JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M101375200 on March 8, 2001

J. Biol. Chem., Vol. 276, Issue 23, 20346-20356, June 8, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/23/20346    most recent
M101375200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, B. Y.
Right arrow Articles by Cartwright, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, B. Y.
Right arrow Articles by Cartwright, C. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Interaction of Src and RACK1 Is Enhanced by Activation of Protein Kinase C and Tyrosine Phosphorylation of RACK1*

Betty Y. Chang, Meiling Chiang, and Christine A. CartwrightDagger

From the Department of Medicine, Stanford University, Stanford, California 94305

Received for publication, February 13, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RACK1 is an intracellular receptor for the serine/ threonine protein kinase C. Previously, we demonstrated that RACK1 also interacts with the Src protein-tyrosine kinase. RACK1, via its association with these protein kinases, may play a key role in signal transduction. To further characterize the Src-RACK1 interaction and to analyze mechanisms by which cross-talk occurs between the two RACK1-linked signaling kinases, we identified sites on Src and RACK1 that mediate their binding, and factors that regulate their interaction. We found that the interaction of Src and RACK1 is mediated, in part, by the SH2 domain of Src and by phosphotyrosines in the sixth WD repeat of RACK1, and is enhanced by serum or platelet-derived growth factor stimulation, protein kinase C activation, and tyrosine phosphorylation of RACK1. To the best of our knowledge, this is the first report of tyrosine phosphorylation of a member of the WD repeat family of proteins. We think that tyrosine phosphorylation of these proteins is an important mechanism of signal transduction in cells.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Src family of intracellular protein-tyrosine kinases participates in diverse signaling pathways that regulate cell growth, differentiation, adhesion, and architecture (reviewed in Ref. 1). Identification of Src-binding proteins has led to better understanding of Src regulation and has provided clues about the function of Src in normal and transformed cells. For example, characterization of the interaction between Src and polyoma middle T antigen led to discovery of a fundamental mechanism by which the cellular Src protein is converted to a transforming protein (by dephosphorylation at Tyr-527) and defined the requirement of Src for polyoma transformation (2-7). Thus, characterization of a single Src-binding protein contributed substantially to our understanding of both RNA and DNA tumor biology.

Recently, using the unique domain/SH2/SH3 domain of Src as bait, and a human lung fibroblast cDNA library as prey, we identified RACK1, a known intracellular receptor for activated C kinase (RACK),1 as a Src-binding protein (8). We found that overexpression of RACK1 inhibited the specific activity of Src tyrosine kinases (as measured in vitro) and the growth of NIH 3T3 cells. RACK1 exerted its effect on growth, in part, by prolonging the G0/G1 phase of the cell cycle.

RACK1 was the first of a group of proteins (collectively called RACKs) to be identified and characterized by Mochly-Rosen and co-workers (reviewed in Refs. 9-11). RACK1 has sequence homology with the beta  subunit of heterotrimeric G proteins. RACK1 and Gbeta are both members of an ancient family of regulatory proteins made up of highly conserved repeating units usually ending with Trp-Asp (WD) (reviewed in Refs. 12 and 13). WD repeat proteins are functionally diverse, although all seem to be regulatory and few are enzymes. The WD repeats in RACK1 are conserved from Chlamydomonas to human (reviewed in Ref. 13). Thus, the function of RACK1 was probably fixed before the evolutionary divergence of plants and animals.

Protein kinase C (PKC) is a family of serine/threonine kinases whose activity depends upon phospholipid, diacylglycerol, and in some case on calcium (reviewed in Refs. 9-11 and 14). Upon stimulation with tumor promoter phorbol esters or hormones that increase intracellular concentrations of diacylglycerol, PKCs become activated and translocate to new subcellular sites where they phosphorylate isozyme-specific substrates. Individual, activated, PKC isozymes are translocated to distinct compartments, suggesting that they mediate distinct cellular functions (9-11, 15).

RACKs interact only with activated forms of PKCs, suggesting that PKC binding to RACK occurs after cell stimulation, to localize the active enzyme to the RACK site (reviewed in Refs. 9-11). Moreover, there are isozyme-specific RACKs, which presumably anchor each PKC isozyme close to its physiologic substrate. For example, in cardiac myocytes RACK1 is specific for beta IIPKC, whereas RACK2 is specific for epsilon PKC (15-17). Thus, it appears that the specificity of PKC function may be determined, in part, by the different locations of isozyme-specific RACKs.

The observation that RACK1 interacts with two, distinct, cytoplasmic protein kinases raises interesting questions about the role of RACK1 in orchestrating the intersection of tyrosine and serine/threonine kinase signaling pathways. The purpose of this study was to further characterize the Src-RACK1 interaction and to begin to analyze the mechanism by which cross-talk occurs between two RACK1-linked signaling protein kinases. We found that the interaction of Src and RACK1 is mediated by the SH2 domain of Src and phosphotyrosines in the sixth WD repeat of RACK1, and is enhanced by serum, PDGF stimulation, PKC activation, and tyrosine phosphorylation of RACK1.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- NIH 3T3 cells overexpressing the beta -platelet-derived growth factor (PDGF) receptor (a gift from Sara Courtneidge, Sugen, San Francisco, CA; Ref. 18) or wild-type or Y527F chicken c-Src (6) were cultured in Dulbecco's modified Eagle's medium (DMEM) (Mediatech, Herndon, VA) supplemented with 10% calf serum (Sigma), and maintained in G418 (200 µg/ml) (Life Technologies, Inc.). CHO cells (American Type Culture Collection (ATCC), Rockville, MD) were cultured in Ham's F-12 medium (Mediatech) supplemented with 10% fetal bovine serum (FBS) (Sigma). HeLa cells (ATCC) were cultured in DMEM supplemented with 10% FBS.

Plasmids-- pGEX-3X plasmids containing the SH2 domain(s) of phospholipase Cgamma 1 (PLCgamma ), Shp-2, Shp-1, p85, Abl, Grb2, rasGAP, Csk, or Shc were gifts from Lewis Cantley (Harvard University, Boston, MA) (19). pGEXsrc-SH2 and pGEX-RACK1 were constructed as described (8). pGEX plasmids were used to generate GST-fusion proteins. Plasmids encoding wild-type (pM5H) or mutant dl155-157 (pM155) chicken c-src were gifts from Sarah Parsons (University of Virginia, Charlottesville, VA; Ref. 20). Src inserts from the plasmids were subcloned into pcDNA3 (Invitrogen, La Jolla, CA) to create pcDNA3 wild-type or dl155 c-src. pcDNA3-HA-RACK1 was generated as described (8). pcDNA3 plasmids were used for transient protein expression assays. pGEMsrc, a gift from Tony Hunter (Salk Institute, La Jolla, CA), was used to generate in vitro translated Src (8).

Antibodies-- For Src antibodies, 1) monoclonal antibody (mAb) 327 (21) was used (unless otherwise stated) for immunoprecipitation and immunoblot analyses; 2) anti-peptide antibody N16, which recognizes the unique domain of Src (Santa Cruz Laboratories, Santa Cruz, CA), was used for immunoprecipitation; and 3) anti-peptide antibody R7, which recognizes the C terminus of Src (8) was used for immunoprecipitation. RACK1 mAb (Transduction Laboratories, Lexington, KY; Ref. 7) was used for immunoblot analyses. Anti-phosphotyrosine mAb PY20 (Transduction Laboratories; Ref. 22) were used for immunoprecipitation and immunoblot analyses. Polyclonal anti-GST was a gift from Anson Lowe (Stanford University, Stanford, CA).

GST Fusion Protein Binding Assays-- Cultures of Escherichia coli DH5alpha containing various pGEX-SH2 or pGEX RACK1 plasmids were induced with 0.1 mM isopropyl-beta -D-thiogalactopyranoside (United States Biochemical Corp., Cleveland, OH) for 3 h at 30 °C as described (8). Bacteria were harvested, resuspended in Tris-buffered saline (TBS) containing 1% Triton X-100 and 100 mM EDTA and sonicated. After centrifugation at 12,000 × g for 10 min to remove debris, the supernatant was incubated with glutathione-agarose beads (Sigma) for 2 h at 4 °C with agitation. Beads were washed three times with TBS. GST fusion proteins were eluted by the addition of 100 mM Tris, pH 8.0, 120 mM NaCl, and 20 mM glutathione and dialyzed four times against TBS.

Purified GST fusion proteins (1-5 µg) were incubated with cell lysates or radiolabeled, in vitro translated Src for 3 h at 4 °C as described (8). Protein complexes were collected with the addition of 30 µl of glutathione beads, washed four times in buffer containing 0.5% Nonidet P-40, 20 mM Tris, pH 8.0, 100 mM sodium chloride (NaCl), and 1 mM EDTA, and boiled in sodium dodecyl sulfate (SDS) sample buffer. Proteins were resolved by SDS-PAGE and detected by fluorography (see below) or subjected to immunoblot analysis and detected by enhanced chemiluminescence (ECL) (Amersham Pharmacia Biotech), according to the manufacturer's protocol.

Transfection Assays-- CHO cells were transfected with pcDNA3, pcDNA3-HA-RACK1, or pcDNA3-HA-RACK1 together with pcDNA3c-src, using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's protocol and as described (8). Briefly, 2 × 105 cells were seeded in six-well plates in Ham's F-12 medium containing 10% FBS. 24 h later, transfections were performed using 0.5-1 µg of plasmid DNA and 10 µl of LipofectAMINE in serum-free media. 5 h later, cells were placed in fresh media containing 10% FBS. Cells were lysed 48 h after transfection.

Protein Extractions, Immunoprecipitations, and in Vitro Protein Kinase Assays-- Cells were washed three times with ice-cold TBS and lysed in modified RIPA buffer (0.1% SDS, 1% Nonidet P-40, 1% sodium deoxycholate, 150 mM NaCl, 10 mM sodium phosphate, pH 7.0, 100 µM sodium vanadate, 50 mM sodium fluoride, 50 µM leupeptin, 1% aprotinin, 2 mM EDTA, and 1 mM dithiothreitol) (6, 8, 23-27). Lysates were centrifuged at 14,000 × g for 1 h at 4 °C. Protein concentrations were measured by the BCA protein assay (Pierce), and samples were standardized to equal amounts of total cellular protein (6, 8, 23-27). Lysates were incubated for 3 h at 4 °C with excess antibody (1 µg of mAb 327 or PY20, or anti-peptide N16 or R7) and protein complexes were collected with the addition of 30 µl of protein A/G-Sepharose beads (Amersham Pharmacia Biotech). Protein kinase assays were performed by incubating mAb 327 immunoprecipitates (of Y527F Src-overexpressing NIH 3T3 cell lysates) for 10 min at 30 °C in 30 µl of kinase buffer containing 50 mM piperazine-N,N'-bis (2-ethanesulfonic acid), pH 7.0, 10 mM manganese chloride, 10 mM dithiothreitol, 1 µg of GST-RACK1 or GST, and, in some cases, 1 mM ATP (6, 8, 23-27). Phosphorylated proteins were detected by immunoblot analysis with anti-phosphotyrosine PY20 or by binding to radiolabeled, in vitro translated Src (see below).

Immunoblot Analysis-- Src or PY20 immunoprecipitates were resolved on 10% SDS-polyacrylamide gels (acrylamide-bisacrylamide, 29:0.8). Proteins were transferred to polyvinylidene difluoride membranes (Immobilon-PTM; Millipore, Bedford, MA) in transfer buffer (25 mM Tris-HCl, pH 7.4, 192 mM glycine, and 15% methanol) using a Trans-Blot apparatus (Bio-Rad) for 2 h at 60 V (6, 8, 23-27). Protein binding sites on the membranes were blocked by incubating membranes overnight in TNT buffer (10 mM Tris-HCl, pH 7.5, 100 mM sodium chloride, 0.1% (v/v) Tween 20 (Sigma)) containing 3% nonfat, powdered milk (blocking buffer). Membranes were incubated with mAb RACK1 (0.08 mg/ml), affinity-purified mAb 327 ascites (2 µg/ml), mAb PY20 (0.08 mg/ml), or polyclonal anti-GST (2 mg/ml) for 1 h, washed in TNT buffer with changes every 5 min for 30 min, and incubated with horseradish peroxidase-conjugated donkey anti-mouse IgM (Zymed Laboratories Inc., San Francisco, CA) for RACK1 blots, goat anti-mouse IgG (Bio-Rad) for mAb 327 or PY20 blots, or goat anti-rabbit IgG (Bio-Rad) for anti-GST blots (6, 8, 23-27). Proteins were detected by ECL (see above).

In Vitro Translation of Proteins-- pGEMsrc (2 µg) was transcribed and translated in vitro using a TnT coupled rabbit reticulocyte lysate system (Promega, Madison, WI), as instructed by the manufacturer and as described (8). In vitro translated products labeled with Pro-Mix[35S] (70% L-[35S]methionine and 30% L-[35S]cysteine; >1,000 Ci/mmol; Amersham Pharmacia Biotech) were diluted (1:100) in buffer (50 mM Tris, pH 7.5, 150 mM NaCl, and 0.2% Nonidet P-40) and incubated with 1 µg of purified GST or GST-RACK1 for 3 h at 4 °C as described above. 1/20 of the unbound translation reaction product was loaded directly on the gel as a marker for in vitro translated Src. Gels were treated with Fluoro-Hance (Research Products International Corp., Mount Prospect, IL), and radiolabeled proteins were detected by fluorography.

Protein Phosphatase Assays-- Cell lysates, GST fusion proteins, or immunoprecipitates were incubated in phosphatase buffer (50 mM Tris-HCl, pH 8.5, 0.1 mM EDTA) with or without the addition of purified calf intestinal alkaline phosphatase (50 units) (Promega) for 30 min at room temperature. The reaction was stopped by heating the mixture to 75 °C for 15 min (27-30).

Synthesis and Purification of RACK1 Peptides-- Tyrosine-phosphorylated (or identical unphosphorylated) peptides corresponding to the sequence surrounding each of the 6 tyrosines of RACK1 were synthesized by the Protein Structure Core Facility of the Digestive Disease Center, Stanford University (Director, Gary Schoolnik), on an automated Milligen Peptide Synthesizer using FMOC-Novasyn KA resin (NovaBioChem, San Diego, CA) (31-33). Phosphotyrosine was incorporated as Fmoc (N-(9-fluorenyl)methoxycarbonyl)-Tyr(PO3H2)-OH. The crude peptides were purified using reverse phase high performance liquid chromatography (HPLC) (3.9 × 300-mm C18 column) and a linear gradient containing 0.05% trifluoroacetic acid in 15-65% acetonitrile. The purity of the HPLC-purified products was confirmed using mass spectrometry. The purified phosphopeptides (Tyr-52, TRDETNY(PO4)GIPQ; Tyr-140, TLGVCKY(PO4)TVQD; Tyr-195, HIGHTGY(PO4)LNTV; Tyr-228, NEGKHLY(PO4)TLD; Tyr-246, CFSPNRY(PO4)WLCA; Tyr-302, QTLFAGY(PO4)TDNL), or the identical unphosphorylated peptides, were used for peptide competition assays.

Phosphopeptide Competition Assays-- CHO cells were treated with phorbol-12-myristate-13-acetate (PMA) (Life Technologies, Inc.) (10 ng/ml) at 37 °C for 10 min prior to lysis in RIPA buffer. Lysate containing 200 µg of total cellular protein was incubated with peptide (100 µM) and GST-Src-SH2 (500 nM) or GST for 1 h at 4 °C (8, 34). Glutathione-agarose beads (30 µl) were added, and the mixture was incubated with gentle rocking for 2 h at at 4 °C. Proteins were eluted from the beads, resolved by SDS-PAGE, and subjected to immunoblot analysis with anti-RACK1, as described above.

Site-directed Mutagenesis of Tyrosines in RACK1-- Oligonucleotide-directed mutagenesis was used to substitute phenylalanine for tyrosine at residues 52, 140, 194, 228, 246, or 302 of RACK1, utilizing the Transformer site-directed mutagenesis kit according to the manufacturer's protocol (CLONTECH, Palo Alto, CA) and the following oligonucleotides: Y52F oligo, GATGAGACCAACTTTGGAATTCCA; Y140F oligo, GGTGTGTGCAAATTCACTGTCCAG; Y195F oligo, CACACAGGCTTTCTGAACACGGTG; Y228F oligo, GGCAAACACCTTTTCACGCTAGAT; Y246F oligo, CCTAACCGCTTCTGGCTGTGTGCT; Y302F oligo, CTGTTTGCTGGCTTCACGGACAAC.

The sequence of each RACK1 mutant was confirmed by automated DNA sequencing (Protein and Nucleic Acid Facility, Stanford University, Stanford, CA). Mutant RACK1 genes were inserted into pcDNA3 to create pcDNA3-HA-RACK1(Y52F, Y140F, Y195F, Y228F, Y246F, or Y302F) as described (8).

Treatment of Cells-- CHO cells were transfected with pcDNA3 plasmids as described above. 18 h later after transfection, cells were placed in fresh media containing 0.5% FBS. 24 h later, cells were treated for various time periods with PMA, which was dissolved in dimethyl sulfoxide (Me2SO) and used at a concentration of 10 ng/ml (35, 36). In some cases, cells were pre-treated with a PKC inhibitor: GF109203X, chelerythrine, or calphostin C (each was dissolved in Me2SO and used at a concentration of 0.1 µM) (Calbiochem, La Jolla, CA) for 30 min prior to PMA stimulation. Control cells were treated with Me2SO alone. NIH 3T3 cells that were stably overexpressing the PDGFR were maintained in 0.5% serum for 48 h before treatment with PDGF-BB (Sigma) (10 ng/ml) for various time periods. For immunoblot analysis with anti-phosphotyrosine PY20, cells were treated with 100 µM sodium vanadate (Sigma) for 30 min prior to harvesting (8). Cells were harvested by trypsinization, collected by centrifugation, and lysed in SDS sample buffer.

Immunofluorescence-- NIH 3T3 cells stably overexpressing c-Src were grown subconfluently on coverslips in DMEM supplemented with 10% FBS for 24 - 48 h and then in fresh media containing 0.5% FBS for 72 h. Cells were treated with PMA (10 ng/ml) or Me2SO for various time periods prior to fixation in 3.7% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature and permeabilization in 0.4% Triton X-100/PBS for 20 min at room temperature (37). Nonspecific sites were blocked with 10% goat serum and 1% bovine serum albumin (BSA) in PBS containing 50 mM NH4Cl, for 1 h. Cells were incubated with primary antibodies, anti-RACK1 (1:500) and anti-Src (mAb 327) (1:100) in PBS containing 5% goat serum and 0.2% BSA for 1 h. After washing three times in PBS containing 0.2% BSA, cells were incubated with secondary antibodies, FITC-conjugated goat anti-mouse IgG (Jackson Immunoresearch Laboratories, West Grove, PA) and lissamine-rhodamine conjugated goat anti-mouse IgM (Jackson Immunoresearch), which were diluted 1:100 in PBS containing 5% goat serum and 0.2% BSA, for 40 min in the dark. Coverslips were washed three times in PBS containing 0.2% BSA and a fourth time in PBS containing bisbenzamidine. Src and RACK1 immunostaining were visualized with FITC and Texas Red filters, respectively. Control experiments demonstrated that cross-reactivity did not occur between the two secondary antibodies. Cells were photographed using Nikon TE 300 eclipse lenses on a Bio-Rad MRC 1024 confocal microscope. Confocal image analysis was performed using a Bio-Rad MRC600 laser confocal scanner, and final digital images were processed using Adobe Photoshop 5.1 (Adobe System, San Jose, CA). Layers comprised a thickness of 0.2 µm.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RACK1 Associates, in Vitro, with the SH2 Domains of Src, PLCgamma , and rasGAP-- Previously, we showed that RACK1 binds to the SH2 domain of Src in vitro (8). To determine whether RACK1 binds to the SH2 domain of other signaling proteins, we incubated GST fusion proteins containing the SH2 domain of Src, PLCgamma , Shp-2, Shp-1, p85, Abl, Grb2, rasGAP, Csk, or Shc together with HeLa cell lysates; collected protein complexes on glutathione-agarose beads; and assayed for RACK1 binding by immunoblot analysis with anti-RACK1 (Fig. 1, upper panel). We observed that RACK1 bound to the SH2 domain of Src (lane 1), to the N-terminal SH2 domain of PLCgamma (lane 3) and of rasGAP (lane 10), and not to the SH2 domains of the other proteins tested. When the membrane was stripped of antibody and re-probed with GST antibody (lower panel), a similar amount of GST-SH2 fusion protein was present in each lane, except for the one containing the C-terminal SH2 domain of p85, where less protein was present (lane 6). Thus, RACK1 interacted specifically with the SH2 domain of Src and the N-terminal SH2 domain of PLCgamma and rasGAP, and not with the SH2 domains of Shp-1, Shp-2, p85, Abl, Grb2, Csk, or Shc.


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1.   Binding of RACK1 to GST-SH2 fusion proteins. RIPA lysates of HeLa cells (containing 300 µg of total cellular protein) were incubated with 2 µg of purified GST fusion protein containing an SH2 domain of Src (lane 1), PLCgamma (lanes 2 and 3), Shp-2 (lane 4), Shp-1 (lane 5), p85 (lanes 6 and 7), Abl (lane 8), Grb2 (lane 9), rasGAP (lane 10), Csk (lane 11), or Shc (lane 12). Protein complexes were collected on glutathione-agarose beads. Proteins bound to GST-SH2 fusions were recovered, resolved by SDS-PAGE, transferred to polyvinylidene difluoride membranes, and subjected to immunoblot analysis with a monoclonal antibody specific for RACK1 (top panel). The membrane was stripped of antibody and re-blotted with anti-GST (bottom panel). For proteins containing two SH2 domains, C represents the C-terminal and N the N-terminal SH2 domain. Data are representative of three independent experiments.

RACK1 Associates, in Vivo, with the SH2 Domain of Src-- To determine whether the SH2 domain of Src mediates binding of Src and RACK1 in vivo, we utilized a Src mutant that contains a 3-amino acid deletion (Arg-155, Arg-156, and Gly-157) in the phosphotyrosine-binding pocket of the SH2 domain (dl155) (20). CHO cells were transfected with vector alone, HA-RACK1, or HA-RACK1 together with wild-type or dl155 Src. Lysate proteins, or proteins immunoprecipitated with a mAb specific for Src or with mouse IgG were resolved by SDS-PAGE, transferred to polyvinylidene difluoride membranes, and immunoblotted with a mAb specific for RACK1 (Fig. 2A). We observed that HA-RACK1 protein was expressed at equivalent levels in cells transfected with wild-type or dl155 Src (compare lanes 1 and 2). However, there was less binding of HA-RACK1 to dl155 (lane 5) than to wild-type (lane 6) Src. Moreover, the amount of RACK1 bound to dl155 Src (lane 5) was only slightly more than could be accounted for by endogenous Src (lane 4). When the membrane was stripped of RACK1 antibody and re-blotted with Src antibody (Fig. 2B), we observed equivalent amounts of wild-type and dl155 Src protein in cell lysates (compare lanes 1 and 2) and in Src immunoprecipitates (compare lanes 5 and 6). Neither RACK1 nor Src proteins were detected in control IgG immunoprecipitates (lanes 7-10). These findings indicate that the SH2 domain of Src mediates the interaction of Src and RACK1 in vivo. Additional experiments showed that GST-RACK1 binds to a Src mutant that contains an intact SH2 domain and that lacks 80 amino acids in the SH3 domain (Delta SH3; Ref. 38), but GST-RACK1 does not bind to the dl155 Src mutant (data not shown). These results suggest that it is specifically the SH2 and not the SH3 domain of Src that mediates the interaction of Src and RACK1.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   In vivo binding of RACK1 to wild-type Src and not to mutant Src that contains a deletion in the SH2 domain. CHO cells were transiently transfected with vector alone (lanes 3 and 7), HA-RACK1 (lanes 4 and 8), or HA-RACK1 together with wild-type Src (lanes 2, 6, and 10) or a Src mutant containing a deletion in the SH2 domain (dl155 Src; lanes 1, 5, and 9). A, proteins were immunoprecipitated with anti-Src (lanes 3-6) or mouse IgG (lanes 7-10) from RIPA lysates containing 100 µg of total cellular protein, resolved by SDS-PAGE, and subjected to immunoblot analysis with anti-RACK1. Lanes 1 and 2, lysate containing 5 µg of total cellular protein was loaded directly on the gel prior to transfer and immunoblot analysis with anti-RACK1. B, the membrane shown in A was stripped of antibody and re-blotted with anti-Src. Data are representative of four independent experiments.

Phosphorylation of RACK1 on Tyrosine Enhances Binding of RACK1 and Src-- SH2 domains are known to interact with phosphotyrosines on cellular proteins. To determine whether tyrosine phosphorylation of RACK1 regulates the interaction of RACK1 and Src in vitro, we first pre-treated HeLa cell lysates with alkaline phosphatase or phosphatase buffer, incubated lysates with GST-Src-SH2 or GST alone, collected protein complexes on glutathione-agarose beads, and performed immunoblot analysis with anti-RACK1 (Fig. 3A). We observed less binding of lysate RACK1 to GST-Src-SH2 when the lysate was pre-treated with alkaline phosphatase (lane 3) than when it was pre-treated with buffer lacking alkaline phosphatase (lane 2). Lysate RACK1 did not bind to GST alone (lanes 4 and 5). This result suggested that phosphorylation of RACK1 enhances the binding of RACK1 to Src.


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 3.   Phosphorylation of RACK1 on tyrosine increases binding of RACK1 to Src. A, dephosphorylation of RACK1 decreases binding of RACK1 to a GST fusion protein containing the SH2 domain of Src. RIPA lysates of HeLa cells (containing 200 µg of total cellular protein) were treated for 30 min at room temperature with purified alkaline phosphatase (50 units) (+, lanes 3 and 5) or with phosphatase buffer alone (-, lanes 2 and 4) and incubated with GST-Src-SH2 (lanes 2 and 3) or GST alone (lanes 4 and 5). Protein complexes were collected on glutathione beads. Proteins bound to GST-Src-SH2 or GST alone were subjected to immunoblot analysis with anti-RACK1. Lane 1, lysate containing 5 µg of total cellular protein was loaded directly on the gel prior to transfer and immunoblot analysis with anti-RACK1. B, tyrosine phosphorylation of RACK1 by Src increases binding of RACK1 to in vitro translated Src, and dephosphorylation of the tyrosine-phosphorylated RACK1 decreases binding. Y527F Src immunoprecipitates were incubated with 1 µg of GST-RACK1 (lanes 1, 2, and 4-6) or GST alone (lane 7) in the presence (+) or absence (-) of cold ATP (1 mM) and in vitro protein kinase reactions were performed. Aliquots from the reaction mixture containing both GST-RACK1 and ATP (lane 2) or GST-RACK1 without the addition of ATP (lane 1) were subjected to immunoblot analysis with anti-phosphotyrosine. The unphosphorylated GST-RACK1 (lane 4), the tyrosine-phosphorylated GST-RACK1 (lanes 5 and 6) or GST alone (lane 7) were then incubated with purified alkaline phosphatase (lane 6) or with phosphatase buffer alone (lanes 4, 5, and 7) as described in A, and assayed for binding to [35S]methionine/cysteine-labeled in vitro translated Src. Lane 3, 1/20 of the unbound translation reaction product (FT for flow-through) was loaded directly on the gel as a marker for in vitro translated Src. 35S-Labeled proteins were visualized by autoradiography. C, dephosphorylation of RACK1 on tyrosine decreases binding of RACK1 to Src. CHO cells were transiently transfected with vector alone (V; lanes 1 and 3-6) or with HA-RACK1 and wild-type Src (lanes 2 and 7-12). Proteins were immunoprecipitated from RIPA lysates (containing 100 µg of total cellular protein) with anti-Src N16 (lanes 3, 4, 7, and 8), anti-Src R7 (lanes 9 and 10), or anti-phosphotyrosine (lane 5, 6, 11, and 12). Immunoprecipitates were treated with purified alkaline phosphatase (+, even lanes 4-12) or phosphatase buffer (-, odd lanes 3-11) and subjected to immunoblot analysis with anti-RACK1. Lanes 1 and 2, lysate containing 5 µg of total cell protein was loaded directly on the gel prior to transfer and immunoblot analysis with anti-RACK1. Data are representative of at least three independent experiments.

To determine whether it is specifically tyrosine phosphorylation of RACK1 that enhances binding, we incubated GST-RACK1 with constitutively active Y527F Src (4-7) in the presence or absence of cold ATP, performed an in vitro kinase reaction, and subjected aliquots to immunoblot analysis with anti-phosphotyrosine (Fig. 3B, lanes 1 and 2). We observed increased tyrosine phosphorylation of GST-RACK1 by Src when ATP was added to the reaction mixture. We treated the tyrosine-phosphorylated or unphosphorylated GST-RACK1 with alkaline phosphatase or phosphatase buffer and assayed for binding to [35S]methionine/cysteine-labeled, in vitro translated Src (lanes 3-7). We observed more binding of Src to tyrosine-phosphorylated GST-RACK1 (lane 5) than to dephosphorylated GST-RACK1 (lane 6) or to unphosphorylated GST-RACK1 (lane 4). When we repeated the experiment using potato acid phosphatase instead of alkaline phosphatase, we observed similar results (data not shown).

To further analyze the effect of tyrosine phosphorylation of RACK1 on the interaction of RACK1 and Src, we transiently expressed HA-RACK1 and Src in CHO cells, treated Src immunoprecipitates with alkaline phosphatase or phosphatase buffer and tested for binding of RACK1 to Src (Fig. 3C). We used two Src antibodies for immunoprecipitation: one that recognizes the unique domain of Src (N16) and another that recognizes the C terminus of Src (R7). When we immunoprecipitated Src with either antibody and tested for RACK1 binding by immunoblot analysis with anti-RACK1, we observed decreased binding of RACK1 and Src when alkaline phosphatase was added to the immunoprecipitate (Fig. 3C, compare lanes 7 and 8 or lanes 9 and 10). Immunoprecipitation with anti-phosphotyrosine followed by immunoblot analysis with anti-RACK1 demonstrated that lysate RACK1 was tyrosine-phosphorylated (lane 11) and that tyrosine phosphorylation on RACK1 decreased with the addition of alkaline phosphatase to the immunoprecipitate (compare lanes 11 and 12). Immunoblot analysis with anti-Src revealed an equivalent amount of immunoprecipitated Src in each lane (data not shown). Additional studies showed that RACK1 is phosphorylated on more than one tyrosine, and that the RACK1 antibody recognizes both phosphorylated and unphosphorylated forms of RACK1 equally well (data not shown). Together, these results suggested that phosphorylation of RACK1 on tyrosine enhances binding of RACK1 to Src.

Phosphotyrosines in the Sixth WD Repeat of RACK1 Mediate the Interaction of RACK1 with Src's SH2 Domain-- Together, the results of the binding assays shown in Figs. 2 and 3 suggested that a phosphorylated tyrosine(s) on RACK1 might mediate the interaction of RACK1 with Src's SH2 domain of Src. Thus, we searched for tyrosines in the RACK1 sequence that, when phosphorylated, could potentially interact with the SH2 domain of Src. Analysis of the amino acid sequence of RACK1 revealed six tyrosines (Fig. 4A): Tyr-52 (located at the boundary of WD40 repeats 1 and 2), Tyr-140 (in repeat 4), Tyr-194 (in repeat 5), Tyr-228 and Tyr-246 (in repeat 6), and Tyr-302 (in repeat 7).


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4.   A, structure of RACK1: location of tyrosines within WD repeat domains. B, tyrosine-phosphorylated peptides of RACK1 compete with lysate RACK1 for binding to a GST-fusion containing the SH2 domain of Src. CHO cell lysates (containing 200 µg of total cellular protein) were incubated with 5 µg of GST (lane 3), GST-Src-SH2 (lane 2), or GST-Src-SH2 together with 100 µM unphosphorylated RACK1 peptide (even lanes 4-14) or the corresponding tyrosine-phosphorylated RACK1 peptide (odd lanes 5-15). Protein complexes were collected on glutathione-agarose beads. Proteins bound to GST-Src-SH2 or GST were subjected to immunoblot analysis with anti-RACK1 (upper panel). Lane 1, lysate containing 5 µg of total cellular protein was loaded directly on the gel prior to transfer and immunoblot analysis with anti-RACK1. Peptides correspond to the sequence surrounding each tyrosine of RACK1. Lower panel, the membrane shown in the upper panel was stripped of antibody and re-blotted with anti-Src. Data are representative of three independent experiments.

To determine which phosphotyrosine(s) on RACK1 might interact with Src's SH2 domain, we first performed phosphopeptide competition assays. To do so, we synthesized tyrosine-phosphorylated or unphosphorylated peptides corresponding to the sequence surrounding each tyrosine of RACK1 and tested the peptides for their ability to compete with RACK1 from HeLa cell lysate for binding to a GST fusion protein containing Src's SH2 domain (GST-SH2). We incubated lysates with GST, GST-SH2, or GST-SH2 together with the tyrosine-phosphorylated RACK1 peptide or the corresponding unphosphorylated peptide, collected protein complexes on glutathione-agarose beads, and performed immunoblot analysis with anti-RACK1 (Fig. 4B, upper panel). We observed that lysate RACK1 (lane 1) bound GST-SH2 (lane 2) but not GST alone (lane 3). We observed less binding of lysate RACK1 to GST-SH2 when the Y228 phosphopeptide was present in the incubation mixture (lane 11) than when the corresponding unphosphorylated peptide was present (lane 10). Similarly, we observed less binding of lysate RACK1 to GST-SH2 when the Tyr-246 phosphopeptide was present in the mixture (lane 13) than when the unphosphorylated Tyr-246 peptide was present (lane 12). Interestingly, we observed more binding of lysate RACK1 to GST-SH2 in the presence of the unphosphorylated Tyr-246 peptide (lane 12) than in the absence of peptide (lane 2). In all other cases, the binding of RACK1 to GST-SH2 was similar in the presence of either the phosphorylated or the unphosphorylated peptide and not different than in the absence of peptide. When the blot was stripped of anti-RACK1, re-probed with anti-Src, and exposed for a longer time period, similar amounts of GST-SH2 fusion protein were present in each lane (lower panel). Thus, a RACK1 phosphopeptide corresponding to the sequence surrounding Tyr-246 or Tyr-228 can competed with lysate RACK1 for binding to Src's SH2 domain in vitro. These results suggested that phosphorylated Tyr-228 and/or Tyr-246 on RACK1 (both located in WD repeat 6) might mediate, at least in part, the interaction of RACK1 with Src's SH2 domain in vivo.

To further analyze the site on RACK1 that mediates the interaction with Src's SH2 domain, we introduced mutations into RACK1, substituting phenylalanine for tyrosine at residue 52, 140, 194, 228, 246, or 302, and tested the RACK1 mutants for binding to Src. To do so, we transiently expressed wild-type or mutant (Y52F, Y140F, Y194F, Y228F, Y246F, or Y302F) HA-tagged RACK1 together with Src in CHO cells, immunoprecipitated proteins with anti-Src, and performed immunoblot analysis with anti-RACK1 (Fig. 5A). We observed that RACK1 mutant Y246F did not bind to Src (lane 6), whereas all other RACK1 mutants did bind to Src (lanes 2-5 and 7) and the amount bound was similar to that of wild-type RACK1 (lane 1). When the blot was stripped of RACK1 antibody and re-probed with Src antibody, similar amounts of immunoprecipitated Src were present in each lane (Fig. 5B). RACK1 immunoblot analysis of cell lysates revealed that HA-RACK1 protein was expressed at equivalent levels in all transfected cells and the levels were ~10 fold higher than those of endogenous RACK1 (Fig. 5C). These results suggested that phosphotyrosine 246 of RACK1 mediates the interaction of RACK1 with Src's SH2 domain. Together, the results from the peptide competition assays and the mutational analyses indicate that phosphotyrosines in the sixth WD repeat of RACK1 mediate the interaction of RACK1 with Src's SH2 domain.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 5.   Src does not bind to a RACK1 mutant that contains a phenylalanine substitution for tyrosine at residue 246. CHO cells were transiently transfected with wild-type HA-RACK1 (wt-RK; lane 1) or with mutant HA-RACK1 Y52F (lane 2), Y140F (lane 3), Y194F (lane 4), Y228F (lane 5), Y246F (lane 6), or Y302F (lane 7). A, proteins were immunoprecipitated with anti-Src from RIPA lysates (containing 100 µg of total cellular protein) and subjected to immunoblot analysis with anti-RACK1. B, the membrane shown in A was stripped of antibody and re-blotted with anti-Src. C, proteins from lysate containing 5 µg of total cellular protein were subjected to immunoblot analysis with anti-RACK1. Data are representative of three independent experiments.

Serum, PDGF, and Activation of PKC Enhance the Tyrosine Phosphorylation of RACK1 and the Interaction of RACK1 and Src-- RACK1 is known to be an intracellular receptor for activated PKC (reviewed in Refs. 9-11). To determine whether PKC activation influences the interaction of RACK1 and Src and the tyrosine phosphorylation of RACK1, we treated cells with mitogens that activate PKC (the tumor promoter PMA or serum) and analyzed their effect. To do so, we expressed vector alone or HA-RACK1 together with Src in CHO cells, treated serum-starved quiescent cells with PMA (10 ng/ml) or 10% serum, immunoprecipitated proteins with anti-Src or anti-phosphotyrosine, and performed immunoblot analysis with anti-RACK1 (Fig. 6A). We and others have been unsuccessful in attempts to generate antibodies that immunoprecipitate RACK1 efficiently from cell lysates. Thus, to study tyrosine-phosphorylated RACK1, we immunoprecipitated proteins with anti-phosphotyrosine and performed immunoblot analysis with anti-RACK1. After treating cells for 15 min with either PMA or serum, we observed a striking increase in the amount of RACK1 bound to Src (compare lanes 4 and 5 or lanes 4 and 7, respectively) and a striking increase in tyrosine phosphorylation of RACK1 (compare lanes 10 and 11 or lanes 10 and 13, respectively). The effect of PMA was transient; after sustained treatment for 60 min, binding of RACK1 and Src and tyrosine phosphorylation of RACK1 had returned to base-line levels (compare lanes 5 and 6 or lanes 11 and 12, respectively). When the blot was stripped of antibody and re-probed with Src antibody (Fig. 6B), similar amounts of Src protein were present in all Src immunoprecipitates of Src-transfected cells (compare lanes 4-7) and similar amounts of tyrosine-phosphorylated Src were present in all anti-phosphotyrosine immunoprecipitates of Src-transfected cells (compare lanes 10-13). These results indicated that treatment of cells with serum or PMA increases the tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of PMA or serum treatment of cells on the tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src. CHO cells were transfected with vector alone (lanes 2, 3, 8, and 9) or HA-RACK1 and Src (lanes 1, 4-7, and 10-13). 24 h after transfection, cells were placed in fresh media containing 0.5% serum. 48 h after transfection, cells were treated with PMA (10 ng/ml) for 15 min (lanes 3, 5, 9, and 11) or 60 min (lanes 6 and 12), FBS for 15 min (lanes 7 and 13), or left untreated (lanes 2, 4, 8, and 10) before lysis in RIPA buffer. A, proteins were immunoprecipitated with anti-Src (lanes 2-7) or anti-phosphotyrosine (lanes 8-13) from lysate containing 100 µg of total cellular protein and subjected to immunoblot analysis with anti-RACK1. Lane 1, lysate of cells expressing both HA-RACK and Src (and containing 5 µg of total cellular protein) was loaded directly on the gel prior to transfer and immunoblotting with anti-RACK1. B, the membrane shown in A was stripped of antibody and re-blotted with anti-Src. The band running below Src in lanes 8-13 has a mobility consistent with that predicted for the tyrosine-phosphorylated heavy chain of the anti-phosphotyrosine antibody. Data are representative of three independent experiments.

To determine whether PDGF, a growth factor in serum that can indirectly activate PKC through PLCgamma (39), influences the association of RACK1 and Src, we treated serum-starved fibroblasts that overexpress the beta -PDGF receptor with purified PDGF-BB (10 ng/ml) for various time periods, immunoprecipitated proteins with anti-Src, and performed immunoblot analysis with anti-RACK1 (Fig. 7). We observed an increase in RACK1 bound to Src after 2 and 5 min of PDGF treatment (compare lanes 1-3 of Fig. 7A, and lanes 1 and 2 of Fig. 7B). The effect of PDGF was transient; after treatment for 10, 30, or 120 min, binding of RACK1 and Src had returned to near base-line levels (Fig. 7A, compare lanes 4-6 with lane 3). When the blot was stripped of anti-RACK1 and re-probed with anti-Src, similar amounts of Src protein were present in all Src immunoprecipitates (compare lanes 7-12). Immunoblot analysis of lysate proteins with anti-RACK1 revealed that equivalent amounts of RACK1 protein were present in all lanes (compare lanes 13-18). The effect of PDGF on the RACK1-Src interaction was concentration-dependent, with the maximal effect achieved with 10 ng/ml (data not shown; Ref. 18).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of PDGF treatment of cells on the tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src. NIH 3T3 cells that were stably overexpressing the PDGFR were maintained in 0.5% serum for 48 h before treatment with PDGF (10 ng/ml) for 2, 5, 10, 30, or 120 min and lysis in RIPA buffer. A, upper panel, proteins were immunoprecipitated with anti-Src from lysate containing 200 µg of total cellular protein and subjected to immunoblot analysis with anti-RACK1. Middle panel, the membrane shown in the upper panel was stripped of antibody and re-blotted with anti-Src. The band running below Src is mouse IgG heavy chain. Lower panel, proteins from lysate containing 2 µg of total cellular protein were subjected to immunoblot analysis with anti-RACK1. B, proteins were immunoprecipitated with anti-Src (lanes 1 and 2) or anti-phosphotyrosine (lanes 3 and 4) as described in A and subjected to immunoblot analysis with anti-RACK1. Data are representative of three independent experiments.

To determine whether PDGF enhances the tyrosine phosphorylation of RACK1, we treated serum-starved cells that overexpress the PDGF receptor with PDGF for 5 min, immunoprecipitated lysate proteins with anti-phosphotyrosine, and performed immunoblotting with anti-RACK1 (Fig. 7B). We observed increased tyrosine phosphorylation on RACK1 following PDGF treatment (compare lanes 3 and 4). Thus, PDGF stimulation enhances the tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src.

To determine the time course of PMA effect on RACK1-Src binding, we treated CHO cells that were transiently expressing HA-RACK1 and Src for varying time periods with PMA, immunoprecipitated proteins with anti-Src, and performed immunoblot analysis with anti-RACK1. We observed that the maximum binding of RACK1 and Src occurred after 15 min of PMA treatment (Fig. 8A, lanes 2-5 and 7). Again, immunoblot analysis with anti-Src revealed that similar amounts of Src protein were present in all Src immunoprecipitates (lanes 9-14). Likewise, immunoblot analysis of lysate proteins with anti-RACK1 revealed that similar amounts of RACK1 protein were expressed in all cells (lanes 15-20). RACK1 was not detected in IgG immunoprecipitates of PMA-treated cells (Fig. 8B, lane 9). Moreover, when we co-expressed Src and a RACK1 mutant (Y246F) that does not bind Src, we did not detect RACK1 in Src immunoprecipitates of PMA-treated cells (Fig. 8B, lane 8). The effect of PMA on the RACK1-Src interaction was concentration-dependent, with the maximal effect achieved with 10 ng/ml (data not shown; Refs. 35 and 36). Together, these results showed that the effect of PMA on the interaction of RACK1 and Src is both time- and dose-dependent.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 8.   Effect of PKC inhibitors on PMA-induced tyrosine phosphorylation of RACK1 and binding of RACK1 to Src. A, CHO cells were transiently transfected with HA-RACK1 and Src, and serum-starved as described in the legend to Fig. 6. Cells were left untreated (0), treated for varying time periods with PMA (10 ng/ml) or pre-treated with the PKC inhibitor GF109203X (0.1 µM; +) for 30 min prior to treatment with PMA for 15 min (lanes 6, 13, and 19). Proteins were immunoprecipitated with anti-Src (lanes 2-7 and 9-14) from RIPA lysate containing 100 µg of total cellular protein and subjected to immunoblot analysis with anti-RACK1 (top panel) or with anti-Src (middle panel). Lanes 1 and 8, cell lysate containing 5 µg of total cellular protein was loaded directly on the gel prior to transfer and immunoblot analysis. Bottom panel, proteins from lysate containing 5 µg of total cellular protein were subjected to immunoblot analysis with anti-RACK1. B, CHO cells were transiently transfected with Src and HA-tagged, wild-type RACK1 (lanes 1-7 and 9) or with Src and HA-tagged, mutant Y246F RACK1 (lane 8). Serum-starved cells were left untreated (lane 1), treated with PMA for 5 min (lane 2) or 15 min (lanes 3, 6, 8, and 9), or treated with the PKC inhibitor GF109203X (0.1 µM) (lanes 4 and 7) or chelerythrine (0.1 µM) (lane 5) for 30 min prior to treatment with PMA for 15 min. Proteins were immunoprecipitated with anti-Src (lanes 1-8) or mouse IgG (lane 9) from RIPA lysates containing 50 µg of total cellular protein and subjected to immunoblot analysis with anti-RACK1. C, CHO cells were transiently transfected with HA-RACK1 and Src, serum-starved and left untreated (lanes 1, 4, 7, and 10), treated for 15 min with PMA (lanes 2, 5, 8, and 11) or treated with GF109203X prior to PMA treatment (lanes 3, 6, 9, and 12). Proteins were immunoprecipitated with anti-phosphotyrosine (lanes 1-3) or anti-Src (lanes 4-6) from RIPA lysates containing 100 µg of total cellular protein and subjected to immunoblot analysis with anti-RACK1. Lanes 7-9, the membrane shown in lanes 4-6 was stripped of antibody and re-blotted with anti-Src. Lanes 10-12, proteins from lysate containing 5 µg of total cellular protein were subjected to immunoblot analysis with anti-RACK1. Data are representative of at least three independent experiments.

To confirm that activation of PKC is necessary for PMA-enhanced binding of RACK1 and Src, we pre-treated cells with inhibitors of PKC and analyzed the effect of PMA on the Src-RACK1 interaction (Fig. 8). When we pre-treated cells with GF109203X (a bisindoylmaleimide I derivative), at a concentration that inhibits PKC and not Src activity (0.1 µM; Refs. 40 and 41), we detected little increase in binding of RACK1 and Src after treating cells with PMA for 15 min (Fig. 8, A (lane 6) and B (lanes 4 and 7)). Similarly, when we pre-treated cells with another inhibitor of PKC activity, chelerythrine (0.1 µM) (10), we observed little enhancement of binding of RACK1 and Src after treating cells with PMA (Fig. 8B, lane 5). Treatment of cells with a third PKC inhibitor, calphostin C (0.1 µM) (10), also blocked the PMA-induced enhancement of RACK1-Src binding (data not shown). These results confirmed that PKC activation is required for PMA-enhanced binding of RACK1 and Src.

To confirm that activation of PKC is necessary for PMA-enhanced tyrosine phosphorylation of RACK1, we pre-treated cells with inhibitors of PKC activity prior to PMA treatment, immunoprecipitated proteins with anti-phosphotyrosine and performed immunoblot analysis with anti-RACK1 (Fig. 8C). As we observed previously, PMA treatment for 15 min resulted in a marked increase in tyrosine phosphorylation of RACK1 (compare lanes 1 and 2). When we pre-treated cells with the PKC inhibitor GF109203X (0.1 µM) prior to PMA treatment, we did not detect an increase in tyrosine phosphorylation of RACK1 (lane 3). Similar results were seen with other PKC inhibitors (data not shown). As we showed previously, PMA treatment increased binding of Src and RACK1 (compare lanes 4 and 5), whereas pretreatment with GF109203X did not (lane 6). When the blot shown in lanes 4-6 was stripped of antibody and re-probed with Src antibody, we observed that Src protein levels were equivalent in all Src immunoprecipitates (lanes 7-9). Immunoblot analyses of lysate proteins with anti-RACK1 showed that equivalent amounts of RACK1 protein were present in all lysates (lanes 10-12). These results confirmed that PKC activation is required for PMA-enhanced tyrosine phosphorylation of RACK1 and binding of RACK1 to Src.

In a complementary approach to analyze the effect of PMA on the interaction of RACK1 and Src, we treated serum-starved, NIH 3T3 cells that were stably overexpressing c-Src (6) with PMA (10 ng/ml) for varying time periods and localized Src and RACK1 using confocal immunofluorescence microscopy (Fig. 9). In quiescent cells (row 1), we observed both Src (column 1) and RACK1 (column 2) in the cytoplasm (particularly in the perinuclear region) but there was little colocalization of the two proteins: yellow regions in the double immunofluorescent-labeled cells (column 3), and white regions in the computer-generated images of the double immunofluorescent-labeled cells (column 4). After treatment of cells with PMA for 2 (row 2) or 5 (row 3) min, a subpopulation of Src molecules (column 1) translocated to the cell periphery (presumably to the plasma membrane), whereas most RACK1 molecules (column 2) remained more centrally located. After treatment of cells with PMA for 10 min (rows 4 and 5), a subpopulation of RACK1 molecules translocated to the cell periphery (column 2) and appeared to colocalize with Src: yellow regions in the double immunofluorescent-labeled cells (column 3), and white regions in the computer-generated images of the double immunofluorescent-labeled cells (column 4). These findings are internally consistent with those of our biochemical studies; both show that PMA stimulation enhances the association of RACK1 and Src. In addition, the immunofluorescence studies suggested that the association of the two proteins occurs at the cell periphery, presumably at the plasma membrane.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 9.   Localization of Src and RACK1 in cells following treatment with PMA. NIH 3T3 cells stably overexpressing Src were maintained in media containing 0.5% serum for 72 h and treated with PMA (10 ng/ml) for 2 (row 2), 5 (row 3), or 10 (rows 4-6) min, or left untreated (row 1). Cells were fixed in 3.7% paraformaldehyde, permeabilized in 0.4% Triton X-100, and incubated with primary antibodies (anti-Src and anti-RACK1) for 60 min before adding secondary antibodies (FITC-conjugated goat anti-mouse IgG and rhodamine-conjugated goat anti-mouse IgM) for 40 min. Stained proteins were visualized by confocal microscopy using 400× or 100× (low) magnification, and using the FITC (column 1), rhodamine (column 2), or both (column 3) filters. Composite (column 4), computer-generated images of the double immunofluorescent-labeled cells (anti-Src and anti-RACK1) shown in column 3. C, cells incubated with secondary antibodies alone. Data are representative of three independent experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study shows that RACK1 interacts with the SH2 domain of Src and several other intracellular signaling molecules. The Src-RACK1 interaction is mediated, at least in part, by the SH2 domain of Src and by phosphotyrosines in the sixth WD repeat of RACK1, and is enhanced by PKC activation and tyrosine phosphorylation of RACK1.

Evidence that RACK1 interacts with the SH2 domains of multiple signaling molecules in vitro is that GST fusions containing an SH2 domain of Src, PLCgamma 1, or rasGAP bind to RACK1 from HeLa cell lysate (Fig. 1). Evidence that the Src-RACK1 interaction is mediated by the SH2 domain of Src in vivo is that a Src mutant, which contains a 3-amino acid deletion in the phosphotyrosine-binding pocket of the SH2 domain (dl155), does not bind to RACK1 (Fig. 2). In addition, in vitro studies show that RACK1 binds to a Src mutant that contains an intact SH2 domain and has an 80-amino acid deletion in the SH3 domain, yet does not bind to dl155 Src (data not shown), indicating that it is specifically the SH2 and not the SH3 domain that mediates Src's interaction with RACK1. Evidence that the Src-RACK1 interaction is mediated by phosphotyrosines in the sixth WD repeat of RACK1 is that a phosphopeptide corresponding to the sequence surrounding Tyr-246 or Tyr-228 can compete with RACK1 from HeLa cell lysate for binding to GST-Src-SH2 (Fig. 4), and that a mutant of RACK1 that contains a phenylalanine substitution for tyrosine at residue 246 does not bind Src (Fig. 5). Evidence that the Src-RACK1 interaction is enhanced by tyrosine phosphorylation of RACK1 is that: 1) phosphorylation of RACK1 on tyrosine by Src in an in vitro kinase assay increases binding of RACK1 to Src, and phosphatase treatment of the tyrosine-phosphorylated RACK1 decreases binding (Fig. 3B); 2) phosphatase treatment of endogenous RACK1 decreases tyrosine phosphorylation of RACK1 and binding of RACK1 to Src (Fig. 3C); and 3) treatment of cells with agents that enhance the tyrosine phosphorylation of RACK1 (serum, PDGF, or PMA) also enhance the binding of RACK1 to Src (Figs. 6-8). Finally, evidence that the Src-RACK1 interaction is enhanced by PKC activation is that treatment of cells with specific activators of PKC increases the association of RACK1 and Src (as shown by both biochemical and immunofluorescence studies; Figs. 8 and 9, respectively), and pre-treatment of cells with specific inhibitors of PKC decreases the association (Fig. 8).

Although RACK1 has been reported to interact with the PKC family of serine/threonine kinases (reviewed in Refs. 9-11), this is the first report of RACK1 interacting with a tyrosine kinase and of RACK1 being tyrosine-phosphorylated. Moreover, although serine/threonine phosphorylation of members of the WD repeat family of proteins has been observed (42), to the best of our knowledge, this is the first report of tyrosine phosphorylation of a member of this family. We believe that tyrosine phosphorylation of RACK1 and other WD repeat proteins may be important "switches" that link these molecules to other signaling molecules and relays signals across multiple pathways. Because each WD repeat protein contains multiple WD domains and multiple tyrosines, the "switches" may be many, and the signals may be amplified and diverse.

A clear correlation exists between enhanced tyrosine phosphorylation of RACK1 and enhanced binding of RACK1 to Src (Figs. 3, 4, and 6). Thus, it is tempting to suggest that the two are linked, that RACK1 is a substrate for the Src tyrosine kinase, and that signals (like PKC or PDGFR activation) which bring Src and RACK1 in close proximity to each other result in phosphorylation of RACK1 by Src and, in turn, enhanced binding of RACK1 to Src's SH2 domain. However, Src is only one of many tyrosine kinases that could potentially phosphorylate RACK1 in cells, and factors in addition to tyrosine phosphorylation of RACK1 may regulate the interaction of RACK1 and Src. Nonetheless, we believe that both tyrosine phosphorylation of RACK1, and the interaction of Src and RACK1 are important mechanisms of signal transduction in cells.

Our finding that the intracellular localization of RACK1 in NIH 3T3 cells changes in response to PKC activation (moving from a perinuclear to another intracellular site; Fig. 9) confirms recent findings of Ron et al. (15). Moreover, our finding that PKC activation induces the co-localization of RACK1 and Src (Figs. 6, 8, and 9) is similar to the finding of Ron and co-workers that PKC activation induces the co-localization of RACK1 and beta IIPKC. Together, these findings suggest that RACK1 is involved in the intracellular trafficking of protein kinases from one intracellular site to another, perhaps bringing the enzymes into close proximity with their specific substrates.

RACK1 has been shown to interact with at least six different proteins: PKC (16), PLC-gamma 1 (43), Src (8), integrin beta  subunit (44), cAMP-specific phosphodiesterase PDE4D5 isoform (45), and p65 synaptotagmin (46). The interaction of RACK1 and PKC, Src, or integrin beta  subunit is inducible by PMA treatment (44), and in the case of Src and PKC, specifically by PKC activation. PKC activation appears to occur before RACK1 binds to Src because blocking PKC activation prevents most binding. PKC activation may induce a post-translational modification of RACK1 (other than serine/threonine phosphorylation) that allows RACK1 to interact with other signaling proteins. Here we report that one modification induced, indirectly, by PKC activation is tyrosine phosphorylation of RACK1 (Figs. 6 and 8). Others have shown that PMA stimulation results in tyrosine phosphorylation of several proteins including Shc and ErbB2 (35). Perhaps PKC activation brings RACK1 and other signaling proteins into close proximity with tyrosine kinases. Here we show that Src is one tyrosine kinase that associates with RACK1 following PKC activation (Figs. 6, 8, and 9). Alternatively, PKC activation may induce a conformational change in RACK1 that exposes an otherwise inaccessible tyrosine for phosphorylation. Because PKC does not directly phosphorylate RACK1 (16), the simplest explanation for how activated PKC might induce a conformational change in RACK1 is by directly binding to RACK1. Whether activated PKC is required to bind RACK1 before and/or in order that Src or integrin beta  subunit bind RACK1, is unknown (see below).

Interestingly, Src, PLC-gamma 1, and rasGAP are all known to associate via their SH2 domains with the PDGFR following PDGF stimulation (18, 39). Here we report that Src, PLC-gamma 1, and rasGAP also associate via their SH2 domains (at least in vitro) with RACK1 from HeLa cell lysate (Fig. 1) and that PDGF treatment of cells enhances both the tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src (Fig. 7). This suggests intriguing similarities, and possibly a link between PDGFR and RACK1 signaling; perhaps RACK1 in involved in the recruitment, assembly, and/or regulation of signaling molecules at the PDGFR following PDGF stimulation. Here we show that RACK1 interacts with the SH2 domains of some signaling proteins (Fig. 1). Rodriquez et al. (47) have shown that RACK1 interacts with the pleckstrin homology domain of other signaling proteins.

Overall, RACK1 appears to serve as a scaffold, anchor, or adaptor protein that is involved in the recruitment, assembly, and/or regulation of a variety of different signaling molecules (48). In the case of the PKC and Src protein kinases, RACK1 may help to recruit substrates or regulatory proteins and/or to stabilize the kinases in protein complexes. Examples of other proteins that work in similar ways include protein kinase A-anchoring proteins which interact with PKC, protein kinase A, and protein phosphatase 2B (49).

Of the large family of WD repeat proteins to which RACK1 belongs, RACK1 most closely resembles Gbeta subunit, which interacts with the beta -adrenergic receptor kinase, and like RACK1, has seven WD repeats (50, 51). (Interestingly, beta -adrenergic receptor kinase associates with Src after stimulation of beta -arrestin (52, 53).) Although the crystal structure of RACK1 has not been determined, it is very likely similar to that of Gbeta subunit (54). Gbeta folds into a symmetric "propeller" structure with seven "propeller blades," each corresponding to one of the seven WD repeats (reviewed in Refs. 12, 13, and 55). The blades of the propeller are thought to be the sites of interaction of Gbeta subunit with other proteins. Each blade may be specialized for interacting with specific proteins. Moreover, there is an insert of 3 amino acids into repeat 6 of Gbeta that helps generate a very hydrophobic region that runs from the top of the propeller down the side of blades 5 and 6 (12, 13, 55). This hydrophobic region is thought to be a potential binding site for an interacting protein(s) (reviewed in Ref. 55). Interestingly, repeat 6 of RACK1 is known to contain, at least in part, the binding site for both Src (Figs. 4 and 5) and PKC (16, 56). Thus, specific regions of RACK1 may serve as common "docking sites" for various intracellular signaling molecules. Whether different signaling proteins compete with each other for binding to the same site on one RACK1 molecule, bind near each other on the same RACK1 molecule, or bind to different RACK1 molecules but at the same site, is unknown. Because RACK1 is far more abundant in cells than are the Src or PKC protein kinases, the kinases are not obligated to compete with each other on an "either/or" basis or even to share a common "docking site" on the same RACK1 molecule. However, our preliminary studies suggest that beta IIPKC may interact with RACK1 and Src in a trimolecular complex.2 Interestingly, Ron et al. (57) showed recently that theta PKC associates with, and is phosphorylated by the Src-related kinase p59fyn in T cells. Similarly, PKCdelta associates with, and is phosphorylated by, v-Src in v-Src-transformed cells (58, 59). Thus, PKCs, Src kinases, and RACK1 may interact cooperatively in signaling pathways.

Our mutational analyses of RACK1 suggested that phosphotyrosine 246 mediates the interaction of RACK1 with Src's SH2 domain (Fig. 5). Our results from the peptide competition assays, showing that the phosphorylated Tyr-246 peptide inhibited binding (relative to the unphosphorylated control peptide) of lysate RACK1 to GST-Src-SH2 (Fig. 4), were internally consistent with results from the mutant RACK1 binding assays. Surprisingly, though, the presence of the unphosphorylated Tyr-246 peptide enhanced binding of lysate RACK1 to GST-Src-SH2. One possible explanation for this is that the Tyr-246 peptides interact with RACK1 in such a way as to increase the accessibility of the Src SH2-binding site. Another possible explanation is that the Tyr-246 peptides remove or displace a RACK1 binding protein that is partially covering the Src-SH2 binding site. Nonetheless, there is relatively less binding of RACK1 to GST-Src-SH2 in the presence of the phosphorylated than the unphosphorylated Tyr-246 peptide, indicating that the tyrosine-phosphorylated Tyr-246 peptide competes with RACK1 for binding to GST-Src-SH2.

Introducing a phenylalanine substitution for tyrosine at residue 228 in RACK1 did not affect the ability of RACK1 to interact with Src (Fig. 5). However, a phosphorylated Tyr-228 peptide inhibited binding of lysate RACK1 to GST-Src-SH2 in phosphopeptide competition assays (Fig. 4). One possible explanation for the discrepancy between these results is that either Tyr-246 or Tyr-228 of RACK1, if phosphorylated, can mediate the interaction with Src's SH2 domain, but normally only Tyr-246 is phosphorylated in cells. Another possibility is that phosphotyrosine 228 represents a minor, secondary site on RACK1 for interacting with Src's SH2 domain. Although the amino acid sequences flanking Tyr-228 and Tyr-246 of RACK1 are not predicted to be those most likely to interact with Src's SH2 domain (19, 60, 61), they are highly conserved evolutionarily from Neurospora to human (62).

Our findings that PLC-gamma 1 interacts with RACK1 in vitro (Fig. 1) confirm previous observations of other investigators (43) and provide new observations about the RACK1 binding site on PLC-gamma 1. PLC-gamma 1 contains a region homologous to the C2 region of PKC, which is known to mediate, in part, the binding of PKCs to RACKs (43). Thus, a previous hypothesis was that the C2 region of PLC-gamma 1 might, like the C2 region of PKC, contain part of the RACK1 binding site (43). We found that the N-terminal SH2 domain of PLC-gamma 1 mediates, at least in part, the interaction of PLC-gamma 1 and RACK1 in vitro (Fig. 1). It is possible that there are regions of PLC-gamma 1 in addition to the SH2 domain (such as the C2 domain) that also mediate the binding of PLC-gamma 1 to RACK1.

In summary, we have shown that RACK1 interacts with the SH2 domain of Src and several other intracellular signaling molecules. In the case of Src, binding is mediated by phosphotyrosines in the sixth WD repeat of RACK1, and enhanced by PKC activation and by tyrosine phosphorylation of RACK1. We believe that tyrosine-phosphorylated RACK1 plays an important role in protein-protein interactions and signal transduction pathways, perhaps by serving as a scaffold, anchor, or adaptor protein that helps to recruit, assemble, and/or regulate signaling molecules.

    ACKNOWLEDGEMENTS

We thank Rachel Harte for assistance with data analysis and figure preparation. We thank Lewis Cantley for pGEX plasmids containing the SH2 domains of PLCgamma , Shp-1, Shp-2, p85, Abl, Grb2, rasGAP, Csk, and Shc; Sara Courtneidge for NIH 3T3 cells overexpressing the PDGFR; Sarah Parsons for pM5Hc-src and pMdl155c-src; Tony Hunter for pGEMsrc; and Anson Lowe for antibodies to GST. We are grateful to Rosemary Fernandez and Gary Schoolnik for synthesis and purification of RACK1 peptides and phosphopeptides (Protein Structure Core Facility, Stanford Digestive Disease Center), and Evelyn Resurreccion, Eugene Butcher, Jou Tzuu-Shuh, and James Nelson for assistance with immunofluorescence studies (Cell Biology Core Facility, Stanford Digestive Disease Center). We thank Daria Mochly-Rosen, Anson Lowe, and Bishr Omary for critical review of the data and Daria Mochly-Rosen for critical review of the manuscript.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant R01 DK43743 (to C. A. C.) and National Research Service Award CA69810 (to B. Y. C.).

Dagger To whom correspondence should be addressed: CCSR Bldg., Rm. 3115C, 269 Campus Dr., Stanford University School of Medicine, Stanford, CA 94305-5187. Tel.: 650-725-8464; Fax: 650-723-5488; E-mail: chris.cartwright@stanford.edu.

Published, JBC Papers in Press, March 8, 2001, DOI 10.1074/jbc.M101375200

2 B. Y. Chang and C. A. Cartwright, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: RACK, receptor for activated protein kinase C; PKC, protein kinase C; SH2, Src homology 2; SH3, Src homology 3; WD, tryptophan-aspartic acid; PDGF, platelet-derived growth factor; PDGFR, platelet-derived growth factor receptor; DMEM, Dulbecco's modified Eagle medium; mAb, monoclonal antibody; TBS, Tris-buffered saline; PBS, phosphate-buffered saline; FBS, fetal bovine serum; GST, glutathione S-transferase; PMA, phorbol-12-myristate-13-acetate; BSA, bovine serum albumin; HA, hemagglutinin; FITC, fluorescein isothiocyanate; PAGE, polyacrylamide gel electrophoresis; GAP, GTPase-activating protein; CHO, CHinese hamster ovary; RIPA, radioimmunoprecipitation assay; PLC, phospholipase C; HPLC, high performance liquid chromatography.