![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 22, 19020-19026, June 1, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Subunit Promoter*
From the Department of Cell and Developmental Biology, Oregon Health Sciences University, Portland, Oregon 97201
Received for publication, February 27, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Lhx3, a member of the LIM homeodomain family of
transcription factors, is required for development of the pituitary in
mice. A recent report has described a point mutation in the human
LHX3 gene that is associated with a combined pituitary
hormone disorder. The mutation is predicted to lead to the replacement
of a tyrosine residue with a cysteine in the second LIM domain of LHX3.
We have characterized the effects of this point mutation (Y114C) when analyzed in the context of the mouse Lhx3 coding sequence. Mobility shift assays demonstrated that the Lhx3 Y114C mutant is capable of
binding DNA, although a decrease in the formation of a specific complex
was observed. Transfection assays using an expression vector for either
full-length Lhx3 or a GAL4-Lhx3 LIM domain fusion provided evidence
that the Lhx3 Y114C mutant has a decreased ability to stimulate
transcription. In particular, a GAL4-Lhx3 Y114C LIM mutant was unable
to support Ras responsiveness of a modified glycoprotein hormone
The Lhx1 family of
transcription factors contain a homeodomain and two LIM domains each
consisting of two zinc fingers (1-3). Lhx3 is expressed in the
pituitary and a subset of neurons and is able to enhance the
transcription of several pituitary hormone reporter genes in transient
transfection assays (4-8). Lhx3 can synergize with the POU homeodomain
transcription factor, Pit-1, to stimulate prolactin promoter activity
(4, 9). Lhx3 also appears to play a role in permitting the promoter for
the Members of the LIM homeodomain family of transcription factors all
contain a homeodomain which functions as the DNA-binding domain and two
amino-terminal LIM domains (1, 2). The LIM domains each contain two
zinc finger structures and appear to function as protein-protein
interaction domains (11, 12). The LIM domains of Lhx3 have been shown
to specifically bind several proteins. Lhx3 can bind to the
pituitary-specific transcription factor, Pit-1 (4). Lhx3 has also been
shown to interact with several co-activator/adapter proteins. Several
laboratories have identified the widely expressed nuclear adapter
protein nuclear LIM interactor (NLI, also designated LBD or CLIM) as an
Lhx3 interacting protein (13-16). Recently, The LIM domains of Lhx3
have also been shown to bind the novel putative adapter, selective
LIM-binding protein (SLB) (17). Unlike NLI, which binds to all nuclear
LIM domains tested, SLB appears to bind to a subset of LIM domains with
the highest affinity for Lhx3 and the closely related protein, Lhx4.
The developmental role of Lhx3 has been clearly demonstrated through
the use of gene disruption studies in mice and Drosophila melanogaster (6, 18-20). In the mouse Lhx3 is required for
pituitary development and for specification and pathway selection of
certain motor neurons (6, 18, 19). Disruption of the mouse
lhx3 and lhx4 genes have demonstrated the role of
these LIM factors in pituitary gland development and in differentiation
and proliferation of pituitary cell lineages (18, 19). There is also
evidence that LHX3 plays an important role in pituitary hormone gene
expression in humans. A recent report has described mutations in the
human LHX3 gene in patients displaying a syndrome called
combined pituitary hormone deficiency (21). This syndrome is
characterized by the loss of all but one (adrenocorticotropin) of the
five hormones produced in the anterior pituitary resulting in severe
growth retardation. Two mutations which are associated with this
syndrome in humans have been identified. One of the mutations is
predicted to produce a truncated protein lacking the homeodomain. Thus, this protein would likely be inactive due to failure to bind DNA. Interestingly, the other mutation is a point mutation that is predicted
to convert a tyrosine residue to cysteine in the first zinc finger
structure of the second LIM domain. It is not clear how this
mutation alters the activity of LHX3.
In the present studies we have explored how this point mutation in the
second LIM domain alters the functional properties of Lhx3. To study
this issue, we have prepared the corresponding mutation in the mouse
Lhx3 coding sequence. We have analyzed the ability of the mutant
transcription factor to bind DNA, participate in transcriptional
activation, and interact with other transcription factors and
co-activator/adapter proteins.
Cell Culture, DNA Constructs, and
Transfections--
GH3 cells were maintained in
Dulbecco's modified Eagle's medium supplemented with 15%
equine serum and 2.5% fetal bovine serum. Human embryonic kidney 293 cells (HEK 293) and the gonadotrope-derived Preparation of Cell Extracts--
For immunoblotting or
immunoprecipitations, Mobility Shift Assay for Protein/DNA Interaction--
Cell
extracts were made from transfected 293 cells as described above for
immunoprecipitations. A duplex DNA probe was synthesized containing the
sequence, ATATCAGGTACTTAGCTAATTAAATGTGCT, which corresponds to the
pituitary glycoprotein hormone basal element (26). This DNA element
contains a LIM factor-binding site (7). Binding reactions contained
10,000 cpm of 32P-labeled DNA probe, varying amounts of
cell extract, 1 µg of sheared salmon sperm DNA, 10 µg of bovine
serum albumin, 10 mM Tris, pH 7.5, 5% glycerol, 50 mM NaCl, 1 mM EDTA, and 1 mM
dithiothreitol in a total volume of 25 µl. In some reactions 0.5 µl
of preimmune serum or antiserum to Lhx3 was included. Reactions were
incubated for 20 min at room temperature and then analyzed on
nondenaturing, 4% polyacrylamide gels. The gels were then dried and
exposed to x-ray film.
Antiserum, Immunoprecipitations, and Immunoblotting--
The
antiserum to SLB has been described previously (17). Monoclonal
antibody to the AU1 epitope was obtained as from the Berkeley Antibody
Company. The antiserum to Lhx3 was produced by immunizing rabbits with
a fusion protein containing glutathione S-transferase fused
to residues 266 to 400 of mouse Lhx3 (GST-Lhx3266-400). This antigen represents the carboxyl-terminal domain of Lhx3
facilitating the use of the resulting antiserum to detect Lhx3 proteins
with point mutations in the amino-terminal, LIM domains. The
GST-Lhx3266-400 fusion protein was produced in
Escherichia coli and purified by affinity chromatography as
described (27). For immunoprecipitation, cell extracts were adjusted to
contain 0.1% Tween 20. Aliquots containing equal amounts of total
protein were combined with 15 µl of a 50% slurry of
anti-FLAG-agarose (Kodak). The immunoprecipitation mixtures were
rotated for 2 h at 4 °C and the anti-FLAG-agarose was collected
by centrifugation. The anti-FLAG-agarose was then washed 3 times with 1 ml each of 10 mM Tris, pH 7.4, 150 mM NaCl, 0.1% Tween 20, 0.1% Triton X-100, and 0.025% SDS. Proteins bound to
the anti-FLAG-agarose were then analyzed by electrophoresis on a
denaturing, polyacrylamide gel. For immunoblotting, proteins were
transferred to polyvinylidene difluoride membranes (Millipore). Blocking reactions, incubation with a 1:5,000 dilution of antiserum to
AU1, Lhx3, or SLB, incubation with a 1:10,000 dilution of horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse antibody (Santa
Cruz) and incubation with chemiluminescent reagent (Amersham Renaissance) were all performed as suggested by the suppliers.
In Vitro Protein Binding
Assays--
GST-SLB1213-1265 or a
GST-NLI295-375 fusion protein was used for protein binding
assays. The proteins were expressed in E. coli and
immobilized on agarose beads as described (27). For binding assays with
Pit-1, FLAG epitope-tagged Pit-1 was expressed in baculovirus-infected
Sf9 cells and immobilized on anti-FLAG-agarose. Radiolabeled
proteins to be tested in these assays were prepared by coupled
transcription and translation reactions in the presence of
[35S]methionine using reagents and protocols provided by
the supplier (Promega). Typical binding reactions contained 7 µl of
in vitro translated protein, 15 µl of GST, GST-SLB,
anti-FLAG, or anti-FLAG-Pit-1-agarose, and Tris-buffered saline (10 mM Tris, pH 7.4, 150 mM NaCl) with 0.1% Tween
20 in a final volume of 100 µl. Reactions were rotated at 4 °C for
2 h and then washed 3 × 1 ml each with Tris-buffered saline
with 0.1% Tween 20, 0.1% Triton X-100, and 0.025% SDS. The bound
radiolabeled proteins were then analyzed by denaturing polyacrylamide
gel electrophoresis. The gels were dried and exposed to x-ray film.
Recently it has been shown that a point mutation which results in
replacement of a tyrosine residue with a cysteine residue in the LIM
domain of the human LHX3 transcription factor is associated with
combined pituitary hormone deficiency (21). It seems likely that this
point mutation alters the ability of LHX3 to modulate a transcriptional
event important for the development of pituitary cell lineages (18,
19). In addition, the point mutation may alter the ability of LHX3 to
stimulate pituitary hormone gene expression (4-10). To examine the
effects of this point mutation on LHX3 activity, we created the
corresponding mutation (Y114C) in the mouse Lhx3 coding sequence.
Although we have studied this mutation in the context of the mouse Lhx3
sequence, it is likely the findings also apply to human LHX3 as the
second LIM domain of human LHX3 is identical to the second LIM domain
of mouse Lhx3. The Y114C mutation is adjacent to histidine 115, one of
four residues predicted to coordinate a zinc atom in the first zinc
finger of the second LIM domain (2, 28, 29). It seemed possible that the introduction of a cysteine residue which potentially could coordinate with the zinc atom might disrupt or distort the zinc finger
structure. Therefore we created a point mutation which replaced
tyrosine 114 with an alanine residue (Y114A) which should not
coordinate a zinc atom. We also prepared a mutant Lhx3 in which
histidine 115 was replaced with alanine (H115A) presumably disrupting
the zinc finger structure. The ability of the wild type and mutant Lhx3
proteins was then tested for DNA binding, transcriptional activity, and
co-factor binding.
Mutant Lhx3 Is Capable of Binding DNA--
A point mutation might
reduce the ability of a transcription factor to stimulate gene
expression through any of several mechanisms. One of the most
straightforward mechanisms would involve a decrease in DNA binding
activity. Although the Y114C mutation is outside of the homeodomain of
Lhx3, there is evidence that the LIM domain of Lhx3 may inhibit the DNA
binding activity of the homeodomain (4, 9, 30). To test for DNA binding
activity, HEK 293 cells were transiently transfected with expression
vectors for wild type and mutant Lhx3 and then cell extracts prepared
for binding experiments. The cell extracts were incubated with a
radiolabeled probe corresponding to an Lhx3-binding element designated
the pituitary glycoprotein basal element from the gonadotropin
LIM Point Mutations Decrease Transcriptional Activity of
Lhx3--
Previous studies have shown that Lhx3 can synergize with the
pituitary specific transcription factor, Pit-1, to activate the prolactin promoter in heterologous cells (4, 9, 17). We used this assay
to explore the transcriptional activity of the Lhx3 LIM domain mutants
in HEK 293 cells (Fig. 2). As previously reported (4, 9), wild type Lhx3 weakly activated the prolactin promoter
alone and showed strongly synergistic activation in the presence of
Pit-1 (Fig. 2A). All three of the mutant Lhx3 proteins were
found to synergize with Pit-1, although reporter activity was reduced
somewhat as compared with wild type Lhx3. Immunoblot analysis
demonstrated that the wild type and mutant Lhx3 proteins were expressed
at approximately the same levels (Fig. 2B). These findings
suggest that replacement of tyrosine 114 of Lhx3 with either cysteine
or alanine modestly reduces the ability of Lhx3 to act in concert with
Pit-1 to synergistically activate transcription.
To further characterize the transcriptional activity of the mutant Lhx3
proteins, we took advantage of a different Lhx3-responsive reporter
gene. Lhx3 can bind to an element designated the pituitary glycoprotein
hormone basal element in the glycoprotein hormone Point Mutations in the LIM domain of Lhx3 Greatly Reduce
Interaction with the Putative Co-activator, SLB--
The Y114C Lhx3
mutation occurs in a domain that is known to be important for binding
of several proteins including other transcription factors such as Pit-1
(4) as well as several putative co-activator proteins including NLI,
MRG1, and SLB (10, 13, 14, 16, 17). The possible effects of the point
mutations on interactions with the putative co-activators seemed
particularly interesting. Of the three potential co-activators which
might play a role in mediating transcriptional responses to Lhx3, NLI
has been studied the most extensively. Several studies have
demonstrated that NLI can interact with a number of different LIM
factors and there is evidence that NLI may play a role in mediating
transcriptional responses (13-16, 31). Perhaps the most compelling
evidence for a role for NLI as a LIM factor co-activator has come from
genetic experiments in Drosophila (32-34). These studies
support a model in which interaction of Chip, the Drosophila
homolog of NLI, with the LIM homeodomain factor, apterous, is necessary
for normal wing development.
To begin to explore possible mechanisms mediating the decreased
transcriptional activity of mutant Lhx3, we analyzed the binding of
several factors to Lhx3. To directly assess the ability of SLB and NLI
to bind Lhx3 we performed in vitro binding studies. Radiolabeled wild type or mutant Lhx3 were incubated with immobilized proteins consisting of GST fused to the LIM interacting domains of NLI
or SLB, and the bound proteins were analyzed by denaturing gel
electrophoresis (Fig. 4A).
Wild type Lhx3 bound strongly to GST-NLI and GST-SLB. The Y114A and
Y114C mutants bound GST-NLI quite well (PhosphorImager analysis of
several experiments indicated 60% or greater as compared with wild
type binding). However, the Y114A and Y114C mutants bound GST-SLB only
marginally better than GST alone (PhosphorImager analysis indicated
about 1-2% of wild type binding). The H115A Lhx3 mutant which
disrupts the zinc finger did not bind appreciably to either GST-SLB or
GST-NLI in this assay. We also analyzed binding of Lhx3 to Pit-1. For
these binding experiments, Pit-1 containing a FLAG epitope at the amino
terminus was produced in baculovirus. The epitope-tagged Pit-1 was then immobilized on resin containing a monoclonal antibody to the FLAG epitope. Radiolabeled wild type or mutant Lhx3 was incubated with the
immobilized FLAG-Pit-1, and the bound proteins were analyzed by
denaturing gel electrophoresis (Fig. 4B). Consistent with
previous reports (4), a substantial amount of wild type Lhx3 was found to interact with Pit-1. All three mutant Lhx3 proteins also bound Pit-1
at about 50 to 60% of wild type binding. As Bach et al. (4)
demonstrated that each of the two LIM domains of Lhx3 can individually
strongly interact with Pit-1, it is perhaps not surprising that a point
mutation in one of the two LIM domains reduces binding to Pit-1 by only
about 50%. Overall, the in vitro binding data provide
evidence that the Lhx3 Y114C and Y114A mutations which greatly reduce
transcriptional responses to Ras, essentially abrogate binding to SLB,
with more modest effects on binding to NLI and Pit-1.
We also used a mammalian version of the two-hybrid assay to further
test for the apparent interaction of Lhx3 with NLI and SLB in intact
cells (Fig. 5). HEK 293 cells were
transfected with a GAL4-dependent reporter gene and
expression vectors for a GAL4-Lhx3 LIM domain fusion and a fusion of
NLI or SLB to the strong transcriptional activation domain of VP16. As
expected, transfection of NLI-VP16 or SLB-VP16 with the wild type
GAL4-Lhx3 LIM fusion resulted in strong stimulation of reporter gene
activity suggesting substantial interaction of wild type Lhx3 with both
NLI and SLB. Similar to the in vitro binding studies, the
Y114C and Y114A mutations of Lhx3 modestly reduced the apparent
interaction with NLI, but abrogated apparent binding to SLB. Disruption
of the zinc finger structure by replacement of histidine 115 with
alanine, abrogated apparent binding to both NLI and SLB. The mammalian
two-hybrid assay offers further evidence confirming that replacement of
tyrosine 114 of Lhx3 with either cysteine or alanine disrupts in
vivo interaction with SLB with rather modest effects on binding to
NLI.
Previous studies have demonstrated that for Lmx1, a different LIM
homeodomain transcription factor, both LIM domains contribute to high
affinity binding to NLI (16). In the case of Lmx1, NLI demonstrates
weak but detectable binding to the first LIM domain, stronger binding
to the second LIM domain, and highest affinity binding to both LIM
domains (16). We used a mammalian two-hybrid assay to investigate the
binding capabilities of the individual LIM domains of Lhx3 in an effort
to understand the differential effect of the Y114C mutation on NLI and
SLB binding (Fig. 6A). As
assessed by reporter gene activation, the role of the individual LIM
domains of Lhx3 for binding to NLI is similar to the role of the
domains of Lmx1. NLI appears to bind weakly to the first LIM domain
(LIM1), more strongly to the second LIM domain (LIM2), and with highest
affinity to both LIM domains (LIM1,2). For binding to SLB,
there was no apparent interaction with the first LIM domain of Lhx3
(LIM1), a weak apparent interaction with the second LIM domain (LIM2),
and considerably stronger interaction with both LIM domains
(LIM1,2). These findings suggest that the second LIM domain
of Lhx3 is critical for interaction with SLB and less important for
binding to NLI. This is consistent with the finding that mutation of
Tyr114 in the second LIM domain of Lhx3, essentially
blocks SLB binding, but only modestly reduces NLI binding. We also
tested the ability of the individual LIM domains to support a Ras
response of the glycoprotein hormone
We also analyzed the in vivo binding of Lhx3 to SLB using a
co-immunoprecipitation assay (Fig. 7).
Expression vectors encoding FLAG epitope-tagged wild type or mutant
Lhx3 were transfected into HEK 293 cells with an expression vector
encoding an AU1-tagged fragment of SLB that contains the LIM
interacting domain (17). We used this fragment of SLB as overexpression
of the full-length protein appears to be toxic to many tissue culture
cells (17). The FLAG antibody did not co-immunoprecipitate SLB in the
absence of FLAG-tagged Lhx3 (Fig. 5, third
lane). When the cells were transfected with wild type
FLAG-tagged Lhx3, substantial amounts of the SLB fragment were
co-immunoprecipitated (Fig. 5, fourth lane). The Y114C Lhx3
essentially eliminated co-immunoprecipitation of the SLB fragment (Fig.
5, fifth and sixth lanes). The Lhx3 H115A
mutation which disrupts the zinc finger also disrupted
co-immunoprecipitation with the SLB fragment. Thus, the
co-immunoprecipitation assay again offers evidence that the Y114C
mutations essentially eliminates the in vivo interaction of
Lhx3 and SLB.
These studies provide insights into mechanisms mediating the
effects of a specific point mutation in Lhx3 on pituitary hormone gene
expression. The findings provide evidence that replacement of tyrosine
114 with a cysteine in the second LIM domain of Lhx3 reduces
transcriptional activity. In one assay, the ability of the Lhx3 mutant
to synergize with the pituitary specific factor, Pit-1, to activate the
prolactin promoter was reduced. In another assay, the mutation
substantially reduced the ability of Lhx3 to contribute to Ras
responsiveness of the gonadotropin Although the Y114C Lhx3 mutant is clearly capable of binding to DNA, a
qualitative difference in DNA binding by the wild type and mutant
proteins was detected by mobility shift assay. Previous studies have
provided evidence that the LIM domain may inhibit DNA binding activity
as removal of the LIM domain enhances DNA binding (4, 9, 30). If the
Y114C mutation acted to inhibit the function of the LIM domain, then it
might be expected to enhance DNA binding activity, similar to the
results obtained by deleting the LIM domain. Although the mobility
shift studies did not reveal substantial increases in DNA binding
activity of the mutant Lhx3, there was a difference in the nature of
the complexes formed. The wild type protein produced two major
complexes while the mutant protein yielded predominantly the faster
migrating complex. This assay involved use of extracts from cells
transfected with expression vectors for wild type or mutant Lhx3. Thus,
the binding activity may represent Lhx3 plus other endogenous proteins.
The nature of the components which make up the two complexes and the
possible functional significance of the two complexes is not clear at
this time and will require further study.
The studies of the interaction of the mutant Lhx3 with other proteins
may provide insights into the mechanisms mediating the transcriptional
activity of Lhx3. The Y114C mutation appeared to somewhat reduce the
interaction of Lhx3 with Pit-1 and NLI. Although the effects of the
mutation on the binding of Lhx3 to Pit-1 and NLI were rather modest,
these effects may play a functional role. For instance, the reduced
ability of the Lhx3 Y114C mutant to bind to Pit-1 was accompanied by a
reduced ability of the mutant Lhx3 to synergize with Pit-1 to activate
the prolactin promoter. One mechanism that might account for this
observation would involve changes in cooperative DNA binding by Lhx3
and Pit-1. However, previous studies have failed to demonstrate
cooperative DNA binding by Lhx3 and Pit-1 using a variety of different
DNA-binding sites (4). Thus, it is perhaps more likely that the
decreased ability of Lhx3 Y114C to bind to Pit-1 leads to decreases in
the subsequent recruitment of co-activators or general transcription factors.
We were particularly interested to examine the effects of the Y114C
substitution on the interaction of Lhx3 with NLI. Several laboratories
have shown that NLI can bind to a number of LIM homeodomain transcription factors including Lhx3 (13-15, 31). Genetic experiments have offered evidence that CHIP, the Drosophila homolog of
NLI, plays a role in transcriptional responses to LIM homeodomain
transcription factors (32-34). In view of the evidence supporting a
functional role for the interaction of NLI with LIM transcription
factors, it seemed quite possible that the Y114C mutation would disrupt the interaction of Lhx3 and NLI. Although we found that the Y114C mutation reduced the interaction of Lhx3 with NLI, the effects were
rather modest, decreasing binding to about half of the binding achieved
by wild type Lhx3. It seems somewhat unlikely that this modest change
in binding to NLI accounts for the major change in the ability of Y114C
Lhx3 to support Ras responsiveness of a glycoprotein The most dramatic effect of the Y114C mutation on protein interactions
involved essentially eliminating binding of Lhx3 to SLB. Interestingly,
the Y114C mutation also blocked the ability of a GAL4-Lhx3 fusion to
support Ras-stimulated activation of the glycoprotein hormone
-subunit reporter gene. Protein interaction studies suggest that the
Y114C mutation may modestly reduce binding to the POU transcription
factor, Pit-1. Interestingly, the Y114C mutation essentially abrogated
binding to the putative co-activator/adapter, selective LIM-binding
protein. The findings provide insights into the mechanisms mediating
transcriptional activation by Lhx3 and suggest that the observed
phenotype of the human mutation probably involves reduced
transcriptional activity of the mutant LHX3.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-subunit of the glycoprotein hormones to respond to the
mitogen-activated protein kinase signaling pathway (10).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
T-3 cell line (22) were
maintained in Dulbecco's modified Eagle's medium containing 10%
fetal bovine serum. Luciferase reporter genes containing 0.6 kilobase
pairs of 5'-flanking region of the rat prolactin gene (23) or 5 copies
of a GAL4-binding site upstream of the minimal thymidine kinase
promotor (24) have been described previously. A reporter gene
containing the
507 to
205 region of the glycoprotein hormone
-subunit gene with a GAL4 site substituted for the pituitary
glycoprotein basal element was as described (10). Mammalian expression
vectors for GAL4 and VP16 fusions have been described previously (25).
The coding sequences for various LIM domains and NLI were amplified by
polymerase chain reaction using standard protocols. The products were
all confirmed by automated DNA sequencing. Cells were transfected with
a total of 1 µg of DNA and 5 µl of LipofectAMINE (Life
Technologies, Inc.) in 35-mm well plates, or 0.4 µg of DNA and 2 µl
of LipofectAMINE in 22-mm well plates using a protocol provided by the supplier.
T-3 or 293 cells were scraped from the culture
dishes in 100 mM sodium phosphate, pH 7.8. The cells were
pelleted in a microcentrifuge and resuspended in the same buffer
but with 0.1% Nonidet P-40. The cells were disrupted by 4 cycles of
freeze thaw using dry ice/ethanol and 37 °C water baths. After
centrifugation at 10,000 × g for 5 min at 4 °C, the
supernatant was saved as a whole cell extract. For preparation of cell
extracts for luciferase assays and for some immunoblotting studies,
cell monolayers were rocked for 15 min in Passive Lysis Buffer
(Promega). Cell debris was removed by transferring the extract to
microcentrifuge tubes and centrifuging for 2 min.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-subunit promoter (7, 26). Bound complexes were separated from free probe by electrophoresis on nondenaturing polyacrylamide gels (Fig.
1.). Extracts prepared from the HEK 293 cells transfected with the empty expression vector formed several weak
complexes which were insensitive to addition of an antiserum to Lhx3.
Transfection of the vector for wild type Lhx3 resulted in the formation
of two major complexes. Both complexes were apparently disrupted by
antiserum to Lhx3 but not by preimmune serum. The more slowly migrating
complex, C2, has a similar migration to a complex from nontransfected
cells. However, the Lhx3-directed, C2 complex can be distinguished from
the endogenous complex (designated NS) by the disrupting effects of the
Lhx3 antiserum. Formation of two Lhx3-directed complexes is consistent
with the observation that the related LIM homeodomain protein, Lhx2,
also forms two complexes on DNA fragments containing this sequence (7).
As this DNA element contains an imperfect palindrome, it is possible
that the slower migrating, C2 complex contains an Lhx3 dimer. Analysis of extracts from cells transfected with vectors for the mutant Lhx3
proteins demonstrated that the mutant proteins can also bind to the DNA
element. Expression vectors for all of the Lhx3 mutants led to
formation of a C1 complex which was disrupted by the Lhx3 antiserum and
was comparable in magnitude to the C1 complex for the wild type
protein. The H115A mutation which presumably disrupts the zinc finger
appeared to produce more C1 complex than was obtained with the wild
type protein, consistent with other observations that the LIM domain
can inhibit DNA binding (4, 9, 30). Analysis of the formation of the C2
complex by the mutants is somewhat complicated due to substantial
variation in the amount of the NS complex in the various cell extracts.
However, as indicated above, the C2 complex from cells transfected with
wild type Lhx3 is disrupted by the Lhx3 antiserum. None of the Lhx3
mutants produced a C2 complex which was sensitive to the Lhx3
antiserum. Addition of larger amounts of cell extract did not result in
formation of the C2 complex for the mutants (data not shown). These
observations provide evidence that the mutant Lhx3 proteins are capable
of binding DNA. However, there is a qualitative difference in binding with a reduction in the formation of the C2 complex. This may indicate
that these LIM domain mutations have an influence on oligomerization of
Lhx3 or perhaps on the interaction of Lhx3 with other factors which
contribute to complex formation. While the effects of the mutations on
forming the C2 complex might contribute to changes in transcriptional
activity, the finding that the mutant Lhx3 proteins demonstrated
substantial DNA binding activity indicates that they could possibly
participate in transcriptional activation. Therefore, their activity
was further characterized.

View larger version (57K):
[in a new window]
Fig. 1.
DNA binding activity of wild type and mutant
Lhx3. A, extracts from 293 cells transfected with the
indicated expression vectors were incubated with a
32P-labeled DNA probe containing the pituitary glycoprotein
basal element, a LIM factor binding site (7) from the mouse
glycoprotein hormone
-subunit promoter. Protein-DNA complexes were
resolved on a nondenaturing polyacrylamide gel, the gel dried and
exposed to x-ray film. B, the same cell extracts used for
the mobility shift in panel A were assayed for protein
expression. The extracts were resolved by denaturing polyacrylamide gel
electrophoresis, transferred to a membrane, and then incubated with a
1:10,000 dilution of Lhx3 antiserum. A horseradish peroxidase-labeled
anti-rabbit secondary antibody was used with a chemiluminescent
detection reagent to visualize the immunoreactive proteins.

View larger version (18K):
[in a new window]
Fig. 2.
Activation of a prolactin reporter gene by
Pit-1 and Lhx3. A, cultured 293 cells were transfected
with a reporter gene containing the proximal region and promoter of the
rat prolactin gene linked to luciferase and expression vectors for
Pit-1 and wild type or mutant Lhx3 as indicated. The cells also
received an expression vector for
-galactosidase driven by a
cytomegalovirus promoter as an internal standard. The amount of
expression vector was kept constant for all transfections by the
inclusion of empty expression vector. Values were corrected for
-galactosidase activity and are the average ± S.E. of three
independent transfections. B, the triplicate cell extracts
for each group from the transient transfection in panel A
were combined and then resolved by denaturing polyacrylamide gel
electrophoresis, transferred to a membrane, and incubated with a
1:10,000 dilution of Lhx3 antiserum. A horseradish peroxidase-labeled
anti-rabbit secondary antibody was used with a chemiluminescent
detection reagent to visualize the immunoreactive proteins.
-subunit gene and
activate transcription (4, 10). Interestingly, mutation of the
pituitary glycoprotein hormone basal element reduces the ability of Ras
to stimulate
-subunit promoter activity. Direction of GAL4-Lhx3 to
bind to this site can restore Ras responsiveness (10). We have used
this assay to examine the ability of the Lhx3 LIM mutations to support
a Ras response (Fig. 3). The
T3-1 gonadotrope-derived cell line was transfected with a GAL4-Lhx3 expression vector and the glycoprotein hormone reporter gene containing a GAL4-binding site replacing the Lhx2/Lhx3-binding site. As expected, this reporter does not support a Ras response when transfected alone
because the GAL4-binding site has disrupted the Lhx3-binding site.
Transfection of a GAL4 DNA-binding domain expression vector did not
rescue the response. As has been previously reported (10), an
expression vector for GAL4 fused to the wild type Lhx3 LIM domain
increased basal reporter gene activity and supported a substantial
response to transfection of the activated Ras. In contrast, GAL4 fused
to any of the three mutant Lhx3 proteins did not support Ras
responsiveness. Immunoblot analysis demonstrates that all the GAL4
fusion proteins are expressed at approximately the same levels (Fig.
3B). Thus, this assay using a glycoprotein hormone
-subunit reporter provides evidence that mutation of tyrosine 114 of
Lhx3 greatly reduces the ability of the transcription factor to mediate
transcriptional responses to the Ras/mitogen-activated protein kinase
pathway.

View larger version (14K):
[in a new window]
Fig. 3.
Comparison of the ability of wild type and
mutant Lhx3 LIM domain to permit Ras responsiveness of a modified
glycoprotein hormone
-subunit reporter
gene. A,
T3-1 cells were transfected with a
luciferase reporter gene containing the
507 to
205 region of the
mouse glycoprotein hormone
-subunit gene in which the LIM
factor-binding site was replaced with a GAL4-binding site (10). The
cells also received an expression vector for either the GAL4
DNA-binding domain alone (
) or the GAL4 DNA-binding domain fused to
either the wild type or mutant Lhx3 LIM domain (residues 25 to 222) as
indicated. The cells were also transfected with an expression vector
for
-galactosidase driven by a cytomegalovirus promoter as an
internal standard. The amount of expression vector was kept constant
for all transfections by the inclusion of empty expression vector.
Values were corrected for
-galactosidase activity and are the
average ± S.E. of three independent transfections. B,
in a separate experiment the same transient transfection as in
panel A was performed on a larger scale. Whole cell extracts
were prepared and proteins resolved by denaturing polyacrylamide gel
electrophoresis, transferred to a membrane, and then incubated with a
1:10,000 dilution of the GAL4 monoclonal antibody. A horseradish
peroxidase-labeled anti-mouse secondary antibody was used with a
chemiluminescent detection reagent to visualize the immunoreactive
proteins.
![]()
View larger version (16K):
[in a new window]
Fig. 4.
Analysis of the interaction of NLI, SLB, and
Pit-1 with wild type and mutant Lhx3 in vitro.
A, radiolabeled wild type and mutant Lhx3 were prepared by
cell-free translation in the presence of [35S]methionine
and then incubated with GST, GST-NLI295-375
(GST-NLI), or GST- SLB1213-1265
(GST-SLB) fusion proteins immobilized on agarose beads. The
agarose beads were washed and the eluted proteins analyzed by
denaturing gel electrophoresis. The gel was dried and exposed to x-ray
film. B, the experiment was performed as in panel
A except Lhx3 proteins were incubated with FLAG epitope-tagged
Pit-1 immobilized on agarose beads.

View larger version (18K):
[in a new window]
Fig. 5.
Analysis of the interaction of wild type and
mutant Lhx3 with NLI and SLB in HEK 293 cells. A, HEK
293 cells were transfected with a reporter construct containing five
copies of a GAL4-binding site upstream of the minimal thymidine kinase
luciferase reporter and expression vectors for the GAL4 DNA-binding
domain alone (
) or the GAL4 DNA-binding domain fused to either wild
type or mutant Lhx3 LIM domain as indicated. The cells were also
transfected with an empty expression vector control or an expression
vector for VP16 fused to either residues 295-375 of NLI (NLI-VP16) or
residues 1213-1265 of SLB (SLB-VP16). The cells also received an
expression vector for
-galactosidase driven by a cytomegalovirus
promoter as an internal standard. The amount of expression vector was
kept constant for all transfections by the inclusion of empty
expression vector. Values were corrected for
-galactosidase activity
and are the average ± S.E. of three independent transfections.
B, in a separate experiment 293 cells were transfected with
the expression vectors for the GAL4 DNA-binding domain fusions used in
panel A. Whole cell extracts were then prepared and proteins
resolved by denaturing polyacrylamide gel electrophoresis, transferred
to a membrane, and then incubated with a 1:10,000 dilution of the GAL4
monoclonal antibody. A horseradish peroxidase-labeled anti-mouse
secondary antibody was used with a chemiluminescent detection reagent
to visualize the immunoreactive proteins.
-subunit reporter gene (Fig.
6B). As described above, this assay uses a reporter gene in
which the Lhx2/Lhx3-binding site has been disrupted with a GAL4-binding
site. The reporter gene was transfected with GAL4 fusions to the
individual or combined LIM domains of Lhx3. As shown above, the fusion
of GAL4 to both LIM domains supports a substantial Ras response. The
GAL4-LIM1 fusion was not able support a Ras response and GAL4-LIM2
supported a weak Ras response. All of the LIM domain proteins were
expressed at similar levels (Fig. 6C). Similar to the
effects of point mutations, these findings demonstrate a correlation
between SLB binding to the Lhx3 constructs and the ability of the
constructs to support a Ras response when directed to the appropriate
context in the glycoprotein hormone
-subunit gene.

View larger version (19K):
[in a new window]
Fig. 6.
Comparison of the ability of individual LIM
domains of Lhx3 to bind to NLI and SLB and to support Ras
responsiveness. A, 293 cells were transfected with a
reporter construct containing five copies of a GAL4-binding site
upstream of the minimal thymidine kinase luciferase reporter and
expression vectors for the GAL4 DNA-binding domain alone or the GAL4
DNA-binding domain fused to either both LIM domains
(LIM1,2), the first LIM domain
(LIM1), or the second LIM domain
(LIM2) of Lhx3 as indicated. The cells were also
transfected with an empty expression vector control or an expression
vector for VP16 fused to either residues 295-375 of NLI
(NLI-VP16) or residues 1213-1265 of SLB
(SLB-VP16). The cells also received an expression vector for
-galactosidase driven by a cytomegalovirus promoter as an internal
standard. The amount of expression vector was kept constant for all
transfections by the inclusion of empty expression vector. Values were
corrected for
-galactosidase activity and are the average ± S.E. of three independent transfections. B,
T3-1 cells
were transfected with a luciferase reporter gene containing the
507
to
205 region of the mouse glycoprotein hormone
-subunit gene in
which the LIM factor-binding site was replaced with a GAL4-binding site
(10). The cells also received expression vectors for the GAL4
DNA-binding domain alone (
) or the GAL4 DNA-binding domain fusion to
either both LIM domains (LIM1,2), the first LIM
domain (LIM1), or the second LIM domain
(LIM2) of Lhx3 as indicated. The cells were
transfected with an empty expression vector control or an expression
vector for constitutively active Ras and all cells also received an
expression vector for
-galactosidase driven by a cytomegalovirus
promoter as an internal standard. The amount of expression vector was
kept constant for all transfections by the inclusion of empty
expression vector. Values were corrected for
-galactosidase activity
and are the average ± S.E. of three independent transfections. In
a separate experiment
T3-1 cells were transfected with the
expression vectors for the GAL4 DNA-binding domain fusions used in
panels A and B. Whole cell extracts were then
prepared and proteins resolved by denaturing polyacrylamide gel
electrophoresis, transferred to a membrane, and then incubated with a
1:10,000 dilution of the GAL4 monoclonal antibody. A horseradish
peroxidase-labeled anti-mouse secondary antibody was used with a
chemiluminescent detection reagent to visualize the immunoreactive
proteins.

View larger version (40K):
[in a new window]
Fig. 7.
Co-immunoprecipitation of Lhx3 with
SLB1213-1749. Cultured HEK 293 cells were transfected
with expression vectors for SLB1213-1749
(SLBCOOH), Lhx3, or FLAG-tagged wild type and mutant Lhx3
as indicated. The total amount of expression vector was kept constant
by the inclusion of empty expression vector. Whole cell extracts were
prepared and then either directly electrophoresed on a denaturing gel
(Input) or immunoprecipitated with a mouse anti-FLAG
monoclonal antibody (Co-IP) and then resolved by denaturing
gel electrophoresis. The separated proteins were transferred to a
membrane and then incubated with a 1:5000 dilution of either Lhx3
antiserum (Input) or SLB antiserum
(SLBCOOH). A horseradish peroxidase-labeled
secondary antibody was used with a chemiluminescent detection reagent
to visualize the immunoreactive proteins.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-subunit promoter.
Protein-protein interaction studies demonstrated that the Y114C LIM
mutation essentially abrogates binding of Lhx3 to the putative
co-activator/adapter protein, SLB. These changes in protein-protein
interaction provide a possible mechanism mediating the reduced
transcriptional activity. As Lhx3 has been shown to be capable of
stimulating the promoters for a number of pituitary hormone genes (4),
a decrease in the transcriptional activity of Lhx3 would presumably
lead to decreased expression of several pituitary hormone genes leading
to hormone deficiency. Lhx3 also has effects on the development of a
number of pituitary cell lineages (18, 19). Thus, it is also possible
that the decreased transcriptional activity of LHX3 may have effects on
development of specific cells in the pituitary and the lack of these
cells contributes to the hormone deficiency syndrome.
-subunit
reporter gene. These findings suggest that although the binding of NLI
to Lhx3 may be important, in at least some contexts the interaction
probably is not sufficient for transcriptional activation. This
conclusion would be consistent with previous studies demonstrating that
forced recruitment of GAL4-NLI to the
-subunit reporter gene does
not lead to transcriptional activation (10).
-subunit promoter. This correlation is consistent with a possible
involvement of SLB playing some role in mediating Ras responsiveness of
the glycoprotein hormone
-subunit promoter. Previous studies have
shown that forced expression of the LIM-interacting domain of SLB can
reduce the ability of Ras to activate the prolactin promoter in GH3
lactotroph cells (17). Thus there is an accumulating body of evidence
implicating the interaction of Lhx3 with SLB in mediating Ras
responsiveness of specific promoters. Further studies will be required
to determine if Ras activation leads to changes in the phosphorylation
of Lhx3 or SLB or changes in the interaction of these factors with
other transcription factors, co-activators, or adapter proteins.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Reginald Schafer for construction of several of the Lhx3 mutants and Shall Jue and Bobbi Maurer for assistance with these studies.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grants DK36407 and DK40339 (to R. A. M).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Cell and
Developmental Biology, Oregon Health Sciences University, 3181 S.W. Sam
Jackson Park Rd., Portland, OR 97201. Tel.: 503-494-7566; Fax:
503-494-4253; E-mail: maurerr@ohsu.edu.
Published, JBC Papers in Press, March 15, 2001, DOI 10.1074/jbc.M101782200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: Lhx, LIM homeodomain transcription factor; NLI, nuclear LIM interactor; SLB, selective LIM domain binding protein; GST, glutathionine S-transferase.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Jurata, L. W., and Gill, G. N. (1998) Curr. Top. Microbiol. Immunol. 228, 75-113 |
| 2. | Dawid, I. B., Breen, J. J., and Toyama, R. (1998) Trends Genet. 14, 156-162 |
| 3. | Dawid, I. B. (1998) Trends Genet. 14, 480-482 |
| 4. | Bach, I., Rhodes, S. J., Pearse, R. V., II, Heinzel, T., Gloss, B., Scully, K. M., Sawchenko, P. E., and Rosenfeld, M. G. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2720-2724 |
| 5. | Seidah, N. G., Barale, J.-C., Marcinkiewicz, M., Mattei, M.-G., Day, R., and Chrétien, M. (1994) DNA Cell Biol. 13, 1163-1180 |
| 6. | Sharma, K., Sheng, H. Z., Lettieri, K., Li, H., Karavanov, A., Potter, S., Westphal, H., and Pfaff, S. L. (1998) Cell 95, 817-828 |
| 7. | Roberson, M. S., Schoderbek, W. E., Tremml, G., and Maurer, R. A. (1994) Mol. Cell. Biol. 14, 2985-2993 |
| 8. | Girardin, S. E., Benjannet, S., Barale, J.-C., Chrétien, M., and Seidah, N. G. (1998) FEBS Lett. 431, 333-338 |
| 9. | Meier, B. C., Price, J. R., Parker, G. E., Bridwell, J. L., and Rhodes, S. J. (1999) Mol. Cell. Endocrinol. 147, 65-74 |
| 10. | Glenn, D. J., and Maurer, R. A. (1999) J. Biol. Chem. 274, 36159-36167 |
| 11. | Schmeichel, K. L., and Beckerle, M. C. (1994) Cell 79, 211-219 |
| 12. | Feuerstein, R., Wang, X., Song, D. C., Cooke, N. E., and Liebhaber, S. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10655-10659 |
| 13. | Agulnick, A. D., Taira, M., Breen, J. J., Tanaka, T., Dawid, I. B., and Westphal, H. (1996) Nature 384, 270-272 |
| 14. | Jurata, L. W., Kenny, D. A., and Gill, G. N. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 11693-11698 |
| 15. | Bach, I., Carrière, C., Ostendorff, H. P., Andersen, B., and Rosenfeld, M. G. (1997) Genes Dev. 11, 1370-1380 |
| 16. | Jurata, L., and Gill, G. N. (1997) Mol. Cell. Biol. 17, 5688-5698 |
| 17. | Howard, P. W., and Maurer, R. A. (2000) J. Biol. Chem. 275, 13336-13342 |
| 18. | Sheng, H. Z., Zhadnov, A. B., Mosinger, B., Jr., Fujii, T., Bertuzzi, S., Grinberg, A., Lee, E. J., Huang, S.-P., Mahon, K. A., and Westphal, H. (1996) Science 272, 1004-1007 |
| 19. | Sheng, H. Z., Moriyama, K., Yamashita, T., Li, H., Potter, S. S., Mahon, K. A., and Westphal, H. (1997) Science 278, 1809-1812 |
| 20. | Thor, S., Andersson, S. G. E., Tomlinson, A., and Thomas, J. B. (1999) Nature 397, 76-80 |
| 21. | Netchine, I., Sobrier, M.-L., Krude, H., Schnabel, D., Maghnie, M., Marcos, E., Duriez, B., Cacheux, V., Moers, A. V., Goossens, M., Gruters, A., and Amselem, S. (2000) Nat. Genet. 25, 182-186 |
| 22. | Windle, J. J., Weiner, R. I., and Mellon, P. L. (1990) Mol. Endocrinol. 4, 597-603 |
| 23. | Iverson, R. A., Day, K. H., d'Emden, M., Day, R. N., and Maurer, R. A. (1990) Mol. Endocrinol. 4, 1564-1571 |
| 24. | Sun, P., Enslen, H., Myung, P. S., and Maurer, R. A. (1994) Genes Dev. 8, 2527-2539 |
| 25. | Sun, P., and Maurer, R. A. (1995) J. Biol. Chem. 270, 7041-7044 |
| 26. | Schoderbek, W. E., Roberson, M. S., and Maurer, R. A. (1993) J. Biol. Chem. 268, 3903-3910 |
| 27. | Smith, D. B., and Johnson, K. S. (1988) Gene (Amst.) 67, 31-40 |
| 28. | Sánchez-García, I., and Rabbits, T. H. (1994) Trends Genet. 10, 315-321 |
| 29. | Pérez-Alvarado, G. C., Kosa, J. L., Louis, H. A., Beckerle, M. C., Winge, D. R., and Summers, M. E. (1996) J. Mol. Biol. 257, 153-174 |
| 30. | Sloop, K. W., Meier, B. C., Bridwell, J. L., Parker, G. E., Schiller, A. M., and Rhodes, S. J. (1999) Mol. Endocrinol. 13, 2212-2225 |
| 31. | Breen, J. J., Agulnick, A. D., Westphal, H., and Dawid, I. B. (1998) J. Biol. Chem. 273, 4712-4717 |
| 32. | Morcillo, P., Rosen, C., Baylies, M. K., and Dorsett, D. (1997) Genes Dev. 11, 2720-2740 |
| 33. | Milan, M., and Cohen, S. M. (1999) Mol. Cell 4, 267-273 |
| 34. | van Meyel, D. J., O'Keefe, D. D., Jurata, L. W., Thor, S., Gill, G. N., and Thomas, J. B. (1999) Mol. Cell 4, 259-266 |
This article has been cited by other articles:
![]() |
K. Ayyanathan, H. Peng, Z. Hou, W. J. Fredericks, R. K. Goyal, E. M. Langer, G. D. Longmore, and F. J. Rauscher III The Ajuba LIM Domain Protein Is a Corepressor for SNAG Domain Mediated Repression and Participates in Nucleocytoplasmic Shuttling Cancer Res., October 1, 2007; 67(19): 9097 - 9106. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Pfaeffle, J. J. Savage, C. S. Hunter, C. Palme, M. Ahlmann, P. Kumar, J. Bellone, E. Schoenau, E. Korsch, J. H. Bramswig, et al. Four Novel Mutations of the LHX3 Gene Cause Combined Pituitary Hormone Deficiencies with or without Limited Neck Rotation J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1909 - 1919. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. S. Bhangoo, C. S. Hunter, J. J. Savage, H. Anhalt, S. Pavlakis, E. C. Walvoord, S. Ten, and S. J. Rhodes A Novel LHX3 Mutation Presenting as Combined Pituitary Hormonal Deficiency J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 747 - 753. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Yaden, M. Garcia III, T. P. L. Smith, and S. J. Rhodes Two Promoters Mediate Transcription from the Human LHX3 Gene: Involvement of Nuclear Factor I and Specificity Protein 1 Endocrinology, January 1, 2006; 147(1): 324 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. West, G. E. Parker, J. J. Savage, P. Kiratipranon, K. S. Toomey, L. R. Beach, S. C. Colvin, K. W. Sloop, and S. J. Rhodes Regulation of the Follicle-Stimulating Hormone {beta} Gene by the LHX3 LIM-Homeodomain Transcription Factor Endocrinology, November 1, 2004; 145(11): 4866 - 4879. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Jorgensen, C. C. Quirk, and J. H. Nilson Multiple and Overlapping Combinatorial Codes Orchestrate Hormonal Responsiveness and Dictate Cell-Specific Expression of the Genes Encoding Luteinizing Hormone Endocr. Rev., August 1, 2004; 25(4): 521 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Sloop, C. J. Dwyer, and S. J. Rhodes An Isoform-specific Inhibitory Domain Regulates the LHX3 LIM Homeodomain Factor Holoprotein and the Production of a Functional Alternate Translation Form J. Biol. Chem., September 21, 2001; 276(39): 36311 - 36319. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |