![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 22, 19052-19058, June 1, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1
Null Cells to Alkylating Agents Reveals a Novel Link between TGF
Signaling and O6-Methylguanine
Methyltransferase Promoter Hypermethylation*
,
From the
Toxicology Laboratory, Pharmaceutical
Research Laboratories, Taisho Pharmaceuticals, Tokyo 170-8633, Japan and § Laboratory of Cellular Carcinogenesis and Tumor
Promotion, NCI, National Institutes of Health,
Bethesda, Maryland, 20892
Received for publication, January 23, 2001, and in revised form, March 15, 2001
| |
ABSTRACT |
|---|
|
|
|---|
Inactivation of the transforming growth
factor Inactivation of tumor suppressor genes is a common feature of
cancer development in humans and animal models. There is increasing evidence that methylation of normally unmethylated CpG islands in gene
promoters is an important epigenetic mechanism for transcriptional inactivation of tumor suppressor and DNA repair genes (1-3). One DNA
repair gene that is frequently hypermethylated in tumors is
methylguanine methyltransferase
(MGMT)1 (4, 5). MGMT removes
alkyl adducts from O6-guanine residues by
transferring the alkyl group to an active cysteine residue within its
sequence in a reaction that inactivates further enzymatic activity (6).
Since O6-alkylated guanine can mispair with
thymine during replication to cause transversions as well as cross-link
with cytosines on the opposite DNA strand (6), cells that are deficient
in MGMT activity may be more susceptible to mutation and, hence, cancer development or progression. Supporting this role in cancer development, transgenic animals overexpressing MGMT are resistant to tumor formation
induced by alkylating agents (7), whereas MGMT null animals exhibit an
increased frequency of methylnitrosourea-induced tumors (8).
TGF Cell Culture--
The TGF Clonogenic Survival Assay--
Approximately 500 cells of each
cell line were seeded into 60-cm2 culture dishes and
allowed to attach for 24 h. Cells were treated with serial
dilutions of the different drugs for 1 h in complete medium, then
placed in fresh medium without drug and allowed to proliferate for
7-14 days. For MGMT Enzyme Activity Assay--
MGMT activity in crude
cellular extracts was determined by measuring the transfer of
3H from [3H]methylated Micrococcus
luteus DNA to an acid-insoluble protein fraction (26). Briefly,
cellular extracts were prepared by sonication of cell pellets in a
buffer containing 50 mM Hepes, pH 7.6, 100 mM
KCl, 1 mM EDTA, 5 mM dithiothreitol. 50-200
µg of protein was incubated with the 3H substrate
prepared from purified M. luteus DNA as described (27) at
37 °C for 30 min and then precipitated with 1 M
perchloric acid. Precipitated protein and DNA was then heated to
70 °C for 1 h to hydrolyze precipitated DNA, and after washing,
the amount of 3H remaining in the insoluble fraction was
determined by liquid scintillation counting (26). The reaction was
linear between 25 and 500 µg of cellular extract.
Northern and Southern Blot Analysis--
mRNA was prepared
from cell lines using the FastTrack mRNA isolation kit
(Invitrogen). 2 µg of poly(A) RNA was electrophoresed through a 1%
formaldehyde-agarose gel and transferred to Nytran filters (Schleicher
& Schuel). Northern filters were hybridized to
[32P]dCTP-labeled DNA probes in 50% formamide at
42 °C. The methylpurine glycosylase cDNA was obtained from ATCC.
The human MGMT cDNA was isolated from pKT100 (28). Genomic DNA was
isolated from cultured cells according to standard methods (29), and 40 µg was restricted with either MspI or HpaII,
electrophoresed through a 2% agarose gel, and transferred to Nytran
filters. The filters were hybridized to a 1.9-kilobase pair PCR
fragment of the mouse MGMT promoter. Primers used for amplification
were obtained from the published sequence (30),
5'-GGATCCCAGTTCTAATTGGGCCTT, downstream
5'-CACCAAGATCTGGCACTGAGAAAT.
Methylation-specific PCR--
CpG methylation patterns in
the mouse MGMT promoter were identified using sodium bisulfite
modification, which converts unmethylated cytosines to uracil, and
subsequent PCR amplification using primers specific for either the
unmethylated or methylated modified DNA (31). 1 µg of genomic DNA was
modified with sodium bisulfite and purified (31). For the mouse MGMT
promoter, the following primer pairs were identified using the CpGware
program (Intergen) and used to specifically amplify unmodified DNA,
5'-CTCCCAGAGCCACGCCCCGCGT, downstream 5'-GTGCACGGGGTGGGGGCGGGG;
modified unmethylated DNA, TTTGGTAGTTTTTAGAGTTATGTTTTGTGT,
downstream 5'-CCACAAACACATACACAAAATAAAAACAAAA; modified methylated DNA,
5'-GGTAGTTTTTAGAGTTACGTTTCGCGT, downstream 5'-CAAACGCGTACACGAAATAAAAACGAAA.
PCR reactions were carried out in a 20-µl volume using 100 ng of
modified DNA, 1× PCR buffer (PerkinElmer Life Sciences) 0.2 units of Amplitaq Gold (PerkinElmer Life Sciences) under the following amplification conditions: 94 °C for 90 s, 60 °C for 90 s; 72 °C for 2 min for 35 cycles. With these conditions, no
amplification was observed with the wild type primers on modified DNA
or with unmethylated/methylated primers on unmodified DNA. Controls
without DNA were performed with each set of PCR. PCR products were
electrophoresed through a 2% agarose gel and visualized by ethidium
bromide fluorescence.
Bisulfite Sequencing--
Genomic DNA was treated with bisulfite
as above, and a 560-base pair fragment between 1401 and 1960 of the
published mouse MGMT promoter sequence (30) was amplified using primers
that are independent of methylation state and recognize
bisulfite-modified DNA. The PCR primers were
5'-TTTAGTTGGGTAGTGATTGGATTTTTAGTG and 5'-CCCCAAAACTCACCAACTTACAAACTACAA. The PCR fragment was cloned into
pCR2.1 using the TA-cloning method (Invitrogen), and selected clones
were sequenced with M13 primers using the dye terminator DNA-sequencing
kit (PE Applied Biosystems) with a PerkinElmer ABI Prism 377 DNA sequencer.
Sensitivity of TGF Increased Sensitivity to MNNG Due to Absence of MGMT--
MNNG and
methylnitrosourea produce a high proportion of
O6-methylguanine adducts that are specifically
repaired by the enzyme O6-methylguanine DNA
methyltransferase (MGMT) (6). Cells that lack this enzyme exhibit
increased sensitivity to cell killing by alkylating agents (4). The
level of MGMT enzyme activity in the TGF Hypermethylation of MGMT Promoter in TGF 5-Azacytidine Causes Demethylation and Reexpression of MGMT
mRNA--
To further strengthen the link between methylation of
the MGMT promoter and lack of mRNA expression in the TGF Relationship of TGF Inactivation of the TGF Bisulfite sequencing revealed that although the MGMT promoter was
hypermethylated in the KO3 cell line, there was heterogeneity between
individual DNA clones sequenced and regions of both frequent and rare
methylation. Similar heterogeneity of methylation at specific CpG sites
between individual DNA clones was also found by bisulfite sequencing of
the human MGMT promoter from the Mer An important question left unresolved is how loss of autocrine TGF In conclusion we have demonstrated distinct patterns of CpG methylation
at the MGMT promoter in immortal keratinocyte lines, which differ by
ability to produce autocrine TGF
(TGF
)-signaling pathway and gene silencing through
hypermethylation of promoter CpG islands are two frequent alterations
in human and experimental cancers. Here we report that nonneoplastic
TGF
1
/
keratinocyte cell lines exhibit increased sensitivity to
cell killing by alkylating agents, and this is due to lack of
expression of the DNA repair enzyme
O6-methylguanine DNA methyltransferase (MGMT).
In TGF
1
/
but not TGF
1+/
cell lines, the CpG dinucleotides
in the MGMT promoter are hypermethylated, as measured by restriction
enzyme analysis and methylation specific polymerase chain reaction. In
one unstable TGF
1+/
cell line, loss of the wild type TGF
1
allele correlates with the appearance of methylation in the MGMT
promoter. Bisulfite sequencing shows that in the KO3 TGF
1
/
cell
line nearly all of the 28 CpG sites in the MGMT promoter 475 base pairs
upstream of the start site of transcription are methylated, whereas
most are unmethylated in the H1 TGF
1+/
line. Treatment of the
TGF
1
/
cell lines with 5-azacytidine causes reexpression of MGMT
mRNA and demethylation of CpG islands in the promoter. Analysis of the time course of methylation using methylation-specific polymerase chain reaction shows a lack of methylation in primary TGF
1
/
keratinocytes and increasing methylation with passage number of immortalized clones. Subcloning of early passage clones reveals a
remarkable heterogeneity and instability of the methylation state in
the TGF
1
/
keratinocytes. Thus, the TGF
1
/
genotype does
not directly regulate MGMT methylation but predisposes cells to
immortalization-associated MGMT hypermethylation.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1 is a member of a large family of multifunctional secreted
polypeptides that are potent growth inhibitors of epithelial cells (9).
In human cancers and animal models of multistage carcinogenesis,
inactivation of TGF
signaling through mutations in the receptors
(10-12) or intracellular Smad proteins (13-16) is associated
with accelerated premalignant progression and malignant conversion. In
the mouse epidermal carcinogenesis model, TGF
1 acts as a tumor
suppressor since progression of chemically induced benign tumors is
associated with loss of TGF
1 (17, 18), and genetic inactivation of
the signaling pathway in keratinocytes leads to rapid progression to
squamous cell carcinoma (19, 20). To understand the mechanism by which
loss of autocrine TGF
signaling leads to accelerated tumor
progression, we established a series of nonneoplastic, spontaneously
immortal cell lines derived from newborn mouse TGF
1+/
and
/
keratinocytes. The TGF
1
/
cell lines had a significantly higher
level of gene amplification than controls (21). To explore further the
role of TGF
1 in genomic stability, we have examined the response of
TGF
1+/
and TGF
1
/
cell lines to different DNA-damaging
agents. Our results show that the TGF
1
/
cell lines are
specifically more sensitive to cell killing by alkylating agents, and
this is due to a lack of expression of MGMT mRNA and enzyme.
Southern blot, MSP, and bisulfite sequencing of the MGMT promoter
indicates that the lack of expression is due to hypermethylation of CpG
islands in the MGMT promoter. This is the first demonstration of a link
between TGF
1 expression and aberrant promoter methylation, and it
could have important implications for mechanisms of tumor progression
caused by inactivation of TGF
signaling.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1+/
and TGF
1
/
cell lines
are spontaneously immortal, clonally derived non-tumorigenic
keratinocyte cell lines isolated from primary epidermal cultures of
newborn mice from the TGF
1
/
strain (19, 22). Cells were
routinely cultured in Earle's minimum essential medium, 8%
chelexed fetal calf serum, 0.05 mM CaCl2, and
antibiotics. Unless indicated, all cell lines were used between passage
20-35. Balb/c keratinocytes were isolated from newborn Balb/c mice
using standard techniques (23) and cultured for 3-5 days before
isolation of DNA. For 5-azacytidine treatment, cells were seeded at
1 × 106 cells/175-cm2 tissue culture
flask, and exponentially growing cells were treated with 1 µM 5-azacytidine (Sigma) for 48 h. After a 3-day
recovery period, the treatment protocol was repeated, after which DNA
and RNA were isolated. To isolate subclones of the KO3 passage 8 line, cells were seeded at low density in 150-cm2 tissue culture
dishes, and colonies that grew out were ring-cloned, expanded to a T-75
flask, and DNA-isolated. To generate continuous lines, primary
TGF
1
/
keratinocytes were cultured in medium containing 10 ng/ml
keratinocyte growth factor for several weeks until immortal
colonies grew out. These colonies were pooled and passaged twice before
seeding at low density and ring-cloning. The TGF
1 wild type
keratinocyte cell line, NHK4, was clonally derived from newborn
keratinocyte cultures isolated from p53
/
mice (24). The B8 and M3
TGF
1 wild type cell lines were derived from newborn epidermis from
control mice of the c-fos
/
line (25).
and UV irradiation, the medium was removed, and
irradiation done in a small volume of phosphate-buffered saline. Gamma
irradiation was done with a MarkIV cesium source, and UV irradiation
was done with a Stratalinker (Stratagene) set to deliver a preset
joule/mm2. After irradiation, the medium was replaced.
Colonies were stained with 0.5% crystal violet, 10% formaldehyde and
counted with a dissecting microscope. Only colonies greater than 50 cells were counted. Each treatment was performed in triplicate, and the
percent of colonies relative to the untreated cells was determined. For each cell line and treatment, the concentration producing 50% inhibition of colony formation was determined from the dose-response curve.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1
/
Keratinocytes to Alkylating
Agents--
TGF
1+/
and
/
keratinocyte cell lines were treated
with different DNA-damaging agents, and the ability of the treated
cells to form viable colonies was used as a measure of relative DNA repair capacity. Fig. 1 shows that for UV
and
irradiation or cisplatin there was no consistent difference in
the IC50 for inhibition of colony formation between the
TGF
1
/
and TGF
1+/
genotypes. Similar dose-response curves
were obtained with the topoisomerase inhibitors camptothecin or
etoposide (data not shown). However, the TGF
1
/
cell lines were
5-fold more sensitive to cell killing by the alkylating agent MNNG than
the TGF
1+/
lines. Similar results were obtained with
methylnitrosourea (data not shown). TGF
1+/+ cell lines derived
independently from other transgenic lines (B8, M3, NHK4) had
sensitivities to MNNG that were similar to the TGF
1+/
cell lines.
Since the NHK4 cell line is p53
/
(24), the increased sensitivity to
alkylating damage is specific to the TGF
1
/
genotype.

View larger version (23K):
[in a new window]
Fig. 1.
TGF
1
/
keratinocyte cell lines are more sensitive to cell killing by
MNNG. Shown is the colony-forming ability of TGF
1+/+, +/
, and
/
keratinocyte cell lines after treatment with MNNG (A),
UV (B) and
(C) irradiation, or cisplatin
(D). Cells were plated at clonal density as described under
"Experimental Procedures," allowed to recover 24 h, and then
treated with the indicated concentration of the drug or irradiated.
Colonies, which formed 7-14 days after treatment, were stained and
counted, and the number of colonies formed at each dose was determined
as a percentage of the untreated control. Each dose was done in
triplicate. MNNG treatment was repeated 4 times with identical results.
TGF
1 wild type lines were generated from the epidermis of p53
/
mice (NHK4) and from the wild type genotype of c-fos
/
mice (B8, M3).
1+/
and TGF
1
/
keratinocyte cell lines was determined using a well characterized assay
that measures the ability of crude cellular extracts to transfer a
[3H]methyl group from M. luteus DNA to protein
(26). Table I shows that all
TGF
1+/cell lines had levels of MGMT activity ranging from
0.102-0.255 pmol/mg of protein. Treatment of these cells with
O6-benzylguanine, a specific inhibitor of MGMT,
eliminated enzyme activity. In contrast, 4/5 TGF
1
/
keratinocyte
cell lines had no detectable MGMT activity, whereas in KO6 the levels
were 0.005 pmol/mg of protein, barely above the background. Northern
blot analysis showed that the lack of MGMT enzyme in the TGF
1
/
cell lines was due to the absence of the MGMT transcript (Fig. 2). There was no difference between the two genotypes in expression of
another repair enzyme, methylpurine glycosylase, which removes N-methylpurines and other damaged purines in DNA (33) (Fig. 2). No difference in hybridization
pattern was seen when restriction-digested genomic DNA from the
TGF
1+/
and TGF
1
/
cell lines was hybridized to a MGMT
cDNA probe (data not shown). These results indicate that the lack
of MGMT expression in the TGF
1
/
cell lines was not due to
deletion or rearrangement of the MGMT gene.
Absence of MGMT enzyme activity in TGF
1
/
keratinocyte cell
lines
1
/
and +/
keratinocyte cell lines as described under "Experimental
Procedures." Values represent the average of 2-3 independent
determinations. MGMT activity was inhibited by
O6-benzylguanine (BZG), indicating specificity of
the enzyme activity measured for MGMT.

View larger version (42K):
[in a new window]
Fig. 2.
TGF
1
/
cell lines do not express MGMT mRNA. Northern blot
analysis of MGMT expression in poly(A)+ RNA isolated from TGF
1+/
and TGF
1
/
cell lines is shown. The Northern filters were
sequentially hybridized to a human MGMT cDNA probe (28), a
methylpurine glycosylase (MPG) cDNA, and a
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe.
Exposure times were 3-4 days for MGMT and methylpurine glycosylase
(MPG) and 1 h for glyceraldehyde-3-phosphate
dehydrogenase.
1
/
Keratinocytes--
A frequent mechanism for inactivation of MGMT
expression in human tumors and tumor cell lines is hypermethylation
of CpG islands in the gene promoter (3, 34). Initial Southern blot
analysis of methylation in the MGMT promoter using the
methylation-sensitive restriction enzyme pair MspI and
HpaII revealed specific methylation of the
328
HpaII site in two TGF
1
/
cell lines (not shown). To
assay the methylation status of the MGMT promoter in all cell lines, we
developed a methylation-specific PCR assay for the mouse MGMT promoter
(31). Treatment of DNA with bisulfate converts unmethylated cytosines
to uracil, whereas methylated cytosines are resistant to this chemical
modification (31). Specific primers were generated to distinguish
methylated (M) from unmethylated (U) DNA in the
mouse MGMT promoter based on sequence alterations following bisulfite
modification. Fig. 3 shows that in all of the TGF
1+/
lines as well as Balb/c keratinocytes, a PCR product was obtained after bisulfite modification only with the unmethylated PCR primers and not with the methylated primers. Thus some or all of
the CpG sites within these primer sequences are unmethylated in the
control cells. In contrast, the methylated primer pair yielded a strong
PCR product with bisulfite-modified DNA from all of the TGF
1
/
lines, whereas variable levels of PCR product was generated with the
unmethylated primer pair. To examine the extent of methylation in the
MGMT promoter, DNA from the KO3 and H1 cell lines at passage 35 was
subjected to bisulfite modification followed by sequencing of PCR
products amplified with non-methylation-specific primers. Of 28 CpG
dinucleotides between
475 and the start of transcription,
virtually all were unmethylated in different PCR clones from the H1
cell line. In contrast, between 57 and 82% of the CpG dinucleotides
were methylated in different PCR products sequenced from the KO3 cell
line (Fig. 4). Apart from a region just
upstream from
25, which was free of methylation in all clones, virtually the entire promoter was methylated.
![]()
View larger version (22K):
[in a new window]
Fig. 3.
MSP analysis of MGMT promoter CpG
methylation. A, genomic DNA from the indicated
TGF
1+/
and TGF
1
/
cell lines, and Balb/c keratinocytes
(B) was modified with bisulfite as described under
"Experimental Procedures" and analyzed for methylated CpG sites
using PCR primers, which distinguish unmethylated (U) and
methylated (M) sequences. Amplification did not occur with
either primer set using unmodified DNA. PCR products were analyzed on a
2% agarose gel and visualized by ethidium bromide fluorescence.
![]()
View larger version (13K):
[in a new window]
Fig. 4.
Bisulfite sequencing reveals extensive
methylation of the MGMT promoter in KO3 cells but not H1 cells.
Bisulfite-modified genomic DNA was sequenced as described under
"Experimental Procedures." Lollipops represent individual CpG sites
within the MGMT promoter. The methylation status of each site for
individual PCR clones sequenced is indicated by an open box
(unmethylated) or closed box (methylated). Four subcloned
PCR products were sequenced for the H1 line, and seven were sequenced
for the KO3 line. The arrow indicates the start site of
transcription.
1
/
lines, these cells were treated with 5-azacytidine to block
methylation. Fig. 5A shows
that after treatment of the TGF
1
/
cell lines with 5-azacytidine
MGMT mRNA was reexpressed (Fig. 5A). This correlated with demethylation of the MGMT promoter as measured by an increase in
the unmethylated- relative to the methylated-specific PCR product after
bisulfite modification and MSP in KO1 KO3 and KO6 DNA (Fig. 5B).

View larger version (45K):
[in a new window]
Fig. 5.
Demethylation of the MGMT promoter with
5-azacytidine causes reexpression of MGMT mRNA. A,
5-azacytidine induces MGMT mRNA expression in TGF
1
/
cell
lines. Northern blot analysis of MGMT mRNA expression in
TGF
1
/
cell lines treated with 1 µM 5-azacytidine
(5-AzaC) for 48 h. mRNA isolated from treated or
untreated cells was hybridized to a human MGMT cDNA probe and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Exposure
time was 1 week for MGMT. B, reduced MGMT promoter
methylation in 5-azacytidine-treated TGF
1
/
cell lines. Genomic
DNA from control and treated cells was modified with bisulfite as
described under "Experimental Procedures" and subjected to
methylation-specific PCR using primers specific for unmethylated
(U) and methylated (M) sequences.
1 to Methylation Is Indirect and Linked to
Immortalization--
To examine the correlation between the lack of
autocrine TGF
1 expression and aberrant methylation of the MGMT
promoter, we analyzed the MGMT methylation status in the unstable
TGF
1+/
cell line H7. Previous studies show that the TGF
1 wild
type allele in this cell line is lost with increasing passage (21).
Methylation-specific PCR analysis of the MGMT promoter in H7 showed
that at passage 9 a PCR product was generated only with the
unmethylated primer pair, but by passage 12, a methylated band is
evident, and this increases relative to the unmethylated band by
passage 24 (Fig. 6). These results
suggest that there is a close association between autocrine TGF
1
expression and hypermethylation of the MGMT promoter. However,
short or long term treatment of cells with TGF
1 did not alter MGMT
expression. Table II shows that treatment
of Balb/c primary keratinocytes with 0.5 ng/ml TGF
1 for 48 h
did not alter MGMT enzyme activity, nor did a similar treatment induce
expression of MGMT in the KO1 and KO3 cell lines. Additionally,
treatment of the KO3 cells with exogenous TGF
1 at 50 pg/ml for up to
1 month did not reduce methylation of the MGMT promoter. These results suggest that the effect of a TGF
1 null genotype on methylation of
the MGMT promoter is indirect or that once established, the methylation
pattern cannot be reversed by addition of TGF
1. To test whether
hypermethylation is an inherent property of the TGF
1 null cells, we
examined MGMT promoter methylation by MSP in primary keratinocytes of
all genotypes as well as TGF
1
/
cells at different times of
culture. Table II and Fig. 7A
show that regardless of TGF
1 genotype, all primary keratinocytes
express similar levels of MGMT enzyme and have an unmethylated MGMT
promoter. However, with continued passage of the null cells in culture,
a faint band was reproducibly detected with the methylated PCR primers
in passage 8 TGF
1
/
cells, and this increased in proportion such
that by passage 35 the predominant band was with the
methylated-specific primers. These results suggest that the methylation
state of the MGMT promoter is unstable in the KO keratinocytes. To test
this more directly, we subcloned the null keratinocytes at passage 2 and 8 and examined methylation status of these clones by MSP. Fig. 7,
B and C, shows that in subclones from both, there
is considerable variability in the methylation state of the MGMT
promoter. DNA from some clones was completely methylated (clones 1, 3, 4, 6, 8), whereas in others it was unmethylated (clones 2, 9, 10), and the remainder had amplification with both unmethylated- and
methylated-specific PCR primers. Thus the methylation state of the MGMT
promoter in the TGF
1
/
cells exhibits clonal- and
time-dependent variability.

View larger version (27K):
[in a new window]
Fig. 6.
Loss of wild type
TGF
1 allele in heterozygote cell line
correlates with increased methylation of the MGMT promoter.
Methylation-specific PCR analysis of H7 cell line at different
passages. The MGMT promoter is initially unmethylated in P9 of this
cell line, correlating wild type TGF
1 allele. In DNA of P12 and P24
cells there is an increase in MGMT promoter methylation corresponding
to loss of the wild type allele. U, unmethylated-specific
primer; M, methylated-specific primer.
TGF
1 does not directly regulate MGMT enzyme levels
1 for 48 h.

View larger version (48K):
[in a new window]
Fig. 7.
MGMT methylation increases with passage in
TGF
1
/
cells and exhibits clonal variation. A,
methylation of the MGMT promoter is not detected in primary cultures of
TGF
1
/
keratinocytes but increases with passage. MSP analysis of
MGMT promoter methylation in primary cultures of TGF
1+/+
(1) and TGF
1
/
keratinocytes (2), passage 2 mass cultures of immortalized TGF
1
/
keratinocytes
(3), passage 8 culture of KO3 cell line (4),
passage 32 of KO3 cell line (5), and passage 50 of KO3 cell
line (6). B, variable methylation in clones of
passage 2 TGF
1
/
keratinocytes. Colonies of keratinocytes were
ring-cloned and expanded, and the isolated DNA was subjected to
bisulfite modification and MSP. C, variable methylation in
clones of passage 8 KO3 cell line. Colonies of KO3 were ring-cloned and
expanded, and the isolated DNA was subjected to bisulfite modification
and MSP. U, unmethylated-specific primer; M,
methylated-specific primer.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
signaling pathway is a common event in
the progression of human and experimental cancers. In the multistage
skin carcinogenesis model v-rasHa retrovirus
transduced TGF
1
/
primary keratinocytes undergo rapid aneuploidy
in culture (35) and progress to squamous cell carcinoma, whereas
control genotypes show limited instability and progression in
vivo (19). Nontumorigenic cell lines derived from primary cultures
of TGF
1
/
keratinocytes also have a high frequency of gene
amplification
N-(phosphonacetyl)-L-aspartate (21), suggesting
that loss of autocrine TGF
1 signaling results in decreased genomic
stability and rapid malignant progression. Here we show that these
TGF
1
/
cell lines also exhibit a specific defect in the DNA
repair enzyme MGMT, which is crucial to repair of adducts caused by
alkylating agents. Relative to the TGF
1+/
cell lines, all of the
TGF
1
/
cell lines had a 5-fold increase in sensitivity to cell
killing by MMNG, which produces O6-methylguanine
adducts with high frequency. In addition, the TGF
1
/
cell lines
did not have measurable MGMT enzyme activity or express MGMT mRNA,
the enzyme responsible for repair of this DNA lesion (6). In contrast
there was no significant difference in sensitivity to
or UV
irradiation, cisplatin, or topoisomerase inhibitors. All of these
agents produce lesions that utilize repair pathways distinct from MGMT.
There was also no difference in mRNA expression of another repair
enzyme, methylpurine glycosylase, between the two TGF
1 genotypes,
pointing to a specific defect in MGMT expression. Using a combination
of Southern blot analysis with methylation-sensitive restriction
enzymes, methylation-specific PCR, and bisulfite sequencing, we found
that the promoter region of the mouse MGMT gene was also heavily
methylated in the MGMT-deficient TGF
1
/
cell lines but not in the
MGMT proficient TGF
1+/
cell lines. Furthermore, treatment of the
TGF
1
/
lines with 5-azacytidine caused reexpression of MGMT
mRNA expression and demethylation of the promoter. These results
are in agreement with many studies of MGMT expression in human cancers
and tumor cell lines that show a strong correlation between promoter
methylation and silencing of MGMT expression (4, 5) and support the
idea that hypermethylation of the MGMT promoter specifically in the
TGF
1
/
cell lines is responsible for lack of expression.
BE colon tumor cell
line (34). Whether this reflects cellular or allelic variability is not
clear, but it must reflect an inherent variability in the process of
methylation itself. The regions from
450 to
100 and
25 to +25
were highly methylated in all KO3 DNA copies sequenced, whereas there
was infrequent methylation in the region from
80 to
30. It is
remarkable that a similar regional pattern of CpG methylation is found
in the MGMT promoter of the BE and HeLa S3 tumor cell lines, with a
region of rare methylation between
100 to
30 surrounded by highly
methylated regions on either side (34) even though there is no sequence homology between the mouse (30) and human (36) MGMT promoters. 6/6
TGF
1
/
cell lines and none of the TGF
1+/
cell lines lacked MGMT expression and had a hypermethylated MGMT promoter. We found no
increase in sensitivity to MNNG in a p53
/
keratinocyte cell line
derived in a similar manner as the TGF
1
/
cell lines, pointing to
a specific defect of MGMT that is related to TGF
1 genotype and not
to a nonspecific effect of knockout production or inherent instability
related to loss of a tumor suppressor gene. However, primary
TGF
1
/
null keratinocytes were MGMT-proficient and did not have
apparent methylation as judged by the MSP assay, but rather this
analysis showed that methylation increased specifically during
passaging of the TGF
1
/
cells. Whether this represents a specific
growth advantage of rare cells with MGMT methylation and
TGF
-signaling defects or ongoing methylation of the promoter in the
absence of TGF
signaling will require bisulfite sequencing of cells
at different passage number for clarification. Although methylation was
undetectable in passage 2 and slightly detectable in passage 8 TGF
1
/
cells, subclones of these passages exhibited variable
methylation ranging from none to complete. Since the MSP assay is
reported to detect methylated alleles at a frequency of 0.1% (31), it
seems unlikely that the appearance of methylated alleles with such high
frequency in the subclones represents enrichment of rare cells with
methylation. Previous studies with fibroblasts show that genes
unmethylated in adult tissues or primary cell cultures become
methylated in immortal cell lines that grow out after crisis (37). A
plausible hypothesis is that TGF
1
/
cells are more susceptible to
hypermethylation, and this occurs randomly at the MGMT locus with every
cell division. Such a model would allow for recovery of clones
containing MGMT alleles that were unmethylated, completely methylated,
or both.
1
could be linked to hypermethylation. TGF
1 could directly regulate
expression of one of the DNA methyltransferases (DNMT1-3), a
demethylase (38), or proteins that bind to methylated DNA (39, 40).
Since DNMT1 is both regulated by Rb (41) and forms a complex with Rb,
E2F1, and HDAC1 (42), it is possible that altered TGF
1 signaling by
modulating the phosphorylation state of Rb could indirectly affect
DNMT1 levels or activity. However, the inability of short or long term
TGF
1 treatment to induce MGMT or reduce MGMT methylation in the
TGF
1
/
lines suggests that MGMT regulation by TGF
1 is indirect
and that hypermethylation, once achieved, is stable. Both the human and
mouse MGMT promoters contain regions of high GC content and multiple
SP1 sites (30, 36). A recent model for the evolution of
hypermethylation in promoters suggests that SP1 sites protect GC-rich
regions from spreading of methylation (43). It is intriguing that Smad3
and Smad4, intracellular mediators of TGF
1 signaling, can activate transcription through interaction with SP1 proteins and SP1 DNA binding
sites (44, 45). It is tempting to speculate that alterations in Smad
levels or activity due to inhibition of TGF
1 signaling could
influence occupancy of SP1 sites and effect increased accessibility to
de novo methylation.
1. Hypermethylation of the MGMT
promoter specifically in the TGF
1
/
keratinocytes occurs during
immortalization and subsequent passaging, suggesting that these cells,
because of the absence of TGF
1 signaling, are more susceptible to
hypermethylation. Analysis of CpG islands of a number of genes will be
required to determine if this is specific for the MGMT locus or
represents a general methylator phenotype. However, our results also
show that the MGMT promoter also becomes methylated during tumor
development in the mouse multistage skin carcinogenesis
model,2 suggesting that this
in vitro observation is relevant to neoplastic transformation of mouse keratinocytes in vivo. It
will be important to determine if aberrant MGMT methylation contributes
to either spontaneous or alkylation-induced mutation and transformation in the TGF
1
/
cells. Given that loss of expression of TGF
1 is
associated with malignant progression in the mouse skin tumor model
(17) and that defects in TGF
signaling occurs frequently in both
human tumors and tumor cell lines (10, 11, 32), it is tempting to
speculate that inactivation of the TGF
pathway may play a causal
role in the widespread hypermethylation of genes that occurs during
cancer development and progression.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge Dr. Brian Glassner, Harvard School of Public Health, for his advice on the MGMT activity assay, Dr. James Hermann, Johns Hopkins University, for advice on methylation-specific PCR, Drs. Wendy Weinberg and Susan Rutberg for cell lines, and Dr. Stuart Yuspa, NCI, National Institutes of Health for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed: Laboratory of Cellular Carcinogenesis and Tumor Promotion, Bldg. 37 3B19 National Cancer Institute, NIH, Bethesda, MD 20892. Tel.: 301-496-3248; Fax: 301-496-8709; E-mail: glicka@dc37a.nci.nih.gov
Published, JBC Papers in Press, March 21, 2001, DOI 10.1074/jbc.M100615200
2 N. Abdul-Fatah, submitted for publication.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: MGMT, O6-methylguanine DNA methyltransferase; PCR, polymerase chain reaction; MSP, methylation-specific PCR; TGF, transforming growth factor.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bachman, K. E., Herman, J. G., Corn, P. G., Merlo, A., Costello, J. F., Cavenee, W. K., Baylin, S. B., and Graff, J. R. (1999) Cancer Res. 59, 798-802 |
| 2. | Esteller, M., Sanchez-Cespedes, M., Rosell, R., Sidransky, D., Baylin, S. B., and Herman, J. G. (1999) Cancer Res. 59, 67-70 |
| 3. | Esteller, M., Hamilton, S. R., Burger, P. C., Baylin, S. B., and Herman, J. G. (1999) Cancer Res. 59, 793-797 |
| 4. | Yarosh, D. B., Foote, R. S., Mitra, S., and Day, R. S. (1983) Carcinogenesis 4, 199-205 |
| 5. | Chen, J. M., Zhang, Y. P., Wang, C., Sun, Y., Fujimoto, J., and Ikenaga, M. (1992) Carcinogenesis 13, 1503-1507 |
| 6. | Pegg, A. E., Dolan, M. E., and Moschel, R. C. (1995) Prog. Nucleic Acid Res. Mol. Biol. 51, 167-223 |
| 7. | Becker, K., Dosch, J., Gregel, C. M., Martin, B. A., and Kaina, B. (1996) Cancer Res. 56, 3244-3249 |
| 8. | Sakumi, K., Shiraishi, A., Shimizu, S., Tsuzuki, T., Ishikawa, T., and Sekiguchi, M. (1997) Cancer Res. 57, 2415-2418 |
| 9. | Wrana, J. L., Attisano, L., Carcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X. F., and Massague, J. (1992) Cell 71, 1003-1014 |
| 10. | Markowitz, S., Wang, J., Myeroff, L., Parsons, R., Sun, L., Lutterbaugh, J., Fan, R. S., Zborowska, E., Kinzler, K. W., Vogelstein, B., Brattain, M., and Willson, J. K. V. (1995) Science 268, 1336-1338 |
| 11. | Garrigue-Antar, L., Munoz-Antonia, T., Antonia, S. J., Gesmonde, J., Vellucci, V. F., and Reiss, M. (1995) Cancer Res. 55, 3982-3987 |
| 12. | Parsons, R., Myeroff, L. L., Liu, B., Willson, J. K., Markowitz, S. D., Kinzler, K. W., and Vogelstein, B. (1995) Cancer Res. 55, 5548-5550 |
| 13. | Howe, J. R., Roth, S., Ringold, J. C., Summers, R. W., Jarvinen, H. J., Sistonen, P., Tomlinson, I. P., Houlston, R. S., Bevan, S., Mitros, F. A., Stone, E. M., and Aaltonen, L. A. (1998) Science 280, 1086-1088 |
| 14. | Eppert, K., Scherer, S. W., Ozcelik, H., Pirone, R., Hoodless, P., Kim, H., Tsui, L. C., Bapat, B., Gallinger, S., Andrulis, I. L., Thomsen, G. H., Wrana, J. L., and Attisano, L. (1996) Cell 86, 543-552 |
| 15. | Riggins, G. J., Kinzler, K. W., Vogelstein, B., and Thiagalingam, S. (1997) Cancer Res. 57, 2578-2580 |
| 16. | Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T., Rozenblum, E., Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R. H., and Kern, S. E. (1996) Science 271, 350-353 |
| 17. | Glick, A. B., Kulkarni, A. B., Tennenbaum, T., Hennings, H., Flanders, K. C., O'Reilly, M., Sporn, M. B., Karlsson, S., and Yuspa, S. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6076-6080 |
| 18. | Cui, W., Kemp, C. J., Duffie, E., Balmain, A., and Akhurst, R. J. (1994) Cancer Res. 54, 5831-5836 |
| 19. | Glick, A. B., Lee, M. M., Darwiche, N., Kulkarni, A. B., Karlsson, S., and Yuspa, S. H. (1994) Genes Dev. 8, 2429-2440 |
| 20. | Amendt, C., Schirmacher, P., Weber, H., and Blessing, M. (1998) Oncogene 17, 25-34 |
| 21. | Glick, A. B., Weinberg, W. C., Wu, I. H., Quan, W., and Yuspa, S. H. (1996) Cancer Res. 56, 3645-3650 |
| 22. | Kulkarni, A. B., Huh, G. G., Becker, D., Geiser, A., Lyght, M., Flanders, K. C., Roberts, A. B., Sporn, M. B., Ward, J. M., and Karlsson, S. (1992) Proc. Natl. Acad. Sci. U. S. A. 90, 770-774 |
| 23. | Dlugosz, A. A., Glick, A. B., Tennenbaum, T., Weinberg, W. C., and Yuspa, S. H. (1995) Methods Enzymol 254, 3-20 |
| 24. | Azzoli, C. G., Sagar, M., Wu, A., Lowry, D., Hennings, H., Morgan, D. L., and Weinberg, W. C. (1998) Mol. Carcinog. 21, 50-61 |
| 25. | Saez, E., Rutberg, S. E., Mueller, E., Oppenheim, H., Smoluk, J., Yuspa, S. H., and Spiegelman, B. M. (1995) Cell 82, 721-732 |
| 26. | Margison, G. P., Butler, J., and Hoey, B. (1985) Carcinogenesis 6, 1699-1702 |
| 27. | Demple, B., Karran, P., Lindahl, T., Jacobsson, A., and Olsson, M. (1983) in DNA Repair: A Laboratory Manual of Research Procedures (Friedberg, E. C. , and Hanawalt, P. C., eds) , pp. 41-52, Marcel Dekker, Inc., New York |
| 28. | Tano, K., Shiota, S., Collier, J., Foote, R. S., and Mitra, S. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 686-690 |
| 29. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , p. 280, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY |
| 30. | Iwakuma, T., Shiraishi, N., Fukuhara, M., Kawate, H., and Sekiguchi, M. (1996) DNA Cell Biol. 15, 863-872 |
| 31. | Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9821-9826 |
| 32. | Manning, A. M., Williams, A. C., Game, S. M., and Paraskeva, C. (1991) Oncogene 6, 1471-1476 |
| 33. | Saffhill, R., Margison, G. P., and O'Connor, P. J. (1985) Biochim. Biophys. Acta 823, 111-145 |
| 34. | Qian, X. C., and Brent, T. P. (1997) Cancer Res. 57, 3672-3677 |
| 35. | Glick, A., Popescu, N., Alexander, V., Ueno, H., Bottinger, E., and Yuspa, S. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14949-14954 |
| 36. | Harris, L. C., Potter, P. M., Tano, K., Shiota, S., Mitra, S., and Brent, T. P. (1991) Nucleic Acids Res. 19, 6163-6167 |
| 37. | Jones, P. A., Wolkowicz, M. J., Rideout, W. M., III, Gonzales, F. A., Marziasz, C. M., Coetzee, G. A., and Tapscott, S. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 6117-6121 |
| 38. | Bhattacharya, S. K., Ramchandani, S., Cervoni, N., and Szyf, M. (1999) Nature 397, 579-583 |
| 39. | Hendrich, B., and Bird, A. (1998) Mol. Cell. Biol. 18, 6538-6547 |
| 40. | Fujita, N., Shimotake, N., Ohki, I., Chiba, T., Saya, H., Shirakawa, M., and Nakao, M. (2000) Mol. Cell. Biol. 20, 5107-5118 |
| 41. | Slack, A., Cervoni, N., Pinard, M., and Szyf, M. (1999) J. Biol. Chem. 274, 10105-10112 |
| 42. | Robertson, K. D., Ait-Si-Ali, S., Yokochi, T., Wade, P. A., Jones, P. L., and Wolffe, A. P. (2000) Nat. Genet. 25, 338-342 |
| 43. | Graff, J. R., Herman, J. G., Myohanen, S., Baylin, S. B., and Vertino, P. M. (1997) J. Biol. Chem. 272, 22322-22329 |
| 44. | Datta, P. K., Blake, M. C., and Moses, H. L. (2000) J. Biol. Chem. 275, 40014-40019 |
| 45. | Li, J. M., Datto, M. B., Shen, X., Hu, P. P., Yu, Y., and Wang, X. F. (1998) Nucleic Acids Res. 26, 2449-2456 |
This article has been cited by other articles:
![]() |
J. Kirshner, M. F. Jobling, M. J. Pajares, S. A. Ravani, A. B. Glick, M. J. Lavin, S. Koslov, Y. Shiloh, and M. H. Barcellos-Hoff Inhibition of Transforming Growth Factor-{beta}1 Signaling Attenuates Ataxia Telangiectasia Mutated Activity in Response to Genotoxic Stress Cancer Res., November 15, 2006; 66(22): 10861 - 10869. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-W. Chen, Y.-C. Chang, Y.-L. Lai, Y.-J. Chen, M.-J. Huang, Y.-S. Leu, Y.-K. Fu, L.-W. Wang, and J.-J. Hwang Change of Plasma Transforming Growth Factor-{beta}1 Levels in Nasopharyngeal Carcinoma Patients Treated with Concurrent Chemo-radiotherapy Jpn. J. Clin. Oncol., August 1, 2005; 35(8): 427 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
M H Barcellos-Hoff How tissues respond to damage at the cellular level: orchestration by transforming growth factor-{beta} (TGF-{beta}) Br. J. Radiol., January 1, 2005; Supplement_27(1): 123 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yoneda, T. Furukawa, Y.-J. Zheng, T. Momoi, I. Izawa, M. Inagaki, M. Manabe, and N. Inagaki An Autocrine/Paracrine Loop Linking Keratin 14 Aggregates to Tumor Necrosis Factor {alpha}-mediated Cytotoxicity in a Keratinocyte Model of Epidermolysis Bullosa Simplex J. Biol. Chem., February 20, 2004; 279(8): 7296 - 7303. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Ewan, R. L. Henshall-Powell, S. A. Ravani, M. J. Pajares, C. Arteaga, R. Warters, R. J. Akhurst, and M. H. Barcellos-Hoff Transforming Growth Factor-{beta}1 Mediates Cellular Response to DNA Damage in Situ Cancer Res., October 15, 2002; 62(20): 5627 - 5631. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||