|
Originally published In Press as doi:10.1074/jbc.M009376200 on March 26, 2001
J. Biol. Chem., Vol. 276, Issue 23, 20093-20100, June 8, 2001
Regulation of Human CLC-3 Channels by Multifunctional
Ca2+/Calmodulin-dependent Protein Kinase*
Ping
Huang ,
Jie
Liu ,
Anke
Di,
Nicole C.
Robinson,
Mark W.
Musch§,
Marcia A.
Kaetzel¶, and
Deborah J.
Nelson
From the Department of Neurobiology, Pharmacology and Physiology,
§ IBD Research Center and Department of Medicine, The
University of Chicago, Chicago, Illinois 60637 and the
¶ Department of Molecular & Cellular Physiology, University of
Cincinnati, Cincinnati, Ohio 45267
Received for publication, October 13, 2000, and in revised form, February 22, 2001
 |
ABSTRACT |
The multifunctional
calcium/calmodulin-dependent protein kinase II, CaMKII, has
been shown to regulate chloride movement and cellular function in both
excitable and non-excitable cells. We show that the plasma membrane
expression of a member of the ClC family of Cl
channels, human CLC-3 (hCLC-3), a 90-kDa protein, is regulated by
CaMKII. We cloned the full-length hCLC-3 gene from
the human colonic tumor cell line T84, previously shown to express a
CaMKII-activated Cl conductance (ICl,CaMKII),
and transfected this gene into the mammalian epithelial cell line tsA,
which lacks endogenous expression of ICl,CaMKII. Biotinylation experiments demonstrated plasma membrane expression of
hCLC-3 in the stably transfected cells. In whole cell patch clamp
experiments, autonomously active CaMKII was introduced into tsA cells
stably transfected with hCLC-3 via the patch pipette. Cells
transfected with the hCLC-3 gene showed a 22-fold increase in current density over cells expressing the vector alone.
Kinase-dependent current expression was abolished in the
presence of the autocamtide-2-related inhibitory peptide, a
specific inhibitor of CaMKII. A mutation of glycine 280 to glutamic
acid in the conserved motif in the putative pore region of the channel
changed anion selectivity from I > Cl to Cl > I . These results
indicate that hCLC-3 encodes a Cl channel
that is regulated by CaMKII-dependent phosphorylation.
 |
INTRODUCTION |
Gating of the chloride channel, CLC-3, which is expressed in brain
and chloride (Cl ) secretory epithelial tissues has
remained controversial since its initial identification and
characterization (1). The 760-amino acid protein encoded by the
Clc-3 gene was originally cloned from rat kidney and
showed abundant expression in rat brain, most notably in the olfactory
bulb, hippocampus, and cerebellum (1). When expressed in a stably
transfected cell line, the rat kidney isoform of the channel showed
basal activation, inhibition by phorbol esters, and Ca2+
sensitivity (2). Duan and colleagues (3, 4) characterized the
functional expression of a cardiac clone of guinea pig
clc-3, which when expressed in NIH 3T3 cells resulted in a
large basally active Cl conductance that was activated by
an increase in cell volume, inhibited by phorbol esters and exhibited
biophysical properties at the single channel level identical to the
swelling activated current in native cardiac myocytes. Shimada and
colleagues (5) examined rat hepatocytes for Clc-3 expression
and found that mRNA for two different isoforms was present; a short
form corresponding to the guinea pig clone, and a long form containing
a putative 58-amino acid addition at the N terminus of the protein.
Both isoforms gave rise to current expression with identical
selectivity when transiently expressed in CHO-K1 cells; however, they
differed in the degree of outward rectification and
voltage-dependent inactivation (5). Adding a further
dimension to the controversy, Friedrich and colleagues (6) report in a
mutational analysis of Clc-4 and Clc-5 that they were unable to detect
currents upon Clc-3 expression in Xenopus oocytes
or in transfected HEK293 cells.
Recent evidence from the studies of Stobrawa et al. (7) in
transgenic mice with disrupted Clc-3 demonstrates that the
chloride channel is broadly expressed and present in endosomal
compartments and neuronal synaptic vesicles. Although the
Clc-3 knockout mice remained smaller than wild type
littermates, they nonetheless remained viable for approximately 1 year.
Among the most dramatic effects which Stobrawa and colleagues (7)
demonstrated in the Clcn-3 / knockout mice were the
nearly complete developmental loss of the hippocampus after birth as
well as the complete loss of photoreceptors (7). The loss of both the
hippocampus and photoreceptors was attributed to inadequate
acidification of synaptic vesicles. Defects observed in the
Clc-3-deficient mice lead Stobrawa and colleagues (7) to
hypothesize that Clc-3 acts as an anion shunt pathway which maintains
charge balance for the proton pump which acidifies the vesicle interior
prior to membrane fusion (7). The finding that Clc-3 is an
intracellular chloride channel expressed in both synaptic as well as
endosomal vesicles suggests that it may be in dynamic equilibrium with
the plasma membrane at a level which is dependent upon vesicular
cycling in the various tissues in which it is expressed. Hence,
expression of Clc-3 at surface sites will depend upon a balance between
vesicle fusion with the plasma membrane and membrane retrieval.
Regulated Ca2+-dependent Cl
conductances have been described in cells types as diverse as neurons,
lymphocytes, and secretory epithelia. They regulate cellular volume,
excitability, and salt balance. The multifunctional
Ca2+/calmodulin-dependent protein kinase II
(CaMKII)1 is a major mediator
of Ca2+ signaling, is abundantly expressed in the brain,
and is found in almost every cell type. Regulation of Cl
channels by CaMKII has been shown in cells from the human colonic tumor
cell line, T84 (8-13), airway epithelia (14), T lymphocytes (15),
human macrophages (16), biliary epithelial cells (17), and cystic
fibrosis-derived pancreatic epithelial cells (18). The molecular
identity of the channel or channels mediating the CaMKII-dependent conductance has remained unknown. Given
the current controversy in the literature as to the activation pathway
for heterologously expressed Clc-3, the ubiquitous
expression of the CaMKII-activated Cl conductance in
native cells, and the presence of three possible CaMKII consensus
sequences in the predicted amino acid sequence, our aim in the present
study was to test the hypothesis that hCLC-3 is a Cl
channel regulated by CaMKII.
For this study, we cloned a full-length hCLC-3 gene from T84
cells. This gene was 92% identical to the rat long form of
Clc-3 reported by Shimada and colleagues (5). Surface
biotinylation experiments demonstrated that at least a portion of
hCLC-3 is expressed at the surface of the stably transfected cells.
Immunohistochemistry data showed that an increase in intracellular
Ca2+ shifted the distribution of CLC-3 from a cytoplasmic,
vesicular compartment to apparent surface sites. This translocation
step was not required for current expression in the stably transfected cells as demonstrated in high resolution membrane capacitance measurements. We used the whole cell voltage-clamp technique to characterize the gating and selectivity of recombinant
hCLC-3 channels stably expressed in a large-T antigen
stabilized human embryonic kidney cell line HEK293 (tsA) cells. Our
data show that the functional expression of the recombinant
hCLC-3 induces Cl conductance which is
regulated by CaMKII with phenotypic properties of endogenous
ICl,CaMKII in secretory epithelia. A mutation in the
putative pore region, G280E, produced a characteristic change in anion
selectivity from the I > Br > Cl to Cl > Br > I further demonstrating that the transfected channel was
responsible for the current in the stably transfected cell line.
 |
MATERIALS AND METHODS |
Cloning and Expression of hCLC-3
Full-length hCLC-3 was cloned from a human colonic
tumor cell line T84 by RT-PCR using SuperScript Preamplification System (Life Technologies Inc., MD). PCR primers (sense strand,
TTGCTATGTCTCTGAGCTGC; antisense strand, AAGTAGATGACTCCCTCAGG) were
derived from the hCLC-3 gene cloned from a human retina
cDNA library by Borsani et al. (19). The PCR product was
subcloned into pCR2.1-TOPO vector (Invitrogen) and sequenced. A
comparison of the Borsani et al. (19) sequence with the T84
clone which we report reveals two variations. First, two amino acid
residues (Glu647 and Phe658) are
repeated in the Borsani et al. sequence. Second, a silent mutation at Ile772 (ATT) in the Borsani et al.
(19) clone corresponds to Ile770 (ATC) in the T84 clone. In
order to confirm the differences, we independently cloned the
full-length hCLC-3 from tsA. The resultant sequence was
consistent with the hCLC-3 cloned from T84 cells (GenBankTM AF172729).
The full-length hCLC-3 was subcloned into the
pcDNA3.1zeo+ vector (Invitrogen, CA) and transfected
into tsA cells using SuperFect reagent (Qiagen, CA). Stably transfected
clonal cell lines were selected using zeocin (Invitrogen) at 400 µg/ml and maintained at 200 µg/ml. The expression of hCLC-3 was
detected by immunoblot analysis, and the homogenicity of the clone used
in this study was confirmed ~80% by immunostaining with
hCLC-3-specific antibodies.
Site-directed Mutagenesis and Expression of Mutant hCLC-3
The glycine at position 280 was mutated to a glutamic acid
(G280E) using the QuikChangeTM Site-directed Mutagenesis
Kit (Stratagene). Escherichia coli transformed with mutant
hCLC-3 were grown at 30 °C. The resultant G280E mutation
was confirmed by sequence analysis. Mutant hCLC-3 was
co-transfected with pEGFPN1 vector (CLONTECH) into
tsA cells at a 10:1 ratio, using SuperFect reagent (Qiagen).
Transiently transfected cells were identified by their expression of
enhanced green fluorescent protein. Whole cell electrophysiology
recordings were performed at 48 h post-transfection.
Antibody Production
Antibodies were produced and affinity purified commercially by
Quality Controlled Biochemical (Hopkinton, MA). Two synthetic peptides
coupled to keyhole limpet hemocyanin were used to raise antibodies
against hCLC-3 in rabbits. The peptides corresponded to amino acids
59-74 plus an additional cysteine (MTNGGSINSSTHLLDLC) and to amino
acids 730-744 with an additional alanine and glutamic acid
(GSSRVCFAQHTPSLPAE) in the C terminus. After a second boost, -hCLC-3
serum was affinity purified using peptide coupled to thiol- or
amino-linked gels. The stock concentration was 0.072 mg/ml for
-hCLC-359-74 and 1.03 mg/ml for
-hCLC-3730-744. The specificity of the antibodies was
verified by immunoblotting whole cell lysates obtained from HEK293
stable cell lines expressing human CLC-1, rat Clc-2, and human CLC-4
(generous gifts of Drs. K. Blumenthal, A. George, and C. Fahlke).
Western Blot of Stably Transfected Cell Lines
Cultured cells were harvested in H20E1D1 solution (20 mM HEPES, pH 8.0, 1 mM EDTA, 1 mM
dithiothreitol) in the presence of a proteinase inhibitor mixture
(Roche Molecular Biochemicals). The membrane and cytosolic fractions
were crudely separated by centrifugation of the whole cell lysate at
200,000 × g for 30 min at 4 °C. Protein was
denatured with 1/10 V of 10% SDS and 1 mM dithiothreitol,
and heated to 95 °C for 5-8 min. For deglycosylation, the denatured
protein (100 µg) was incubated with 5 units of N-glycanase F (Oxford GlycoSciences Ltd., Oxford, United Kingdom) for 18 h at
37 °C. Total protein (100 µg) was resolved by 7.5% SDS-PAGE and
transferred to polyvinylidene difluoride membrane. Blots were incubated
overnight at 4 °C with -hCLC-359-74 at a 1:400 dilution or -hCLC-3730-744 at a 1:3000 dilution, and
subsequently with donkey -rabbit antibody conjugated to horseradish
peroxidase (Amersham Pharmacia Biotech) at a 1:2000 dilution for 20 min. Renaissance Western blot Chemiluminescence Reagent Plus
(PerkinElmer Life Sciences) was used for detection.
Immunoprecipitation of Endogenous hCLC-3
Following the protocol provided by Upstate Biotechnology (NY).
Cells cultured on 100-mm dishes were lysed in 1 ml of modified RIPA
buffer (in mM: Tris-HCl, 50; pH 7.4, NaCl, 150; and Nonidet P-40, 1%) containing proteinase inhibitors. One-third the volume of
lysate was diluted with PBS to 1 ml, precipitated with 20 µg of
-hCLC-3730-744, then collected with 100 µl of 50%
recombinant Protein A (Sigma). Immunoprecipitated protein was heated to
95 °C for 5-8 min in 1% SDS sample buffer containing 10 mM dithiothreitol and 100 mM
-mercaptoethanol. One-fifth volume of the supernatant, prior to or
following deglycosylation with 3 units of N-glycanase, was
used for the Western blot. The membrane was immunoblotted with
-hCLC-359-74 at a 1:500 dilution.
Biotinylation
The tsA cells stably transfected with hCLC-3 were
grown to ~80% confluence in a 100-mm dish. The cells were washed
three times with PBS, scraped, and pelleted (1,000 × g, 2 min) into an Eppendorf microcentrifuge tube.
Sulf-NHS-LC-LC-Biotin (Pierce) dissolved in PBS (pH 8.0, 0.5 mg/ml) was
used to resuspend the cells at a concentration of 2.5 × 107 cells/ml. Incubation took place at 4 °C for 30 min
on a rotating wheel. The cells were pelleted and the labeling step was
repeated once. To terminate the biotinylation, 1/100 volume of 1 M Tris-HCl, pH 7.5, was added and incubated for 3 min.
Following incubation, the cells were washed with PBS three times for 2 min, and then immunoprecipitated in modified RIPA buffer with
proteinase inhibitors. Total protein (300 µg) from the cell lysate
was incubated with 40 µg of -hCLC-3730-744 or PBS,
pulled down with 100 µl of 50% Protein A (Sigma), and solublized in
60 µl of 2 × sample buffer containing 200 µM
dithiothreitol. The resultant denatured protein was loaded for Western
blot (30 µl/lane) analysis. The membrane was blotted with
avidin-horesradish peroxidase conjugate (Bio-Rad) at a 1:5000 dilution
and incubated overnight at 4 °C .
Isolation of Brush-border and Basolateral Membrane Protein
Mucosal cells were harvested from ovine tracheal, rat ileal, and
colonic epithelium. Brush-border was separated from basolateral membrane by differential centrifugation and precipitated with 15 mM CaCl2 as described by Bookstein et
al. (20). Membrane protein (100 µg) prior to or following
treatment with 5 units of N-glycanase was used for Western
blot analysis.
Immunofluorescence
Cells were grown on 25-mm coverslips coated with
poly-D-lysine. Cells were incubated with fresh medium or 10 µM A23187 (Sigma) for 5 min at room temperature followed
by fixation in neutral-buffered 4% paraformaldehyde for 10 min at
4 °C, and permeabilization with 0.1% Triton X-100 for 3 min at
4 °C. Cells were incubated with either
-hCLC-3730-744 at a 1:400 dilution or mouse monoclonal
anti-heat shock protein 27 (Affinity BioReagents, Inc.) at a 1:500
dilution for 1 h at room temperature, then washed with PBS, and
incubated with AlexaFluor 488-conjugated goat -rabbit IgG or goat
-mouse IgG (Molecular Probes, Eugene, OR) for 1 h at room
temperature. Cells without exposure to the primary antibody were used
as control. The coverslips were mounted on a slide and observed using
confocal microscopy (Olympus Fluoview).
Electrophysiological Studies
Whole Cell Voltage Clamp--
Whole cell patch clamp experiments
were performed on both T84 and hCLC-3 transfected tsA cells.
All electrophysiological methods were similar to those described
earlier (11, 12). Currents were elicited during a series of test pulses
from 110 to +110 mV in 10-mV increments from a holding potential of
40 mV. Test pulses were 200 ms in duration and delivered at 2-s
intervals. The pipette solution contained (in mM): N-methyl
D-glucamine, 140; HCl, 40; L-glutamic acid, 100;
CaCl2, 0.2; MgCl2, 2; EGTA, 1; HEPES, 10; and
ATP-Mg, 2, pH 7.2. Free Ca2+ was 40 nM. In some
of the experiments, 10 mM BAPTA was included in the pipette
as the Ca2+ buffer in place of EGTA as indicated in the
text. The bath solution contained (in mM): N-methyl
D-glucamine, 140; HCl, 140; CaCl2, 2;
MgCl2, 1; and HEPES, 10, pH 7.4. Purified rat brain CaMKII was dialyzed daily in PIPES buffer (in mM: PIPES, 25; pH
7.0, EGTA, 1; NaCl, 0.1) using Slide-A-LyzerTM Mini
Dialysis Units, 7000 MWCO (Pierce). The autonomous CaMKII was prepared
as previously described (9). The autonomous, autophosphorylated kinase
was introduced into the cell via the pipette solution. A 100 µM stock solution of the CaMKII-specific inhibitor
autocamtide-2-related inhibitory peptide (21, 22) in water was
diluted to 1 µM with pipette solution (Biomol Research
Laboratories, Inc.). The catalytic subunit of PKA (Promega) was diluted
to 75 units/ml with pipette solution.
Capacitance Measurements--
Whole cell capacitance recordings
were obtained using an EPC-9 computer controlled patch clamp amplifier
(HEKA Electronik, Lambrecht, Germany) running PULSE software (HEKA).
The EPC-9 includes a built-in data acquisition interface (ITC-16,
Instrutech, NY). The software package controlled the stimulus and data
acquisition for the software lock-in amplifier in the "sine + dc"
mode as described by Gillis (23). The temporal resolution of the
capacitance data was 40 ms per point using a 1 kHz, 20 mV sine wave.
The holding potential in the capacitance experiments was 10 mV.
All experiments were performed at room temperature. Data are expressed
as mean ± S.E. with the number of experiments in parentheses. The
statistical significance of the results was assessed using Student's
t test analysis.
 |
RESULTS |
Expression of Recombinant and Endogenous hClC-3
The full-length hCLC-3 was cloned from the human
colonic tumor cell line T84 using RT-PCR. The putative hCLC-3 protein
is 818 amino acid residues in length sharing 92% identity with the long form Clc-3 cloned from rat hepatocytes (5). The 58 residues at the N terminus are absent from guinea pig clc-3
characterized by Duan et al. (3). The remaining 760-amino
acid sequence shows 90% identity with both guinea pig and rat short
form Clc-3. Analysis of the putative hCLC-3 amino acid
sequence using CBS prediction servers (Center for Biological Sequence
Analysis, Department of Biotechnology, The Technical University of
Denmark) resulted in three putative CaMKII consensus sequences in
hCLC-3 located at Ser109, Ser420,
Thr713.
We generated two polyclonal antibodies directed against peptides
corresponding to the N- ( -hCLC-359-74) or C-terminal ( -hCLC-3730-744) sequences of hCLC-3. The specificity
of the antibodies was verified by immunoblotting whole cell lysates obtained from HEK 293 stable cell lines expressing hCLC-1,
rClc-2, and hCLC-4 (Fig.
1A). The corresponding
predicted molecular mass for each of the chloride channel
proteins was 107, 100, and 82 kDa, respectively. The affinity purified
antibodies were used to evaluate expression of recombinant
hCLC-3 in stably transfected tsA cells. Both antibodies
detected a protein band from whole cell lysates with a molecular mass
range from 90 to 120 kDa (Fig. 1A). A single molecular mass
band of ~90 kDa was obtained from the same whole cell lysates
digested with N-glycanase, which was consistent with the
predicted mass for hCLC-3 of 88 kDa. The 90-120-kDa band was observed
in the total membrane fraction, but absent from the cytosolic
fraction.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of recombinant hCLC-3
and specificity of hCLC-3 antibodies. A, whole
cell lysates, crude membrane, and cytosol isolates were prepared from
tsA cells stably transfected with full-length hCLC-3 or
vector alone. The two affinity-purified polyclonal antibodies against
peptides derived from the hCLC-3 sequence,
-hCLC-359-74 and -hCLC-3730-744, were
used for detection. Both antibodies detected a molecular mass range
from 90 to 120 kDa in whole cell lysate and membrane isolates.
Following digestion with N-glycanase (DG), a
single immunoreactive band at ~90 kDa was observed in whole cell
lysates. Mutiple bands corresponding to differential deglycosylation
were detected in membrane isolates. Isoform specificity of
-hCLC-359-74 and -hCLC-3730-744 was
verified by immunoblotting of whole cell lysates obtained from HEK 293 cells stably expressing hCLC-1, hCLC-4, or rat
Clc-2. B, tsA cells that express
hCLC-3 were surface biotinylated, and immunoprecipited with
-hCLC-3730-744 or PBS, then immunoblotted with
avidin-horesradish peroxidase conjugate.
|
|
Given that CLC-3 has been localized to intracellular vesicles in cells
from the central nervous system (7), we carried out experiments to
determine whether hCLC-3 was also expressed at the cell surface. Cells
stably transfected with hCLC-3 were surface biotinylated,
immunoprecipited with -hCLC-3730-744 antibody or PBS,
and subsequently immunoblotted with avidin-horesradish peroxidase
conjugate. A single protein band was observed at approximately 90 kDa,
and was absent in the PBS control (Fig. 1B) clearly
demonstrating that a significant fraction of hCLC-3 expression is at
the cell surface.
Expression of endogenous hCLC-3 in the human colonic epithelial cell
line, T84, and in the murine macrophage cell line J774.1 was too low to
be detected by standard Western blot analysis. However, protein
expression in these cells was observed by immunoprecipitation with
-hCLC-3730-744 followed by immunoblot detection with -hCLC-359-74. Following deglycosylation, endogenous
hCLC-3 detected in both the gastrointestinal and immune cell lines had a molecular mass of 90 kDa (Fig. 2,
IP).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of endogenous of CLC-3
expression in human colonic T84 cells, murine macrophage-like
J774.1 cells, and recombinant hCLC-3 expression in tsA
cell. Western blot (WB): whole cell lysates were
prepared from tsA cells stably transfected with full-length
hCLC-3 or vector alone. Immunoprecipitation (IP):
hCLC-3 was immunoprecipitated with -hCLC-3730-744 from
hCLC-3 transfected tsA cells, T84, and J774.1 cells.
Following deglycosylation (DG) with N-glycanase,
protein was resolved by 7.5% SDS-PAGE and immunoblotted with
-hCLC-359-74.
|
|
To determine protein localization in native, fluid-secreting tissues,
the brush border and basolateral fractions of rat ileal and colonic as
well as ovine tracheal epithelium were isolated by differential
centrifugation. Membrane protein was resolved by 7.5% SDS-PAGE, and
immunoblotted with -hCLC-3730-744 antibody. An apparent
molecular mass range from 90 to 130 kDa was detected in the brush
border membrane fraction (Fig.
3A). The tissue dependent
difference in apparent molecular weight for CLC-3 is consistent with
Western analysis of membrane proteins from mice (7). Tracheal CLC-3
revealed a high molecular mass band of greater than 120 kDa indicating
an elevated level of glycosylation. CLC-3 detected in
gastrointestinal tissue was characterized by a predominant molecular
mass of 90 kDa, which did not shift after deglycosylation (Fig.
3B).

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of CLC-3 in native tissues.
Brush border (BB) and basolateral (BL) membranes
were isolated from epithelial mucosa of ovine trachea, rat ileum, and
colon. Proteins were separated by 7.5% SDS-PAGE and detected with
-hCLC-3730-744. A, CLC-3 was detected in the
brush border fraction with a molecular mass range from 90 to 130 kDa.
B, the predominant protein band in the brush border membrane
did not shift following the treatment with N-glycanase
(DG). This band corresponded to the deglycosylated hCLC-3
derived from whole cell lysates (LY) of hCLC-3
transfected tsA cells.
|
|
Regulation of Surface Expression
Regulation of the subcellular distribution of CLC-3 was studied in
T84 and the stably transfected tsA cells using confocal microscopy.
Increases in the level of intracellular Ca2+ regulates
vesicle trafficking and membrane fusion. We hypothesized that an
increase in intracellular Ca2+ might shift the apparent
expression of CLC-3 to surface sites. Cells were fixed and
immunostained with -hCLC-3730-744 either prior to or
following exposure to the calcium ionophore, A23187 (10 µM). As seen in Fig. 4, the
ionophore induced a translocation of fluorescence intensity from the
cytoplasmic compartment to the plasma membrane in both cell lines. As a
control, cells were immunostained under the same condition with another
antibody targeting a non-secreted protein, heat shock protein 27 (HSP27). Fig. 5 demonstrates that HSP27
associated immunofluorescence remained in the cytoplasmic compartment
before and after A23187 treatment.

View larger version (97K):
[in this window]
[in a new window]
|
Fig. 4.
Intracellular Ca2+-induced
translocation of hCLC-3. T84 cells and tsA cells stably
transfected with hCLC-3 were immunostained with
-hCLC-3730-744. Images were acquired with an Olympus
Fluoview confocal microscope. Human CLC-3 was localized primarily to
cytoplasmic vesicles in cells maintained in tissue culture media, but
polarized along cell surfaces following treatment with 10 µM of A23187 for 5 min at room temperature. Cells without
exposure to primary antibody were used as controls. Bars, 10 µm.
|
|

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 5.
Intracellular Ca2+ does not
change subcellular localization of HSP27. T84 cells were
immunostained with an antibody targeting a non-secreted protein, heat
shock protein 27 (HSP27). Images were acquired with an Olympus Fluoview
confocal microscope. HSP27 retained a diffuse cytoplasmic distribution
prior to and following treatment with 10 µM A23187 for 5 min at room temperature. Bars, 10 µm.
|
|
Functional expression studies
CaMKII Regulates Activation of the hCLC-3 Channel--
Whole cell
patch clamp experiments were carried out in order to examine the
functional expression of hCLC-3. Experiments were performed in
asymmetrical solutions where Cl was the major permeant
species, and the theoretical Cl equilibrium potential was
31 mV. Under these ionic conditions, nonspecific leak current was
identified as a depolarizing shift in zero-current potential. Voltage
clamp experiments were performed on single, nonconfluent cells that had
been maintained in culture for 1-2 days. The autonomous CaMKII was
introduced into the cells via the patch pipette as has been previously
described (9, 11, 12). Initial currents following the establishment of
the whole cell configuration were elevated in some cells and declined in amplitude over the first 5 min. Basal current in our studies was
determined after allowing for the initial decrease in current amplitude. As the autonomous enzyme diffused into the cell, current activation was observed to reach a maximum over ~20 min. Current elicited in the presence of autonomous CaMKII (ICl,CaMKII) from tsA cells stably transfected with either hCLC-3 or
vector is compared in Fig. 6A.
There was a significant increase (p < 0.05) in
Cl current amplitude over time in 24 out of 31 tsA cells
transfected with the hCLC-3 gene following CaMKII
activation. Maximal current density at 110 mV was 75.7 ± 9.0 pA/pF (n = 31) which is ~22 times that observed in
cells transfected with vector alone, 3.5 ± 2.2 pA/pF
(n = 11) (Fig. 6C). The current-voltage
(I-V) relationship of ICl,CaMKII was outwardly rectifying with a reversal potential in asymmetrical solutions of approximately 16 mV (Fig. 6B). The chloride channel blocker DIDS (500 µM) inhibited inward and outward ICl,CaMKII
(74% ± 7% at 110 mV and 65% ± 16% at 110 mV, n = 4, p > 0.05).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6.
CaMKII-dependent activation of
whole cell currents in hClC-3-transfected tsA cells. A,
representative currents were recorded at the point at which the initial
current reached a minimum (basal) and after currents had
reached a steady state (CaMKII) in tsA cells transfected
with hClC3 or vector alone. B, current-voltage (I-V)
relationship for the representive ICl,CAMKII listed in
A. C, comparison of ICl,CaMKII
amplitude at +110 mV in hCLC-3 or vector transfected tsA
cells. The asterisk indicates a significant difference
(p < 0.01) in mean current density between basal and
CaMKII-induced Cl current. D, Cl
current recorded in hClC-3-transfected tsA cells with PKA (75 units/ml), CaMKII, CaMKII + BAPTA (10 mM), or CaMKII + autocamtide-2-related inhibitory peptide (1 µM)
included in the pipette solution. Pipette solution alone was used as
control. There was no significant difference in ICl,CAMKII
amplitude between experiments performed with intracellular BAPTA as
compared with those carried out with a solution buffered with 1 mM EGTA and 0.2 mM Ca2+. The number
of cells examined is given above each bar in
parentheses.
|
|
In order to confirm that the CaMKII-mediated current activation was
specific, a series of control experiments were performed and are
summarized in Fig. 6D. The catalytic subunit of PKA (75 units/ml) did not significantly increase current density over that
observed in control experiments in which kinase was not included in the
pipette solution (2.2 + 1.7 pA/pF, n = 5 (p > 0.05). When the autocamtide-2-related inhibitory
peptide (1 µM), a CaMKII specific inhibitor
(21) was included in the pipette solution along with the
autonomous CaMKII, current activation was absent in all 6 cells tested
(5.7 ± 3.2 pA/pF). To exclude the possibility that CaMKII may
activate CLC-3 through an indirect mechanism involving release of
Ca2+ from intracellular stores, experiments were carried
out in the presence of BAPTA (10 mM) and the autonomous
kinase in the pipette solution. The resultant ICl,CaMKII amplitude (76.0 ± 10.3 pA/pF, n = 9) in these
experiments was not significantly different from that obtained when
internal free Ca2+ levels were buffered to 40 nM with 1 mM EGTA and 0.2 mM
Ca2+.
In order to determine whether hCLC-3 was expressed as a functional
channel and not a regulatory subunit which mediated activation of an
endogenous channel, we introduced a mutation in the hCLC-3 cDNA that encodes a glutamic acid at position 280 for a glycine (G280E) in a region which is evolutionarily conserved across the ClC
channel family. The relative anion permeability of
ICl,CaMKII was determined for both wild type and mutant
hCLC-3 transfected tsA cells as given in Table
I. In these experiments, all of the extracellular Cl was replaced by either I
or Br . Cells were returned to a Cl
containing solution between each halide exchange to ensure stability of
the Cl reversal potential relative to the other permeant
halide anions. The I-V relationship for each anion was determined (Fig.
7). The relative selectivity sequence for
ICl,CaMKII derived from reversal potential measurements and
calculated using the Goldman-Hodgkin-Katz equation was
I > Br > Cl for wild type
hCLC-3, and Cl > Br > I for the G280E mutant. In addition to the reversal of
the I to Cl permeability ratio, the G280E
mutant showed a slight decrease in outward rectification as can be seen
in the averaged I-V data from the 6 cells examined.
View this table:
[in this window]
[in a new window]
|
Table I
Comparison of the relative anion permeability of the
CaMKII-dependent anion conductance in tsA cells stably
transfected with wild type hCLC-3 and in tsA cells transiently
transfected with mutant hCLC-3, G280E
Relative anion permeability through CaMKII-stimulated channels was
determined in tsA cells expressing wild type hCLC-3 and tsA
cells transiently expressing the hCLC-3 G280E mutation. Data
are mean ± S.E. of values calculated from currents in
CaMKII-stimulated individual cells. Number of cells is indicated in
parentheses. During stimulation, the extracellular (bath) solution was
changed from a Cl solution to one containing each of the
indicated anions. Permeability ratios Px/PCl, where
X is I or Br , were calculated from
reversal potentials using the Goldman-Hodgkin-Katz equation,
Erev = Erev, x, Erev, Cl = RT/zF ln
Px
[X]o/PCl/[Cl]o.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7.
Halide selectivity of ICl,CaMKII
in tsA cells that express wild type (WT) or mutant
(G280E) hCLC-3. Extracellular
Cl was replaced with I or Br .
A, representative current from a tsA cell expressing the
G280E mutant channel. B, average current-voltage
relationship from the G280E mutant (n = 6) as compared
with that for the wild type Clc-3 channel (n = 5). C, averaged current-voltage relationships for cells
expressing wild type or G280E mutant channels exposed to all three
anion solutions. Cells were equilibrated in Cl containing
solutions between each anion exchange to ensure stability of
Cl reversal potentials. For wild type, the
Br and I substitutions shifted the reversal
potential to more negative values: Erev,I < Erev,Br < Erev,Cl
(n = 3). Reversal potentials following anion exchange
in the G280E mutant expressing cells were shifted to more positive
values, Erev,Cl < Erev,Br < Erev,I, when
Br and I were substituted for
Cl (n = 3).
|
|
CaMKII-stimulated Cl Current Does Not Require Increased Surface
Expression of hCLC-3 in the Stably Transfected tsA Cells
We carried out high resolution membrane capacitance experiments to
monitor the increase in cell surface area accompanying ICl,CaMKII activation in the hCLC-3 stably
transfected tsA cells. In these experiments we examined the question of
whether cytoplasmic vesicular fusion accompanied a membrane conductance
(G) increase in the presence of the autonomous kinase. Representative
data from these studies are plotted and summarized in Fig.
8. We observed a significant increase in
GCl,CaMKII in the presence of autonomous CaMKII (22.4 ± 2.9 nS, n = 4) over that obtained in the absence of
the kinase (0.3 ± 0.1 nS, n = 4). Small and
inconsistent changes in membrane capacitance were observed in both
cases and were not correlated with membrane conductance changes. These
experiments allowed us to conclude that a vesicular fusion step was not
required for conductance activation in the tsA cells. These experiments
do not rule out the possibility that vesicle fusion could contribute to
a conductance change in the presence of the autonomous kinase in other
secretory cells expressing CLC-3.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 8.
Comparison of CaMKII-dependent
changes in membrane conductance and capacitance in hCLC-3
stably transfected tsA cells. Membrane capacitance (Cm)
(A) and membrane conductance (Gm) records
(B) with (CaMKII) or without (control) autonomous CaMKII in
the pipette are plotted as superimposed records for all cells examined.
The holding potential was 10 mV. Changes in membrane capacitance
(C) were compared with changes in membrane conductance
(D) in the presence or absence of the autonomous kinase. The
asterisks indicate a significant increase in membrane
conductance in the presence of CaMKII compared with the control group
(p < 0.01). Changes in membrane capacitance were not
correlated with changes in membrane conductance. Numbers of
cells in each group are indicated in parentheses.
|
|
The hCLC-3 Gene Does Not Code for the Swelling-activated Cl
Conductance
In order to determine whether hCLC-3 is also activated by
increases in cell volume, we compared Cl current
activation in the vector transfected to that of hCLC-3 transfected tsA cells. In the presence of 50% hypotonic extracellular solution, the resultant current was outwardly rectifying (Fig. 9A). The predicted
Cl reversal potential in the hypotonic solution was 14
mV and the experimentally observed potential was approximately 14 mV
demonstrating that the swelling-activated current was Cl
selective. The mean current density of both the basal and
swelling-activated current measured from the vector-transfected cells
(82.6 ± 16.9 pA/pF, n = 9) was not significantly
different from currents recorded from the hCLC-3 stably
transfected tsA cells (78.5 ± 8.1 pA/pF, n = 13)
as summarized in Fig. 9B.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 9.
Human CLC-3 is not regulated by changes in
cell volume. A, representative currents recorded from
tsA cells that express hCLC-3 or vector before (isotonic)
and following exposure to 50% hypotonic solutions (hypotonic). The I-V
relationship for the cells examined is shown to the right of
each of the current traces. B, summary of
ICl,swell data of hCLC-3 or vector-transfected
tsA cells under isotonic and hypotonic conditions. Numbers of cells in
each group are indicated in parentheses. The mean current
density at +110 mV was not significantly different between
hCLC-3 and vector-transfected cells (p > 0.05).
|
|
Anti-CLC-3730-744 Inhibits Endogenous
ICl,CaMKII but Leaves ICl,swell Intact We
introduced each of two hCLC-3 antibodies into either the
hCLC-3 transfected tsA or T84 cells to examine the changes in both CaMKII and swelling-activated Cl current (Fig.
10A). In the presence of
-hCLC-359-74, ICl,CaMKII recorded from tsA
cells that express recombinant hCLC-3 did not differ in
current density (69.7 ± 21.2 pA/pF, n = 5) as
compared with controls (75.7 ± 9.0 pA/pF, n = 31). However, the presence of -hCLC-3730-744 in the
pipette solution completely inhibited current activation by the kinase
(10.9 ± 6.5 pA/pF, n = 6) (p < 0.05). The swelling-activated anion current was not inhibited by either
antibody. The same results were also obtained from T84 cells that
express endogenous hCLC-3.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 10.
Anti-hCLC-3730-744 inhibits
ICl,CaMKII but leaves ICl,swell intact.
A, whole cell currents activated by CaMKII in pipette
solution (CaMKII) or exposure to 50% hypotonic bath
solution (Swelling) were recorded when the currents reached
steady-state in T84 and hClC-3 transfected tsA cells. Saline, 10 µg/µl -hCLC-3730-744, or 10 µg/µl
-hCLC-359-74 was introduced into cells through the
patch pipette. Numbers of cells in each group are indicated in
parentheses. Data are given as mean peak current at +110 mV
for each experimental condition. Asterisks indicate
significant differences (p < 0.05) from the control in
each group. B, anti-hCLC-3730-744 does not
inhibit CaMKII activity directly. The reaction mixture contained CaMKII
(20 ng), calmodulin (80 ng), and 32P-labeled Mg-ATP in
HEPES buffer, pH 7.4. Anti-hCLC-3730-744 was allowed to
interact with the CaMKII for 1 h on ice prior to addition of
[ -32P]ATP. After 30 s at 30 °C, the reaction
was terminated by the addition of an equal volume of ice-cold saturated
trichloroacetic acid. The pellet was washed twice with 100% ethanol
and resuspended in 90 °C Laemmli sample buffer containing 10 mM EDTA. Following SDS-PAGE electrophoresis, the gel was
dried and subjected to autoradiography.
|
|
To determine whether the inhibition of the CaMKII-dependent
current activation by -hCLC-3730-744 was via direct
interaction of the antibody and the enzyme, the in vitro
interaction between the two was evaluated. In the presence of
Ca2+, -hCLC-3730-744 did not inhibit kinase
activity, as determined by autophosphorylation activity (Fig.
10B). These data demonstrate that the antibody-induced
inhibition is not through its direct interaction with the kinase.
 |
DISCUSSION |
We present data in this investigation which demonstrates that the
expression of the Cl channel hCLC-3 is in dynamic
equilibrium between a cytoplasmic granular compartment and the plasma
membrane. The translocation of the protein from the cytoplasmic
vesicular compartment to plasma membrane sites appears to be controlled
in Cl secretory cells in a calcium-dependent
manner. Subcellular localization in native Cl secretory
tissue is restricted to apical membrane expression. CLC-3 current
activation is dependent upon a CaMKII-dependent phosphorylation step, is not necessarily associated with increases in
membrane capacitance, and is not correlated with changes in cellular
swelling. Although our experiments in the stably transfected tsA cells
showed a significant component of surface CLC-3 expression as evidenced
by biotinylation experiments and site-directed mutagenesis studies,
they do not rule out the possibility that surface expression may be
enhanced via vesicle fusion with the plasma membrane accompanying increases in secretory activity. Thus, our results are consistent with
those of Stobrawa et al. (7) which localize the
intracellular expression of CLC-3 to endosomal compartments and
neuronal synaptic vesicles.
The function of the protein product of the Clc-3 gene cloned
originally using the LLC-PK1 and MDCK epithelial cell lines (1, 2) has
been the subject of a number of studies. Kawasaki and colleagues (1)
first demonstrated constitutive current activation of the rat kidney
Clc-3 (rClc-3) in Xenopus oocytes and
found that the recombinant channel currents were inhibited by protein kinase C. The abundant expression of the transcript in brain and its
modulation by protein kinase C suggested a potential role for the
conductance in the induction and maintenance of long term memory.
Expression of the gene in stable mammalian cell lines in a later study
by Kawasaki et al. (2) utilized single channel recording
measurements to show that an increase in intracellular Ca2+
produced channel inhibition. In more recent studies, the guinea pig
heart ClC-3 (gpclc-3) has been identified as a candidate
volume-regulated Cl channel (3, 4). The volume-regulated
Cl conductance (ICl,swell) associated with
gpclc-3 expression is characterized by large basal activity
under isotonic conditions and sensitivity to PKC, properties which are
not shared by the endogenous human, bovine, and rat volume-regulated
outwardly rectifying Cl conductance (24). That the human
isoform of CLC-3 differs from the rat and guinea pig isoform by the
addition of 58 amino acids in the N-terminal domain suggested to us
that it may be associated with a different functional phenotype.
Recently, Shimada and colleagues (5) have shown that rat
Clc-3 is expressed as two distinct isoforms one
corresponding to the gpclc-3 and one corresponding to the
hCLC-3 which we report here. They were able to confirm that
both isoforms express functional Cl channels differing in
their outward rectification and presence of inactivation at more
depolarized potentials. Recent studies from Strowbrawa and colleagues
(7) demonstrate that CLC-3 is expressed in neuronal endosomal and
synaptic vesicular compartments where it serves as an anion shunt for
the V-type H+ ATPase during vesicular acidification.
Previous studies on the characterization of the CaMKII-activated anion
conductance carried out in our laboratory as well as others have shown
that ICl,CaMKII is outwardly rectifying (8, 11, 12, 14-16,
25), is inhibited in the presence of 500 µM DIDS (16,
25), and has a PI/PCl ratio greater than 1 in
airway cells (25, 26) and human macrophages (16). In this paper, we
have cloned and expressed the human isoform of the CLC-3
gene and shown that its properties are identical to the endogenous
ICl,CaMKII in cells of both airway and gastrointestinal origin.
Introduction of autonomous CaMKII into hCLC-3 stably
transfected tsA cells gave rise to an outwardly rectifying
Cl current. The percentage of cells responsive to CaMKII
(78%) was comparable to the positive immunostaining in the
hCLC-3 stably transfected tsA cells (80%). The
CaMKII-dependent anion current was absent in
vector-transfected tsA cells, and was blocked by the CaMKII specific
inhibitor, autocamtide-2-related inhibitory peptide. The
relative lyotropic anion permeability (PX/PCl)
of wild type hClC-3 was I > Br > Cl and is consistent with previous reports of
ICl,CaMKII from different laboratories (3, 16, 25-27). To
confirm that ICl,CaMKII is directly mediated by hCLC-3 and
not due to activation of an ion channel endogenous to tsA cells, a
mutation in hCLC-3 (G280E) was made and transiently expressed in tsA
cells. The relative anion permeability for the G280E mutant was changed
to Cl > Br > I , supporting
the hypothesis that the human isoform of CLC-3 codes for a
CaMKII-activated conductance.
Extended mutational analysis of residues within the region of
Gly230 in CLC-1 allowed Fahlke and colleagues (27) to
identify a putative pore region located at the C-terminal side of
transmembrane segment D3. This region, designated P1, contains a
sequence motif (GKXGPXXH) that is evolutionarily
conserved across the voltage-gated ClC channel family (27).
Interestingly, the G230E mutation in CLC-1 enhances channel
permeability to cations and changes the relative anion permeability
from Cl > Br > I to
I > Cl > Br (27). The
homologous mutation in hCLC-3, while reversing the relative
I to Cl permeability, does so in the
opposite direction. This indicates that residue Gly280 is
likely to lie within the anion-selective conduction pathway; however,
there exists a fundamental difference in the physical properties
between the pores of the two CLC isoforms.
CLC-3 along with CLC-4 and CLC-5 are highly homologous proteins and as
such form a separate branch of the CLC gene superfamily. Expression studies of CLC-4 and CLC-5 show that they directly mediate
plasma membrane currents in that they are characterized by strong
outward rectification. However, Friedrich and colleagues (6) reported
that they were unable to measure basally active CLC-3 mediated currents
in either oocytes or transfected cells in stark contrast to the
currents observed by Kawasaki (1, 2) and Duan et al. (3, 4).
Our explanation for the absence of currents in the Friedrich et
al. (3, 4) studies would be that channel activation is not
constitutive but rather phosphorylation dependent.
We examined the gating of hCLC-3 by cell swelling. We recorded
ICl,swell in stably transfected tsA cells following an
exposure to 50% hypotonic solution. The current characteristics of the ICl,swell from vector and hCLC-3 transfected tsA
cells were identical, showing that overexpression of hCLC-3
was not associated with an augmentation of ICl,swell. In
order to further study the correspondence between hCLC-3 and
ICl,swell, we examined the functional activity of
antibodies against peptides specific to CLC-3, which were introduced via the pipette solution into the stably transfected tsA cells as well
as T84 cells endogenously expressing ICl,CaMKII. In both
cell lines, ICl,CaMKII was abolished in the presence of the
anti-C-terminal peptide antibody ( -hCLC-3730-744). In
both cases, ICl,swell remained intact. The differential
antibody sensitivity strongly suggests that ICl,swell and
ICl,CaMKII are not mediated by the same protein. The
mechanism of ICl,CaMKII current inhibition by
-hCLC-3730-744 remains uncertain. Antibody binding to
the channel or associated regulatory protein could plausibly either
block gating of hCLC-3, or alternatively inhibit a translocation step
that is essential for ICl,CaMKII activation.
Our results suggest that the activation of hCLC-3 is not mediated by
cell volume changes, rather it is CaMKII-dependent.
However, the molecular pathway leading to ICl,CaMKII activation remains unclear. One hypothesis is that CaMKII
phosphorylation gates the channel directly or indirectly though
associated regulatory subunits. Alternatively, a second hypothesis is
that CaMKII-dependent phosphorylation may increase granule
fusion, either though facilitation of the movement of channels from a
docked granular compartment to the plasma membrane, or though the
translocation of cytoplasmic granules containing hCLC-3 protein to the
surface sites. The later hypothesis was not supported by our
capacitance measurements. However, our experiments do not exclude the
involvement of regulatory molecules in the activation of
ICl,CaMKII.
CLC-3 has a broad tissue distribution in the body suggesting an
important physiological role. Kawasaki et al. (1) reported high levels of Clc-3 expression in rat brain (19). The
cellular and physiological importance of CLC-3 in the central nervous
system is underscored in the Clcn-3 / knockout mice
which showed a selective degeneration of the hippocampus as well as
photoreceptor loss (7). In this study we have shown that there is
significant expression of hCLC-3 in cells as diverse in function as
Cl secretory epithelial cells and phagocytic cells of the
immune system.
Immunolocalization of hCLC-3 to apical membranes of epithelial cells
lining the small intestine, colon, and its expression in the airway
epithelia suggest that the channel may prove suitable as an alternate
path for anion-driven fluid transport in CF. Activation of an alternate
Ca2+-dependent Cl conductance in
the epithelial secretory cells affected in CF has long been recognized
as a potential therapeutic target in circumventing the defect in the
disease. The development of pharmacological strategies which would
ameliorate the consequences of secretory defects in CF utilizing the
CaMKII-dependent Cl conductance are dependent
upon identification of the channel at the molecular level.
Understanding mechanisms controlling the levels of CLC-3 in the plasma
membrane and the factors directly affecting activity of the channel are
prerequisite to designing strategies to improve tissue fluid balance in
diseases (or conditions) such as CF.
 |
ACKNOWLEDGEMENT |
We thank Dr. J. R. Dedman for many
helpful discussions.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant GM36823 and a grant from the Cystic Fibrosis Foundation
(Nelson96PO) (to D. J. N.), National Institutes of Health
Grant DK46433 (to M. A. K.), National Institutes of Health
Digestive Disease Core Grant DK-42086 and The Caroline Halfter Spahn
Trust.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
This work is dedicated to the fond memory of Wellesley Anne Johnson.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF172729.
Contributed equally to the results of this work.
To whom correspondence should be addressed: Dept. of
Neurobiology, Pharmacology, and Physiology, the University of Chicago, 947 E. 58th St., MC 0926, Chicago, IL 60637. Tel.:
773-702-0126; Fax: 773-702-4066; E-mail:
dnelson@drugs.bsd.uchicago.edu.
Published, JBC Papers in Press, March 26, 2001, DOI 10.1074/jbc.M009376200
 |
ABBREVIATIONS |
The abbreviations used are:
CaMKII, Ca2+/calmodulin-dependent protein kinase II;
RT-PCR, reverse
transcriptase-polymerase chain reaction;
PAGE, polyacrylamide gel
electrophoresis;
PBS, phosphate-buffered saline;
BAPTA, 1,2-bis(O-aminophenoxy)ethane-N,N,N',N'-tetraacetic
acid;
PIPES, 1,4-piperazinediethanesulfonic acid;
DIDS, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid;
CF, cystic
fibrosis.
 |
REFERENCES |
| 1.
|
Kawasaki, M.,
Uchida, S.,
Monkawa, T.,
Miyawaki, A.,
Mikoshiba, K.,
Marumo, F.,
and Sasaki, S.
(1994)
Neuron
12,
597-604
|
| 2.
|
Kawasaki, M.,
Suzuki, M.,
Uchida, S.,
Sasaki, S.,
and Marumo, F.
(1995)
Neuron
14,
1285-1291
|
| 3.
|
Duan, D.,
Winter, C.,
Cowley, S.,
Hume, J. R.,
and Horowitz, B.
(1997)
Nature
390,
417-421
|
| 4.
|
Duan, D.,
Cowley, S.,
Horowitz, B.,
and Hume, J. R.
(1999)
J. Gen. Physiol.
113,
57-70
|
| 5.
|
Shimada, K.,
Li, X.,
Xu, G.,
Nowak, D.,
Showalter, L.,
and Weinman, S.
(2000)
Am. J. Physiol. Gastroint. Liver Physiol.
279,
G268-G276
|
| 6.
|
Friedrich, T.,
Breiderhoff, T.,
and Jentsch, T.
(1999)
J. Biol. Chem.
274,
896-902
|
| 7.
|
Stobrawa, S.,
Breiderhoff, T.,
Takamori, S.,
Engel, D.,
Schweizer, M.,
Zdebik, A.,
Boesl, M.,
Ruether, K.,
Jahn, H.,
Draguhn, A.,
Jahn, R.,
and Jentsch, T.
(2001)
Neuron
29,
185-196
|
| 8.
|
Worrell, R. T.,
and Frizzell, R. A.
(1991)
Am. J. Physiol.
260,
C877-C882
|
| 9.
|
Chan, H. C.,
Kaetzel, M. A.,
Gotter, A. L.,
Dedman, J. R.,
and Nelson, D. J.
(1994)
J. Biol. Chem.
269,
32464-32468
|
| 10.
|
Kaetzel, M. A.,
Chan, H. C.,
Dubinsky, W. P.,
Dedman, J. R.,
and Nelson, D. J.
(1994)
J. Biol. Chem.
269,
5297-5302
|
| 11.
|
Xie, W.,
Kaetzel, M. A.,
Bruzik, K. S.,
Dedman, J. R.,
Shears, S. R.,
and Nelson, D. J.
(1996)
J. Biol. Chem.
271,
14092-14097
|
| 12.
|
Xie, W.,
Solomons, K. R. H.,
Freeman, S.,
Kaetzel, M. A.,
Bruzik, K. S.,
Nelson, D. J.,
and Shears, S. B.
(1998)
J. Physiol.
510,
661-673
|
| 13.
|
Merlin, D.,
Jiang, L.,
Strohmeier, G. R.,
Nusrat, A.,
Alper, S. L.,
Lencer, W. I.,
and Madara, J. L.
(1998)
Am. J. Physiol.
275,
C484-C495
|
| 14.
|
Wagner, J. A.,
Cozens, A. L.,
Schulman, H.,
Gruenert, D. C.,
Stryer, L.,
and Gardner, P.
(1991)
Nature
349,
793-796
|
| 15.
|
Nishimoto, I.,
Wagner, J. A.,
Schulman, H.,
and Gardner, P.
(1991)
Neuron
6,
547-555
|
| 16.
|
Holevinsky, K. O.,
Jow, F.,
and Nelson, D. J.
(1994)
J. Membr. Biol.
140,
13-30
|
| 17.
|
Schlenker, T.,
and Fitz, J. G.
(1996)
Am. J. Physiol.
271,
G304-G310
|
| 18.
|
Chao, A. C.,
Kouyama, K.,
Heist, E. K.,
Dong, Y. J.,
and Gardner, P.
(1995)
J. Clin. Invest.
96,
1794-1801
|
| 19.
|
Borsani, G.,
Rugarli, E. I.,
Taglialatela, M.,
Wong, C.,
and Ballabio, A.
(1995)
Genomics
27,
131-141
|
| 20.
|
Bookstein, C.,
dePaoli, A. M.,
Xie, Y.,
Niu, P.,
Musch, M. W.,
Rao, M. C.,
and Chang, E. B.
(1994)
J. Clin. Invest.
93,
106-113
|
| 21.
|
Ishida, A.,
Kameshita, I.,
Okuno, S.,
Kitani, T.,
and Fujisawa, H.
(1995)
Biochem. Biophys. Res. Commun.
212,
806-812
|
| 22.
|
Ishida, A.,
Shigeri, Y.,
Tatsu, Y.,
Uegaki, K.,
Kameshita, I.,
Okuno, S.,
Kitani, T.,
Yumoto, N.,
and Fujisawa, H.
(1998)
FEBS Lett.
427,
115-118
|
| 23.
|
Gillis, K.
(2000)
Pflügers Arch. Eur. J. Physiol.
439,
655-664
|
| 24.
|
Okada, Y.,
Oiki, S.,
Hazama, A.,
and Morishima, S.
(1998)
J. Gen. Physiol.
112,
365-367
|
| 25.
|
Chan, H.-C.,
Goldstein, J.,
and Nelson, D. J.
(1992)
Am. J. Physiol.
262,
C1273-C1283
|
| 26.
|
Anderson, M. P.,
and Welsh, M. J.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
6003-6007
|
| 27.
|
Fahlke, C., Yu, H. T.,
Beck, C. L.,
Rhodes, T. H.,
and George, A. L., Jr.
(1997)
Nature
390,
529-532
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. A. Falin, R. Morrison, A.-J. L. Ham, and K. Strange
Identification of Regulatory Phosphorylation Sites in a Cell Volume- and Ste20 Kinase-dependent ClC Anion Channel
J. Gen. Physiol.,
December 29, 2008;
133(1):
29 - 42.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. P. D. Volk, C. K. Heise, J. L. Hougen, C. M. Artman, K. A. Volk, D. Wessels, D. R. Soll, W. M. Nauseef, F. S. Lamb, and J. G. Moreland
ClC-3 and IClswell are Required for Normal Neutrophil Chemotaxis and Shape Change
J. Biol. Chem.,
December 5, 2008;
283(49):
34315 - 34326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Caputo, E. Caci, L. Ferrera, N. Pedemonte, C. Barsanti, E. Sondo, U. Pfeffer, R. Ravazzolo, O. Zegarra-Moran, and L. J. V. Galietta
TMEM16A, A Membrane Protein Associated with Calcium-Dependent Chloride Channel Activity
Science,
October 24, 2008;
322(5901):
590 - 594.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Maritzen, D. J. Keating, I. Neagoe, A. A. Zdebik, and T. J. Jentsch
Role of the Vesicular Chloride Transporter ClC-3 in Neuroendocrine Tissue
J. Neurosci.,
October 15, 2008;
28(42):
10587 - 10598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. Habela, M. L. Olsen, and H. Sontheimer
ClC3 Is a Critical Regulator of the Cell Cycle in Normal and Malignant Glial Cells
J. Neurosci.,
September 10, 2008;
28(37):
9205 - 9217.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. C. Claud, J. Lu, X. Q. Wang, M. Abe, E. O. Petrof, J. Sun, D. J. Nelson, J. Marks, and T. Jilling
Platelet-activating factor-induced chloride channel activation is associated with intracellular acidosis and apoptosis of intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol,
May 1, 2008;
294(5):
G1191 - G1200.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Li, M. Kawazaki, K. Ogasahara, and A. Nakagawa
The Intracellular Region of ClC-3 Chloride Channel Is in a Partially Folded State and a Monomer.
J. Biochem.,
May 1, 2006;
139(5):
813 - 820.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. P. Atluri and T. A. Ryan
The kinetics of synaptic vesicle reacidification at hippocampal nerve terminals.
J. Neurosci.,
February 22, 2006;
26(8):
2313 - 2320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-G. Zhou, J.-L. Ren, Q.-y. Qiu, H. He, and Y.-Y. Guan
Regulation of Intracellular Cl- Concentration through Volume-regulated ClC-3 Chloride Channels in A10 Vascular Smooth Muscle Cells
J. Biol. Chem.,
February 25, 2005;
280(8):
7301 - 7308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Denton, K. Nehrke, X. Yin, R. Morrison, and K. Strange
GCK-3, a Newly Identified Ste20 Kinase, Binds To and Regulates the Activity of a Cell Cycle-dependent ClC Anion Channel
J. Gen. Physiol.,
January 31, 2005;
125(2):
113 - 125.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hara-Chikuma, B. Yang, N. D. Sonawane, S. Sasaki, S. Uchida, and A. S. Verkman
ClC-3 Chloride Channels Facilitate Endosomal Acidification and Chloride Accumulation
J. Biol. Chem.,
January 14, 2005;
280(2):
1241 - 1247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Seong, B. H. Wainer, E. D. Hughes, T. L. Saunders, M. Burmeister, and V. Faundez
Genetic Analysis of the Neuronal and Ubiquitous AP-3 Adaptor Complexes Reveals Divergent Functions in Brain
Mol. Biol. Cell,
January 1, 2005;
16(1):
128 - 140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Piper and W. A. Large
Direct effect of Ca2+-calmodulin on cGMP-activated Ca2+-dependent Cl-channels in rat mesenteric artery myocytes
J. Physiol.,
September 1, 2004;
559(2):
449 - 457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Salazar, R. Love, M. L. Styers, E. Werner, A. Peden, S. Rodriguez, M. Gearing, B. H. Wainer, and V. Faundez
AP-3-dependent Mechanisms Control the Targeting of a Chloride Channel (ClC-3) in Neuronal and Non-neuronal Cells
J. Biol. Chem.,
June 11, 2004;
279(24):
25430 - 25439.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Yamamoto-Mizuma, G.-X. Wang, L. L. Liu, K. Schegg, W. J. Hatton, D. Duan, T. L. B. Horowitz, F. S. Lamb, and J. R. Hume
Altered properties of volume-sensitive osmolyte and anion channels (VSOACs) and membrane protein expression in cardiac and smooth muscle myocytes from Clcn3-/- mice
J. Physiol.,
June 1, 2004;
557(2):
439 - 456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. C. Robinson, P. Huang, M. A. Kaetzel, F. S. Lamb, and D. J. Nelson
Identification of an N-terminal amino acid of the CLC-3 chloride channel critical in phosphorylation-dependent activation of a CaMKII-activated chloride current
J. Physiol.,
April 15, 2004;
556(2):
353 - 368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Pusch
Ca2+-activated Chloride Channels Go Molecular
J. Gen. Physiol.,
March 29, 2004;
123(4):
323 - 325.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Eggermont
Calcium-activated Chloride Channels: (Un)known, (Un)loved?
Proceedings of the ATS,
January 1, 2004;
1(1):
22 - 27.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. G. Jin, J. K. Kim, D. K. Yang, S. J. Cho, J. M. Kim, E. J. Koh, H. C. Jung, I. So, and K. W. Kim
Fundamental role of ClC-3 in volume-sensitive Cl- channel function and cell volume regulation in AGS cells
Am J Physiol Gastrointest Liver Physiol,
November 1, 2003;
285(5):
G938 - G948.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Li, J. R. Dedman, and M. A. Kaetzel
Intron Disruption of the Annexin IV Gene Reveals Novel Transcripts
J. Biol. Chem.,
October 31, 2003;
278(44):
43276 - 43283.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-X. Wang, W. J. Hatton, G. L. Wang, J. Zhong, I. Yamboliev, D. Duan, and J. R. Hume
Functional effects of novel anti-ClC-3 antibodies on native volume-sensitive osmolyte and anion channels in cardiac and smooth muscle cells
Am J Physiol Heart Circ Physiol,
October 1, 2003;
285(4):
H1453 - H1463.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Fong, B. E. Argent, W. B. Guggino, and M. A. Gray
Characterization of vectorial chloride transport pathways in the human pancreatic duct adenocarcinoma cell line HPAF
Am J Physiol Cell Physiol,
August 1, 2003;
285(2):
C433 - C445.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Olsen, S. Schade, S. A. Lyons, M. D. Amaral, and H. Sontheimer
Expression of Voltage-Gated Chloride Channels in Human Glioma Cells
J. Neurosci.,
July 2, 2003;
23(13):
5572 - 5582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Gentzsch, L. Cui, A. Mengos, X.-b. Chang, J.-H. Chen, and J. R. Riordan
The PDZ-binding Chloride Channel ClC-3B Localizes to the Golgi and Associates with Cystic Fibrosis Transmembrane Conductance Regulator-interacting PDZ Proteins
J. Biol. Chem.,
February 14, 2003;
278(8):
6440 - 6449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Arreola, T. Begenisich, K. Nehrke, H.-V. Nguyen, K. Park, L. Richardson, B. Yang, B. C Schutte, F. S Lamb, and J. E Melvin
Secretion and cell volume regulation by salivary acinar cells from mice lacking expression of the Clcn3 Cl- channel gene
J. Physiol.,
November 15, 2002;
545(1):
207 - 216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hermoso, C. M. Satterwhite, Y. N. Andrade, J. Hidalgo, S. M. Wilson, B. Horowitz, and J. R. Hume
ClC-3 Is a Fundamental Molecular Component of Volume-sensitive Outwardly Rectifying Cl- Channels and Volume Regulation in HeLa Cells and Xenopus laevis Oocytes
J. Biol. Chem.,
October 11, 2002;
277(42):
40066 - 40074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Rutledge, J. Denton, and K. Strange
Cell cycle- and swelling-induced activation of a Caenorhabditis elegans ClC channel is mediated by CeGLC-7{alpha}/{beta} phosphatases
J. Cell Biol.,
August 5, 2002;
158(3):
435 - 444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik
Molecular Structure and Physiological Function of Chloride Channels
Physiol Rev,
April 1, 2002;
82(2):
503 - 568.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Mohammad-Panah, C. Ackerley, J. Rommens, M. Choudhury, Y. Wang, and C. E. Bear
The Chloride Channel ClC-4 Co-localizes with Cystic Fibrosis Transmembrane Conductance Regulator and May Mediate Chloride Flux across the Apical Membrane of Intestinal Epithelia
J. Biol. Chem.,
January 4, 2002;
277(1):
566 - 574.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Lipecka, M. Bali, A. Thomas, P. Fanen, A. Edelman, and J. Fritsch
Distribution of ClC-2 chloride channel in rat and human epithelial tissues
Am J Physiol Cell Physiol,
April 1, 2002;
282(4):
C805 - C816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li, T. Wang, Z. Zhao, and S. A. Weinman
The ClC-3 chloride channel promotes acidification of lysosomes in CHO-K1 and Huh-7 cells
Am J Physiol Cell Physiol,
June 1, 2002;
282(6):
C1483 - C1491.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. D. Edmonds, I. V. Silva, W. B. Guggino, R. B. Butler, P. L. Zeitlin, and C. J. Blaisdell
Pre- and Postnatal Lung Development, Maturation, and Plasticity: ClC-5: ontogeny of an alternative chloride channel in respiratory epithelia
Am J Physiol Lung Cell Mol Physiol,
March 1, 2002;
282(3):
L501 - L507.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|