JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M100615200 on March 21, 2001

J. Biol. Chem., Vol. 276, Issue 22, 19052-19058, June 1, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/22/19052    most recent
M100615200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamada, H.
Right arrow Articles by Glick, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamada, H.
Right arrow Articles by Glick, A.

Increased Sensitivity of Transforming Growth Factor (TGF) beta 1 Null Cells to Alkylating Agents Reveals a Novel Link between TGFbeta Signaling and O6-Methylguanine Methyltransferase Promoter Hypermethylation*

Hisaharu YamadaDagger , Kinnimulki Vijayachandra§, Carrie Penner§, and Adam Glick§

From the Dagger  Toxicology Laboratory, Pharmaceutical Research Laboratories, Taisho Pharmaceuticals, Tokyo 170-8633, Japan and § Laboratory of Cellular Carcinogenesis and Tumor Promotion, NCI, National Institutes of Health, Bethesda, Maryland, 20892

Received for publication, January 23, 2001, and in revised form, March 15, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Inactivation of the transforming growth factor beta  (TGFbeta )-signaling pathway and gene silencing through hypermethylation of promoter CpG islands are two frequent alterations in human and experimental cancers. Here we report that nonneoplastic TGFbeta 1-/- keratinocyte cell lines exhibit increased sensitivity to cell killing by alkylating agents, and this is due to lack of expression of the DNA repair enzyme O6-methylguanine DNA methyltransferase (MGMT). In TGFbeta 1-/- but not TGFbeta 1+/- cell lines, the CpG dinucleotides in the MGMT promoter are hypermethylated, as measured by restriction enzyme analysis and methylation specific polymerase chain reaction. In one unstable TGFbeta 1+/- cell line, loss of the wild type TGFbeta 1 allele correlates with the appearance of methylation in the MGMT promoter. Bisulfite sequencing shows that in the KO3 TGFbeta 1-/- cell line nearly all of the 28 CpG sites in the MGMT promoter 475 base pairs upstream of the start site of transcription are methylated, whereas most are unmethylated in the H1 TGFbeta 1+/- line. Treatment of the TGFbeta 1-/- cell lines with 5-azacytidine causes reexpression of MGMT mRNA and demethylation of CpG islands in the promoter. Analysis of the time course of methylation using methylation-specific polymerase chain reaction shows a lack of methylation in primary TGFbeta 1-/- keratinocytes and increasing methylation with passage number of immortalized clones. Subcloning of early passage clones reveals a remarkable heterogeneity and instability of the methylation state in the TGFbeta 1-/- keratinocytes. Thus, the TGFbeta 1-/- genotype does not directly regulate MGMT methylation but predisposes cells to immortalization-associated MGMT hypermethylation.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Inactivation of tumor suppressor genes is a common feature of cancer development in humans and animal models. There is increasing evidence that methylation of normally unmethylated CpG islands in gene promoters is an important epigenetic mechanism for transcriptional inactivation of tumor suppressor and DNA repair genes (1-3). One DNA repair gene that is frequently hypermethylated in tumors is methylguanine methyltransferase (MGMT)1 (4, 5). MGMT removes alkyl adducts from O6-guanine residues by transferring the alkyl group to an active cysteine residue within its sequence in a reaction that inactivates further enzymatic activity (6). Since O6-alkylated guanine can mispair with thymine during replication to cause transversions as well as cross-link with cytosines on the opposite DNA strand (6), cells that are deficient in MGMT activity may be more susceptible to mutation and, hence, cancer development or progression. Supporting this role in cancer development, transgenic animals overexpressing MGMT are resistant to tumor formation induced by alkylating agents (7), whereas MGMT null animals exhibit an increased frequency of methylnitrosourea-induced tumors (8).

TGFbeta 1 is a member of a large family of multifunctional secreted polypeptides that are potent growth inhibitors of epithelial cells (9). In human cancers and animal models of multistage carcinogenesis, inactivation of TGFbeta signaling through mutations in the receptors (10-12) or intracellular Smad proteins (13-16) is associated with accelerated premalignant progression and malignant conversion. In the mouse epidermal carcinogenesis model, TGFbeta 1 acts as a tumor suppressor since progression of chemically induced benign tumors is associated with loss of TGFbeta 1 (17, 18), and genetic inactivation of the signaling pathway in keratinocytes leads to rapid progression to squamous cell carcinoma (19, 20). To understand the mechanism by which loss of autocrine TGFbeta signaling leads to accelerated tumor progression, we established a series of nonneoplastic, spontaneously immortal cell lines derived from newborn mouse TGFbeta 1+/- and -/- keratinocytes. The TGFbeta 1-/- cell lines had a significantly higher level of gene amplification than controls (21). To explore further the role of TGFbeta 1 in genomic stability, we have examined the response of TGFbeta 1+/- and TGFbeta 1-/- cell lines to different DNA-damaging agents. Our results show that the TGFbeta 1-/- cell lines are specifically more sensitive to cell killing by alkylating agents, and this is due to a lack of expression of MGMT mRNA and enzyme. Southern blot, MSP, and bisulfite sequencing of the MGMT promoter indicates that the lack of expression is due to hypermethylation of CpG islands in the MGMT promoter. This is the first demonstration of a link between TGFbeta 1 expression and aberrant promoter methylation, and it could have important implications for mechanisms of tumor progression caused by inactivation of TGFbeta signaling.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- The TGFbeta 1+/- and TGFbeta 1-/- cell lines are spontaneously immortal, clonally derived non-tumorigenic keratinocyte cell lines isolated from primary epidermal cultures of newborn mice from the TGFbeta 1-/- strain (19, 22). Cells were routinely cultured in Earle's minimum essential medium, 8% chelexed fetal calf serum, 0.05 mM CaCl2, and antibiotics. Unless indicated, all cell lines were used between passage 20-35. Balb/c keratinocytes were isolated from newborn Balb/c mice using standard techniques (23) and cultured for 3-5 days before isolation of DNA. For 5-azacytidine treatment, cells were seeded at 1 × 106 cells/175-cm2 tissue culture flask, and exponentially growing cells were treated with 1 µM 5-azacytidine (Sigma) for 48 h. After a 3-day recovery period, the treatment protocol was repeated, after which DNA and RNA were isolated. To isolate subclones of the KO3 passage 8 line, cells were seeded at low density in 150-cm2 tissue culture dishes, and colonies that grew out were ring-cloned, expanded to a T-75 flask, and DNA-isolated. To generate continuous lines, primary TGFbeta 1-/- keratinocytes were cultured in medium containing 10 ng/ml keratinocyte growth factor for several weeks until immortal colonies grew out. These colonies were pooled and passaged twice before seeding at low density and ring-cloning. The TGFbeta 1 wild type keratinocyte cell line, NHK4, was clonally derived from newborn keratinocyte cultures isolated from p53 -/- mice (24). The B8 and M3 TGFbeta 1 wild type cell lines were derived from newborn epidermis from control mice of the c-fos -/- line (25).

Clonogenic Survival Assay-- Approximately 500 cells of each cell line were seeded into 60-cm2 culture dishes and allowed to attach for 24 h. Cells were treated with serial dilutions of the different drugs for 1 h in complete medium, then placed in fresh medium without drug and allowed to proliferate for 7-14 days. For gamma  and UV irradiation, the medium was removed, and irradiation done in a small volume of phosphate-buffered saline. Gamma irradiation was done with a MarkIV cesium source, and UV irradiation was done with a Stratalinker (Stratagene) set to deliver a preset joule/mm2. After irradiation, the medium was replaced. Colonies were stained with 0.5% crystal violet, 10% formaldehyde and counted with a dissecting microscope. Only colonies greater than 50 cells were counted. Each treatment was performed in triplicate, and the percent of colonies relative to the untreated cells was determined. For each cell line and treatment, the concentration producing 50% inhibition of colony formation was determined from the dose-response curve.

MGMT Enzyme Activity Assay-- MGMT activity in crude cellular extracts was determined by measuring the transfer of 3H from [3H]methylated Micrococcus luteus DNA to an acid-insoluble protein fraction (26). Briefly, cellular extracts were prepared by sonication of cell pellets in a buffer containing 50 mM Hepes, pH 7.6, 100 mM KCl, 1 mM EDTA, 5 mM dithiothreitol. 50-200 µg of protein was incubated with the 3H substrate prepared from purified M. luteus DNA as described (27) at 37 °C for 30 min and then precipitated with 1 M perchloric acid. Precipitated protein and DNA was then heated to 70 °C for 1 h to hydrolyze precipitated DNA, and after washing, the amount of 3H remaining in the insoluble fraction was determined by liquid scintillation counting (26). The reaction was linear between 25 and 500 µg of cellular extract.

Northern and Southern Blot Analysis-- mRNA was prepared from cell lines using the FastTrack mRNA isolation kit (Invitrogen). 2 µg of poly(A) RNA was electrophoresed through a 1% formaldehyde-agarose gel and transferred to Nytran filters (Schleicher & Schuel). Northern filters were hybridized to [32P]dCTP-labeled DNA probes in 50% formamide at 42 °C. The methylpurine glycosylase cDNA was obtained from ATCC. The human MGMT cDNA was isolated from pKT100 (28). Genomic DNA was isolated from cultured cells according to standard methods (29), and 40 µg was restricted with either MspI or HpaII, electrophoresed through a 2% agarose gel, and transferred to Nytran filters. The filters were hybridized to a 1.9-kilobase pair PCR fragment of the mouse MGMT promoter. Primers used for amplification were obtained from the published sequence (30), 5'-GGATCCCAGTTCTAATTGGGCCTT, downstream 5'-CACCAAGATCTGGCACTGAGAAAT.

Methylation-specific PCR-- CpG methylation patterns in the mouse MGMT promoter were identified using sodium bisulfite modification, which converts unmethylated cytosines to uracil, and subsequent PCR amplification using primers specific for either the unmethylated or methylated modified DNA (31). 1 µg of genomic DNA was modified with sodium bisulfite and purified (31). For the mouse MGMT promoter, the following primer pairs were identified using the CpGware program (Intergen) and used to specifically amplify unmodified DNA, 5'-CTCCCAGAGCCACGCCCCGCGT, downstream 5'-GTGCACGGGGTGGGGGCGGGG; modified unmethylated DNA, TTTGGTAGTTTTTAGAGTTATGTTTTGTGT, downstream 5'-CCACAAACACATACACAAAATAAAAACAAAA; modified methylated DNA, 5'-GGTAGTTTTTAGAGTTACGTTTCGCGT, downstream 5'-CAAACGCGTACACGAAATAAAAACGAAA.

PCR reactions were carried out in a 20-µl volume using 100 ng of modified DNA, 1× PCR buffer (PerkinElmer Life Sciences) 0.2 units of Amplitaq Gold (PerkinElmer Life Sciences) under the following amplification conditions: 94 °C for 90 s, 60 °C for 90 s; 72 °C for 2 min for 35 cycles. With these conditions, no amplification was observed with the wild type primers on modified DNA or with unmethylated/methylated primers on unmodified DNA. Controls without DNA were performed with each set of PCR. PCR products were electrophoresed through a 2% agarose gel and visualized by ethidium bromide fluorescence.

Bisulfite Sequencing-- Genomic DNA was treated with bisulfite as above, and a 560-base pair fragment between 1401 and 1960 of the published mouse MGMT promoter sequence (30) was amplified using primers that are independent of methylation state and recognize bisulfite-modified DNA. The PCR primers were 5'-TTTAGTTGGGTAGTGATTGGATTTTTAGTG and 5'-CCCCAAAACTCACCAACTTACAAACTACAA. The PCR fragment was cloned into pCR2.1 using the TA-cloning method (Invitrogen), and selected clones were sequenced with M13 primers using the dye terminator DNA-sequencing kit (PE Applied Biosystems) with a PerkinElmer ABI Prism 377 DNA sequencer.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Sensitivity of TGFbeta 1-/- Keratinocytes to Alkylating Agents-- TGFbeta 1+/- and -/- keratinocyte cell lines were treated with different DNA-damaging agents, and the ability of the treated cells to form viable colonies was used as a measure of relative DNA repair capacity. Fig. 1 shows that for UV and gamma  irradiation or cisplatin there was no consistent difference in the IC50 for inhibition of colony formation between the TGFbeta 1-/- and TGFbeta 1+/- genotypes. Similar dose-response curves were obtained with the topoisomerase inhibitors camptothecin or etoposide (data not shown). However, the TGFbeta 1-/- cell lines were 5-fold more sensitive to cell killing by the alkylating agent MNNG than the TGFbeta 1+/- lines. Similar results were obtained with methylnitrosourea (data not shown). TGFbeta 1+/+ cell lines derived independently from other transgenic lines (B8, M3, NHK4) had sensitivities to MNNG that were similar to the TGFbeta 1+/- cell lines. Since the NHK4 cell line is p53-/- (24), the increased sensitivity to alkylating damage is specific to the TGFbeta 1-/- genotype.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1.   TGFbeta 1-/- keratinocyte cell lines are more sensitive to cell killing by MNNG. Shown is the colony-forming ability of TGFbeta 1+/+, +/-, and -/- keratinocyte cell lines after treatment with MNNG (A), UV (B) and gamma  (C) irradiation, or cisplatin (D). Cells were plated at clonal density as described under "Experimental Procedures," allowed to recover 24 h, and then treated with the indicated concentration of the drug or irradiated. Colonies, which formed 7-14 days after treatment, were stained and counted, and the number of colonies formed at each dose was determined as a percentage of the untreated control. Each dose was done in triplicate. MNNG treatment was repeated 4 times with identical results. TGFbeta 1 wild type lines were generated from the epidermis of p53-/- mice (NHK4) and from the wild type genotype of c-fos-/- mice (B8, M3).

Increased Sensitivity to MNNG Due to Absence of MGMT-- MNNG and methylnitrosourea produce a high proportion of O6-methylguanine adducts that are specifically repaired by the enzyme O6-methylguanine DNA methyltransferase (MGMT) (6). Cells that lack this enzyme exhibit increased sensitivity to cell killing by alkylating agents (4). The level of MGMT enzyme activity in the TGFbeta 1+/- and TGFbeta 1-/- keratinocyte cell lines was determined using a well characterized assay that measures the ability of crude cellular extracts to transfer a [3H]methyl group from M. luteus DNA to protein (26). Table I shows that all TGFbeta 1+/cell lines had levels of MGMT activity ranging from 0.102-0.255 pmol/mg of protein. Treatment of these cells with O6-benzylguanine, a specific inhibitor of MGMT, eliminated enzyme activity. In contrast, 4/5 TGFbeta 1-/- keratinocyte cell lines had no detectable MGMT activity, whereas in KO6 the levels were 0.005 pmol/mg of protein, barely above the background. Northern blot analysis showed that the lack of MGMT enzyme in the TGFbeta 1-/- cell lines was due to the absence of the MGMT transcript (Fig. 2). There was no difference between the two genotypes in expression of another repair enzyme, methylpurine glycosylase, which removes N-methylpurines and other damaged purines in DNA (33) (Fig. 2). No difference in hybridization pattern was seen when restriction-digested genomic DNA from the TGFbeta 1+/- and TGFbeta 1-/- cell lines was hybridized to a MGMT cDNA probe (data not shown). These results indicate that the lack of MGMT expression in the TGFbeta 1-/- cell lines was not due to deletion or rearrangement of the MGMT gene.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Absence of MGMT enzyme activity in TGFbeta 1 -/- keratinocyte cell lines
MGMT enzyme activity (pmol of 3H removed/mg of protein) was measured in crude cellular extracts of the TGFbeta 1 -/- and +/- keratinocyte cell lines as described under "Experimental Procedures." Values represent the average of 2-3 independent determinations. MGMT activity was inhibited by O6-benzylguanine (BZG), indicating specificity of the enzyme activity measured for MGMT.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   TGFbeta 1-/- cell lines do not express MGMT mRNA. Northern blot analysis of MGMT expression in poly(A)+ RNA isolated from TGFbeta 1+/- and TGFbeta 1-/- cell lines is shown. The Northern filters were sequentially hybridized to a human MGMT cDNA probe (28), a methylpurine glycosylase (MPG) cDNA, and a glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe. Exposure times were 3-4 days for MGMT and methylpurine glycosylase (MPG) and 1 h for glyceraldehyde-3-phosphate dehydrogenase.

Hypermethylation of MGMT Promoter in TGFbeta 1-/- Keratinocytes-- A frequent mechanism for inactivation of MGMT expression in human tumors and tumor cell lines is hypermethylation of CpG islands in the gene promoter (3, 34). Initial Southern blot analysis of methylation in the MGMT promoter using the methylation-sensitive restriction enzyme pair MspI and HpaII revealed specific methylation of the -328 HpaII site in two TGFbeta 1-/- cell lines (not shown). To assay the methylation status of the MGMT promoter in all cell lines, we developed a methylation-specific PCR assay for the mouse MGMT promoter (31). Treatment of DNA with bisulfate converts unmethylated cytosines to uracil, whereas methylated cytosines are resistant to this chemical modification (31). Specific primers were generated to distinguish methylated (M) from unmethylated (U) DNA in the mouse MGMT promoter based on sequence alterations following bisulfite modification. Fig. 3 shows that in all of the TGFbeta 1+/- lines as well as Balb/c keratinocytes, a PCR product was obtained after bisulfite modification only with the unmethylated PCR primers and not with the methylated primers. Thus some or all of the CpG sites within these primer sequences are unmethylated in the control cells. In contrast, the methylated primer pair yielded a strong PCR product with bisulfite-modified DNA from all of the TGFbeta 1-/- lines, whereas variable levels of PCR product was generated with the unmethylated primer pair. To examine the extent of methylation in the MGMT promoter, DNA from the KO3 and H1 cell lines at passage 35 was subjected to bisulfite modification followed by sequencing of PCR products amplified with non-methylation-specific primers. Of 28 CpG dinucleotides between -475 and the start of transcription, virtually all were unmethylated in different PCR clones from the H1 cell line. In contrast, between 57 and 82% of the CpG dinucleotides were methylated in different PCR products sequenced from the KO3 cell line (Fig. 4). Apart from a region just upstream from -25, which was free of methylation in all clones, virtually the entire promoter was methylated.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   MSP analysis of MGMT promoter CpG methylation. A, genomic DNA from the indicated TGFbeta 1+/- and TGFbeta 1-/- cell lines, and Balb/c keratinocytes (B) was modified with bisulfite as described under "Experimental Procedures" and analyzed for methylated CpG sites using PCR primers, which distinguish unmethylated (U) and methylated (M) sequences. Amplification did not occur with either primer set using unmodified DNA. PCR products were analyzed on a 2% agarose gel and visualized by ethidium bromide fluorescence.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Bisulfite sequencing reveals extensive methylation of the MGMT promoter in KO3 cells but not H1 cells. Bisulfite-modified genomic DNA was sequenced as described under "Experimental Procedures." Lollipops represent individual CpG sites within the MGMT promoter. The methylation status of each site for individual PCR clones sequenced is indicated by an open box (unmethylated) or closed box (methylated). Four subcloned PCR products were sequenced for the H1 line, and seven were sequenced for the KO3 line. The arrow indicates the start site of transcription.

5-Azacytidine Causes Demethylation and Reexpression of MGMT mRNA-- To further strengthen the link between methylation of the MGMT promoter and lack of mRNA expression in the TGFbeta 1-/- lines, these cells were treated with 5-azacytidine to block methylation. Fig. 5A shows that after treatment of the TGFbeta 1-/- cell lines with 5-azacytidine MGMT mRNA was reexpressed (Fig. 5A). This correlated with demethylation of the MGMT promoter as measured by an increase in the unmethylated- relative to the methylated-specific PCR product after bisulfite modification and MSP in KO1 KO3 and KO6 DNA (Fig. 5B).


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 5.   Demethylation of the MGMT promoter with 5-azacytidine causes reexpression of MGMT mRNA. A, 5-azacytidine induces MGMT mRNA expression in TGFbeta 1-/- cell lines. Northern blot analysis of MGMT mRNA expression in TGFbeta 1-/-cell lines treated with 1 µM 5-azacytidine (5-AzaC) for 48 h. mRNA isolated from treated or untreated cells was hybridized to a human MGMT cDNA probe and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Exposure time was 1 week for MGMT. B, reduced MGMT promoter methylation in 5-azacytidine-treated TGFbeta 1-/- cell lines. Genomic DNA from control and treated cells was modified with bisulfite as described under "Experimental Procedures" and subjected to methylation-specific PCR using primers specific for unmethylated (U) and methylated (M) sequences.

Relationship of TGFbeta 1 to Methylation Is Indirect and Linked to Immortalization-- To examine the correlation between the lack of autocrine TGFbeta 1 expression and aberrant methylation of the MGMT promoter, we analyzed the MGMT methylation status in the unstable TGFbeta 1+/- cell line H7. Previous studies show that the TGFbeta 1 wild type allele in this cell line is lost with increasing passage (21). Methylation-specific PCR analysis of the MGMT promoter in H7 showed that at passage 9 a PCR product was generated only with the unmethylated primer pair, but by passage 12, a methylated band is evident, and this increases relative to the unmethylated band by passage 24 (Fig. 6). These results suggest that there is a close association between autocrine TGFbeta 1 expression and hypermethylation of the MGMT promoter. However, short or long term treatment of cells with TGFbeta 1 did not alter MGMT expression. Table II shows that treatment of Balb/c primary keratinocytes with 0.5 ng/ml TGFbeta 1 for 48 h did not alter MGMT enzyme activity, nor did a similar treatment induce expression of MGMT in the KO1 and KO3 cell lines. Additionally, treatment of the KO3 cells with exogenous TGFbeta 1 at 50 pg/ml for up to 1 month did not reduce methylation of the MGMT promoter. These results suggest that the effect of a TGFbeta 1 null genotype on methylation of the MGMT promoter is indirect or that once established, the methylation pattern cannot be reversed by addition of TGFbeta 1. To test whether hypermethylation is an inherent property of the TGFbeta 1 null cells, we examined MGMT promoter methylation by MSP in primary keratinocytes of all genotypes as well as TGFbeta 1-/- cells at different times of culture. Table II and Fig. 7A show that regardless of TGFbeta 1 genotype, all primary keratinocytes express similar levels of MGMT enzyme and have an unmethylated MGMT promoter. However, with continued passage of the null cells in culture, a faint band was reproducibly detected with the methylated PCR primers in passage 8 TGFbeta 1-/- cells, and this increased in proportion such that by passage 35 the predominant band was with the methylated-specific primers. These results suggest that the methylation state of the MGMT promoter is unstable in the KO keratinocytes. To test this more directly, we subcloned the null keratinocytes at passage 2 and 8 and examined methylation status of these clones by MSP. Fig. 7, B and C, shows that in subclones from both, there is considerable variability in the methylation state of the MGMT promoter. DNA from some clones was completely methylated (clones 1, 3, 4, 6, 8), whereas in others it was unmethylated (clones 2, 9, 10), and the remainder had amplification with both unmethylated- and methylated-specific PCR primers. Thus the methylation state of the MGMT promoter in the TGFbeta 1-/- cells exhibits clonal- and time-dependent variability.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6.   Loss of wild type TGFbeta 1 allele in heterozygote cell line correlates with increased methylation of the MGMT promoter. Methylation-specific PCR analysis of H7 cell line at different passages. The MGMT promoter is initially unmethylated in P9 of this cell line, correlating wild type TGFbeta 1 allele. In DNA of P12 and P24 cells there is an increase in MGMT promoter methylation corresponding to loss of the wild type allele. U, unmethylated-specific primer; M, methylated-specific primer.

                              
View this table:
[in this window]
[in a new window]
 
Table II
TGFbeta 1 does not directly regulate MGMT enzyme levels
MGMT enzyme activity (pmol of 3H removed/mg of protein) was measured in crude cellular extracts of keratinocytes as described under "Experimental Procedures." Values represent the average of 2-3 independent determinations. Cells were assayed for MGMT levels after treatment with TGFbeta 1 for 48 h.


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 7.   MGMT methylation increases with passage in TGFbeta 1-/- cells and exhibits clonal variation. A, methylation of the MGMT promoter is not detected in primary cultures of TGFbeta 1-/- keratinocytes but increases with passage. MSP analysis of MGMT promoter methylation in primary cultures of TGFbeta 1+/+ (1) and TGFbeta 1-/- keratinocytes (2), passage 2 mass cultures of immortalized TGFbeta 1-/- keratinocytes (3), passage 8 culture of KO3 cell line (4), passage 32 of KO3 cell line (5), and passage 50 of KO3 cell line (6). B, variable methylation in clones of passage 2 TGFbeta 1-/- keratinocytes. Colonies of keratinocytes were ring-cloned and expanded, and the isolated DNA was subjected to bisulfite modification and MSP. C, variable methylation in clones of passage 8 KO3 cell line. Colonies of KO3 were ring-cloned and expanded, and the isolated DNA was subjected to bisulfite modification and MSP. U, unmethylated-specific primer; M, methylated-specific primer.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Inactivation of the TGFbeta signaling pathway is a common event in the progression of human and experimental cancers. In the multistage skin carcinogenesis model v-rasHa retrovirus transduced TGFbeta 1-/- primary keratinocytes undergo rapid aneuploidy in culture (35) and progress to squamous cell carcinoma, whereas control genotypes show limited instability and progression in vivo (19). Nontumorigenic cell lines derived from primary cultures of TGFbeta 1-/- keratinocytes also have a high frequency of gene amplification N-(phosphonacetyl)-L-aspartate (21), suggesting that loss of autocrine TGFbeta 1 signaling results in decreased genomic stability and rapid malignant progression. Here we show that these TGFbeta 1-/- cell lines also exhibit a specific defect in the DNA repair enzyme MGMT, which is crucial to repair of adducts caused by alkylating agents. Relative to the TGFbeta 1+/- cell lines, all of the TGFbeta 1-/- cell lines had a 5-fold increase in sensitivity to cell killing by MMNG, which produces O6-methylguanine adducts with high frequency. In addition, the TGFbeta 1-/- cell lines did not have measurable MGMT enzyme activity or express MGMT mRNA, the enzyme responsible for repair of this DNA lesion (6). In contrast there was no significant difference in sensitivity to gamma  or UV irradiation, cisplatin, or topoisomerase inhibitors. All of these agents produce lesions that utilize repair pathways distinct from MGMT. There was also no difference in mRNA expression of another repair enzyme, methylpurine glycosylase, between the two TGFbeta 1 genotypes, pointing to a specific defect in MGMT expression. Using a combination of Southern blot analysis with methylation-sensitive restriction enzymes, methylation-specific PCR, and bisulfite sequencing, we found that the promoter region of the mouse MGMT gene was also heavily methylated in the MGMT-deficient TGFbeta 1-/- cell lines but not in the MGMT proficient TGFbeta 1+/- cell lines. Furthermore, treatment of the TGFbeta 1-/- lines with 5-azacytidine caused reexpression of MGMT mRNA expression and demethylation of the promoter. These results are in agreement with many studies of MGMT expression in human cancers and tumor cell lines that show a strong correlation between promoter methylation and silencing of MGMT expression (4, 5) and support the idea that hypermethylation of the MGMT promoter specifically in the TGFbeta 1-/- cell lines is responsible for lack of expression.

Bisulfite sequencing revealed that although the MGMT promoter was hypermethylated in the KO3 cell line, there was heterogeneity between individual DNA clones sequenced and regions of both frequent and rare methylation. Similar heterogeneity of methylation at specific CpG sites between individual DNA clones was also found by bisulfite sequencing of the human MGMT promoter from the Mer- BE colon tumor cell line (34). Whether this reflects cellular or allelic variability is not clear, but it must reflect an inherent variability in the process of methylation itself. The regions from -450 to -100 and -25 to +25 were highly methylated in all KO3 DNA copies sequenced, whereas there was infrequent methylation in the region from -80 to -30. It is remarkable that a similar regional pattern of CpG methylation is found in the MGMT promoter of the BE and HeLa S3 tumor cell lines, with a region of rare methylation between -100 to -30 surrounded by highly methylated regions on either side (34) even though there is no sequence homology between the mouse (30) and human (36) MGMT promoters. 6/6 TGFbeta 1-/- cell lines and none of the TGFbeta 1+/- cell lines lacked MGMT expression and had a hypermethylated MGMT promoter. We found no increase in sensitivity to MNNG in a p53-/- keratinocyte cell line derived in a similar manner as the TGFbeta 1-/- cell lines, pointing to a specific defect of MGMT that is related to TGFbeta 1 genotype and not to a nonspecific effect of knockout production or inherent instability related to loss of a tumor suppressor gene. However, primary TGFbeta 1-/- null keratinocytes were MGMT-proficient and did not have apparent methylation as judged by the MSP assay, but rather this analysis showed that methylation increased specifically during passaging of the TGFbeta 1-/- cells. Whether this represents a specific growth advantage of rare cells with MGMT methylation and TGFbeta -signaling defects or ongoing methylation of the promoter in the absence of TGFbeta signaling will require bisulfite sequencing of cells at different passage number for clarification. Although methylation was undetectable in passage 2 and slightly detectable in passage 8 TGFbeta 1-/- cells, subclones of these passages exhibited variable methylation ranging from none to complete. Since the MSP assay is reported to detect methylated alleles at a frequency of 0.1% (31), it seems unlikely that the appearance of methylated alleles with such high frequency in the subclones represents enrichment of rare cells with methylation. Previous studies with fibroblasts show that genes unmethylated in adult tissues or primary cell cultures become methylated in immortal cell lines that grow out after crisis (37). A plausible hypothesis is that TGFbeta 1-/- cells are more susceptible to hypermethylation, and this occurs randomly at the MGMT locus with every cell division. Such a model would allow for recovery of clones containing MGMT alleles that were unmethylated, completely methylated, or both.

An important question left unresolved is how loss of autocrine TGFbeta 1 could be linked to hypermethylation. TGFbeta 1 could directly regulate expression of one of the DNA methyltransferases (DNMT1-3), a demethylase (38), or proteins that bind to methylated DNA (39, 40). Since DNMT1 is both regulated by Rb (41) and forms a complex with Rb, E2F1, and HDAC1 (42), it is possible that altered TGFbeta 1 signaling by modulating the phosphorylation state of Rb could indirectly affect DNMT1 levels or activity. However, the inability of short or long term TGFbeta 1 treatment to induce MGMT or reduce MGMT methylation in the TGFbeta 1-/- lines suggests that MGMT regulation by TGFbeta 1 is indirect and that hypermethylation, once achieved, is stable. Both the human and mouse MGMT promoters contain regions of high GC content and multiple SP1 sites (30, 36). A recent model for the evolution of hypermethylation in promoters suggests that SP1 sites protect GC-rich regions from spreading of methylation (43). It is intriguing that Smad3 and Smad4, intracellular mediators of TGFbeta 1 signaling, can activate transcription through interaction with SP1 proteins and SP1 DNA binding sites (44, 45). It is tempting to speculate that alterations in Smad levels or activity due to inhibition of TGFbeta 1 signaling could influence occupancy of SP1 sites and effect increased accessibility to de novo methylation.

In conclusion we have demonstrated distinct patterns of CpG methylation at the MGMT promoter in immortal keratinocyte lines, which differ by ability to produce autocrine TGFbeta 1. Hypermethylation of the MGMT promoter specifically in the TGFbeta 1-/- keratinocytes occurs during immortalization and subsequent passaging, suggesting that these cells, because of the absence of TGFbeta 1 signaling, are more susceptible to hypermethylation. Analysis of CpG islands of a number of genes will be required to determine if this is specific for the MGMT locus or represents a general methylator phenotype. However, our results also show that the MGMT promoter also becomes methylated during tumor development in the mouse multistage skin carcinogenesis model,2 suggesting that this in vitro observation is relevant to neoplastic transformation of mouse keratinocytes in vivo. It will be important to determine if aberrant MGMT methylation contributes to either spontaneous or alkylation-induced mutation and transformation in the TGFbeta 1-/- cells. Given that loss of expression of TGFbeta 1 is associated with malignant progression in the mouse skin tumor model (17) and that defects in TGFbeta signaling occurs frequently in both human tumors and tumor cell lines (10, 11, 32), it is tempting to speculate that inactivation of the TGFbeta pathway may play a causal role in the widespread hypermethylation of genes that occurs during cancer development and progression.

    ACKNOWLEDGEMENTS

We gratefully acknowledge Dr. Brian Glassner, Harvard School of Public Health, for his advice on the MGMT activity assay, Dr. James Hermann, Johns Hopkins University, for advice on methylation-specific PCR, Drs. Wendy Weinberg and Susan Rutberg for cell lines, and Dr. Stuart Yuspa, NCI, National Institutes of Health for critical reading of the manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Laboratory of Cellular Carcinogenesis and Tumor Promotion, Bldg. 37 3B19 National Cancer Institute, NIH, Bethesda, MD 20892. Tel.: 301-496-3248; Fax: 301-496-8709; E-mail: glicka@dc37a.nci.nih.gov

Published, JBC Papers in Press, March 21, 2001, DOI 10.1074/jbc.M100615200

2 N. Abdul-Fatah, submitted for publication.

    ABBREVIATIONS

The abbreviations used are: MGMT, O6-methylguanine DNA methyltransferase; PCR, polymerase chain reaction; MSP, methylation-specific PCR; TGF, transforming growth factor.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Bachman, K. E., Herman, J. G., Corn, P. G., Merlo, A., Costello, J. F., Cavenee, W. K., Baylin, S. B., and Graff, J. R. (1999) Cancer Res. 59, 798-802
2. Esteller, M., Sanchez-Cespedes, M., Rosell, R., Sidransky, D., Baylin, S. B., and Herman, J. G. (1999) Cancer Res. 59, 67-70
3. Esteller, M., Hamilton, S. R., Burger, P. C., Baylin, S. B., and Herman, J. G. (1999) Cancer Res. 59, 793-797
4. Yarosh, D. B., Foote, R. S., Mitra, S., and Day, R. S. (1983) Carcinogenesis 4, 199-205
5. Chen, J. M., Zhang, Y. P., Wang, C., Sun, Y., Fujimoto, J., and Ikenaga, M. (1992) Carcinogenesis 13, 1503-1507
6. Pegg, A. E., Dolan, M. E., and Moschel, R. C. (1995) Prog. Nucleic Acid Res. Mol. Biol. 51, 167-223
7. Becker, K., Dosch, J., Gregel, C. M., Martin, B. A., and Kaina, B. (1996) Cancer Res. 56, 3244-3249
8. Sakumi, K., Shiraishi, A., Shimizu, S., Tsuzuki, T., Ishikawa, T., and Sekiguchi, M. (1997) Cancer Res. 57, 2415-2418
9. Wrana, J. L., Attisano, L., Carcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X. F., and Massague, J. (1992) Cell 71, 1003-1014
10. Markowitz, S., Wang, J., Myeroff, L., Parsons, R., Sun, L., Lutterbaugh, J., Fan, R. S., Zborowska, E., Kinzler, K. W., Vogelstein, B., Brattain, M., and Willson, J. K. V. (1995) Science 268, 1336-1338
11. Garrigue-Antar, L., Munoz-Antonia, T., Antonia, S. J., Gesmonde, J., Vellucci, V. F., and Reiss, M. (1995) Cancer Res. 55, 3982-3987
12. Parsons, R., Myeroff, L. L., Liu, B., Willson, J. K., Markowitz, S. D., Kinzler, K. W., and Vogelstein, B. (1995) Cancer Res. 55, 5548-5550
13. Howe, J. R., Roth, S., Ringold, J. C., Summers, R. W., Jarvinen, H. J., Sistonen, P., Tomlinson, I. P., Houlston, R. S., Bevan, S., Mitros, F. A., Stone, E. M., and Aaltonen, L. A. (1998) Science 280, 1086-1088
14. Eppert, K., Scherer, S. W., Ozcelik, H., Pirone, R., Hoodless, P., Kim, H., Tsui, L. C., Bapat, B., Gallinger, S., Andrulis, I. L., Thomsen, G. H., Wrana, J. L., and Attisano, L. (1996) Cell 86, 543-552
15. Riggins, G. J., Kinzler, K. W., Vogelstein, B., and Thiagalingam, S. (1997) Cancer Res. 57, 2578-2580
16. Hahn, S. A., Schutte, M., Hoque, A. T., Moskaluk, C. A., da Costa, L. T., Rozenblum, E., Weinstein, C. L., Fischer, A., Yeo, C. J., Hruban, R. H., and Kern, S. E. (1996) Science 271, 350-353
17. Glick, A. B., Kulkarni, A. B., Tennenbaum, T., Hennings, H., Flanders, K. C., O'Reilly, M., Sporn, M. B., Karlsson, S., and Yuspa, S. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6076-6080
18. Cui, W., Kemp, C. J., Duffie, E., Balmain, A., and Akhurst, R. J. (1994) Cancer Res. 54, 5831-5836
19. Glick, A. B., Lee, M. M., Darwiche, N., Kulkarni, A. B., Karlsson, S., and Yuspa, S. H. (1994) Genes Dev. 8, 2429-2440
20. Amendt, C., Schirmacher, P., Weber, H., and Blessing, M. (1998) Oncogene 17, 25-34
21. Glick, A. B., Weinberg, W. C., Wu, I. H., Quan, W., and Yuspa, S. H. (1996) Cancer Res. 56, 3645-3650
22. Kulkarni, A. B., Huh, G. G., Becker, D., Geiser, A., Lyght, M., Flanders, K. C., Roberts, A. B., Sporn, M. B., Ward, J. M., and Karlsson, S. (1992) Proc. Natl. Acad. Sci. U. S. A. 90, 770-774
23. Dlugosz, A. A., Glick, A. B., Tennenbaum, T., Weinberg, W. C., and Yuspa, S. H. (1995) Methods Enzymol 254, 3-20
24. Azzoli, C. G., Sagar, M., Wu, A., Lowry, D., Hennings, H., Morgan, D. L., and Weinberg, W. C. (1998) Mol. Carcinog. 21, 50-61
25. Saez, E., Rutberg, S. E., Mueller, E., Oppenheim, H., Smoluk, J., Yuspa, S. H., and Spiegelman, B. M. (1995) Cell 82, 721-732
26. Margison, G. P., Butler, J., and Hoey, B. (1985) Carcinogenesis 6, 1699-1702
27. Demple, B., Karran, P., Lindahl, T., Jacobsson, A., and Olsson, M. (1983) in DNA Repair: A Laboratory Manual of Research Procedures (Friedberg, E. C. , and Hanawalt, P. C., eds) , pp. 41-52, Marcel Dekker, Inc., New York
28. Tano, K., Shiota, S., Collier, J., Foote, R. S., and Mitra, S. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 686-690
29. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , p. 280, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
30. Iwakuma, T., Shiraishi, N., Fukuhara, M., Kawate, H., and Sekiguchi, M. (1996) DNA Cell Biol. 15, 863-872
31. Herman, J. G., Graff, J. R., Myohanen, S., Nelkin, B. D., and Baylin, S. B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 9821-9826
32. Manning, A. M., Williams, A. C., Game, S. M., and Paraskeva, C. (1991) Oncogene 6, 1471-1476
33. Saffhill, R., Margison, G. P., and O'Connor, P. J. (1985) Biochim. Biophys. Acta 823, 111-145
34. Qian, X. C., and Brent, T. P. (1997) Cancer Res. 57, 3672-3677
35. Glick, A., Popescu, N., Alexander, V., Ueno, H., Bottinger, E., and Yuspa, S. H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14949-14954
36. Harris, L. C., Potter, P. M., Tano, K., Shiota, S., Mitra, S., and Brent, T. P. (1991) Nucleic Acids Res. 19, 6163-6167
37. Jones, P. A., Wolkowicz, M. J., Rideout, W. M., III, Gonzales, F. A., Marziasz, C. M., Coetzee, G. A., and Tapscott, S. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 6117-6121
38. Bhattacharya, S. K., Ramchandani, S., Cervoni, N., and Szyf, M. (1999) Nature 397, 579-583
39. Hendrich, B., and Bird, A. (1998) Mol. Cell. Biol. 18, 6538-6547
40. Fujita, N., Shimotake, N., Ohki, I., Chiba, T., Saya, H., Shirakawa, M., and Nakao, M. (2000) Mol. Cell. Biol. 20, 5107-5118
41. Slack, A., Cervoni, N., Pinard, M., and Szyf, M. (1999) J. Biol. Chem. 274, 10105-10112
42. Robertson, K. D., Ait-Si-Ali, S., Yokochi, T., Wade, P. A., Jones, P. L., and Wolffe, A. P. (2000) Nat. Genet. 25, 338-342
43. Graff, J. R., Herman, J. G., Myohanen, S., Baylin, S. B., and Vertino, P. M. (1997) J. Biol. Chem. 272, 22322-22329
44. Datta, P. K., Blake, M. C., and Moses, H. L. (2000) J. Biol. Chem. 275, 40014-40019
45. Li, J. M., Datto, M. B., Shen, X., Hu, P. P., Yu, Y., and Wang, X. F. (1998) Nucleic Acids Res. 26, 2449-2456


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
Cancer Res.Home page
J. Kirshner, M. F. Jobling, M. J. Pajares, S. A. Ravani, A. B. Glick, M. J. Lavin, S. Koslov, Y. Shiloh, and M. H. Barcellos-Hoff
Inhibition of Transforming Growth Factor-{beta}1 Signaling Attenuates Ataxia Telangiectasia Mutated Activity in Response to Genotoxic Stress
Cancer Res., November 15, 2006; 66(22): 10861 - 10869.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
H.-W. Chen, Y.-C. Chang, Y.-L. Lai, Y.-J. Chen, M.-J. Huang, Y.-S. Leu, Y.-K. Fu, L.-W. Wang, and J.-J. Hwang
Change of Plasma Transforming Growth Factor-{beta}1 Levels in Nasopharyngeal Carcinoma Patients Treated with Concurrent Chemo-radiotherapy
Jpn. J. Clin. Oncol., August 1, 2005; 35(8): 427 - 432.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Radiol.Home page
M H Barcellos-Hoff
How tissues respond to damage at the cellular level: orchestration by transforming growth factor-{beta} (TGF-{beta})
Br. J. Radiol., January 1, 2005; Supplement_27(1): 123 - 127.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yoneda, T. Furukawa, Y.-J. Zheng, T. Momoi, I. Izawa, M. Inagaki, M. Manabe, and N. Inagaki
An Autocrine/Paracrine Loop Linking Keratin 14 Aggregates to Tumor Necrosis Factor {alpha}-mediated Cytotoxicity in a Keratinocyte Model of Epidermolysis Bullosa Simplex
J. Biol. Chem., February 20, 2004; 279(8): 7296 - 7303.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. B. Ewan, R. L. Henshall-Powell, S. A. Ravani, M. J. Pajares, C. Arteaga, R. Warters, R. J. Akhurst, and M. H. Barcellos-Hoff
Transforming Growth Factor-{beta}1 Mediates Cellular Response to DNA Damage in Situ
Cancer Res., October 15, 2002; 62(20): 5627 - 5631.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/22/19052    most recent
M100615200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal