![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 23, 20300-20308, June 8, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
,
,
**,
, and
§§
From
CEA/Cadarache, DSV-DEVM Laboratoire de
Radiobiologie Végétale,
13108 Saint Paul-lez-Durance, France, the
¶ Department of Food Science, Rutgers University,
New Brunswick, New Jersey 08901, the
Laboratoire de
Biométrie et Biologie Evolutive, UMR CNRS 5558, Université
C, Bernard-Lyon 1, 69622 Villeurbanne, and

CEA/Saclay, DSV-Service de Génétique
et de Biologie Moléculaire, 91108 Gif-sur-Yvette, France
Received for publication, October 25, 2000, and in revised form, February 23, 2001
| |
ABSTRACT |
|---|
|
|
|---|
An Arabidopsis thaliana gene
(AtLPP1) was isolated on the basis that it was transiently
induced by ionizing radiation. The putative AtLPP1 gene
product showed homology to the yeast and mammalian lipid phosphate
phosphatase enzymes and possessed a phosphatase signature sequence
motif. Heterologous expression and biochemical characterization of the
AtLPP1 gene in yeast showed that it encoded an enzyme
(AtLpp1p) that exhibited both diacylglycerol pyrophosphate phosphatase
and phosphatidate phosphatase activities. Kinetic analysis indicated
that diacylglycerol pyrophosphate was the preferred substrate for
AtLpp1p in vitro. A second Arabidopsis gene
(AtLPP2) was identified based on sequence homology to
AtLPP1 that was also heterologously expressed in yeast. The
AtLpp2p enzyme also utilized diacylglycerol pyrophosphate and
phosphatidate but with no preference for either substrate. The AtLpp1p
and AtLpp2p enzymes showed differences in their apparent affinities for
diacylglycerol pyrophosphate and phosphatidate as well as other
enzymological properties. Northern blot analyses showed that the
AtLPP1 gene was preferentially expressed in leaves and
roots, whereas the AtLPP2 gene was expressed in all tissues
examined. AtLPP1, but not AtLPP2, was regulated
in response to various stress conditions. The AtLPP1 gene
was transiently induced by genotoxic stress (gamma ray or UV-B) and
elicitor treatments with mastoparan and harpin. The regulation of the
AtLPP1 gene in response to stress was consistent with the
hypothesis that its encoded lipid phosphate phosphatase enzyme may
attenuate the signaling functions of phosphatidate and/or
diacylglycerol pyrophosphate that form in response to stress in plants.
Phospholipids are major structural components of biological
membranes in plants, animals, and yeast. These molecules also serve as
a reservoir for several lipid-signaling molecules.
PA1 and DG are intermediates
in the biosynthesis of phospholipids and triacylglycerols (1, 2).
PA is an intermediate for the synthesis of the major phospholipids,
which include phosphatidylcholine, phosphatidylethanolamine,
phosphatidylinositol, phosphatidylserine, and
phosphatidylglycerol. The dephosphorylation of PA to DG allows for the
subsequent production of phosphatidylcholine and triacylglycerol, the
major components of eukaryotic membranes and storage lipid, respectively (1, 2). In addition, PA, DG, and DGPP are products of
lipid metabolism that serve roles as second messengers in several cellular signal transduction pathways (3-8). The regulation of these
cell-signaling pathways may be achieved, at least in part, by lipid
phosphate phosphatase enzymes that catalyze the sequential conversion
of DGPP to PA and of PA to DG (5, 7, 9).
Recent studies with a variety of plant systems have shown that PA and
DGPP transiently accumulate after elicitor treatment or in response to
stress (5, 10-12). These observations have suggested that these
phospholipid molecules play a role in plant signal transduction (10,
11). Lipid second messengers in plant cell signaling are produced
through the activation of phospholipase C and phospholipase D (5, 13).
Enhanced levels of PA, necessary for maintaining housekeeping functions
in lipid metabolism and transient induction of PA-related signaling
events, are produced by phospholipase D-mediated hydrolysis of
structural phospholipids and the combined actions of phospholipase C
and DG kinase (5). Stimulation of phospholipase D activity is
associated with plant stress responses, particularly in response to
pathogens (13), wounding (14, 15), water deficit (11), hyperosmotic
stress (12, 16), and the plant stress hormone abscissic acid (17, 18).
Some of these effects may be mediated by G-protein-coupled stress
receptors, because G-protein activators such as mastoparan activate PLD
in the absence of stress (19, 20). Plants appear to have established a
mechanism to attenuate PA action through its phosphorylation by PA
kinase (21) to yield DGPP (22). DGPP is rapidly produced together with
PA during G-protein activation, and high levels of DGPP are rapidly
eliminated (20), which raised the question whether signaling functions
should also be attributed to DGPP. The plant DGPP phosphatase activity
described by Riedel et al. (23) preferentially
dephosphorylates DGPP to PA but also dephosphorylates PA to DG, which
makes possible the sequential conversion of DGPP to PA and DG. The
function of DG remains unclear because a protein kinase C, the
downstream effector target of DG in mammalian cells, has not been
isolated from plants. So far, plant lipid phosphate phosphatase enzymes
able to remove elevated levels of PA and DGPP during the early phase of
stress response have not yet been described.
During the course of studies to examine global responses of genes to
radiation stress in Arabidopsis thaliana, we identified a
gene, which we called AtLPP1, whose deduced protein
structure resembled lipid phosphate phosphatase enzymes from yeast and
mammalian cells. Heterologous expression of the Arabidopsis
AtLPP1 cDNA in the yeast Saccharomyces cerevisiae
showed that the encoded protein was indeed a lipid phosphate
phosphatase that exhibited DGPP phosphatase and PA phosphatase
activities. A second gene (AtLPP2) was identified in the
Arabidopsis data base that was also shown to encode a lipid
phosphate phosphatase enzyme.
AtLPP1, but not AtLPP2, was transiently induced
by ionizing radiation, UV-B radiation, and elicitor treatments with
mastoparan and harpin. The regulation of the AtLPP1 gene in
response to stress was consistent with the hypothesis that its encoded
lipid phosphate phosphatase activities may attenuate the signaling
functions of PA and/or DGPP that form in response to stress in plants.
Plant Materials and Treatment Conditions--
A.
thaliana cell suspensions were grown with constant shaking at
25 °C and continuous white light as described previously (24).
A. thaliana (L) Heynh (Columbia ecotype) plants were
cultivated in a growth chamber on a 14-h light/10-h dark cycle.
Chemical or physical treatments of cell suspensions were applied at the beginning of the exponential phase of growth, which corresponded to
8-12% packed cell volume. Cells in culture medium were treated directly with mastoparan (10 µM) and then collected at
the indicated time intervals. Harpin (Erwinia amylovora)
elicitation was carried out by mechanic infiltration of the elicitin
solution (60 mg/ml) into leaves followed by collection of samples at
the indicated time intervals. Gamma irradiation was performed with a
60Co gamma irradiator (2200 Tbq; CIS Bio International,
France). Cell suspensions were filtered to avoid side effects due to
radiolysis of the culture medium. After gamma irradiation (25-100 Gy,
dose delivery 35 Gy/min), cells were suspended in the culture medium and harvested at the indicated time intervals. Whole plants were irradiated individually followed by the isolation of the indicated tissues. UV-B (312 nm) irradiation was carried out on mature rosettes before bolting with a dose delivery of 1.25 J/cm2/h. After treatments, samples were collected and stored at Molecular Methods and Isolation of the Arabidopsis AtLPP1 and
AtLPP2 Genes--
Poly(A)+ RNA from plant tissues or cell
cultures were prepared as described by Montané et al.
(25). DD-RTPCRs were carried out with purified mRNA preparations
from untreated and gamma-irradiated cells as described by Liang and
Pardee (26). For Northern blot analyses, samples (5 µg) of
poly(A)+ RNA were transferred to Hybond-N nylon membrane
(Amersham Pharmacia Biotech) and hybridized with specific cDNA
probes according to standard procedures (27). Unless otherwise stated,
hybridizations were carried out with the cDNA probe of interest and
A. thaliana 25 S cDNA (internal control). Blots were
scanned and quantified using Storm 840 PhosphorImager (Molecular
Dynamics, S.A. Paris, France). Quantitative RT-PCR (28) was performed
with total RNA extracted from plant tissues (29) using primers specific
for AtLPP1 (CGCAATTCTCAGGACCAGGAGGCGC and
GGACCAGGAAGTGTGTCCGCTCGG) and for AtLPP2
(CCACACATCTTGGTCGTTTGCTGGTC and CGGGTGGTGTCCCGCGTGTTGCTTC). Specific
primers (GCTGAGAGATTCAGGTGCCC and GAGATCCACATCTGCTGG) for the
constitutively expressed actin 8 gene (30) were used as an internal
control. PCRs were in the linear range.
An Arabidopsis cDNA library (31) and a
The AtLPP1 and AtLPP2 open reading frames
comprising the ATG initiator codon and the translation stop codon were
amplified by PCR using AtLPP1-specific
(CGGGATCCATGGACAATAGGGTCGGTTTTTC and ATAAGAATGCGGCCGCTCACAAT
CTCACGACGACGGCC) and AtLPP2-specific (CGGGATCCATGCCTGAAATTCATTTGGG and
ATAAGAATGCGGCCGCTCAACGTACGCTCTCTAGCTCTG) primers, respectively,
using Pfu turbo polymerase (Stratagene). The PCR
fragments were digested with NotI/BamHI and
cloned into the NotI/BamHI sites of the multicopy
shuttle vector pCM185 (32) for expression of the plant cDNAs in
yeast under the control of the tetR promoter.
Yeast Strains and Growth Conditions--
Methods for yeast
growth, sporulation, and tetrad analysis were performed as described
previously (27). Yeast cultures were grown at 28 °C in YPD medium
(1% yeast extract, 2% peptone, 2% glucose) or in complete synthetic
SD medium supplemented with 2% glucose. The appropriate amino acid of
complete synthetic SD medium was omitted for selection purposes.
Escherichia coli strain DH5
The diploid S. cerevisiae strain YPH500xYPH499 (33) was used
as a genetic background for the disruption of the DPP1 and LPP1 genes and the heterologous expression of the
Arabidopsis AtLPP1 and AtLPP2 cDNAs. To
obtain the dpp1 Preparation of Yeast Membranes, Protein Determination, Enzyme
Assays, and Analysis of Kinetic Data--
The total membrane fraction
was isolated from exponential phase yeast cells as described by Toke
et al. (35). Protein concentration was determined with the
BCA microassay reagent (Pierce) using bovine serum albumin as the
standard. Mg2+-independent PA phosphatase activity was
measured by following the release of water-soluble
32Pi from chloroform-soluble 32P-PA
(10,000 cpm/nmol). The reaction mixture contained 50 mM
Tris maleate buffer (pH 6.5), 0.1 mM PA, 1 mM
Triton X-100, 2 mM Na2EDTA, 10 mM
2-mercaptoethanol, and enzyme protein in a total volume of 0.1 ml. DGPP
phosphatase activity was measured by the release of water-soluble
[32P] from chloroform-soluble
[ Identification of Arabidopsis AtLPP1 as an Ionizing
Radiation-induced Gene--
By using differential display methodology
(26), we identified an mRNA species that rapidly increased in
response to severe radiation stress. The display gel shown in Fig.
1A revealed a 400-bp RT-PCR
DNA fragment that accumulated in mRNA preparations from irradiated
cells with respect to RNA preparations from unstressed control cells.
In Northern blot hybridization experiments, the purified DNA fragment
hybridized to a single RNA species of about 1.3 kilobase pairs that
rapidly and transiently accumulated in mRNA populations extracted
from irradiated cell suspensions (Fig. 1B). The 8-fold
elevation of hybridizing mRNA levels in response to radiation
stress was restricted in time to 30 min immediately following the
radiation injury. After this initial induction, the mRNA levels
rapidly returned to near basal levels. We isolated a 1350-bp cDNA
from an Arabidopsis cDNA library (31), which shared
complete sequence identity with the DD-RTPCR fragment at its 3' end. We
also isolated the genomic DNA for this gene from an A. thaliana genomic DNA library. Comparison of the genomic DNA and
cDNA revealed the existence of two putative initiator ATG codons,
separated by the insertion of an intron (Fig.
2A). This gene is located on
chromosome II (Arabidopsis Genome Sequencing Program). The
open reading frame of 984 nucleotides on the cDNA codes for a
putative 35-kDa integral membrane protein, containing six highly
hydrophobic regions of sufficient length to be membrane spanning that
are designated TM1-6 (Fig. 2D). The putative protein contains a 3-domain phosphatase sequence motif (38) that is conserved
in several lipid phosphate phosphatase enzymes in S. cerevisiae and in mammalian cells (7, 38) (Fig. 2D).
Because of this structural conservation, we named this gene
AtLPP1 (A. thaliana
lipid phosphate phosphatase) and
its product AtLpp1p.
Identification of the Arabidopsis AtLPP2 and AtLPP3 Genes--
A
BLAST search in Arabidopsis data bases with the deduced
AtLpp1p protein sequence revealed the existence of two additional proteins of similar size that possessed six putative
transmembrane-spanning domains and the phosphatase signature motif
(Fig. 2, E and F). We named the proteins AtLpp2p
and AtLpp3p and their genes AtLPP2 and AtLPP3,
respectively. The size of AtLPP2 cDNA
(Arabidopsis EST clone 158J20-XP3') is 1131 bp with an open
reading frame of 873 nucleotides coding for a putative protein of 291 amino acids (Fig. 2B). The corresponding gene was identified
by systematic sequencing of chromosome I (GenBankTM
accession number AC007591). The gene encoding the putative AtLpp3p
protein of 35 kDa (Fig. 2C) was found by sequencing of chromosome III BAC F16B3 genomic DNA (GenBankTM
accession number AC021640). In striking difference to
AtLPP1, the AtLPP2 and AtLPP3 genes
are organized in similar exon/intron structures (Fig. 2, B
and C). The AtLPP2 gene, deduced from sequence comparison of its cDNA with the genomic DNA, is interrupted by seven introns in the genome. The start of the open reading frame is
near the 5' end of the second intron. The genomic AtLPP3 DNA downstream of the putative ATG initiator codon is organized into seven
exons of similar size and separated by six introns of similar size,
which may indicate that the two genes have evolved by a recent
duplication from a common ancestor gene. This assumption is further
strengthened by the extent of sequence conservation at the level of
nucleic acids (AtLPP2/AtLPP3 47.8%,
AtLPP1/AtLPP2 30.2%, and AtLPP1/AtLPP3 18.3%).
The data shown in Fig. 3 indicate that
the deduced amino acid sequence of the three putative lipid phosphate
phosphatase proteins are highly conserved (AtLpp1p/AtLpp2p 54.1%,
AtLpp1p/AtLpp3p 54.9%, and AtLpp2p/AtLpp3p 59.7%). This sequence
conservation does not take into account the hypervariable C-terminal
extensions and the AtLpp1p-specific extension at the N terminus, which
brings about the question whether two AtLpp1p splice variants exist,
and whether this extension has the function of a leader peptide
triggering subcellular localization. However, we have not found a short
version of the AtLPP1 mRNA. The lipid phosphatase motif
(denoted by asterisks) is located in virtually invariant
domains of the three Arabidopsis lipid phosphate phosphatase proteins. These domains are juxtaposed to the proposed
membrane-spanning regions in a way that the conserved domains probably
form an important three-dimensional component for the proteins (7, 38).
This model has been confirmed by the mutational analysis of the
S. cerevisiae DPP1 and mouse LPP1 genes,
demonstrating that single amino acid changes in each phosphatase
consensus domain (large asterisks in Fig. 3) are sufficient
to produce severe losses of lipid phosphate phosphatase activity (39,
40). These amino acid residues are conserved in the
Arabidopsis proteins.
We constructed a phylogenetic tree of members of the lipid phosphate
phosphatase protein family including the Arabidopsis AtLpp1p, AtLpp2p, and AtLpp3p proteins (Fig.
4). Although it was not possible to
determine the exact location of the tree root, nevertheless the
phylogenetic tree was clearly split into two major branches whose
separation is a remote event. The Arabidopsis proteins were
grouped with the S. cerevisiae Dpp1p and Lpp1p proteins in
one main branch, whereas all animal lipid phosphate phosphatase proteins were grouped in the other main branch, with the exception of
the putative Drosophila melanogaster Lpp-like protein Q9VND6 (Fig. 4). The recent multiplication of the A. thaliana
Lpp-like proteins leads to the formation of two distinct subgroups, one specified by the AtLpp1p protein and the other composed of the AtLpp2p
and AtLpp3p proteins. Collectively, these analyses indicated that the
Arabidopsis proteins were lipid phosphate phosphatase enzymes. The analysis of one member of each subgroup, namely the AtLPP1 and AtLPP2 genes and their encoded
proteins, is described below. The analysis of AtLPP3 gene
and its product will be described elsewhere.
Functional Analysis of the Arabidopsis AtLPP1- and AtLPP2-encoded
Proteins Expressed in S. cerevisiae--
The lipid phosphate
phosphatase enzymes from S. cerevisiae (35, 41) and
mammalian cells (7) exhibit activity toward a variety of substrates.
Since AtLPP1 gene was identified on the basis of its
induction by radiation stress, and in light of the well documented
transient accumulation of PA and DGPP in plants in response to stress,
it was of particular interest to compare these two substrates. We
examined the hypothesis that the AtLpp1p and AtLpp2p enzymes from
Arabidopsis exhibited both PA phosphatase and DGPP
phosphatase activities. The AtLPP1 and AtLPP2
cDNAs were expressed in a S. cerevisiae lpp1
The dependence of the AtLpp1p and AtLpp2p enzymes on PA and DGPP was
examined using Triton X-100/phospholipid mixed micelles according to
the surface dilution kinetic model (42). Accordingly, the dependence of
the enzymes on their substrates was measured as a function of surface
concentration (in mol %) as opposed to a molar concentration (42).
Under the conditions used here, the activities of the AtLpp1p and
AtLpp2p enzymes were essentially independent of the molar concentration
of substrates. The AtLpp1p (Fig.
6A) and AtLpp2p (Fig.
6B) enzymes exhibited saturation kinetics with respect to
PA. The Km value for PA of the AtLpp2p enzyme (0.04 mol %) was 30-fold lower than that of the AtLpp1p enzyme (1.26 mol %). This suggested that the AtLpp2p enzyme had a greater affinity
for PA when compared with the AtLpp1p enzyme. Owing to the fact that
these enzyme preparations were not homogeneous, we could not make
comparisons of their relative turnover numbers using PA as a substrate.
The dependence of the AtLpp1p enzyme activity on the surface
concentration of DGPP is shown in Fig. 6C. The enzyme
displayed saturation kinetics toward DGPP with a Km
value of 0.25 mol %. For the AtLpp1p enzyme, the Km value for DGPP was 5-fold lower than the
Km value for PA. Thus, based on relative
Km values, DGPP was a better substrate for the
enzyme when compared with PA. We were unable to obtain kinetic data for
the AtLpp2p enzyme using DGPP as a substrate. The dose-response curve
for DGPP was already saturated at the lowest surface concentration that
was possible to use in these experiments. Collectively, these data
showed that the Arabidopsis AtLPP1 and AtLPP2
genes encoded lipid phosphate phosphatase enzymes with distinct
enzymological properties.
Expression of the AtLPP1 and AtLPP2 mRNAs in Arabidopsis
Tissues--
To examine the expression profile of the
Arabidopsis AtLPP1 and AtLPP2 genes, we compared
the distribution of their transcripts in the major plant organs.
Northern blot analyses of total RNA preparations revealed that the
AtLPP1 mRNA was strongly expressed in leaves, moderately
expressed in roots, and weakly expressed in floral hamps and flower
buds (Fig. 7A). The
AtLPP1 mRNA was not detected in adult flowers and
seedpods (Fig. 7A). To analyze simultaneously the levels of
AtLPP1 and AtLPP2 mRNAs in the different RNA
preparations, we employed the quantitative RT-PCR method (28). We
confirmed the preferential expression of AtLPP1 in leaves, whereas the AtLPP2 gene was expressed at detectable levels
in all plant organs analyzed (Fig. 7B).
Differential Regulation of the Arabidopsis AtLPP1 and AtLPP2 Genes
in Response to Stress--
We examined the steady state levels of
AtLPP1 and AtLPP2 mRNAs in the response to
different extracellular stimuli. Because we identified the
AtLPP1 gene based on its induction in response to radiation
injury, we analyzed the levels of the AtLPP1 and AtLPP2 mRNAs after exposure to two different genotoxic
stresses, namely gamma rays and UV-B radiation. Both cause DNA damage
but by different mechanisms (reviewed in Ref. 43). Ionizing radiation preferentially induces double strand breaks on genomic DNA, whereas UV-B radiation induces thymidine dimers. Exposure of cell suspensions to ionizing radiation resulted in a rapid and transient accumulation (8-fold) of AtLPP1 mRNA (Fig.
8A). Maximum induction
occurred at the 15-min time point following treatment (Fig.
8A). These data were consistent with the Northern blot data
shown in Fig. 1B. There was a linear correlation between the
level of induction and the applied dose up to 100 Gy (data not shown).
The application of UV-B radiation caused a transient induction of
AtLPP1 mRNA, with maximum accumulation (~7-fold) at 5 J/cm2 of UV-B (Fig. 8B). The lower levels of
AtLPP1 mRNA expression with higher doses of UV-B
radiation correlated with the appearance of increasing amounts of
cellular degradation that was observable on whole leaves (data not
shown). In contrast to the AtLPP1 gene, the expression
levels of the AtLPP2 mRNA were not significantly
affected by gamma rays (Fig. 8A) or by UV-B radiation (Fig.
8B).
Munnik and co-workers (16, 19, 20, 22) have shown that the levels of PA
and DGPP transiently accumulate in the green alga Chlamydomonas
moewusii in response to mastoparan, a G-protein elicitor. In the
light of these observations, we examined the effects of mastoparan on
the expression of the AtLPP1 and AtLPP2 genes
using Arabidopsis cells. In control experiments, mastoparan elicited changes in the lipid content of Arabidopsis cells
similar to that shown by Munnik et al. (19). Mastoparan
elicited a rapid and transient accumulation (3-fold) of
AtLPP1 mRNA within 30 min after treatment (Fig.
8C). The levels of AtLPP2 mRNA were not significantly affected by mastoparan over the same period (Fig. 8C).
As a second elicitor, we have used harpin, a 44-kDa bacterial protein
that elicits hypersensitive response in plant cells (44). In contrast
to mastoparan, the hypersensitive response is induced by oxidative
stress but is independent of PLD activity (45). We examined the effects
of harpin on the expression of AtLPP1 and AtLPP2.
Infiltration of Arabidopsis leaves with harpin resulted in a
transient accumulation (8-fold) of AtLPP1 mRNA in leaves, whereas AtLPP2 mRNA levels remain unchanged
(Fig. 8D). Interestingly, AtLPP1 mRNA
induction was also observed in the leaves adjacent to those that were
infiltrated with harpin (data not shown). Collectively, these
experiments showed that the Arabidopsis AtLPP1 gene was
induced in response to a variety of signaling events including DNA
damage, G-protein activation, and oxidative stress.
Several lipid phosphate phosphatase enzymes have been described
from S. cerevisiae and mammalian cells (7, 9). These enzymes
utilize a variety of lipid phosphate substrates in vitro including PA, DGPP, lyso-PA, ceramide 1-phosphate, and sphingosine 1-phosphate (7, 9). It has been proposed that the function of these
enzymes is to attenuate the signaling functions that are associated
with their substrates (3, 4, 7, 9). A number of studies have shown that
PA and DGPP accumulate in plants in a transient manner in response to
various forms of stress (5, 10-12). In this work we identified a new
Arabidopsis lipid phosphate phosphatase gene family. The
AtLPP1 gene was identified on the basis that it was induced
in response to ionizing radiation. The other members of the family
(AtLPP2 and AtLPP3) were identified based on
their homology with AtLPP1. The deduced proteins encoded by
these genes showed structural similarities to the lipid phosphate phosphatase enzymes of yeast and mammalian cells, including the presence of a 3-domain phosphatase sequence motif (38). Heterologous expression of the Arabidopsis AtLPP1 and AtLPP2
cDNAs in a S. cerevisiae dpp1 The Arabidopsis AtLpp1p and AtLpp2p enzymes utilized PA and
DGPP as substrates, similar to the lipid phosphate phosphatase enzymes
from yeast (9) and mammalian cells (7). AtLpp1p and AtLpp2p showed
differences in their enzymological properties with respect to effects
by Mg2+ ions and NEM. Kinetic data showed that the AtLpp1p
enzyme preferred DGPP to PA as a substrate, whereas the AtLpp2p enzyme
did not show a preference for either substrate. Based on relative
Km values, the AtLpp2p enzyme exhibited a greater
affinity for its lipid phosphate substrates when compared with the
AtLpp1p enzyme. The substrate preference and apparent affinities of the
Arabidopsis AtLpp1p and AtLpp2p enzymes for PA and DGPP were
generally similar to the DPP1-encoded (36, 41) and
LPP1-encoded (35, 45) lipid phosphate phosphatase enzymes of
S. cerevisiae, respectively. Indeed, the phylogenetic tree
of the Arabidopsis and yeast lipid phosphate phosphatase
enzymes support these relationships.
The Arabidopsis AtLpp1p and AtLpp2p enzymes appear to have
different functions in cell physiology. Expression of the
AtLPP1 gene was mainly found in leaves and roots, whereas
the AtLPP2 gene was expressed in all plant organs examined.
The expression of AtLPP1 gene was regulated in response to
stress, whereas the AtLPP2 gene was constitutively
expressed. Treatment of cells with both ionizing radiation and UV-B
radiation, both of which induce DNA damage, resulted in a transient
increase in AtLPP1 gene expression. Elicitation with
mastoparan, which induces G-protein-mediated activation of
phospholipase D and subsequently accumulation of PA and DGPP (19, 22),
caused the transient induction of the AtLPP1 gene.
Elicitation with harpin, which induces oxidative stress but not PLD
activity, also caused the transient induction of AtLPP1.
Taken together, these observations suggest that the AtLpp1p enzyme
plays a general role in cellular responses to stress. The AtLpp2p
enzyme may play a general "housekeeping role" in lipid metabolism;
however, additional studies will be needed to establish this. The
S. cerevisiae DPP1-encoded lipid phosphate phosphatase also
plays a role in cellular responses to stress. The DPP1 gene is induced by inositol supplementation (47), the stress condition of
stationary growth phase (47), and by zinc deprivation (48).
The rapid synthesis of PA and its subsequent conversion to DGPP by PA
kinase are newly discovered common signaling events that take place in
plants after elicitor treatment (10), wounding (14), dehydration (11),
and hyperosmotic stress (12, 16). The increases in PA and DGPP levels
measured in the resurrection plant Craterostigma
plantagineum early after onset of dehydration correlates with the
induction of PLD2 gene expression, a global increase in
phospholipase D activity, and the combined actions of phospholipase C
and DG kinase (11). These observations demonstrate a link between
stress, phospholipase activities, and the transient accumulation of PA
and DGPP, which may activate pathways leading to stress adaptation.
Interestingly, dehydration causes an increase in expression of the
PLD genes in leaves and roots, the organs where the
AtLPP1 gene was expressed the most. This further suggests a
link between the phospholipases and lipid phosphate phosphatases, one creating the signal and the other attenuating the signal. From the
responsiveness of the AtLPP1 gene to a variety of stress conditions, we cannot rule out that other bioactive plant phospholipids may be substrates for the AtLpp1p enzyme.
Before PA and DGPP can be generally accepted as second messengers in
plants, specific downstream targets and responses must be identified,
and a rapid and direct down-regulation mechanism should exist to remove
signaling when appropriated. PA has been shown to activate
deflagellation in Chlamydomonas spp. (19), inhibit
In summary, these studies advance the understanding of the lipid
phosphate phosphatase protein family in higher plants and the
regulation of the AtLPP1 gene in response to stress. To
understand better the individual roles of the Arabidopsis
lipid phosphate phosphatase protein family, ongoing research in our
laboratory focuses on the isolation and characterization of
AtLPP1 and AtLPP2 knock-out mutant plants to
determine their roles in lipid metabolism and cellular responses to stress.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
80 °C.
phage
genomic DNA library were screened with the DD-RTPCR AtLPP1
fragment as a probe using standard protocols (27). Purified clones that
gave strong positive hybridization signals with the plant DNA inserts were chosen for physical mapping and sequencing.
was grown at 37 °C in LB
medium (1% tryptone, 0.5% yeast extract, 1% NaCl (pH 7.4).
Ampicillin (100 mg/ml) was added to the culture medium of DH5
cells
that carried plasmids. Media were supplemented with 2 (yeast) or 1.5%
(bacteria) agar for growth on plates. Cell numbers were determined
spectrophotometrically at an absorbance of 600 nm.
lpp1
double mutant, the
resident genes were successively disrupted by the insertion of
selection marker genes allowing growth on appropriate selective media.
Gene disruption was carried out according to the method of Baudin
et al. (34). The DPP1 gene was disrupted by
insertion of the S. cerevisiae HIS3 gene, and the
LPP1 gene was disrupted by insertion of the
Kluyveromyces lactis URA3 gene. Haploid dpp1
and lpp1
mutant strains were selected by tetrad analysis.
A dpp1
mutant was crossed with an lpp1
to
form a diploid strain that was heterozygous for the DPP1 and
LPP1 alleles. Putative dpp1
lpp1
double mutants were selected for their ability to grow on complete
synthetic SD media lacking both histidine and uracil. The disruption of
the chromosomal copies of the DPP1 and LPP1 genes
was confirmed by PCR and Northern blot analysis. Strain 239 was one of
the haploid dpp1
lpp1
mutants that was
isolated and used for the expression of the Arabidopsis cDNAs.
-32P]DGPP (5000-10,000 cpm/nmol) as described by Wu
et al. (36). The reaction mixture contained 50 mM citrate buffer (pH 5.0), 0.1 mM DGPP, 2 mM Triton X-100, 10 mM 2-mercaptoethanol, and
enzyme protein in a total volume of 0.1 ml. [32P]PA was
synthesized from DG using E. coli DG kinase (37), and DGPP
was synthesized from PA using purified Catharanthus roseus PA kinase as described previously (36). All enzyme assays were conducted at 30 °C in triplicate. The enzyme reactions were linear with time and protein concentration. Activities were expressed as
pkatal (pmol of product/s) per mg of protein. Kinetic data were
analyzed according to the Michaelis-Menten equation using SigmaPlot
software with nonlinear regression algorithms.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (68K):
[in a new window]
Fig. 1.
Identification of the Arabidopsis
AtLPP1 gene in response to ionizing radiation by
DD-RTPCR. A, DD-RTPCR was performed with the primers
T11CA and Ara 15 (GACCGCTTGT) and the indicated amounts of
reverse-transcribed mRNA derived from untreated (C) or
irradiated cell suspensions as templates. Samples were taken 15 min
following a gamma ray dose of 100 Gy. The amplified product
AtLPP1 (indicated by the arrowhead) corresponded
to the RNA that was induced by ionizing radiation. B,
samples of mRNA (10 µg) prepared from untreated (C) or
irradiated cells (100 Gy), prepared at the indicated time intervals,
were used for Northern blot analysis with a mixture of radiolabeled
AtLPP1 differential display cDNA and the constitutive
A. thaliana 25 S cDNA (internal control).

View larger version (25K):
[in a new window]
Fig. 2.
Schematic representations of the
Arabidopsis AtLPP1, AtLPP2, and
AtLPP3 genes and hydropathy plots of their deduced
proteins. A-C, schematic representations of the
structures of the AtLPP1, AtLPP2, and
AtLPP3 genes, respectively. For AtLPP1 genomic
DNA, numbers were given with respect to the experimentally determined
transcription start (+1), two possible translation start
codons, in frame in the cDNA but separated by insertion of an
intron on the genomic DNA, are indicated by ATG. The
putative translation initiator ATG (+1) of the AtLPP2 coding
region was deduced from cDNA sequencing, and the nucleotides are
numbered with respect to the translation start. D-F,
hydropathy plots of the deduced AtLpp1p, AtLpp2p, and AtLPP3p proteins
showing potential membrane-spanning domains (designated
TM1-6) and the regions of the phosphatase sequence motif
(designated by roman numerals).

View larger version (49K):
[in a new window]
Fig. 3.
Amino acid sequence comparison of the
deduced AtLpp1p, AtLpp2p, and AtLPP3p proteins. In the aligned
amino acid sequences, invariant amino acids are boxed in
black, and conserved amino acids (2/3) are boxed
in gray. The transmembrane regions are indicated as
yellow boxes; the conserved amino acids therein are in
red (3/3) or green (2/3) letters, and
variable amino acids in black letters. Black bars indicate
the three domains of the phosphatase sequence motif.
Asterisks indicate conserved amino acid residues of all
lipid phosphate phosphatase proteins. Asterisks of different
sizes indicate the amino acid residues that have been used for
site-directed mutagenesis of the S. cerevisiae DPP1 (39) and
mouse LPP1 (40) genes.

View larger version (32K):
[in a new window]
Fig. 4.
Phylogenetic analysis of the lipid phosphate
phosphatase protein family. The Arabidopsis AtLpp1p,
AtLpp2p, and AtLpp3p proteins, the S. cerevisiae Dpp1p and
Lpp1p proteins, all available mammalian lipid phosphate phosphatase
proteins, the Drosophila Wunen protein, as well as the
uncharacterized putative lipid phosphate phosphatase-like proteins
identified in the A. thaliana, D. melanogaster,
Caenorhabditis elegans, and Schizosaccharomyces
pombe genomes were used for comparison. The tree was built
applying the Neighbor Joining Method to PAM distances computed on 88 reliably aligned sites (49). SwissProt accession numbers (in
brackets) designate all protein sequences. The length of
horizontal branches is such that the evolutionary distance between two
proteins is proportional to the total length of the horizontal branches
that connect them. Bootstrap values are shown at the
nodes.
dpp1
mutant that we have constructed (see "Experimental
Procedures") as a genetic background to examine their gene-enzyme
relationships. As described previously (35), the lpp1
dpp1
mutant that we have obtained did not possess DGPP phosphatase activity, and the PA phosphatase activity was reduced to
about 1% of the activity measured in the control wild-type strain.
Thus, this yeast mutant was an appropriate system to examine the
functional expression of the plant enzymes. The Arabidopsis cDNAs were expressed at similar levels in exponential phase cells (Fig. 5A). Moreover, these
cDNAs directed the expression of both PA phosphatase and DGPP
phosphatase activities in the membrane fraction of exponential phase
cells. Under standard assay conditions, with saturating concentrations
of substrates, the DGPP phosphatase activity of the AtLpp1p enzyme was
3.4-fold greater when compared with its PA phosphatase activity (Table
I). On the other hand, the PA
phosphatase and DGPP phosphatase activities of the AtLpp2p enzyme were
not significantly different (Table I). The lipid phosphate phosphatase
activities of S. cerevisiae (9) and mammalian cells (7) are
generally described as being NEM-insensitive and
Mg2+-independent. We examined the effects of these
molecules on the PA phosphatase activity of the Arabidopsis
AtLpp1p and AtLpp2p enzymes. The effects of NEM on the PA phosphatase
activities of the AtLpp1p and AtLpp2p enzymes are shown in Fig.
5B. The addition of NEM to the assay system for the AtLpp1p
enzyme resulted in a dose-dependent inhibition of PA
phosphatase activity with an IC50 value of 10 mM, whereas NEM did not affect the PA phosphatase activity
of the AtLpp2p enzyme. The PA phosphatase activity of each enzyme was
indeed independent of a Mg2+ ion requirement (Fig.
5C). However, the addition of Mg2+ ions to the
assay system for the AtLpp2p enzyme, but not the AtLpp1p enzyme,
resulted in a transient increase (2.5-fold) in PA phosphatase activity
(Fig. 5C). Relatively high concentrations of
Mg2+ ions (e.g. 20 mM) resulted in a
small decrease in the PA phosphatase activities of both the AtLpp1p and
AtLpp2p enzymes (Fig. 5C).

View larger version (21K):
[in a new window]
Fig. 5.
Expression of the Abrabidopsis
AtLPP1 and AtLPP2 genes in a S. cerevisiae dpp1
lpp1
mutant. A, Northern blot analysis was performed
with RNA samples (5 µg) extracted from the S. cerevisiae
dpp1
lpp1
mutant bearing plasmids pCM185
(lanes 1 and 3), pCM185AtLPP1
(lane 2), and pCM185AtLPP2 (lane 4).
S. cerevisiae dpp1
lpp1
mutant cells
bearing plasmids pCM185AtLPP1 and pCM185AtLPP2
were harvested in the exponential phase of growth, and the membrane
fraction was isolated. PA phosphatase activity in the membrane
fractions from these cells was measured in the absence and presence of
the indicated concentrations of Mg2+ ions (B)
and the indicated concentrations of NEM (C).
PA phosphatase and DGPP phosphatase activities exhibited by the
Arabidopsis AtLpp1p and AtLpp2p proteins expressed in the S. cerevisiae
dpp1
lpp1
mutant
lpp1
mutant cells bearing plasmids
pCM185AtLPP1 and pCM185AtLPP2 were harvested in
the exponential phase of growth, and the membrane fraction was
isolated. PA phosphatase and DGPP phosphatase activities were measured
in the membrane fractions from these cells under standard assay
conditions with saturating concentrations of PA (5 mol %) and DGPP (1 mol %), respectively.

View larger version (17K):
[in a new window]
Fig. 6.
Kinetic analysis of the PA phosphatase and
DGPP phosphatase activities of the Arabidopsis AtLpp1p
and AtLpp2p proteins expressed in S. cerevisiae
membranes. The PA phosphatase activity of the AtLpp1p
(A) and AtLpp2p (B) proteins expressed in the
membranes of the S. cerevisiae dpp1
lpp1
mutant was measured as a function of the surface concentration of PA.
The molar concentration of PA was held constant at 0.1 mM.
The DGPP phosphatase activity of the AtLpp1p protein (C) was
measured as a function of the surface concentration of DGPP. The molar
concentration of DGPP was held constant at 0.1 mM. The
insets shown in each of the panels are double-reciprocal
plots of the data.

View larger version (46K):
[in a new window]
Fig. 7.
Expression of the Arabidopsis
AtLPP1 and AtLPP2 mRNAs in various
plant organs. A, samples (20 µg) of total RNA
prepared from roots, leaves, stems, flower buds, mature flowers, and
siliques were transferred to nylon filter and hybridized with a mixture
of radiolabeled AtLPP1 cDNA and 25 S cDNA. The
25 S RNA was visualized after a 6-h exposure, whereas the
AtLPP1 mRNA was visualized after a 10-day exposure.
B, the same RNA preparations were used for the analysis of
AtLPP1, AtLPP2, and Act8 mRNA by
quantitative RT-PCR with gene-specific primers.

View larger version (31K):
[in a new window]
Fig. 8.
Expression of the Arabidopsis
AtLPP1 and AtLPP2 genes in response to
various stresses. Simultaneous quantification of
AtLPP1, AtLPP2, and Act8 (internal
control) transcript levels in RNA preparations from leaves or cell
cultures after stress application was carried out by quantitative
RT-PCR. Gene-specific primers were designed to give distinguishable
amplification products for quantification (583 bp for
AtLPP1, 417 bp for AtLPP2, and 196 bp for
Act8). The results were presented as an autoradiograph
(A) or as the calculated induction ratio deduced from the
RNA quantification (B-D). One-week-old cell suspensions
were irradiated with a single dose of 100 Gy (A) or treated
with 10 µM mastoparan (C). Adult rosettes were
exposed to increasing doses of UV-B radiation (B) or treated
by harpin infiltration of individual leaves (D).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
lpp1
mutant showed that the plant genes did indeed encode lipid phosphate
phosphatase enzymes.
-amylase synthesis in barley aleurone cells (17), and activate
stomatal closure via inhibition of the inward K+ channel in
fava bean leaves (18). The formation of DGPP, barely detectable in
non-stimulated cells and strictly coupled to increases in PA, has been
initially interpreted as inactivation of the PA signal (5, 22). Recent
observations, demonstrating that DGPP is able to activate a
mitogen-activated protein kinase pathway in macrophages (8), and the
fact that DGPP is synthesized when PA levels decline (20), suggest a
signaling function for DGPP.
| |
ACKNOWLEDGEMENTS |
|---|
We thank M. Axelos (INRA, Toulouse, France) for the gift of Arabidopsis cell suspensions; F. Lacroute (CNRS, Gif-sur-Yvette, France) for the gift of the Arabidopsis cDNA library; P. Guerche (INRA Versailles, France) for the gift of the Arabidopsis genomic DNA library; B. Alonso for technical assistance; and C. Triantaphylides for help in setting up the kinetic experiments. C. Berthomieux, C. Godon, M. Mouchaboeuf, D. Pignol, and A. Vermeglio are thanked for helpful comments and critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by Commissariat à L'Energie Atomique (to M. K.) and United States Public Health Service Grant GM-28140 from the National Institutes of Health (to G. M. C).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Recipient of a 3-year thesis fellowship provided by Région Provence-Alpes-Côte d'Azur (France).
** Present address: University of Cambridge, Institute of Biotechnology, Tennis Court Rd., Cambridge CB2 1QT, UK.
§§ To whom correspondence and reprint requests should be addressed: CEA/Cadarache, DSV-DEVM-Laboratoire de Radiobiologie Végétale, 13108 Saint Paul-lez-Durance, France. Tel.: 33-4-42-25-23-36; Fax: 33-4-42-25-62-86; E-mail: mkazmaier@cea.fr.
Published, JBC Papers in Press, February 26, 2001, DOI 10.1074/jbc.M009726200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: PA, phosphatidate; DG, diacylglycerol; DGPP, diacylglycerol pyrophosphate; PCR, polymerase chain reaction; RT-PCR, reverse-transcribed PCR; DD-RTPCR, differential display reverse-transcribed polymerase chain reaction; NEM, N-ethylmaleimide; bp, base pair; PLD, phospholipase D.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Kent, C. (1995) Annu. Rev. Biochem. 64, 315-343 |
| 2. | Browse, J., and Somerville, C. (1991) Annu. Rev. Plant Physiol. Plant Mol. Biol. 42, 467-506 |
| 3. | Divecha, N., and Irvine, R. F. (1995) Cell 80, 269-278 |
| 4. | English, D. (1996) Cell. Signal. 8, 341-347 |
| 5. | Munnik, T., Irvine, R. F., and Musgrave, A. (1998) Biochim. Biophys. Acta 1389, 222-272 |
| 6. | Brindley, D. N., and Waggoner, D. W. (1996) Chem. Phys. Lipids 80, 45-57 |
| 7. | Waggoner, D. W., Xu, J., Singh, I., Jasinka, R., Zhang, Q. X., and Brindley, D. N. (1999) Biochim. Biophys. Acta 1439, 299-316 |
| 8. | Balboa, M. A., Balsinde, J., Dillon, D. A., Carman, G. M., and Dennis, E. A. (1999) J. Biol. Chem. 274, 522-526 |
| 9. | Carman, G. M. (1997) Biochim. Biophys. Acta 1348, 45-55 |
| 10. | Van der Luit, A. H., Piatti, T., van Doorn, A., Musgrave, A., Felix, G., Boller, T., and Munnik, T. (2000) Plant Physiol. 123, 1507-1515 |
| 11. | Frank, W., Munnik, T., Kerkmann, K., Salamini, F., and Bartels, D. (2000) Plant Cell 12, 111-123 |
| 12. | Pical, C., Westergren, T., Dove, S. K., Larsson, C., and Sommarin, M. (1999) J. Biol. Chem. 274, 38232-38240 |
| 13. | Chapman, K. D. (1998) Trends Plant Sci. 3, 419-426 |
| 14. | Lee, S., Suh, S., Kim, S., Crain, R. C., Kwak, J. M., Nam, H. G., and Lee, Y. (1997) Plant J. 12, 547-556 |
| 15. | Ryu, S. B., and Wang, X. (1998) Biochim. Biophys. Acta 1393, 193-202 |
| 16. | Munnik, T., Meijer, H. J. G., ter Riet, B., Hirt, H., Franck, W., Bartels, D., and Musgrave, A. (2000) Plant J. 22, 147-154 |
| 17. | Ritchie, S., and Gilroy, S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2697-2702 |
| 18. | Jacob, T., Ritchie, S., Assmann, S. M., and Gilroy, S. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 12192-12197 |
| 19. | Munnik, T., Arisz, S. A., de Vrije, T., and Musgrave, A. (1995) Plant Cell 7, 2197-2210 |
| 20. | Munnik, T., van Himbergen, J. A. J., ter Riet, B., Braun, F. J., Irvine, R. F., van der Ende, H., and Musgrave, A. (1998) Planta 207, 133-145 |
| 21. | Wissing, J. B., and Behrbohm, H. (1993) Plant Physiol. 102, 1243-1249 |
| 22. | Munnik, T., de Vrije, T., Irvine, R. F., and Musgrave, A. (1996) J. Biol. Chem. 271, 15708-15715 |
| 23. | Riedel, B., Morr, M., Wu, W. I., Carman, G. M., and Wissing, J. B. (1997) Plant Sci. 128, 1-10 |
| 24. | Axelos, M., Curie, C., Mazzolini, L., Bardet, C., and Lescure, B. (1992) Plant Physiol. Biochem. 30, 123-128 |
| 25. | Montané, M. H., Dreyer, S., Triantaphylides, C., and Kloppstech, K. (1997) Planta 202, 293-302 |
| 26. | Liang, P., and Pardee, A. (1992) Science 257, 967-970 |
| 27. | Ausuebel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Siedman, J. G., Smith, J. A., and Struhl, K. (1994) Current Protocols in Molecular Biology , Greene Publishing, Inc., Wiley, New York |
| 28. | Godon, C., Lagniel, G., Lee, J., Buhler, J. M., Kieffer, S., Perrot, M., Boucherie, H., Toledano, M. B., and Labarre, J. (1998) J. Biol. Chem. 273, 22480-22489 |
| 29. | Kloppstech, K., Otto, B., and Sierralta, W. (1991) Mol. Gen. Genet. 225, 468-473 |
| 30. | An, Y. Q., McDowell, J. M., Huang, S., McKinney, E. C., Chambliss, S., and Meagher, R. B. (1996) Plant J. 10, 107-121 |
| 31. | Minet, M., Dufour, M. E., and Lacroute, F. (1992) Plant J. 2, 417-422 |
| 32. | Gari, E., Piedrafita, L., Aldea, M., and Herrero, E. (1997) Yeast 13, 837-848 |
| 33. | Sikorski, R. S., and Hieter, P. (1989) Genetics 122, 19-27 |
| 34. | Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A., Lacroute, F., and Cullin, C. (1993) Nucleic Acids Res. 21, 3329-3330 |
| 35. | Toke, D. A., Bennett, W. L., Oshiro, J., Wu, W. I., Voelker, D. R., and Carman, G. M. (1998) J. Biol. Chem. 273, 14331-14338 |
| 36. | Wu, W. I., Liu, Y., Riedel, B., Wissing, J. B., Fishl, A. S., and Carman, G. M. (1996) J. Biol. Chem. 271, 1868-1876 |
| 37. | Waggoner, D. W., Gomez-Munoz, A., Dewald, J., and Brindley, D. N. (1996) J. Biol. Chem. 271, 16506-16509 |
| 38. | Stukey, J., and Carman, G. M. (1997) Protein Sci. 6, 469-472 |
| 39. | Toke, D. A., McClintick, M. L., and Carman, G. M. (1999) Biochemistry 38, 14606-14613 |
| 40. | Zhang, Q. X., Pilquil, C. S., Dewald, J., Berthiaume, L. G., and Brindley, D. N. (2000) Biochem. J. 345, 181-184 |
| 41. | Toke, D. A., Bennett, W. L., Dillon, D. A., Wu, W., Chen, X., Ostrander, D. B., Oshiro, J., Cremesti, A., Voelker, D. R., Fishl, A. S., and Carman, G. M. (1998) J. Biol. Chem. 273, 3278-3284 |
| 42. | Carman, G. M., Deems, R. A., and Dennis, E. A. (1995) J. Biol. Chem. 270, 18711-18714 |
| 43. | Friedberg, E. C., Walker, G. C., and Seide, W. (1995) DNA Repair and Mutagenesis , pp. 19-41, American Society for Microbiology, Washington, D. C. |
| 44. | Desikan, R., Reynolds, A., Hancock, J. T., and Neill, S. J. (1998) Biochem. J. 330, 115-120 |
| 45. | Schroeder-Taylor, A. T., and Low, P. S. (1997) Biochem. Biophys. Res. Commun. 237, 10-15 |
| 46. | Furneisen, J. M., and Carman, G. M. (2000) Biochim. Biophys. Acta 1484, 71-82 |
| 47. | Oshiro, J., Rangaswamy, S., Chen, X., Han, G. S., Quinn, J. E., and Carman, G. M. (2000) J. Biol. Chem. 275, 40887-40896 |
| 48. | Han, G. S., Johnston, C. N., Chen, X., Athenstaedt, K., Daum, G., and Carman, G. M. (2001) J. Biol. Chem. 276, 10126-10133 |
| 49. | Saitou, N., and Nei, M. (1987) Mol. Biol. Evol. 4, 406-425 |
This article has been cited by other articles:
![]() |
Y. Nakamura, M. Tsuchiya, and H. Ohta Plastidic Phosphatidic Acid Phosphatases Identified in a Distinct Subfamily of Lipid Phosphate Phosphatases with Prokaryotic Origin J. Biol. Chem., September 28, 2007; 282(39): 29013 - 29021. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zalejski, S. Paradis, R. Maldiney, Y. Habricot, E. Miginiac, J.-P. Rona, and E. Jeannette Induction of Abscisic Acid-Regulated Gene Expression by Diacylglycerol Pyrophosphate Involves Ca2+ and Anion Currents in Arabidopsis Suspension Cells Plant Physiology, August 1, 2006; 141(4): 1555 - 1562. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xu, J. Fan, J. E. Froehlich, K. Awai, and C. Benning Mutation of the TGD1 Chloroplast Envelope Protein Affects Phosphatidate Metabolism in Arabidopsis PLANT CELL, November 1, 2005; 17(11): 3094 - 3110. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Marmagne, M.-A. Rouet, M. Ferro, N. Rolland, C. Alcon, J. Joyard, J. Garin, H. Barbier-Brygoo, and G. Ephritikhine Identification of New Intrinsic Proteins in Arabidopsis Plasma Membrane Proteome Mol. Cell. Proteomics, July 1, 2004; 3(7): 675 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-S. Han, C. N. Johnston, and G. M. Carman Vacuole Membrane Topography of the DPP1-encoded Diacylglycerol Pyrophosphate Phosphatase Catalytic Site from Saccharomyces cerevisiae J. Biol. Chem., February 13, 2004; 279(7): 5338 - 5345. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||