucleotide incorporation assay employing
gapped DNA and all four dNTPs (Fig. 4). However, the ability of the
I709F mutant to discriminate against rNTPs is impaired; the observed
discrimination factors ranged from 20- to 80-fold less than wild type,
virtually entirely because of decreased Km values
for rNTPs relative to the wild-type value. These findings indicate that
Ile709 in wild-type pol I functions to exclude
ribonucleotides from the genome, at least in part via diminished
incorporation of rNTPs. As shown below, the I709F mutant also
discriminates against extension of incorporated ribonucleotides less
efficiently than the wild-type exo
Exclusion of rNTPs from DNA involves both discrimination against
incorporation of rNTPs and discrimination against extension of DNA
chains bearing a 3'-terminal ribonucleotide residue. To assess these
two factors concurrently, we examined how well the mutant
HisKlenow(exo Motif A is shared among DNA polymerases (2), is an essential part
of the polymerase active site (12-15, 29), and is highly conserved
among prokaryotic DNA polymerase A family members (16).2
Interestingly, motif A sequences of modern E. coli strains
from around the world were recently found to be identical (17), even though the bacteria divide more than 100 times each year (30), at
mutation rates of 10 To further assess variation in catalytic properties among the selected
active mutants, we screened them for incorporation of ribonucleotides.
Among the 53 amino acid substitutions analyzed, we found that certain
substitutions at Ile709 (Phe, Met, Ala and Asn) permit more
efficient utilization of rNTPs and that the phenylalanine substitution
permitted the most extensive incorporation of rNTPs. The corresponding
isoleucine to phenylalanine substitution has so far not been found
among random sequence substitutions in Taq pol I (17, 27).
The I709F substitution essentially converts E. coli pol I
from a DNA-dependent DNA polymerase to an enzyme that can
effectively use both DNA and RNA substrates. We conclude that
isoleucine at position 709 contributes to sugar discrimination by
wild-type pol I and that this function may promote conservation of the
wild-type motif A sequence. Based on analysis of a structural model of
Taq pol I bound with DNA and an rNTP (27), we infer that the
ribose ring of the rNTP interacts with Ile709
(specifically, with the methyl group at the We have shown that motif A in Taq pol I is highly mutable
(17) and undertook the present work to examine the extent to which this
mutability might be conserved in evolution. As summarized in Fig.
7, the amino acid substitutions observed
at each position in E. coli pol I and Taq pol I
are quite similar. Amino acids 700-704 in E. coli pol I and
the corresponding residues 605-609 in Taq pol I tolerate
predominantly hydrophobic substitutions, i.e. 60 and 64% of
total substitutions, respectively. Asp705 in E. coli and Asp610 in Taq pol I are
nonsubstitutable. Residues 706-709 and 712 in E. coli, and
the corresponding residues in Taq pol I tolerate a large
number of polar and charged substitutions, i.e. 57 and 67%,
respectively. Of the 37 substitutions found in E. coli at these residues, 21 were observed in Taq pol I. Both
Ile709 in E. coli pol I and the corresponding
isoleucine in Taq pol I contribute to discrimination of the
sugar moiety of the incoming nucleotide. Lastly, Glu710 in
E. coli and the corresponding Glu615 in
Taq pol I are substitutable only by Asp. These results
suggest that 1) the structural requirements for nearly wild-type motif A function in vivo are similar and 2) that the observed
tolerance for substitutions within motif A is intrinsic and is
evolutionarily conserved. We infer that motif A mutability may be
adaptive and may promote survival by permitting toleration of a
mutational burden at the polymerase active site without major loss of
ability to function in replication.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and RB69 DNA polymerase), reverse transcriptase (e.g. human immunodeficiency virus reverse
transcriptase, and murine leukemia virus reverse transcriptase), family
X (e.g. DNA polymerase
), the pol III family,
and the UmuC/DinB family (e.g. DNA polymerase
). Crystal
structures of representative enzymes from the first four families have
been determined, revealing a common overall architecture that has been
likened to a human right hand, with fingers, thumb, and palm subdomains
(5-9). Although the structures of the fingers and thumb subdomains
vary considerably, the catalytic palm subdomains are all superimposable
(10, 11). The palm subdomain includes two conserved sequences, motif A
and motif C, each harboring a catalytically essential aspartic acid residue. Essential roles of motif A in catalysis include interaction with the incoming dNTP and coordination with two divalent metal ions
that are required for the polymerization reaction (12-15). Motif A
begins at an anti-parallel
-strand containing predominantly hydrophobic residues and is followed by a turn and an
-helix. Although there is considerable variation in the amino acid sequence of
the anti-parallel
-strand, the sequence of the turn and helix, DYSQIELR, is nearly invariant among known prokaryotic family A polymerases (16).2
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
was amplified by
colony polymerase chain reaction with
5'-ATATATATAAGCTTATGGTTCAGATCCCCCAAAATCCACTTATC-3' and
5'-ATATATATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT-3' as
primers. The 3-kilobase pair amplified fragment was digested with
HindIII and EcoRI and then cloned under the
lactose promoter into pHSG576, a low copy number plasmid that has a pol
I-independent origin (18), to create pECpol I. Site-directed
mutagenesis was performed on pECpol I to introduce silent mutations C
to A at position 2,067 and G to C at position 2,214 of the
polA gene (19) to create AccI and EagI
sites, respectively, that flank the sequence encoding motif A. The
resulting plasmid was named pECpol IS. To avoid contamination with
incompletely cut vectors when preparing the random library, a
nonfunctional stuffer vector, pECpoldum, was constructed by replacing
the AccI-EagI 130-base pair fragment of
polA with an oligonucleotide fragment
(5'-ATACGATCGATCTGCAGCGATCC-3' and
5'-GGCCGGATCGCTGCAGATCGATCGT-3').
-D-thiogalactopyranoside. After further
incubation for 4 h (A600 = 2), cells from
1.5 ml of culture were collected, washed with 1 ml of 20 mM
sodium phosphate (pH 7.2), suspended in 0.1 ml of the same buffer, and
5 µl of 10 mg/ml lysozyme was added. The cells were disrupted by
freezing at
80 °C for 16 h and thawing on ice for 2 h.
The cell extract was collected by centrifugation at 15,000 rpm for 15 min.
-32P]dTTP (3,000 Ci/mmol;
PerkinElmer Life Sciences), and 2 µl of cell extract in 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2,
7.5 mM DTT. The reaction was terminated by addition of 0.5 ml of 10% trichloroacetic acid followed by 0.1 ml of 0.1 M
sodium pyrophosphate. The 32P-labeled DNA was collected
onto glass fiber filters, and radioactivity was measured by using
scintillation counter as described (23). The assay for RNA polymerase
activity was the same, except 12.5 µM rGTP was
substituted for dGTP.
) Expression--
Site-directed mutagenesis
was performed on pECpol IS to introduce an A to C transversion at
position 1,271, changing the corresponding Asp424 to
Ala and inactivating the 3'-exonuclease activity (24). Then, with this
plasmid as a template and
5'-CAGACGAACATATGCACCATCATCACCATCACATTTCTTATGACAACTACGTCACCATCCTTGAT -3' and 5'-ATATATATGAATTCTTAGTGCGCCTGATCCCAGTTTTCGCCACT-3' as primers, polymerase chain reaction was performed to construct the
HisKlenow(exo
) gene. The amplified fragment was digested
with NdeI and EcoRI and cloned under the
PL promoter of pLEX (Invitrogen, Carlsbad, CA). High expression vectors for mutant pol I proteins were constructed by substituting the 1.1-kilobase pair SacI-EcoRI
fragment of the wild-type pol I gene on the expression vector with the
corresponding fragment of the mutant gene.
)
Proteins--
Recombinant HisKlenow(exo
) proteins were
expressed and purified by using the PL
Expression System (Invitrogen), and His-Bond kits (Novagen, Madison,
WI), respectively, essentially according to the manufacturer's
directions. The expression plasmid was introduced into E. coli GI724 (F
, 
,
lacIq, lacPL8,
ampC::Ptrp cI,
mcrA, mcrB,
INV(rnnD-rnnE)), and cells were grown at 30 °C
in 40 ml of induction medium composed of 1× M9 salts, 0.2% casamino
acids, 0.5% glucose, 1 mM MgCl2, and 100 µg/ml ampicillin. When an A550 of 0.5 was
attained, tryptophan was added to a final concentration of 100 µg/ml,
and the culture was incubated at 37 °C for a further 4 h. The
cells were collected by centrifugation, washed with 40 ml of
phosphate-buffered saline, and suspended in 4 ml of 1× binding buffer
(5 mM imidazole, 0.5 M NaCl, 20 mM
Tris-HCl, pH 7.9) containing 200 µg/ml lysozyme and 0.5 mM phenylmethylsulfonyl fluoride. Extracts were prepared by
freezing at
80 °C for 16 h and thawing on ice for 2 h,
followed by centrifugation at 15,000 rpm for 15 min. The extract was
then applied to a 1-ml Ni2+-resin column, washed with 10 ml
of 1× binding buffer, and eluted with buffer composed of 60 mM imidazole, 0.5 M NaCl, 20 mM
Tris-HCl, pH 7.9. The eluted sample was concentrated to ~1 mg/ml by
using a Centricon-30 microconcentrator (Amicon, Beverly, MA), diluted with an equal volume of glycerol containing 2 mM DTT, and
stored at
80 °C. Protein concentrations were determined by the
method of Bradford (25).
)
protein and varying concentrations of each dNTP or rNTP in 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2,
7.5 mM DTT. The ranges of nucleotide substrate
concentrations used were 0.5-10 nM for dNTP incorporation, 0.5-17.5 µM for rNTP incorporation by the wild
type and E710D mutant, and 2.5-400 nM for rNTP
incorporation by the I709F mutant. Following termination of the
reaction by addition of 2.5 µl of formamide solution, the products
were analyzed by 14% PAGE and quantified by PhosphorImager
analysis (27).
) protein and 1 µM each of all
four rNTPs in 10 mM Tris-HCl, pH 7.5, 5 mM
MgCl2, 0.5 mM MnCl2, 7.5 mM DTT. After the reaction was terminated by the addition
of 2.5 µl of formamide solution, the products were analyzed by 14%
PAGE followed by autoradiography.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (18K):
[in a new window]
Fig. 1.
Amino acid substitutions in motif A of 232 genetically selected, active E. coli pol I
mutants. Mutations were introduced into the 13 codons encoding
motif A in the plasmid-borne pol I gene by using random sequence
mutagenesis. Active mutants were then isolated by positive genetic
selection for variants that complemented the temperature-sensitive
growth phenotype of an E. coli strain harboring a
temperature-sensitive endogenous pol I. A, distribution of
amino acid substitutions in clones that exhibited >10% of wild-type
DNA polymerase activity in an in vitro assay, relative to
the number of amino acid changes. B, distribution of DNA
polymerase activity in extracts of cells expressing pol I mutants,
relative to the number of the amino acid changes. The vertical
bars indicate the level of DNA polymerase activity relative to
wild type, as follows: black with horizontal
stripes, 100%-200%; stippled, 60%-100%;
diagonal stripes, 30%-60%; solid, 10%-30%.
Wild-type activity is that observed in extracts of cells expressing
wild-type pol I.
-sheet,
exhibited higher than wild-type activity. In contrast, activity tended
to be reduced when the C-terminal
-helix region, whose primary
structure is practically invariant in the prokaryotic pol I family, was
mutated. Thus, even though both the N- and C-terminal portions of motif
A are highly mutable, the effects on catalytic activity differ.

View larger version (38K):
[in a new window]
Fig. 2.
Amino acid substitutions observed in motif A
of selected, active pol I mutants harboring one (A),
two (B), or three to five (C) amino
acid changes. Amino acid substitutions at each residue are listed
in alphabetical order from top to bottom, along
with the number of times each substitution was observed.

View larger version (18K):
[in a new window]
Fig. 3.
DNA polymerase activity of pol I mutants with
single amino acid substitutions in motif A. Substitutions at each
residue are listed alphabetically from top to
bottom, followed by DNA polymerase activity, relative to
wild type. Polymerase activity in cell extracts was assayed at 42 °C
by measuring the incorporation of [
-32P]dTTP into
gapped calf thymus DNA. Mutant activities are expressed relative to
wild type (1.0), i.e. the activity observed in extracts of
cells expressing recombinant wild-type pol I.

View larger version (25K):
[in a new window]
Fig. 4.
Incorporation of ribonucleotides by wild-type
and mutant pol I with single amino acid substitutions at I709 or
E710. Polymerase activity in cell extracts was measured in assay
mixtures containing gapped calf thymus DNA as a template-primer and
either four dNTPs (dG, dA, dC, and dT) (diagonally striped
bars), three dNTPs (dA, dC, and dT) (open bars), or
three dNTPs plus rGTP (solid bars). The amount of
[
-32P]dTTP incorporated into DNA is shown.
dum, cells expressing the noncomplementing dummy plasmid
pECpoldum; WT, wild type.
)) and purified by one-step nickel
affinity chromatography. The wild-type, I709F, and E710D preparations
each yielded a single band of ~68 kDa in SDS-polyacrylamide gels
(Fig. 5); the estimated purity was
95%
in all cases, and importantly, no bands of 109 kDa (the molecular
mass of endogenous pol I) were detected.

View larger version (9K):
[in a new window]
Fig. 5.
SDS-PAGE analysis of purified Klenow fragment
derived from wild-type (WT), I709F, and E710D pol
I. Exonuclease-minus Klenow fragments were constructed as
described under "Experimental Procedures" and expressed in E. coli as N-terminal hexahistidine fusions. The proteins were
purified on nickel resin columns and analyzed by SDS-PAGE followed by
Coomassie Brilliant Blue R-250 staining. M, molecular mass
markers.
Klenow fragment. In
contrast to the I709F mutation, the E710D substitution had little or no
effect on either incorporation of dNTPs or discrimination against
rNTPs. These observations are in accord with essentially wild-type
activity in both the standard DNA polymerase and ribonucleotide
incorporation assays.
Kinetic analysis of dNTP and rNTP incorporation by wild-type and mutant
exo
Klenow fragments
) proteins were able to incorporate multiple
rNTPs sequentially, i.e. to act as RNA polymerases. To do
this, we incubated the proteins with a 5'-32P-labeled DNA
primer template in the presence of all four rNTPs. As shown in Fig.
6, the wild-type protein added seven
residues to the primer, stopping upon the addition of the two uracil
residues; only at 60 min was addition of further nucleotides observed.
In contrast, the I709F mutant was able to overcome the barrier
comprised of two uracil residues, as well as the downstream barrier
comprised of three uracil residues. We conclude that the I709F
substitution permits not only more efficient incorporation of rNTPs,
but more efficient extension as well. The E710D mutant extended the
primer at a slightly greater rate than the wild-type protein,
indicative of modestly reduced discrimination against extension of
3'-ribonucleotide termini.

View larger version (77K):
[in a new window]
Fig. 6.
RNA synthesis by exonuclease-minus HisKlenow
fragments derived from wild-type, I709F, and E710D pol I. A
5'-32P-labeled DNA primer template was incubated with
either wild-type (WT), I709F, or E710D
HisKlenow(exo
) protein (50 nM) and 1 µM each of all four rNTPs at 37 °C for 5, 10, 15, or
60 min. The products were analyzed by 14% PAGE, followed by
autoradiography. Lane n, incubation was for 60 min in the
presence of 50 nM wild-type enzyme and no rNTPs. Lane
d, incubation was for 15 min in the presence of 50 nM
wild-type enzyme and 50 µM of each dNTP. Nucleotides to
be incorporated are shown at the right.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
5/nucleotide/division in mutators
(31-33) to 10
9/nucleotide/division in nonmutators (34).
Despite this conservation in nature, we show here that motif A in
E. coli pol I can tolerate a substantial mutational burden,
and most of the 13 constituent amino acids are replaceable, yielding
highly competent variant polymerases. E. coli strains
harboring active mutant pol I that were selected in a genetic
complementation system are fit to replicate repetitively, both in
liquid broth and on solid agar at 37 °C. These observations are
consistent with biochemical data showing that the mutant proteins
possess wild type-like DNA polymerase activity in vitro. We
found that only one residue, the catalytically essential
Asp705, was immutable; the corresponding residue in
Taq pol I coordinates with the two metal ligands required
for catalysis (13, 15). Substitution of Glu710 was
restricted to Asp; in crystals of a closed ternary complex of T7 DNA
polymerase complexed with its substrates (13), the glutamate residue
equivalent to Glu710 is hydrogen-bonded with a tyrosine
residue in the O-helix within the fingers subdomain. We conclude that a
Asp residue at position 705 and a negative charge at position 710 are
indispensable for maintaining polymerase activity; this conclusion is
in agreement with the deleterious effects of the D705A and E710A
substitutions on catalysis (35). Both the N- and C-terminal parts of
motif A tolerated a wide spectrum of substitutions. DNA polymerase
activity associated with single amino acid substitutions within the
N-terminal 5 amino acid residues was as high or higher than that of the
wild-type enzyme. These residues form part of an anti-parallel
-sheet structure that is believed to accommodate the triphosphate
moiety of the incoming dNTP and may be a potential target for
engineering of pol I derivatives with altered properties. In contrast,
amino acid substitutions within the C-terminal five residues tended to
be associated with reduced activity.
-carbon). Substitution of Ile709, which is a highly mutable residue, may allow
rNTP binding and incorporation by directly altering the position of the
incoming nucleotide and/or by indirect effects that introduce a local
conformational change in the protein. The neighboring residue,
Glu710, has been proposed to function as the "steric
gate" that excludes the 2'-hydroxyl group of an incoming rNTP (27,
28). Therefore, alteration of Ile709 might allow
repositioning of the Glu710 residue in the chain so that
steric exclusion of rNTP is no longer as effective. Interestingly, the
E710D substitution previously found to incorporate ribonucleotides (28)
had little or no effect on the kinetics of rNTP incorporation in our
assay but did confer an increased ability to add multiple rNTP residues
to a growing oligomer.

View larger version (40K):
[in a new window]
Fig. 7.
Similarity of amino acid replacements
observed in motif A of active mutants of E. coli pol I
(A) and Taq pol I
(B). Mutants of each polymerase were selected by
using the same functional complementation protocol and bear mutations
only within motif A. Substitutions at each locus are listed
alphabetically from top to bottom, along with the
number of times each mutation was observed. The Taq pol I
mutations are those found by Patel and Loeb (17). HP,
Po, (+), and (
) denote the number of
hydrophobic, polar, positively charged, and negatively charged amino
acid residues, respectively. T represents the total number
of substitutions observed.
The main difference in mutability between E. coli and Taq pol I involves a tyrosine residue. In the case of Taq pol I, Tyr611 was replaced only by the planar-ringed amino acids, Phe, His, and Trp, whereas substitutions at the corresponding Tyr706 of E. coli pol I were not similarly restricted. In the closed ternary complex of Taq pol I (15), the side chain of Tyr611 projects into a large hydrophobic pocket. We surmise that the side chains of Phe, His, or Trp may perform a space-filling function in a manner comparable with that of Tyr611, thus permitting replacement; such a function might be less important in E. coli pol I, which tolerates other replacements. Another difference in mutability is that the number of positively charged residues, especially at Ser612, Ile614, and Arg617, is greater among the Taq than the E. coli mutants. These residues may facilitate proper folding of Taq pol I while also maintaining polymerase activity at elevated temperatures (17). The optimum growth temperature for T. aquaticus is far higher than for E. coli; hence, the structure of proteins from T. aquaticus would presumably be restricted to ensure thermostability. Such structural constraints might be reflected in the restricted mutability of Tyr611 or the greater prevalence of positively charged replacements.
In conclusion, we reiterate that all DNA polymerases thus far examined
appear to share a common overall architecture with superimposable
catalytic palm subdomains and a common polymerase mechanism. In view of
this conservation of structure and mechanism, we speculate that high
mutability of motif A has also been retained throughout evolution so as
to promote tolerance of a mutational burden at the polymerase active
site with minimal loss of replicative capacity under conditions of
changing environmental stresses.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. Elinor Adman for helpful discussions and Dr. Ann Blank for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grants CA78885, CA39903, and CA74184 (to L. A. L.) and by a grant from Kyowa Hakko Kogyo Co., Ltd. (to A. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: The Joseph Gottstein
Memorial Cancer Research Lab., Dept. of Pathology, University of
Washington, Box 357705, Seattle, WA 98195-7705. Tel.:
206-543-6015; Fax: 206-543-3967; E-mail:
laloeb@u.washington.edu.
Published, JBC Papers in Press, March 12, 2001, DOI 10.1074/jbc.M011472200
2 Patel, P. H., Suzuki, M., Adman, E., Shinkai, A., and Loeb, L. A. (2001) J. Mol. Biol., in press.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
pol I, DNA
polymerase I;
Taq, T. aquaticus;
DTT, dithiothreitol;
exo
, exonuclease-minus;
PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Kornberg, A., and Baker, T. (1992) DNA Replication , 2nd Ed. , W. H. Freeman and Co., New York |
| 2. | Delarue, M., Poch, O., Tordo, N., Moras, D., and Argos, P. (1990) Protein Eng. 3, 461-467 |
| 3. | Blanco, L., Bernad, A., Blasco, M. A., and Salas, M. (1991) Gene (Amst.) 100, 27-38 |
| 4. | Friedberg, E. C., Feaver, W. J., and Gerlach, V. L. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5681-5683 |
| 5. | Ollis, D. L., Brick, P., Hamlin, R., Xuong, N. G., and Steitz, T. A. (1985) Nature 313, 762-766 |
| 6. | Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1992) Science 256, 1783-1790 |
| 7. | Sawaya, M. R., Pelletier, H., Kumar, A., Wilson, S. H., and Kraut, T. (1994) Science 264, 1930-1935 |
| 8. | Wang, J., Sattar, A. K. M. A., Wang, C. C., Karam, J. D., Konigsberg, W. H., and Steitz, T. A. (1997) Cell 89, 1087-1089 |
| 9. | Steitz, T. A. (1999) J. Biol. Chem. 274, 17395-17398 |
| 10. | Kunkel, T. A., and Wilson, S. H. (1998) Nat. Struct. Biol. 5, 95-99 |
| 11. | Kunkel, T. A., and Bebenek, K. (2000) Annu. Rev. Biochem. 69, 497-529 |
| 12. | Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut, J. (1994) Science 264, 1891-1903 |
| 13. | Doublié, S., Tabor, S., Long, A. M., Richardson, C. C., and Ellenberger, T. (1998) Nature 391, 251-258 |
| 14. | Huang, H., Chopra, R., Verdine, G. L., and Harrison, S. C. (1998) Science 282, 1669-1675 |
| 15. | Li, Y., Korolev, S., and Waksman, G. (1998) EMBO J. 17, 7514-7525 |
| 16. | Astatke, M., Grindley, N. D. F., and Joyce, C. M. (1998) J. Mol. Biol. 278, 147-165 |
| 17. | Patel, P. H., and Loeb, L. A. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 5095-5100 |
| 18. | Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T. (1987) Gene (Amst.) 61, 63-74 |
| 19. | Joyce, C. M., Kelley, W. S., and Grindley, N. D. F. (1982) J. Biol. Chem. 257, 1958-1964 |
| 20. | Sweasy, J. B., and Loeb, L. A. (1992) J. Biol. Chem. 267, 1407-1410 |
| 21. | Witkin, E. M., and Boegner-Maniscalco, V. (1992) J. Bacteriol. 174, 4166-4168 |
| 22. | Spanos, A., Sedgwick, S. G., Yarranton, G. T., Hübscher, U., and Banks, G. R. (1981) Nucleic Acids Res. 9, 1825-1839 |
| 23. | Battula, N., and Loeb, L. A. (1974) J. Biol. Chem. 249, 4086-4093 |
| 24. | Derbyshire, V., Freemont, P. S., Sanderson, M. R., Beese, L., Friedman, J. M., Joyce, C. M., and Steitz, T. A. (1988) Science 240, 199-201 |
| 25. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254 |
| 26. | Boosalis, M. S., Petruska, J., and Goodman, M. F. (1987) J. Biol. Chem. 262, 14689-14696 |
| 27. | Patel, P. H., and Loeb, L. A. (2000) J. Biol. Chem. 275, 40266-40272 |
| 28. | Astatke, M., Ng, K., Grindley, N. D. F., and Joyce, C. M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 3402-3407 |
| 29. | Brautigam, C. A., and Steitz, T. A. (1998) Curr. Opin. Struct. Biol. 8, 54-63 |
| 30. | Gibbons, R. J., and Kapsimalis, B. (1967) J. Bacteriol. 93, 510-512 |
| 31. | Mao, E. F., Lane, L., Lee, J., and Miller, J. H. (1997) J. Bacteriol. 179, 417-422 |
| 32. | Taddei, F., Radman, M., Maynard-Smith, J., Toupance, B., Gouyon, P. H., and Goddelle, B. (1997) Nature 387, 700-702 |
| 33. | Oliver, A., Cantón, R., Campo, P., Baquero, F., and Blázquez, J. (2000) Science 288, 1251-1254 |
| 34. | Drake, J. W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7160-7164 |
| 35. | Polesky, A. H., Dahlberg, M. E., Benkovic, S. J., Grindley, N. D. F., and Joyce, C. M. (1992) J. Biol. Chem. 267, 8417-8428 |
This article has been cited by other articles:
![]() |
R. N. Venkatesan, P. M. Treuting, E. D. Fuller, R. E. Goldsby, T. H. Norwood, T. A. Gooley, W. C. Ladiges, B. D. Preston, and L. A. Loeb Mutation at the Polymerase Active Site of Mouse DNA Polymerase {delta} Increases Genomic Instability and Accelerates Tumorigenesis Mol. Cell. Biol., November 1, 2007; 27(21): 7669 - 7682. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shinkai, S. Kira, N. Nakagawa, A. Kashihara, S. Kuramitsu, and S. Yokoyama Transcription Activation Mediated by a Cyclic AMP Receptor Protein from Thermus thermophilus HB8 J. Bacteriol., May 15, 2007; 189(10): 3891 - 3901. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Loh, J. Choe, and L. A. Loeb Highly Tolerated Amino Acid Substitutions Increase the Fidelity of Escherichia coli DNA Polymerase I J. Biol. Chem., April 20, 2007; 282(16): 12201 - 12209. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. N. Venkatesan, J. J. Hsu, N. A. Lawrence, B. D. Preston, and L. A. Loeb Mutator Phenotypes Caused by Substitution at a Conserved Motif A Residue in Eukaryotic DNA Polymerase {delta} J. Biol. Chem., February 17, 2006; 281(7): 4486 - 4494. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Smith, D. J. Anderson, and B. D. Preston Purifying Selection Masks the Mutational Flexibility of HIV-1 Reverse Transcriptase J. Biol. Chem., June 18, 2004; 279(25): 26726 - 26734. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Niimi, S. Limsirichaikul, S. Yoshida, S. Iwai, C. Masutani, F. Hanaoka, E. T. Kool, Y. Nishiyama, and M. Suzuki Palm Mutants in DNA Polymerases {alpha} and {eta} Alter DNA Replication Fidelity and Translesion Activity Mol. Cell. Biol., April 1, 2004; 24(7): 2734 - 2746. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ogawa, S. Limsirichaikul, A. Niimi, S. Iwai, S. Yoshida, and M. Suzuki Distinct Function of Conserved Amino Acids in the Fingers of Saccharomyces cerevisiae DNA Polymerase {alpha} J. Biol. Chem., May 23, 2003; 278(21): 19071 - 19078. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Limsirichaikul, M. Ogawa, A. Niimi, S. Iwai, T. Murate, S. Yoshida, and M. Suzuki The Gly-952 Residue of Saccharomyces cerevisiae DNA Polymerase {alpha} Is Important in Discriminating Correct Deoxyribonucleotides from Incorrect Ones J. Biol. Chem., May 23, 2003; 278(21): 19079 - 19086. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Xia, L. Chen, T. Sera, M. Fa, P. G. Schultz, and F. E. Romesberg Directed evolution of novel polymerase activities: Mutation of a DNA polymerase into an efficient RNA polymerase PNAS, May 14, 2002; 99(10): 6597 - 6602. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Minnick, L. Liu, N. D. F. Grindley, T. A. Kunkel, and C. M. Joyce Discrimination against purine-pyrimidine mispairs in the polymerase active site of DNA polymerase I: A structural explanation PNAS, February 5, 2002; 99(3): 1194 - 1199. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shinkai and L. A. Loeb In Vivo Mutagenesis by Escherichia coli DNA Polymerase I. ILE709 IN MOTIF A FUNCTIONS IN BASE SELECTION J. Biol. Chem., December 7, 2001; 276(50): 46759 - 46764. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |