Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M009376200 on March 26, 2001

J. Biol. Chem., Vol. 276, Issue 23, 20093-20100, June 8, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/23/20093    most recent
M009376200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, P.
Right arrow Articles by Nelson, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, P.
Right arrow Articles by Nelson, D. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of Human CLC-3 Channels by Multifunctional Ca2+/Calmodulin-dependent Protein Kinase*

Ping HuangDagger, Jie LiuDagger, Anke Di, Nicole C. Robinson, Mark W. Musch§, Marcia A. Kaetzel, and Deborah J. Nelson||

From the Department of Neurobiology, Pharmacology and Physiology, § IBD Research Center and Department of Medicine, The University of Chicago, Chicago, Illinois 60637 and the  Department of Molecular & Cellular Physiology, University of Cincinnati, Cincinnati, Ohio 45267

Received for publication, October 13, 2000, and in revised form, February 22, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The multifunctional calcium/calmodulin-dependent protein kinase II, CaMKII, has been shown to regulate chloride movement and cellular function in both excitable and non-excitable cells. We show that the plasma membrane expression of a member of the ClC family of Cl- channels, human CLC-3 (hCLC-3), a 90-kDa protein, is regulated by CaMKII. We cloned the full-length hCLC-3 gene from the human colonic tumor cell line T84, previously shown to express a CaMKII-activated Cl- conductance (ICl,CaMKII), and transfected this gene into the mammalian epithelial cell line tsA, which lacks endogenous expression of ICl,CaMKII. Biotinylation experiments demonstrated plasma membrane expression of hCLC-3 in the stably transfected cells. In whole cell patch clamp experiments, autonomously active CaMKII was introduced into tsA cells stably transfected with hCLC-3 via the patch pipette. Cells transfected with the hCLC-3 gene showed a 22-fold increase in current density over cells expressing the vector alone. Kinase-dependent current expression was abolished in the presence of the autocamtide-2-related inhibitory peptide, a specific inhibitor of CaMKII. A mutation of glycine 280 to glutamic acid in the conserved motif in the putative pore region of the channel changed anion selectivity from I- > Cl- to Cl- > I-. These results indicate that hCLC-3 encodes a Cl- channel that is regulated by CaMKII-dependent phosphorylation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Gating of the chloride channel, CLC-3, which is expressed in brain and chloride (Cl-) secretory epithelial tissues has remained controversial since its initial identification and characterization (1). The 760-amino acid protein encoded by the Clc-3 gene was originally cloned from rat kidney and showed abundant expression in rat brain, most notably in the olfactory bulb, hippocampus, and cerebellum (1). When expressed in a stably transfected cell line, the rat kidney isoform of the channel showed basal activation, inhibition by phorbol esters, and Ca2+ sensitivity (2). Duan and colleagues (3, 4) characterized the functional expression of a cardiac clone of guinea pig clc-3, which when expressed in NIH 3T3 cells resulted in a large basally active Cl- conductance that was activated by an increase in cell volume, inhibited by phorbol esters and exhibited biophysical properties at the single channel level identical to the swelling activated current in native cardiac myocytes. Shimada and colleagues (5) examined rat hepatocytes for Clc-3 expression and found that mRNA for two different isoforms was present; a short form corresponding to the guinea pig clone, and a long form containing a putative 58-amino acid addition at the N terminus of the protein. Both isoforms gave rise to current expression with identical selectivity when transiently expressed in CHO-K1 cells; however, they differed in the degree of outward rectification and voltage-dependent inactivation (5). Adding a further dimension to the controversy, Friedrich and colleagues (6) report in a mutational analysis of Clc-4 and Clc-5 that they were unable to detect currents upon Clc-3 expression in Xenopus oocytes or in transfected HEK293 cells.

Recent evidence from the studies of Stobrawa et al. (7) in transgenic mice with disrupted Clc-3 demonstrates that the chloride channel is broadly expressed and present in endosomal compartments and neuronal synaptic vesicles. Although the Clc-3 knockout mice remained smaller than wild type littermates, they nonetheless remained viable for approximately 1 year. Among the most dramatic effects which Stobrawa and colleagues (7) demonstrated in the Clcn-3-/- knockout mice were the nearly complete developmental loss of the hippocampus after birth as well as the complete loss of photoreceptors (7). The loss of both the hippocampus and photoreceptors was attributed to inadequate acidification of synaptic vesicles. Defects observed in the Clc-3-deficient mice lead Stobrawa and colleagues (7) to hypothesize that Clc-3 acts as an anion shunt pathway which maintains charge balance for the proton pump which acidifies the vesicle interior prior to membrane fusion (7). The finding that Clc-3 is an intracellular chloride channel expressed in both synaptic as well as endosomal vesicles suggests that it may be in dynamic equilibrium with the plasma membrane at a level which is dependent upon vesicular cycling in the various tissues in which it is expressed. Hence, expression of Clc-3 at surface sites will depend upon a balance between vesicle fusion with the plasma membrane and membrane retrieval.

Regulated Ca2+-dependent Cl- conductances have been described in cells types as diverse as neurons, lymphocytes, and secretory epithelia. They regulate cellular volume, excitability, and salt balance. The multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII)1 is a major mediator of Ca2+ signaling, is abundantly expressed in the brain, and is found in almost every cell type. Regulation of Cl- channels by CaMKII has been shown in cells from the human colonic tumor cell line, T84 (8-13), airway epithelia (14), T lymphocytes (15), human macrophages (16), biliary epithelial cells (17), and cystic fibrosis-derived pancreatic epithelial cells (18). The molecular identity of the channel or channels mediating the CaMKII-dependent conductance has remained unknown. Given the current controversy in the literature as to the activation pathway for heterologously expressed Clc-3, the ubiquitous expression of the CaMKII-activated Cl- conductance in native cells, and the presence of three possible CaMKII consensus sequences in the predicted amino acid sequence, our aim in the present study was to test the hypothesis that hCLC-3 is a Cl- channel regulated by CaMKII.

For this study, we cloned a full-length hCLC-3 gene from T84 cells. This gene was 92% identical to the rat long form of Clc-3 reported by Shimada and colleagues (5). Surface biotinylation experiments demonstrated that at least a portion of hCLC-3 is expressed at the surface of the stably transfected cells. Immunohistochemistry data showed that an increase in intracellular Ca2+ shifted the distribution of CLC-3 from a cytoplasmic, vesicular compartment to apparent surface sites. This translocation step was not required for current expression in the stably transfected cells as demonstrated in high resolution membrane capacitance measurements. We used the whole cell voltage-clamp technique to characterize the gating and selectivity of recombinant hCLC-3 channels stably expressed in a large-T antigen stabilized human embryonic kidney cell line HEK293 (tsA) cells. Our data show that the functional expression of the recombinant hCLC-3 induces Cl- conductance which is regulated by CaMKII with phenotypic properties of endogenous ICl,CaMKII in secretory epithelia. A mutation in the putative pore region, G280E, produced a characteristic change in anion selectivity from the I- > Br- > Cl- to Cl- > Br- > I- further demonstrating that the transfected channel was responsible for the current in the stably transfected cell line.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cloning and Expression of hCLC-3

Full-length hCLC-3 was cloned from a human colonic tumor cell line T84 by RT-PCR using SuperScript Preamplification System (Life Technologies Inc., MD). PCR primers (sense strand, TTGCTATGTCTCTGAGCTGC; antisense strand, AAGTAGATGACTCCCTCAGG) were derived from the hCLC-3 gene cloned from a human retina cDNA library by Borsani et al. (19). The PCR product was subcloned into pCR2.1-TOPO vector (Invitrogen) and sequenced. A comparison of the Borsani et al. (19) sequence with the T84 clone which we report reveals two variations. First, two amino acid residues (Glu647 and Phe658) are repeated in the Borsani et al. sequence. Second, a silent mutation at Ile772 (ATT) in the Borsani et al. (19) clone corresponds to Ile770 (ATC) in the T84 clone. In order to confirm the differences, we independently cloned the full-length hCLC-3 from tsA. The resultant sequence was consistent with the hCLC-3 cloned from T84 cells (GenBankTM AF172729).

The full-length hCLC-3 was subcloned into the pcDNA3.1zeo+ vector (Invitrogen, CA) and transfected into tsA cells using SuperFect reagent (Qiagen, CA). Stably transfected clonal cell lines were selected using zeocin (Invitrogen) at 400 µg/ml and maintained at 200 µg/ml. The expression of hCLC-3 was detected by immunoblot analysis, and the homogenicity of the clone used in this study was confirmed ~80% by immunostaining with hCLC-3-specific antibodies.

Site-directed Mutagenesis and Expression of Mutant hCLC-3

The glycine at position 280 was mutated to a glutamic acid (G280E) using the QuikChangeTM Site-directed Mutagenesis Kit (Stratagene). Escherichia coli transformed with mutant hCLC-3 were grown at 30 °C. The resultant G280E mutation was confirmed by sequence analysis. Mutant hCLC-3 was co-transfected with pEGFPN1 vector (CLONTECH) into tsA cells at a 10:1 ratio, using SuperFect reagent (Qiagen). Transiently transfected cells were identified by their expression of enhanced green fluorescent protein. Whole cell electrophysiology recordings were performed at 48 h post-transfection.

Antibody Production

Antibodies were produced and affinity purified commercially by Quality Controlled Biochemical (Hopkinton, MA). Two synthetic peptides coupled to keyhole limpet hemocyanin were used to raise antibodies against hCLC-3 in rabbits. The peptides corresponded to amino acids 59-74 plus an additional cysteine (MTNGGSINSSTHLLDLC) and to amino acids 730-744 with an additional alanine and glutamic acid (GSSRVCFAQHTPSLPAE) in the C terminus. After a second boost, alpha -hCLC-3 serum was affinity purified using peptide coupled to thiol- or amino-linked gels. The stock concentration was 0.072 mg/ml for alpha -hCLC-359-74 and 1.03 mg/ml for alpha -hCLC-3730-744. The specificity of the antibodies was verified by immunoblotting whole cell lysates obtained from HEK293 stable cell lines expressing human CLC-1, rat Clc-2, and human CLC-4 (generous gifts of Drs. K. Blumenthal, A. George, and C. Fahlke).

Western Blot of Stably Transfected Cell Lines

Cultured cells were harvested in H20E1D1 solution (20 mM HEPES, pH 8.0, 1 mM EDTA, 1 mM dithiothreitol) in the presence of a proteinase inhibitor mixture (Roche Molecular Biochemicals). The membrane and cytosolic fractions were crudely separated by centrifugation of the whole cell lysate at 200,000 × g for 30 min at 4 °C. Protein was denatured with 1/10 V of 10% SDS and 1 mM dithiothreitol, and heated to 95 °C for 5-8 min. For deglycosylation, the denatured protein (100 µg) was incubated with 5 units of N-glycanase F (Oxford GlycoSciences Ltd., Oxford, United Kingdom) for 18 h at 37 °C. Total protein (100 µg) was resolved by 7.5% SDS-PAGE and transferred to polyvinylidene difluoride membrane. Blots were incubated overnight at 4 °C with alpha -hCLC-359-74 at a 1:400 dilution or alpha -hCLC-3730-744 at a 1:3000 dilution, and subsequently with donkey alpha -rabbit antibody conjugated to horseradish peroxidase (Amersham Pharmacia Biotech) at a 1:2000 dilution for 20 min. Renaissance Western blot Chemiluminescence Reagent Plus (PerkinElmer Life Sciences) was used for detection.

Immunoprecipitation of Endogenous hCLC-3

Following the protocol provided by Upstate Biotechnology (NY). Cells cultured on 100-mm dishes were lysed in 1 ml of modified RIPA buffer (in mM: Tris-HCl, 50; pH 7.4, NaCl, 150; and Nonidet P-40, 1%) containing proteinase inhibitors. One-third the volume of lysate was diluted with PBS to 1 ml, precipitated with 20 µg of alpha -hCLC-3730-744, then collected with 100 µl of 50% recombinant Protein A (Sigma). Immunoprecipitated protein was heated to 95 °C for 5-8 min in 1% SDS sample buffer containing 10 mM dithiothreitol and 100 mM beta -mercaptoethanol. One-fifth volume of the supernatant, prior to or following deglycosylation with 3 units of N-glycanase, was used for the Western blot. The membrane was immunoblotted with alpha -hCLC-359-74 at a 1:500 dilution.

Biotinylation

The tsA cells stably transfected with hCLC-3 were grown to ~80% confluence in a 100-mm dish. The cells were washed three times with PBS, scraped, and pelleted (1,000 × g, 2 min) into an Eppendorf microcentrifuge tube. Sulf-NHS-LC-LC-Biotin (Pierce) dissolved in PBS (pH 8.0, 0.5 mg/ml) was used to resuspend the cells at a concentration of 2.5 × 107 cells/ml. Incubation took place at 4 °C for 30 min on a rotating wheel. The cells were pelleted and the labeling step was repeated once. To terminate the biotinylation, 1/100 volume of 1 M Tris-HCl, pH 7.5, was added and incubated for 3 min. Following incubation, the cells were washed with PBS three times for 2 min, and then immunoprecipitated in modified RIPA buffer with proteinase inhibitors. Total protein (300 µg) from the cell lysate was incubated with 40 µg of alpha -hCLC-3730-744 or PBS, pulled down with 100 µl of 50% Protein A (Sigma), and solublized in 60 µl of 2 × sample buffer containing 200 µM dithiothreitol. The resultant denatured protein was loaded for Western blot (30 µl/lane) analysis. The membrane was blotted with avidin-horesradish peroxidase conjugate (Bio-Rad) at a 1:5000 dilution and incubated overnight at 4 °C .

Isolation of Brush-border and Basolateral Membrane Protein

Mucosal cells were harvested from ovine tracheal, rat ileal, and colonic epithelium. Brush-border was separated from basolateral membrane by differential centrifugation and precipitated with 15 mM CaCl2 as described by Bookstein et al. (20). Membrane protein (100 µg) prior to or following treatment with 5 units of N-glycanase was used for Western blot analysis.

Immunofluorescence

Cells were grown on 25-mm coverslips coated with poly-D-lysine. Cells were incubated with fresh medium or 10 µM A23187 (Sigma) for 5 min at room temperature followed by fixation in neutral-buffered 4% paraformaldehyde for 10 min at 4 °C, and permeabilization with 0.1% Triton X-100 for 3 min at 4 °C. Cells were incubated with either alpha -hCLC-3730-744 at a 1:400 dilution or mouse monoclonal anti-heat shock protein 27 (Affinity BioReagents, Inc.) at a 1:500 dilution for 1 h at room temperature, then washed with PBS, and incubated with AlexaFluor 488-conjugated goat alpha -rabbit IgG or goat alpha -mouse IgG (Molecular Probes, Eugene, OR) for 1 h at room temperature. Cells without exposure to the primary antibody were used as control. The coverslips were mounted on a slide and observed using confocal microscopy (Olympus Fluoview).

Electrophysiological Studies

Whole Cell Voltage Clamp-- Whole cell patch clamp experiments were performed on both T84 and hCLC-3 transfected tsA cells. All electrophysiological methods were similar to those described earlier (11, 12). Currents were elicited during a series of test pulses from -110 to +110 mV in 10-mV increments from a holding potential of -40 mV. Test pulses were 200 ms in duration and delivered at 2-s intervals. The pipette solution contained (in mM): N-methyl D-glucamine, 140; HCl, 40; L-glutamic acid, 100; CaCl2, 0.2; MgCl2, 2; EGTA, 1; HEPES, 10; and ATP-Mg, 2, pH 7.2. Free Ca2+ was 40 nM. In some of the experiments, 10 mM BAPTA was included in the pipette as the Ca2+ buffer in place of EGTA as indicated in the text. The bath solution contained (in mM): N-methyl D-glucamine, 140; HCl, 140; CaCl2, 2; MgCl2, 1; and HEPES, 10, pH 7.4. Purified rat brain CaMKII was dialyzed daily in PIPES buffer (in mM: PIPES, 25; pH 7.0, EGTA, 1; NaCl, 0.1) using Slide-A-LyzerTM Mini Dialysis Units, 7000 MWCO (Pierce). The autonomous CaMKII was prepared as previously described (9). The autonomous, autophosphorylated kinase was introduced into the cell via the pipette solution. A 100 µM stock solution of the CaMKII-specific inhibitor autocamtide-2-related inhibitory peptide (21, 22) in water was diluted to 1 µM with pipette solution (Biomol Research Laboratories, Inc.). The catalytic subunit of PKA (Promega) was diluted to 75 units/ml with pipette solution.

Capacitance Measurements-- Whole cell capacitance recordings were obtained using an EPC-9 computer controlled patch clamp amplifier (HEKA Electronik, Lambrecht, Germany) running PULSE software (HEKA). The EPC-9 includes a built-in data acquisition interface (ITC-16, Instrutech, NY). The software package controlled the stimulus and data acquisition for the software lock-in amplifier in the "sine + dc" mode as described by Gillis (23). The temporal resolution of the capacitance data was 40 ms per point using a 1 kHz, 20 mV sine wave. The holding potential in the capacitance experiments was -10 mV.

All experiments were performed at room temperature. Data are expressed as mean ± S.E. with the number of experiments in parentheses. The statistical significance of the results was assessed using Student's t test analysis.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Expression of Recombinant and Endogenous hClC-3

The full-length hCLC-3 was cloned from the human colonic tumor cell line T84 using RT-PCR. The putative hCLC-3 protein is 818 amino acid residues in length sharing 92% identity with the long form Clc-3 cloned from rat hepatocytes (5). The 58 residues at the N terminus are absent from guinea pig clc-3 characterized by Duan et al. (3). The remaining 760-amino acid sequence shows 90% identity with both guinea pig and rat short form Clc-3. Analysis of the putative hCLC-3 amino acid sequence using CBS prediction servers (Center for Biological Sequence Analysis, Department of Biotechnology, The Technical University of Denmark) resulted in three putative CaMKII consensus sequences in hCLC-3 located at Ser109, Ser420, Thr713.

We generated two polyclonal antibodies directed against peptides corresponding to the N- (alpha -hCLC-359-74) or C-terminal (alpha -hCLC-3730-744) sequences of hCLC-3. The specificity of the antibodies was verified by immunoblotting whole cell lysates obtained from HEK 293 stable cell lines expressing hCLC-1, rClc-2, and hCLC-4 (Fig. 1A). The corresponding predicted molecular mass for each of the chloride channel proteins was 107, 100, and 82 kDa, respectively. The affinity purified antibodies were used to evaluate expression of recombinant hCLC-3 in stably transfected tsA cells. Both antibodies detected a protein band from whole cell lysates with a molecular mass range from 90 to 120 kDa (Fig. 1A). A single molecular mass band of ~90 kDa was obtained from the same whole cell lysates digested with N-glycanase, which was consistent with the predicted mass for hCLC-3 of 88 kDa. The 90-120-kDa band was observed in the total membrane fraction, but absent from the cytosolic fraction.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 1.   Expression of recombinant hCLC-3 and specificity of hCLC-3 antibodies. A, whole cell lysates, crude membrane, and cytosol isolates were prepared from tsA cells stably transfected with full-length hCLC-3 or vector alone. The two affinity-purified polyclonal antibodies against peptides derived from the hCLC-3 sequence, alpha -hCLC-359-74 and alpha -hCLC-3730-744, were used for detection. Both antibodies detected a molecular mass range from 90 to 120 kDa in whole cell lysate and membrane isolates. Following digestion with N-glycanase (DG), a single immunoreactive band at ~90 kDa was observed in whole cell lysates. Mutiple bands corresponding to differential deglycosylation were detected in membrane isolates. Isoform specificity of alpha -hCLC-359-74 and alpha -hCLC-3730-744 was verified by immunoblotting of whole cell lysates obtained from HEK 293 cells stably expressing hCLC-1, hCLC-4, or rat Clc-2. B, tsA cells that express hCLC-3 were surface biotinylated, and immunoprecipited with alpha -hCLC-3730-744 or PBS, then immunoblotted with avidin-horesradish peroxidase conjugate.

Given that CLC-3 has been localized to intracellular vesicles in cells from the central nervous system (7), we carried out experiments to determine whether hCLC-3 was also expressed at the cell surface. Cells stably transfected with hCLC-3 were surface biotinylated, immunoprecipited with alpha -hCLC-3730-744 antibody or PBS, and subsequently immunoblotted with avidin-horesradish peroxidase conjugate. A single protein band was observed at approximately 90 kDa, and was absent in the PBS control (Fig. 1B) clearly demonstrating that a significant fraction of hCLC-3 expression is at the cell surface.

Expression of endogenous hCLC-3 in the human colonic epithelial cell line, T84, and in the murine macrophage cell line J774.1 was too low to be detected by standard Western blot analysis. However, protein expression in these cells was observed by immunoprecipitation with alpha -hCLC-3730-744 followed by immunoblot detection with alpha -hCLC-359-74. Following deglycosylation, endogenous hCLC-3 detected in both the gastrointestinal and immune cell lines had a molecular mass of 90 kDa (Fig. 2, IP).


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2.   Comparison of endogenous of CLC-3 expression in human colonic T84 cells, murine macrophage-like J774.1 cells, and recombinant hCLC-3 expression in tsA cell. Western blot (WB): whole cell lysates were prepared from tsA cells stably transfected with full-length hCLC-3 or vector alone. Immunoprecipitation (IP): hCLC-3 was immunoprecipitated with alpha -hCLC-3730-744 from hCLC-3 transfected tsA cells, T84, and J774.1 cells. Following deglycosylation (DG) with N-glycanase, protein was resolved by 7.5% SDS-PAGE and immunoblotted with alpha -hCLC-359-74.

To determine protein localization in native, fluid-secreting tissues, the brush border and basolateral fractions of rat ileal and colonic as well as ovine tracheal epithelium were isolated by differential centrifugation. Membrane protein was resolved by 7.5% SDS-PAGE, and immunoblotted with alpha -hCLC-3730-744 antibody. An apparent molecular mass range from 90 to 130 kDa was detected in the brush border membrane fraction (Fig. 3A). The tissue dependent difference in apparent molecular weight for CLC-3 is consistent with Western analysis of membrane proteins from mice (7). Tracheal CLC-3 revealed a high molecular mass band of greater than 120 kDa indicating an elevated level of glycosylation. CLC-3 detected in gastrointestinal tissue was characterized by a predominant molecular mass of 90 kDa, which did not shift after deglycosylation (Fig. 3B).


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of CLC-3 in native tissues. Brush border (BB) and basolateral (BL) membranes were isolated from epithelial mucosa of ovine trachea, rat ileum, and colon. Proteins were separated by 7.5% SDS-PAGE and detected with alpha -hCLC-3730-744. A, CLC-3 was detected in the brush border fraction with a molecular mass range from 90 to 130 kDa. B, the predominant protein band in the brush border membrane did not shift following the treatment with N-glycanase (DG). This band corresponded to the deglycosylated hCLC-3 derived from whole cell lysates (LY) of hCLC-3 transfected tsA cells.

Regulation of Surface Expression

Regulation of the subcellular distribution of CLC-3 was studied in T84 and the stably transfected tsA cells using confocal microscopy. Increases in the level of intracellular Ca2+ regulates vesicle trafficking and membrane fusion. We hypothesized that an increase in intracellular Ca2+ might shift the apparent expression of CLC-3 to surface sites. Cells were fixed and immunostained with alpha -hCLC-3730-744 either prior to or following exposure to the calcium ionophore, A23187 (10 µM). As seen in Fig. 4, the ionophore induced a translocation of fluorescence intensity from the cytoplasmic compartment to the plasma membrane in both cell lines. As a control, cells were immunostained under the same condition with another antibody targeting a non-secreted protein, heat shock protein 27 (HSP27). Fig. 5 demonstrates that HSP27 associated immunofluorescence remained in the cytoplasmic compartment before and after A23187 treatment.


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 4.   Intracellular Ca2+-induced translocation of hCLC-3. T84 cells and tsA cells stably transfected with hCLC-3 were immunostained with alpha -hCLC-3730-744. Images were acquired with an Olympus Fluoview confocal microscope. Human CLC-3 was localized primarily to cytoplasmic vesicles in cells maintained in tissue culture media, but polarized along cell surfaces following treatment with 10 µM of A23187 for 5 min at room temperature. Cells without exposure to primary antibody were used as controls. Bars, 10 µm.


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 5.   Intracellular Ca2+ does not change subcellular localization of HSP27. T84 cells were immunostained with an antibody targeting a non-secreted protein, heat shock protein 27 (HSP27). Images were acquired with an Olympus Fluoview confocal microscope. HSP27 retained a diffuse cytoplasmic distribution prior to and following treatment with 10 µM A23187 for 5 min at room temperature. Bars, 10 µm.

Functional expression studies

CaMKII Regulates Activation of the hCLC-3 Channel-- Whole cell patch clamp experiments were carried out in order to examine the functional expression of hCLC-3. Experiments were performed in asymmetrical solutions where Cl- was the major permeant species, and the theoretical Cl- equilibrium potential was -31 mV. Under these ionic conditions, nonspecific leak current was identified as a depolarizing shift in zero-current potential. Voltage clamp experiments were performed on single, nonconfluent cells that had been maintained in culture for 1-2 days. The autonomous CaMKII was introduced into the cells via the patch pipette as has been previously described (9, 11, 12). Initial currents following the establishment of the whole cell configuration were elevated in some cells and declined in amplitude over the first 5 min. Basal current in our studies was determined after allowing for the initial decrease in current amplitude. As the autonomous enzyme diffused into the cell, current activation was observed to reach a maximum over ~20 min. Current elicited in the presence of autonomous CaMKII (ICl,CaMKII) from tsA cells stably transfected with either hCLC-3 or vector is compared in Fig. 6A. There was a significant increase (p < 0.05) in Cl- current amplitude over time in 24 out of 31 tsA cells transfected with the hCLC-3 gene following CaMKII activation. Maximal current density at 110 mV was 75.7 ± 9.0 pA/pF (n = 31) which is ~22 times that observed in cells transfected with vector alone, 3.5 ± 2.2 pA/pF (n = 11) (Fig. 6C). The current-voltage (I-V) relationship of ICl,CaMKII was outwardly rectifying with a reversal potential in asymmetrical solutions of approximately -16 mV (Fig. 6B). The chloride channel blocker DIDS (500 µM) inhibited inward and outward ICl,CaMKII (74% ± 7% at 110 mV and 65% ± 16% at -110 mV, n = 4, p > 0.05).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6.   CaMKII-dependent activation of whole cell currents in hClC-3-transfected tsA cells. A, representative currents were recorded at the point at which the initial current reached a minimum (basal) and after currents had reached a steady state (CaMKII) in tsA cells transfected with hClC3 or vector alone. B, current-voltage (I-V) relationship for the representive ICl,CAMKII listed in A. C, comparison of ICl,CaMKII amplitude at +110 mV in hCLC-3 or vector transfected tsA cells. The asterisk indicates a significant difference (p < 0.01) in mean current density between basal and CaMKII-induced Cl- current. D, Cl- current recorded in hClC-3-transfected tsA cells with PKA (75 units/ml), CaMKII, CaMKII + BAPTA (10 mM), or CaMKII + autocamtide-2-related inhibitory peptide (1 µM) included in the pipette solution. Pipette solution alone was used as control. There was no significant difference in ICl,CAMKII amplitude between experiments performed with intracellular BAPTA as compared with those carried out with a solution buffered with 1 mM EGTA and 0.2 mM Ca2+. The number of cells examined is given above each bar in parentheses.

In order to confirm that the CaMKII-mediated current activation was specific, a series of control experiments were performed and are summarized in Fig. 6D. The catalytic subunit of PKA (75 units/ml) did not significantly increase current density over that observed in control experiments in which kinase was not included in the pipette solution (2.2 + 1.7 pA/pF, n = 5 (p > 0.05). When the autocamtide-2-related inhibitory peptide (1 µM), a CaMKII specific inhibitor (21) was included in the pipette solution along with the autonomous CaMKII, current activation was absent in all 6 cells tested (5.7 ± 3.2 pA/pF). To exclude the possibility that CaMKII may activate CLC-3 through an indirect mechanism involving release of Ca2+ from intracellular stores, experiments were carried out in the presence of BAPTA (10 mM) and the autonomous kinase in the pipette solution. The resultant ICl,CaMKII amplitude (76.0 ± 10.3 pA/pF, n = 9) in these experiments was not significantly different from that obtained when internal free Ca2+ levels were buffered to 40 nM with 1 mM EGTA and 0.2 mM Ca2+.

In order to determine whether hCLC-3 was expressed as a functional channel and not a regulatory subunit which mediated activation of an endogenous channel, we introduced a mutation in the hCLC-3 cDNA that encodes a glutamic acid at position 280 for a glycine (G280E) in a region which is evolutionarily conserved across the ClC channel family. The relative anion permeability of ICl,CaMKII was determined for both wild type and mutant hCLC-3 transfected tsA cells as given in Table I. In these experiments, all of the extracellular Cl- was replaced by either I- or Br-. Cells were returned to a Cl- containing solution between each halide exchange to ensure stability of the Cl- reversal potential relative to the other permeant halide anions. The I-V relationship for each anion was determined (Fig. 7). The relative selectivity sequence for ICl,CaMKII derived from reversal potential measurements and calculated using the Goldman-Hodgkin-Katz equation was I- > Br- > Cl- for wild type hCLC-3, and Cl- > Br- > I- for the G280E mutant. In addition to the reversal of the I- to Cl- permeability ratio, the G280E mutant showed a slight decrease in outward rectification as can be seen in the averaged I-V data from the 6 cells examined.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Comparison of the relative anion permeability of the CaMKII-dependent anion conductance in tsA cells stably transfected with wild type hCLC-3 and in tsA cells transiently transfected with mutant hCLC-3, G280E
Relative anion permeability through CaMKII-stimulated channels was determined in tsA cells expressing wild type hCLC-3 and tsA cells transiently expressing the hCLC-3 G280E mutation. Data are mean ± S.E. of values calculated from currents in CaMKII-stimulated individual cells. Number of cells is indicated in parentheses. During stimulation, the extracellular (bath) solution was changed from a Cl- solution to one containing each of the indicated anions. Permeability ratios Px/PCl, where X is I- or Br-, were calculated from reversal potentials using the Goldman-Hodgkin-Katz equation, Delta Erev = Erev, x- Erev, Cl = RT/zF ln Px [X]o/PCl/[Cl]o.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 7.   Halide selectivity of ICl,CaMKII in tsA cells that express wild type (WT) or mutant (G280E) hCLC-3. Extracellular Cl- was replaced with I- or Br-. A, representative current from a tsA cell expressing the G280E mutant channel. B, average current-voltage relationship from the G280E mutant (n = 6) as compared with that for the wild type Clc-3 channel (n = 5). C, averaged current-voltage relationships for cells expressing wild type or G280E mutant channels exposed to all three anion solutions. Cells were equilibrated in Cl- containing solutions between each anion exchange to ensure stability of Cl- reversal potentials. For wild type, the Br- and I- substitutions shifted the reversal potential to more negative values: Erev,I < Erev,Br < Erev,Cl (n = 3). Reversal potentials following anion exchange in the G280E mutant expressing cells were shifted to more positive values, Erev,Cl < Erev,Br < Erev,I, when Br- and I- were substituted for Cl- (n = 3).

CaMKII-stimulated Cl Current Does Not Require Increased Surface Expression of hCLC-3 in the Stably Transfected tsA Cells

We carried out high resolution membrane capacitance experiments to monitor the increase in cell surface area accompanying ICl,CaMKII activation in the hCLC-3 stably transfected tsA cells. In these experiments we examined the question of whether cytoplasmic vesicular fusion accompanied a membrane conductance (G) increase in the presence of the autonomous kinase. Representative data from these studies are plotted and summarized in Fig. 8. We observed a significant increase in GCl,CaMKII in the presence of autonomous CaMKII (22.4 ± 2.9 nS, n = 4) over that obtained in the absence of the kinase (0.3 ± 0.1 nS, n = 4). Small and inconsistent changes in membrane capacitance were observed in both cases and were not correlated with membrane conductance changes. These experiments allowed us to conclude that a vesicular fusion step was not required for conductance activation in the tsA cells. These experiments do not rule out the possibility that vesicle fusion could contribute to a conductance change in the presence of the autonomous kinase in other secretory cells expressing CLC-3.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   Comparison of CaMKII-dependent changes in membrane conductance and capacitance in hCLC-3 stably transfected tsA cells. Membrane capacitance (Cm) (A) and membrane conductance (Gm) records (B) with (CaMKII) or without (control) autonomous CaMKII in the pipette are plotted as superimposed records for all cells examined. The holding potential was -10 mV. Changes in membrane capacitance (C) were compared with changes in membrane conductance (D) in the presence or absence of the autonomous kinase. The asterisks indicate a significant increase in membrane conductance in the presence of CaMKII compared with the control group (p < 0.01). Changes in membrane capacitance were not correlated with changes in membrane conductance. Numbers of cells in each group are indicated in parentheses.

The hCLC-3 Gene Does Not Code for the Swelling-activated Cl Conductance

In order to determine whether hCLC-3 is also activated by increases in cell volume, we compared Cl- current activation in the vector transfected to that of hCLC-3 transfected tsA cells. In the presence of 50% hypotonic extracellular solution, the resultant current was outwardly rectifying (Fig. 9A). The predicted Cl- reversal potential in the hypotonic solution was -14 mV and the experimentally observed potential was approximately -14 mV demonstrating that the swelling-activated current was Cl- selective. The mean current density of both the basal and swelling-activated current measured from the vector-transfected cells (82.6 ± 16.9 pA/pF, n = 9) was not significantly different from currents recorded from the hCLC-3 stably transfected tsA cells (78.5 ± 8.1 pA/pF, n = 13) as summarized in Fig. 9B.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 9.   Human CLC-3 is not regulated by changes in cell volume. A, representative currents recorded from tsA cells that express hCLC-3 or vector before (isotonic) and following exposure to 50% hypotonic solutions (hypotonic). The I-V relationship for the cells examined is shown to the right of each of the current traces. B, summary of ICl,swell data of hCLC-3 or vector-transfected tsA cells under isotonic and hypotonic conditions. Numbers of cells in each group are indicated in parentheses. The mean current density at +110 mV was not significantly different between hCLC-3 and vector-transfected cells (p > 0.05).

Anti-CLC-3730-744 Inhibits Endogenous ICl,CaMKII but Leaves ICl,swell Intact---We introduced each of two hCLC-3 antibodies into either the hCLC-3 transfected tsA or T84 cells to examine the changes in both CaMKII and swelling-activated Cl- current (Fig. 10A). In the presence of alpha -hCLC-359-74, ICl,CaMKII recorded from tsA cells that express recombinant hCLC-3 did not differ in current density (69.7 ± 21.2 pA/pF, n = 5) as compared with controls (75.7 ± 9.0 pA/pF, n = 31). However, the presence of alpha -hCLC-3730-744 in the pipette solution completely inhibited current activation by the kinase (10.9 ± 6.5 pA/pF, n = 6) (p < 0.05). The swelling-activated anion current was not inhibited by either antibody. The same results were also obtained from T84 cells that express endogenous hCLC-3.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 10.   Anti-hCLC-3730-744 inhibits ICl,CaMKII but leaves ICl,swell intact. A, whole cell currents activated by CaMKII in pipette solution (CaMKII) or exposure to 50% hypotonic bath solution (Swelling) were recorded when the currents reached steady-state in T84 and hClC-3 transfected tsA cells. Saline, 10 µg/µl alpha -hCLC-3730-744, or 10 µg/µl alpha -hCLC-359-74 was introduced into cells through the patch pipette. Numbers of cells in each group are indicated in parentheses. Data are given as mean peak current at +110 mV for each experimental condition. Asterisks indicate significant differences (p < 0.05) from the control in each group. B, anti-hCLC-3730-744 does not inhibit CaMKII activity directly. The reaction mixture contained CaMKII (20 ng), calmodulin (80 ng), and 32P-labeled Mg-ATP in HEPES buffer, pH 7.4. Anti-hCLC-3730-744 was allowed to interact with the CaMKII for 1 h on ice prior to addition of [gamma -32P]ATP. After 30 s at 30 °C, the reaction was terminated by the addition of an equal volume of ice-cold saturated trichloroacetic acid. The pellet was washed twice with 100% ethanol and resuspended in 90 °C Laemmli sample buffer containing 10 mM EDTA. Following SDS-PAGE electrophoresis, the gel was dried and subjected to autoradiography.

To determine whether the inhibition of the CaMKII-dependent current activation by alpha -hCLC-3730-744 was via direct interaction of the antibody and the enzyme, the in vitro interaction between the two was evaluated. In the presence of Ca2+, alpha -hCLC-3730-744 did not inhibit kinase activity, as determined by autophosphorylation activity (Fig. 10B). These data demonstrate that the antibody-induced inhibition is not through its direct interaction with the kinase.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We present data in this investigation which demonstrates that the expression of the Cl- channel hCLC-3 is in dynamic equilibrium between a cytoplasmic granular compartment and the plasma membrane. The translocation of the protein from the cytoplasmic vesicular compartment to plasma membrane sites appears to be controlled in Cl- secretory cells in a calcium-dependent manner. Subcellular localization in native Cl- secretory tissue is restricted to apical membrane expression. CLC-3 current activation is dependent upon a CaMKII-dependent phosphorylation step, is not necessarily associated with increases in membrane capacitance, and is not correlated with changes in cellular swelling. Although our experiments in the stably transfected tsA cells showed a significant component of surface CLC-3 expression as evidenced by biotinylation experiments and site-directed mutagenesis studies, they do not rule out the possibility that surface expression may be enhanced via vesicle fusion with the plasma membrane accompanying increases in secretory activity. Thus, our results are consistent with those of Stobrawa et al. (7) which localize the intracellular expression of CLC-3 to endosomal compartments and neuronal synaptic vesicles.

The function of the protein product of the Clc-3 gene cloned originally using the LLC-PK1 and MDCK epithelial cell lines (1, 2) has been the subject of a number of studies. Kawasaki and colleagues (1) first demonstrated constitutive current activation of the rat kidney Clc-3 (rClc-3) in Xenopus oocytes and found that the recombinant channel currents were inhibited by protein kinase C. The abundant expression of the transcript in brain and its modulation by protein kinase C suggested a potential role for the conductance in the induction and maintenance of long term memory. Expression of the gene in stable mammalian cell lines in a later study by Kawasaki et al. (2) utilized single channel recording measurements to show that an increase in intracellular Ca2+ produced channel inhibition. In more recent studies, the guinea pig heart ClC-3 (gpclc-3) has been identified as a candidate volume-regulated Cl- channel (3, 4). The volume-regulated Cl- conductance (ICl,swell) associated with gpclc-3 expression is characterized by large basal activity under isotonic conditions and sensitivity to PKC, properties which are not shared by the endogenous human, bovine, and rat volume-regulated outwardly rectifying Cl- conductance (24). That the human isoform of CLC-3 differs from the rat and guinea pig isoform by the addition of 58 amino acids in the N-terminal domain suggested to us that it may be associated with a different functional phenotype. Recently, Shimada and colleagues (5) have shown that rat Clc-3 is expressed as two distinct isoforms one corresponding to the gpclc-3 and one corresponding to the hCLC-3 which we report here. They were able to confirm that both isoforms express functional Cl- channels differing in their outward rectification and presence of inactivation at more depolarized potentials. Recent studies from Strowbrawa and colleagues (7) demonstrate that CLC-3 is expressed in neuronal endosomal and synaptic vesicular compartments where it serves as an anion shunt for the V-type H+ ATPase during vesicular acidification.

Previous studies on the characterization of the CaMKII-activated anion conductance carried out in our laboratory as well as others have shown that ICl,CaMKII is outwardly rectifying (8, 11, 12, 14-16, 25), is inhibited in the presence of 500 µM DIDS (16, 25), and has a PI/PCl ratio greater than 1 in airway cells (25, 26) and human macrophages (16). In this paper, we have cloned and expressed the human isoform of the CLC-3 gene and shown that its properties are identical to the endogenous ICl,CaMKII in cells of both airway and gastrointestinal origin.

Introduction of autonomous CaMKII into hCLC-3 stably transfected tsA cells gave rise to an outwardly rectifying Cl- current. The percentage of cells responsive to CaMKII (78%) was comparable to the positive immunostaining in the hCLC-3 stably transfected tsA cells (80%). The CaMKII-dependent anion current was absent in vector-transfected tsA cells, and was blocked by the CaMKII specific inhibitor, autocamtide-2-related inhibitory peptide. The relative lyotropic anion permeability (PX/PCl) of wild type hClC-3 was I- > Br- > Cl- and is consistent with previous reports of ICl,CaMKII from different laboratories (3, 16, 25-27). To confirm that ICl,CaMKII is directly mediated by hCLC-3 and not due to activation of an ion channel endogenous to tsA cells, a mutation in hCLC-3 (G280E) was made and transiently expressed in tsA cells. The relative anion permeability for the G280E mutant was changed to Cl- > Br- > I-, supporting the hypothesis that the human isoform of CLC-3 codes for a CaMKII-activated conductance.

Extended mutational analysis of residues within the region of Gly230 in CLC-1 allowed Fahlke and colleagues (27) to identify a putative pore region located at the C-terminal side of transmembrane segment D3. This region, designated P1, contains a sequence motif (GKXGPXXH) that is evolutionarily conserved across the voltage-gated ClC channel family (27). Interestingly, the G230E mutation in CLC-1 enhances channel permeability to cations and changes the relative anion permeability from Cl- > Br- > I- to I- > Cl- > Br- (27). The homologous mutation in hCLC-3, while reversing the relative I- to Cl- permeability, does so in the opposite direction. This indicates that residue Gly280 is likely to lie within the anion-selective conduction pathway; however, there exists a fundamental difference in the physical properties between the pores of the two CLC isoforms.

CLC-3 along with CLC-4 and CLC-5 are highly homologous proteins and as such form a separate branch of the CLC gene superfamily. Expression studies of CLC-4 and CLC-5 show that they directly mediate plasma membrane currents in that they are characterized by strong outward rectification. However, Friedrich and colleagues (6) reported that they were unable to measure basally active CLC-3 mediated currents in either oocytes or transfected cells in stark contrast to the currents observed by Kawasaki (1, 2) and Duan et al. (3, 4). Our explanation for the absence of currents in the Friedrich et al. (3, 4) studies would be that channel activation is not constitutive but rather phosphorylation dependent.

We examined the gating of hCLC-3 by cell swelling. We recorded ICl,swell in stably transfected tsA cells following an exposure to 50% hypotonic solution. The current characteristics of the ICl,swell from vector and hCLC-3 transfected tsA cells were identical, showing that overexpression of hCLC-3 was not associated with an augmentation of ICl,swell. In order to further study the correspondence between hCLC-3 and ICl,swell, we examined the functional activity of antibodies against peptides specific to CLC-3, which were introduced via the pipette solution into the stably transfected tsA cells as well as T84 cells endogenously expressing ICl,CaMKII. In both cell lines, ICl,CaMKII was abolished in the presence of the anti-C-terminal peptide antibody (alpha -hCLC-3730-744). In both cases, ICl,swell remained intact. The differential antibody sensitivity strongly suggests that ICl,swell and ICl,CaMKII are not mediated by the same protein. The mechanism of ICl,CaMKII current inhibition by alpha -hCLC-3730-744 remains uncertain. Antibody binding to the channel or associated regulatory protein could plausibly either block gating of hCLC-3, or alternatively inhibit a translocation step that is essential for ICl,CaMKII activation.

Our results suggest that the activation of hCLC-3 is not mediated by cell volume changes, rather it is CaMKII-dependent. However, the molecular pathway leading to ICl,CaMKII activation remains unclear. One hypothesis is that CaMKII phosphorylation gates the channel directly or indirectly though associated regulatory subunits. Alternatively, a second hypothesis is that CaMKII-dependent phosphorylation may increase granule fusion, either though facilitation of the movement of channels from a docked granular compartment to the plasma membrane, or though the translocation of cytoplasmic granules containing hCLC-3 protein to the surface sites. The later hypothesis was not supported by our capacitance measurements. However, our experiments do not exclude the involvement of regulatory molecules in the activation of ICl,CaMKII.

CLC-3 has a broad tissue distribution in the body suggesting an important physiological role. Kawasaki et al. (1) reported high levels of Clc-3 expression in rat brain (19). The cellular and physiological importance of CLC-3 in the central nervous system is underscored in the Clcn-3-/- knockout mice which showed a selective degeneration of the hippocampus as well as photoreceptor loss (7). In this study we have shown that there is significant expression of hCLC-3 in cells as diverse in function as Cl- secretory epithelial cells and phagocytic cells of the immune system.

Immunolocalization of hCLC-3 to apical membranes of epithelial cells lining the small intestine, colon, and its expression in the airway epithelia suggest that the channel may prove suitable as an alternate path for anion-driven fluid transport in CF. Activation of an alternate Ca2+-dependent Cl- conductance in the epithelial secretory cells affected in CF has long been recognized as a potential therapeutic target in circumventing the defect in the disease. The development of pharmacological strategies which would ameliorate the consequences of secretory defects in CF utilizing the CaMKII-dependent Cl- conductance are dependent upon identification of the channel at the molecular level. Understanding mechanisms controlling the levels of CLC-3 in the plasma membrane and the factors directly affecting activity of the channel are prerequisite to designing strategies to improve tissue fluid balance in diseases (or conditions) such as CF.

    ACKNOWLEDGEMENT

We thank Dr. J. R. Dedman for many helpful discussions.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant GM36823 and a grant from the Cystic Fibrosis Foundation (Nelson96PO) (to D. J. N.), National Institutes of Health Grant DK46433 (to M. A. K.), National Institutes of Health Digestive Disease Core Grant DK-42086 and The Caroline Halfter Spahn Trust.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

This work is dedicated to the fond memory of Wellesley Anne Johnson.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF172729.

Dagger Contributed equally to the results of this work.

|| To whom correspondence should be addressed: Dept. of Neurobiology, Pharmacology, and Physiology, the University of Chicago, 947 E. 58th St., MC 0926, Chicago, IL 60637. Tel.: 773-702-0126; Fax: 773-702-4066; E-mail: dnelson@drugs.bsd.uchicago.edu.

Published, JBC Papers in Press, March 26, 2001, DOI 10.1074/jbc.M009376200

    ABBREVIATIONS

The abbreviations used are: CaMKII, Ca2+/calmodulin-dependent protein kinase II; RT-PCR, reverse transcriptase-polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; BAPTA, 1,2-bis(O-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid; PIPES, 1,4-piperazinediethanesulfonic acid; DIDS, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid; CF, cystic fibrosis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Kawasaki, M., Uchida, S., Monkawa, T., Miyawaki, A., Mikoshiba, K., Marumo, F., and Sasaki, S. (1994) Neuron 12, 597-604
2. Kawasaki, M., Suzuki, M., Uchida, S., Sasaki, S., and Marumo, F. (1995) Neuron 14, 1285-1291
3. Duan, D., Winter, C., Cowley, S., Hume, J. R., and Horowitz, B. (1997) Nature 390, 417-421
4. Duan, D., Cowley, S., Horowitz, B., and Hume, J. R. (1999) J. Gen. Physiol. 113, 57-70
5. Shimada, K., Li, X., Xu, G., Nowak, D., Showalter, L., and Weinman, S. (2000) Am. J. Physiol. Gastroint. Liver Physiol. 279, G268-G276
6. Friedrich, T., Breiderhoff, T., and Jentsch, T. (1999) J. Biol. Chem. 274, 896-902
7. Stobrawa, S., Breiderhoff, T., Takamori, S., Engel, D., Schweizer, M., Zdebik, A., Boesl, M., Ruether, K., Jahn, H., Draguhn, A., Jahn, R., and Jentsch, T. (2001) Neuron 29, 185-196
8. Worrell, R. T., and Frizzell, R. A. (1991) Am. J. Physiol. 260, C877-C882
9. Chan, H. C., Kaetzel, M. A., Gotter, A. L., Dedman, J. R., and Nelson, D. J. (1994) J. Biol. Chem. 269, 32464-32468
10. Kaetzel, M. A., Chan, H. C., Dubinsky, W. P., Dedman, J. R., and Nelson, D. J. (1994) J. Biol. Chem. 269, 5297-5302
11. Xie, W., Kaetzel, M. A., Bruzik, K. S., Dedman, J. R., Shears, S. R., and Nelson, D. J. (1996) J. Biol. Chem. 271, 14092-14097
12. Xie, W., Solomons, K. R. H., Freeman, S., Kaetzel, M. A., Bruzik, K. S., Nelson, D. J., and Shears, S. B. (1998) J. Physiol. 510, 661-673
13. Merlin, D., Jiang, L., Strohmeier, G. R., Nusrat, A., Alper, S. L., Lencer, W. I., and Madara, J. L. (1998) Am. J. Physiol. 275, C484-C495
14. Wagner, J. A., Cozens, A. L., Schulman, H., Gruenert, D. C., Stryer, L., and Gardner, P. (1991) Nature 349, 793-796
15. Nishimoto, I., Wagner, J. A., Schulman, H., and Gardner, P. (1991) Neuron 6, 547-555
16. Holevinsky, K. O., Jow, F., and Nelson, D. J. (1994) J. Membr. Biol. 140, 13-30
17. Schlenker, T., and Fitz, J. G. (1996) Am. J. Physiol. 271, G304-G310
18. Chao, A. C., Kouyama, K., Heist, E. K., Dong, Y. J., and Gardner, P. (1995) J. Clin. Invest. 96, 1794-1801
19. Borsani, G., Rugarli, E. I., Taglialatela, M., Wong, C., and Ballabio, A. (1995) Genomics 27, 131-141
20. Bookstein, C., dePaoli, A. M., Xie, Y., Niu, P., Musch, M. W., Rao, M. C., and Chang, E. B. (1994) J. Clin. Invest. 93, 106-113
21. Ishida, A., Kameshita, I., Okuno, S., Kitani, T., and Fujisawa, H. (1995) Biochem. Biophys. Res. Commun. 212, 806-812
22. Ishida, A., Shigeri, Y., Tatsu, Y., Uegaki, K., Kameshita, I., Okuno, S., Kitani, T., Yumoto, N., and Fujisawa, H. (1998) FEBS Lett. 427, 115-118
23. Gillis, K. (2000) Pflügers Arch. Eur. J. Physiol. 439, 655-664
24. Okada, Y., Oiki, S., Hazama, A., and Morishima, S. (1998) J. Gen. Physiol. 112, 365-367
25. Chan, H.-C., Goldstein, J., and Nelson, D. J. (1992) Am. J. Physiol. 262, C1273-C1283
26. Anderson, M. P., and Welsh, M. J. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 6003-6007
27. Fahlke, C., Yu, H. T., Beck, C. L., Rhodes, T. H., and George, A. L., Jr. (1997) Nature 390, 529-532


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
JGPHome page
R. A. Falin, R. Morrison, A.-J. L. Ham, and K. Strange
Identification of Regulatory Phosphorylation Sites in a Cell Volume- and Ste20 Kinase-dependent ClC Anion Channel
J. Gen. Physiol., December 29, 2008; 133(1): 29 - 42.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. D. Volk, C. K. Heise, J. L. Hougen, C. M. Artman, K. A. Volk, D. Wessels, D. R. Soll, W. M. Nauseef, F. S. Lamb, and J. G. Moreland
ClC-3 and IClswell are Required for Normal Neutrophil Chemotaxis and Shape Change
J. Biol. Chem., December 5, 2008; 283(49): 34315 - 34326.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
A. Caputo, E. Caci, L. Ferrera, N. Pedemonte, C. Barsanti, E. Sondo, U. Pfeffer, R. Ravazzolo, O. Zegarra-Moran, and L. J. V. Galietta
TMEM16A, A Membrane Protein Associated with Calcium-Dependent Chloride Channel Activity
Science, October 24, 2008; 322(5901): 590 - 594.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Maritzen, D. J. Keating, I. Neagoe, A. A. Zdebik, and T. J. Jentsch
Role of the Vesicular Chloride Transporter ClC-3 in Neuroendocrine Tissue
J. Neurosci., October 15, 2008; 28(42): 10587 - 10598.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. W. Habela, M. L. Olsen, and H. Sontheimer
ClC3 Is a Critical Regulator of the Cell Cycle in Normal and Malignant Glial Cells
J. Neurosci., September 10, 2008; 28(37): 9205 - 9217.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
E. C. Claud, J. Lu, X. Q. Wang, M. Abe, E. O. Petrof, J. Sun, D. J. Nelson, J. Marks, and T. Jilling
Platelet-activating factor-induced chloride channel activation is associated with intracellular acidosis and apoptosis of intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, May 1, 2008; 294(5): G1191 - G1200.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
S. J. Li, M. Kawazaki, K. Ogasahara, and A. Nakagawa
The Intracellular Region of ClC-3 Chloride Channel Is in a Partially Folded State and a Monomer.
J. Biochem., May 1, 2006; 139(5): 813 - 820.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
P. P. Atluri and T. A. Ryan
The kinetics of synaptic vesicle reacidification at hippocampal nerve terminals.
J. Neurosci., February 22, 2006; 26(8): 2313 - 2320.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-G. Zhou, J.-L. Ren, Q.-y. Qiu, H. He, and Y.-Y. Guan
Regulation of Intracellular Cl- Concentration through Volume-regulated ClC-3 Chloride Channels in A10 Vascular Smooth Muscle Cells
J. Biol. Chem., February 25, 2005; 280(8): 7301 - 7308.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
J. Denton, K. Nehrke, X. Yin, R. Morrison, and K. Strange
GCK-3, a Newly Identified Ste20 Kinase, Binds To and Regulates the Activity of a Cell Cycle-dependent ClC Anion Channel
J. Gen. Physiol., January 31, 2005; 125(2): 113 - 125.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hara-Chikuma, B. Yang, N. D. Sonawane, S. Sasaki, S. Uchida, and A. S. Verkman
ClC-3 Chloride Channels Facilitate Endosomal Acidification and Chloride Accumulation
J. Biol. Chem., January 14, 2005; 280(2): 1241 - 1247.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
E. Seong, B. H. Wainer, E. D. Hughes, T. L. Saunders, M. Burmeister, and V. Faundez
Genetic Analysis of the Neuronal and Ubiquitous AP-3 Adaptor Complexes Reveals Divergent Functions in Brain
Mol. Biol. Cell, January 1, 2005; 16(1): 128 - 140.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. S. Piper and W. A. Large
Direct effect of Ca2+-calmodulin on cGMP-activated Ca2+-dependent Cl-channels in rat mesenteric artery myocytes
J. Physiol., September 1, 2004; 559(2): 449 - 457.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Salazar, R. Love, M. L. Styers, E. Werner, A. Peden, S. Rodriguez, M. Gearing, B. H. Wainer, and V. Faundez
AP-3-dependent Mechanisms Control the Targeting of a Chloride Channel (ClC-3) in Neuronal and Non-neuronal Cells
J. Biol. Chem., June 11, 2004; 279(24): 25430 - 25439.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. Yamamoto-Mizuma, G.-X. Wang, L. L. Liu, K. Schegg, W. J. Hatton, D. Duan, T. L. B. Horowitz, F. S. Lamb, and J. R. Hume
Altered properties of volume-sensitive osmolyte and anion channels (VSOACs) and membrane protein expression in cardiac and smooth muscle myocytes from Clcn3-/- mice
J. Physiol., June 1, 2004; 557(2): 439 - 456.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
N. C. Robinson, P. Huang, M. A. Kaetzel, F. S. Lamb, and D. J. Nelson
Identification of an N-terminal amino acid of the CLC-3 chloride channel critical in phosphorylation-dependent activation of a CaMKII-activated chloride current
J. Physiol., April 15, 2004; 556(2): 353 - 368.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
M. Pusch
Ca2+-activated Chloride Channels Go Molecular
J. Gen. Physiol., March 29, 2004; 123(4): 323 - 325.
[Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
J. Eggermont
Calcium-activated Chloride Channels: (Un)known, (Un)loved?
Proceedings of the ATS, January 1, 2004; 1(1): 22 - 27.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
N. G. Jin, J. K. Kim, D. K. Yang, S. J. Cho, J. M. Kim, E. J. Koh, H. C. Jung, I. So, and K. W. Kim
Fundamental role of ClC-3 in volume-sensitive Cl- channel function and cell volume regulation in AGS cells
Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G938 - G948.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Li, J. R. Dedman, and M. A. Kaetzel
Intron Disruption of the Annexin IV Gene Reveals Novel Transcripts
J. Biol. Chem., October 31, 2003; 278(44): 43276 - 43283.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G.-X. Wang, W. J. Hatton, G. L. Wang, J. Zhong, I. Yamboliev, D. Duan, and J. R. Hume
Functional effects of novel anti-ClC-3 antibodies on native volume-sensitive osmolyte and anion channels in cardiac and smooth muscle cells
Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1453 - H1463.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. Fong, B. E. Argent, W. B. Guggino, and M. A. Gray
Characterization of vectorial chloride transport pathways in the human pancreatic duct adenocarcinoma cell line HPAF
Am J Physiol Cell Physiol, August 1, 2003; 285(2): C433 - C445.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. L. Olsen, S. Schade, S. A. Lyons, M. D. Amaral, and H. Sontheimer
Expression of Voltage-Gated Chloride Channels in Human Glioma Cells
J. Neurosci., July 2, 2003; 23(13): 5572 - 5582.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Gentzsch, L. Cui, A. Mengos, X.-b. Chang, J.-H. Chen, and J. R. Riordan
The PDZ-binding Chloride Channel ClC-3B Localizes to the Golgi and Associates with Cystic Fibrosis Transmembrane Conductance Regulator-interacting PDZ Proteins
J. Biol. Chem., February 14, 2003; 278(8): 6440 - 6449.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
J. Arreola, T. Begenisich, K. Nehrke, H.-V. Nguyen, K. Park, L. Richardson, B. Yang, B. C Schutte, F. S Lamb, and J. E Melvin
Secretion and cell volume regulation by salivary acinar cells from mice lacking expression of the Clcn3 Cl- channel gene
J. Physiol., November 15, 2002; 545(1): 207 - 216.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hermoso, C. M. Satterwhite, Y. N. Andrade, J. Hidalgo, S. M. Wilson, B. Horowitz, and J. R. Hume
ClC-3 Is a Fundamental Molecular Component of Volume-sensitive Outwardly Rectifying Cl- Channels and Volume Regulation in HeLa Cells and Xenopus laevis Oocytes
J. Biol. Chem., October 11, 2002; 277(42): 40066 - 40074.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. Rutledge, J. Denton, and K. Strange
Cell cycle- and swelling-induced activation of a Caenorhabditis elegans ClC channel is mediated by CeGLC-7{alpha}/{beta} phosphatases
J. Cell Biol., August 5, 2002; 158(3): 435 - 444.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik
Molecular Structure and Physiological Function of Chloride Channels
Physiol Rev, April 1, 2002; 82(2): 503 - 568.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Mohammad-Panah, C. Ackerley, J. Rommens, M. Choudhury, Y. Wang, and C. E. Bear
The Chloride Channel ClC-4 Co-localizes with Cystic Fibrosis Transmembrane Conductance Regulator and May Mediate Chloride Flux across the Apical Membrane of Intestinal Epithelia
J. Biol. Chem., January 4, 2002; 277(1): 566 - 574.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Lipecka, M. Bali, A. Thomas, P. Fanen, A. Edelman, and J. Fritsch
Distribution of ClC-2 chloride channel in rat and human epithelial tissues
Am J Physiol Cell Physiol, April 1, 2002; 282(4): C805 - C816.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Li, T. Wang, Z. Zhao, and S. A. Weinman
The ClC-3 chloride channel promotes acidification of lysosomes in CHO-K1 and Huh-7 cells
Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1483 - C1491.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. D. Edmonds, I. V. Silva, W. B. Guggino, R. B. Butler, P. L. Zeitlin, and C. J. Blaisdell
Pre- and Postnatal Lung Development, Maturation, and Plasticity: ClC-5: ontogeny of an alternative chloride channel in respiratory epithelia
Am J Physiol Lung Cell Mol Physiol, March 1, 2002; 282(3): L501 - L507.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/23/20093    most recent
M009376200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, P.
Right arrow Articles by Nelson, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, P.
Right arrow Articles by Nelson, D. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement