The Interaction of Src and RACK1 Is Enhanced by
Activation of Protein Kinase C and Tyrosine Phosphorylation of
RACK1*
Betty Y.
Chang,
Meiling
Chiang, and
Christine A.
Cartwright
From the Department of Medicine, Stanford University,
Stanford, California 94305
Received for publication, February 13, 2001
 |
ABSTRACT |
RACK1 is an intracellular receptor for the
serine/ threonine protein kinase C. Previously, we demonstrated that
RACK1 also interacts with the Src protein-tyrosine kinase. RACK1,
via its association with these protein kinases, may play a key role in signal transduction. To further characterize the Src-RACK1 interaction and to analyze mechanisms by which cross-talk occurs between the two
RACK1-linked signaling kinases, we identified sites on Src and RACK1
that mediate their binding, and factors that regulate their
interaction. We found that the interaction of Src and RACK1 is
mediated, in part, by the SH2 domain of Src and by
phosphotyrosines in the sixth WD repeat of RACK1, and is
enhanced by serum or platelet-derived growth factor stimulation,
protein kinase C activation, and tyrosine phosphorylation of RACK1. To
the best of our knowledge, this is the first report of tyrosine
phosphorylation of a member of the WD repeat family of proteins. We
think that tyrosine phosphorylation of these proteins is an important
mechanism of signal transduction in cells.
 |
INTRODUCTION |
The Src family of intracellular protein-tyrosine kinases
participates in diverse signaling pathways that regulate cell growth, differentiation, adhesion, and architecture (reviewed in Ref. 1).
Identification of Src-binding proteins has led to better understanding
of Src regulation and has provided clues about the function of Src in
normal and transformed cells. For example, characterization of the
interaction between Src and polyoma middle T antigen led to discovery
of a fundamental mechanism by which the cellular Src protein is
converted to a transforming protein (by dephosphorylation at Tyr-527)
and defined the requirement of Src for polyoma transformation (2-7).
Thus, characterization of a single Src-binding protein contributed
substantially to our understanding of both RNA and DNA tumor biology.
Recently, using the unique domain/SH2/SH3 domain of Src as bait, and a
human lung fibroblast cDNA library as prey, we identified RACK1, a
known intracellular receptor for activated
C kinase
(RACK),1 as a Src-binding
protein (8). We found that overexpression of RACK1 inhibited the
specific activity of Src tyrosine kinases (as measured in
vitro) and the growth of NIH 3T3 cells. RACK1 exerted its effect
on growth, in part, by prolonging the G0/G1 phase of the cell cycle.
RACK1 was the first of a group of proteins (collectively called RACKs)
to be identified and characterized by Mochly-Rosen and co-workers
(reviewed in Refs. 9-11). RACK1 has sequence homology with the
subunit of heterotrimeric G proteins. RACK1 and G
are both members
of an ancient family of regulatory proteins made up of highly conserved
repeating units usually ending with Trp-Asp (WD) (reviewed in Refs. 12
and 13). WD repeat proteins are functionally diverse, although all seem
to be regulatory and few are enzymes. The WD repeats in RACK1 are
conserved from Chlamydomonas to human (reviewed in Ref. 13).
Thus, the function of RACK1 was probably fixed before the evolutionary
divergence of plants and animals.
Protein kinase C (PKC) is a family of serine/threonine kinases whose
activity depends upon phospholipid, diacylglycerol, and in some case on
calcium (reviewed in Refs. 9-11 and 14). Upon stimulation with tumor
promoter phorbol esters or hormones that increase intracellular
concentrations of diacylglycerol, PKCs become activated and translocate
to new subcellular sites where they phosphorylate isozyme-specific
substrates. Individual, activated, PKC isozymes are translocated to
distinct compartments, suggesting that they mediate distinct cellular
functions (9-11, 15).
RACKs interact only with activated forms of PKCs, suggesting that PKC
binding to RACK occurs after cell stimulation, to localize the active
enzyme to the RACK site (reviewed in Refs. 9-11). Moreover, there are
isozyme-specific RACKs, which presumably anchor each PKC isozyme close
to its physiologic substrate. For example, in cardiac myocytes RACK1 is
specific for
IIPKC, whereas RACK2 is specific for
PKC (15-17).
Thus, it appears that the specificity of PKC function may be
determined, in part, by the different locations of isozyme-specific RACKs.
The observation that RACK1 interacts with two, distinct, cytoplasmic
protein kinases raises interesting questions about the role of RACK1 in
orchestrating the intersection of tyrosine and serine/threonine kinase
signaling pathways. The purpose of this study was to further
characterize the Src-RACK1 interaction and to begin to analyze the
mechanism by which cross-talk occurs between two RACK1-linked signaling
protein kinases. We found that the interaction of Src and RACK1 is
mediated by the SH2 domain of Src and phosphotyrosines in the sixth WD
repeat of RACK1, and is enhanced by serum, PDGF stimulation, PKC
activation, and tyrosine phosphorylation of RACK1.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
NIH 3T3 cells overexpressing the
-platelet-derived growth factor (PDGF) receptor (a gift from Sara
Courtneidge, Sugen, San Francisco, CA; Ref. 18) or wild-type or Y527F
chicken c-Src (6) were cultured in Dulbecco's modified Eagle's medium
(DMEM) (Mediatech, Herndon, VA) supplemented with 10% calf serum
(Sigma), and maintained in G418 (200 µg/ml) (Life Technologies,
Inc.). CHO cells (American Type Culture Collection (ATCC), Rockville, MD) were cultured in Ham's F-12 medium (Mediatech) supplemented with
10% fetal bovine serum (FBS) (Sigma). HeLa cells (ATCC) were cultured
in DMEM supplemented with 10% FBS.
Plasmids--
pGEX-3X plasmids containing the SH2 domain(s) of
phospholipase C
1 (PLC
), Shp-2, Shp-1, p85, Abl, Grb2, rasGAP,
Csk, or Shc were gifts from Lewis Cantley (Harvard University, Boston,
MA) (19). pGEXsrc-SH2 and pGEX-RACK1 were constructed as
described (8). pGEX plasmids were used to generate GST-fusion proteins. Plasmids encoding wild-type (pM5H) or mutant dl155-157 (pM155) chicken
c-src were gifts from Sarah Parsons (University of Virginia, Charlottesville, VA; Ref. 20). Src inserts from the plasmids were
subcloned into pcDNA3 (Invitrogen, La Jolla, CA) to create pcDNA3 wild-type or dl155 c-src. pcDNA3-HA-RACK1 was
generated as described (8). pcDNA3 plasmids were used for transient
protein expression assays. pGEMsrc, a gift from Tony Hunter
(Salk Institute, La Jolla, CA), was used to generate in
vitro translated Src (8).
Antibodies--
For Src antibodies, 1) monoclonal antibody (mAb)
327 (21) was used (unless otherwise stated) for immunoprecipitation and immunoblot analyses; 2) anti-peptide antibody N16, which recognizes the
unique domain of Src (Santa Cruz Laboratories, Santa Cruz, CA), was
used for immunoprecipitation; and 3) anti-peptide antibody R7, which
recognizes the C terminus of Src (8) was used for immunoprecipitation.
RACK1 mAb (Transduction Laboratories, Lexington, KY; Ref. 7) was used
for immunoblot analyses. Anti-phosphotyrosine mAb PY20 (Transduction
Laboratories; Ref. 22) were used for immunoprecipitation and immunoblot
analyses. Polyclonal anti-GST was a gift from Anson Lowe (Stanford
University, Stanford, CA).
GST Fusion Protein Binding Assays--
Cultures of
Escherichia coli DH5
containing various pGEX-SH2 or pGEX
RACK1 plasmids were induced with 0.1 mM
isopropyl-
-D-thiogalactopyranoside (United States
Biochemical Corp., Cleveland, OH) for 3 h at 30 °C as described
(8). Bacteria were harvested, resuspended in Tris-buffered saline (TBS)
containing 1% Triton X-100 and 100 mM EDTA and sonicated.
After centrifugation at 12,000 × g for 10 min to
remove debris, the supernatant was incubated with glutathione-agarose beads (Sigma) for 2 h at 4 °C with agitation. Beads were washed three times with TBS. GST fusion proteins were eluted by the addition of 100 mM Tris, pH 8.0, 120 mM NaCl, and 20 mM glutathione and dialyzed four times against TBS.
Purified GST fusion proteins (1-5 µg) were incubated with cell
lysates or radiolabeled, in vitro translated Src for 3 h at 4 °C as described (8). Protein complexes were collected with the addition of 30 µl of glutathione beads, washed four times in
buffer containing 0.5% Nonidet P-40, 20 mM Tris, pH 8.0, 100 mM sodium chloride (NaCl), and 1 mM EDTA,
and boiled in sodium dodecyl sulfate (SDS) sample buffer. Proteins were
resolved by SDS-PAGE and detected by fluorography (see below) or
subjected to immunoblot analysis and detected by enhanced
chemiluminescence (ECL) (Amersham Pharmacia Biotech), according to the
manufacturer's protocol.
Transfection Assays--
CHO cells were transfected
with pcDNA3, pcDNA3-HA-RACK1, or pcDNA3-HA-RACK1 together
with pcDNA3c-src, using LipofectAMINE (Life
Technologies, Inc.) according to the manufacturer's protocol and as
described (8). Briefly, 2 × 105 cells were seeded in
six-well plates in Ham's F-12 medium containing 10% FBS. 24 h
later, transfections were performed using 0.5-1 µg of plasmid DNA
and 10 µl of LipofectAMINE in serum-free media. 5 h later, cells
were placed in fresh media containing 10% FBS. Cells were lysed
48 h after transfection.
Protein Extractions, Immunoprecipitations, and in Vitro Protein
Kinase Assays--
Cells were washed three times with ice-cold TBS and
lysed in modified RIPA buffer (0.1% SDS, 1% Nonidet P-40, 1% sodium
deoxycholate, 150 mM NaCl, 10 mM sodium
phosphate, pH 7.0, 100 µM sodium vanadate, 50 mM sodium fluoride, 50 µM leupeptin, 1%
aprotinin, 2 mM EDTA, and 1 mM dithiothreitol)
(6, 8, 23-27). Lysates were centrifuged at 14,000 × g
for 1 h at 4 °C. Protein concentrations were measured by the
BCA protein assay (Pierce), and samples were standardized to equal
amounts of total cellular protein (6, 8, 23-27). Lysates were
incubated for 3 h at 4 °C with excess antibody (1 µg of mAb
327 or PY20, or anti-peptide N16 or R7) and protein complexes were
collected with the addition of 30 µl of protein A/G-Sepharose beads
(Amersham Pharmacia Biotech). Protein kinase assays were performed by
incubating mAb 327 immunoprecipitates (of Y527F Src-overexpressing NIH
3T3 cell lysates) for 10 min at 30 °C in 30 µl of kinase buffer
containing 50 mM piperazine-N,N'-bis (2-ethanesulfonic acid), pH 7.0, 10 mM manganese chloride,
10 mM dithiothreitol, 1 µg of GST-RACK1 or GST, and, in
some cases, 1 mM ATP (6, 8, 23-27). Phosphorylated
proteins were detected by immunoblot analysis with anti-phosphotyrosine
PY20 or by binding to radiolabeled, in vitro translated Src
(see below).
Immunoblot Analysis--
Src or PY20 immunoprecipitates were
resolved on 10% SDS-polyacrylamide gels (acrylamide-bisacrylamide,
29:0.8). Proteins were transferred to polyvinylidene difluoride
membranes (Immobilon-PTM; Millipore, Bedford, MA) in transfer buffer
(25 mM Tris-HCl, pH 7.4, 192 mM glycine, and
15% methanol) using a Trans-Blot apparatus (Bio-Rad) for 2 h at
60 V (6, 8, 23-27). Protein binding sites on the membranes were
blocked by incubating membranes overnight in TNT buffer (10 mM Tris-HCl, pH 7.5, 100 mM sodium chloride, 0.1% (v/v) Tween 20 (Sigma)) containing 3% nonfat, powdered milk (blocking buffer). Membranes were incubated with mAb RACK1 (0.08 mg/ml), affinity-purified mAb 327 ascites (2 µg/ml), mAb PY20 (0.08 mg/ml), or polyclonal anti-GST (2 mg/ml) for 1 h, washed in TNT
buffer with changes every 5 min for 30 min, and incubated with
horseradish peroxidase-conjugated donkey anti-mouse IgM
(Zymed Laboratories Inc., San Francisco, CA) for RACK1
blots, goat anti-mouse IgG (Bio-Rad) for mAb 327 or PY20 blots, or goat
anti-rabbit IgG (Bio-Rad) for anti-GST blots (6, 8, 23-27). Proteins
were detected by ECL (see above).
In Vitro Translation of Proteins--
pGEMsrc (2 µg) was transcribed and translated in vitro using a TnT
coupled rabbit reticulocyte lysate system (Promega, Madison, WI), as
instructed by the manufacturer and as described (8). In
vitro translated products labeled with Pro-Mix[35S]
(70% L-[35S]methionine and 30%
L-[35S]cysteine; >1,000 Ci/mmol; Amersham
Pharmacia Biotech) were diluted (1:100) in buffer (50 mM
Tris, pH 7.5, 150 mM NaCl, and 0.2% Nonidet P-40) and
incubated with 1 µg of purified GST or GST-RACK1 for 3 h at
4 °C as described above. 1/20 of the unbound translation reaction
product was loaded directly on the gel as a marker for in
vitro translated Src. Gels were treated with Fluoro-Hance
(Research Products International Corp., Mount Prospect, IL), and
radiolabeled proteins were detected by fluorography.
Protein Phosphatase Assays--
Cell lysates, GST fusion
proteins, or immunoprecipitates were incubated in phosphatase buffer
(50 mM Tris-HCl, pH 8.5, 0.1 mM EDTA) with or
without the addition of purified calf intestinal alkaline phosphatase
(50 units) (Promega) for 30 min at room temperature. The reaction was
stopped by heating the mixture to 75 °C for 15 min (27-30).
Synthesis and Purification of RACK1
Peptides--
Tyrosine-phosphorylated (or identical unphosphorylated)
peptides corresponding to the sequence surrounding each of the 6 tyrosines of RACK1 were synthesized by the Protein Structure Core
Facility of the Digestive Disease Center, Stanford University
(Director, Gary Schoolnik), on an automated Milligen Peptide
Synthesizer using FMOC-Novasyn KA resin (NovaBioChem, San Diego, CA)
(31-33). Phosphotyrosine was incorporated as Fmoc
(N-(9-fluorenyl)methoxycarbonyl)-Tyr(PO3H2)-OH. The crude peptides were purified using reverse phase high performance liquid chromatography (HPLC) (3.9 × 300-mm C18 column) and a
linear gradient containing 0.05% trifluoroacetic acid in 15-65%
acetonitrile. The purity of the HPLC-purified products was confirmed
using mass spectrometry. The purified phosphopeptides (Tyr-52,
TRDETNY(PO4)GIPQ; Tyr-140, TLGVCKY(PO4)TVQD;
Tyr-195, HIGHTGY(PO4)LNTV; Tyr-228, NEGKHLY(PO4)TLD; Tyr-246, CFSPNRY(PO4)WLCA;
Tyr-302, QTLFAGY(PO4)TDNL), or the identical
unphosphorylated peptides, were used for peptide competition assays.
Phosphopeptide Competition Assays--
CHO cells were treated
with phorbol-12-myristate-13-acetate (PMA) (Life Technologies, Inc.)
(10 ng/ml) at 37 °C for 10 min prior to lysis in RIPA buffer. Lysate
containing 200 µg of total cellular protein was incubated with
peptide (100 µM) and GST-Src-SH2 (500 nM) or
GST for 1 h at 4 °C (8, 34). Glutathione-agarose beads (30 µl) were added, and the mixture was incubated with gentle rocking for
2 h at at 4 °C. Proteins were eluted from the beads, resolved
by SDS-PAGE, and subjected to immunoblot analysis with anti-RACK1, as
described above.
Site-directed Mutagenesis of Tyrosines in
RACK1--
Oligonucleotide-directed mutagenesis was used to substitute
phenylalanine for tyrosine at residues 52, 140, 194, 228, 246, or 302 of RACK1, utilizing the Transformer site-directed mutagenesis kit
according to the manufacturer's protocol
(CLONTECH, Palo Alto, CA) and the following
oligonucleotides: Y52F oligo, GATGAGACCAACTTTGGAATTCCA; Y140F oligo,
GGTGTGTGCAAATTCACTGTCCAG; Y195F oligo, CACACAGGCTTTCTGAACACGGTG; Y228F
oligo, GGCAAACACCTTTTCACGCTAGAT; Y246F oligo, CCTAACCGCTTCTGGCTGTGTGCT; Y302F oligo, CTGTTTGCTGGCTTCACGGACAAC.
The sequence of each RACK1 mutant was confirmed by automated DNA
sequencing (Protein and Nucleic Acid Facility, Stanford University, Stanford, CA). Mutant RACK1 genes were inserted into pcDNA3 to create pcDNA3-HA-RACK1(Y52F, Y140F, Y195F, Y228F, Y246F, or Y302F) as described (8).
Treatment of Cells--
CHO cells were transfected with
pcDNA3 plasmids as described above. 18 h later after
transfection, cells were placed in fresh media containing 0.5% FBS.
24 h later, cells were treated for various time periods with PMA,
which was dissolved in dimethyl sulfoxide (Me2SO) and used
at a concentration of 10 ng/ml (35, 36). In some cases, cells were
pre-treated with a PKC inhibitor: GF109203X, chelerythrine, or
calphostin C (each was dissolved in Me2SO and used at a
concentration of 0.1 µM) (Calbiochem, La Jolla, CA) for
30 min prior to PMA stimulation. Control cells were treated with
Me2SO alone. NIH 3T3 cells that were stably overexpressing
the PDGFR were maintained in 0.5% serum for 48 h before treatment
with PDGF-BB (Sigma) (10 ng/ml) for various time periods. For
immunoblot analysis with anti-phosphotyrosine PY20, cells were treated
with 100 µM sodium vanadate (Sigma) for 30 min prior to
harvesting (8). Cells were harvested by trypsinization, collected by
centrifugation, and lysed in SDS sample buffer.
Immunofluorescence--
NIH 3T3 cells stably overexpressing
c-Src were grown subconfluently on coverslips in DMEM supplemented with
10% FBS for 24 - 48 h and then in fresh media containing 0.5%
FBS for 72 h. Cells were treated with PMA (10 ng/ml) or
Me2SO for various time periods prior to fixation in 3.7%
paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room
temperature and permeabilization in 0.4% Triton X-100/PBS for 20 min
at room temperature (37). Nonspecific sites were blocked with 10% goat
serum and 1% bovine serum albumin (BSA) in PBS containing 50 mM NH4Cl, for 1 h. Cells were incubated
with primary antibodies, anti-RACK1 (1:500) and anti-Src (mAb 327)
(1:100) in PBS containing 5% goat serum and 0.2% BSA for 1 h.
After washing three times in PBS containing 0.2% BSA, cells were
incubated with secondary antibodies, FITC-conjugated goat anti-mouse
IgG (Jackson Immunoresearch Laboratories, West Grove, PA) and
lissamine-rhodamine conjugated goat anti-mouse IgM (Jackson
Immunoresearch), which were diluted 1:100 in PBS containing 5% goat
serum and 0.2% BSA, for 40 min in the dark. Coverslips were washed
three times in PBS containing 0.2% BSA and a fourth time in PBS
containing bisbenzamidine. Src and RACK1 immunostaining were visualized
with FITC and Texas Red filters, respectively. Control experiments
demonstrated that cross-reactivity did not occur between the two
secondary antibodies. Cells were photographed using Nikon TE 300 eclipse lenses on a Bio-Rad MRC 1024 confocal microscope. Confocal
image analysis was performed using a Bio-Rad MRC600 laser confocal
scanner, and final digital images were processed using Adobe Photoshop
5.1 (Adobe System, San Jose, CA). Layers comprised a thickness of 0.2 µm.
 |
RESULTS |
RACK1 Associates, in Vitro, with the SH2 Domains of Src, PLC
,
and rasGAP--
Previously, we showed that RACK1 binds to the SH2
domain of Src in vitro (8). To determine whether RACK1 binds
to the SH2 domain of other signaling proteins, we incubated GST fusion
proteins containing the SH2 domain of Src, PLC
, Shp-2, Shp-1, p85,
Abl, Grb2, rasGAP, Csk, or Shc together with HeLa cell lysates;
collected protein complexes on glutathione-agarose beads; and assayed
for RACK1 binding by immunoblot analysis with anti-RACK1 (Fig.
1, upper panel). We
observed that RACK1 bound to the SH2 domain of Src (lane
1), to the N-terminal SH2 domain of PLC
(lane
3) and of rasGAP (lane 10), and not to
the SH2 domains of the other proteins tested. When the membrane was
stripped of antibody and re-probed with GST antibody (lower
panel), a similar amount of GST-SH2 fusion protein was
present in each lane, except for the one containing the C-terminal SH2
domain of p85, where less protein was present (lane
6). Thus, RACK1 interacted specifically with the SH2 domain of Src and the N-terminal SH2 domain of PLC
and rasGAP, and not with
the SH2 domains of Shp-1, Shp-2, p85, Abl, Grb2, Csk, or Shc.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 1.
Binding of RACK1 to GST-SH2 fusion
proteins. RIPA lysates of HeLa cells (containing 300 µg of total
cellular protein) were incubated with 2 µg of purified GST fusion
protein containing an SH2 domain of Src (lane 1), PLC
(lanes 2 and 3), Shp-2 (lane 4), Shp-1
(lane 5), p85 (lanes 6 and 7), Abl
(lane 8), Grb2 (lane 9), rasGAP (lane
10), Csk (lane 11), or Shc (lane 12).
Protein complexes were collected on glutathione-agarose beads. Proteins
bound to GST-SH2 fusions were recovered, resolved by SDS-PAGE,
transferred to polyvinylidene difluoride membranes, and subjected to
immunoblot analysis with a monoclonal antibody specific for RACK1
(top panel). The membrane was stripped of
antibody and re-blotted with anti-GST (bottom
panel). For proteins containing two SH2 domains,
C represents the C-terminal and N the N-terminal
SH2 domain. Data are representative of three independent
experiments.
|
|
RACK1 Associates, in Vivo, with the SH2 Domain of Src--
To
determine whether the SH2 domain of Src mediates binding of Src and
RACK1 in vivo, we utilized a Src mutant that contains a
3-amino acid deletion (Arg-155, Arg-156, and Gly-157) in the phosphotyrosine-binding pocket of the SH2 domain (dl155) (20). CHO
cells were transfected with vector alone, HA-RACK1, or HA-RACK1 together with wild-type or dl155 Src. Lysate proteins, or proteins immunoprecipitated with a mAb specific for Src or with mouse IgG were
resolved by SDS-PAGE, transferred to polyvinylidene difluoride membranes, and immunoblotted with a mAb specific for RACK1 (Fig. 2A). We observed that HA-RACK1
protein was expressed at equivalent levels in cells transfected with
wild-type or dl155 Src (compare lanes 1 and
2). However, there was less binding of HA-RACK1 to dl155
(lane 5) than to wild-type (lane
6) Src. Moreover, the amount of RACK1 bound to dl155 Src
(lane 5) was only slightly more than could be
accounted for by endogenous Src (lane 4). When
the membrane was stripped of RACK1 antibody and re-blotted with Src
antibody (Fig. 2B), we observed equivalent amounts of
wild-type and dl155 Src protein in cell lysates (compare
lanes 1 and 2) and in Src immunoprecipitates (compare lanes 5 and
6). Neither RACK1 nor Src proteins were detected in control
IgG immunoprecipitates (lanes 7-10). These
findings indicate that the SH2 domain of Src mediates the interaction
of Src and RACK1 in vivo. Additional experiments showed that
GST-RACK1 binds to a Src mutant that contains an intact SH2 domain and
that lacks 80 amino acids in the SH3 domain (
SH3; Ref. 38), but
GST-RACK1 does not bind to the dl155 Src mutant (data not shown). These
results suggest that it is specifically the SH2 and not the SH3 domain
of Src that mediates the interaction of Src and RACK1.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 2.
In vivo binding of
RACK1 to wild-type Src and not to mutant Src that contains a deletion
in the SH2 domain. CHO cells were transiently transfected with
vector alone (lanes 3 and 7), HA-RACK1
(lanes 4 and 8), or HA-RACK1 together
with wild-type Src (lanes 2, 6, and
10) or a Src mutant containing a deletion in the SH2 domain
(dl155 Src; lanes 1, 5, and
9). A, proteins were immunoprecipitated with
anti-Src (lanes 3-6) or mouse IgG (lanes
7-10) from RIPA lysates containing 100 µg of total
cellular protein, resolved by SDS-PAGE, and subjected to immunoblot
analysis with anti-RACK1. Lanes 1 and
2, lysate containing 5 µg of total cellular protein was
loaded directly on the gel prior to transfer and immunoblot analysis
with anti-RACK1. B, the membrane shown in A was
stripped of antibody and re-blotted with anti-Src. Data are
representative of four independent experiments.
|
|
Phosphorylation of RACK1 on Tyrosine Enhances Binding of RACK1 and
Src--
SH2 domains are known to interact with phosphotyrosines on
cellular proteins. To determine whether tyrosine phosphorylation of
RACK1 regulates the interaction of RACK1 and Src in vitro, we first pre-treated HeLa cell lysates with alkaline phosphatase or
phosphatase buffer, incubated lysates with GST-Src-SH2 or GST alone,
collected protein complexes on glutathione-agarose beads, and performed
immunoblot analysis with anti-RACK1 (Fig.
3A). We observed less binding
of lysate RACK1 to GST-Src-SH2 when the lysate was pre-treated with
alkaline phosphatase (lane 3) than when it was
pre-treated with buffer lacking alkaline phosphatase (lane
2). Lysate RACK1 did not bind to GST alone (lanes
4 and 5). This result suggested that
phosphorylation of RACK1 enhances the binding of RACK1 to Src.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 3.
Phosphorylation of RACK1 on tyrosine
increases binding of RACK1 to Src. A, dephosphorylation
of RACK1 decreases binding of RACK1 to a GST fusion protein containing
the SH2 domain of Src. RIPA lysates of HeLa cells (containing 200 µg
of total cellular protein) were treated for 30 min at room temperature
with purified alkaline phosphatase (50 units) (+, lanes
3 and 5) or with phosphatase buffer alone ( ,
lanes 2 and 4) and incubated with
GST-Src-SH2 (lanes 2 and 3) or GST
alone (lanes 4 and 5). Protein
complexes were collected on glutathione beads. Proteins bound to
GST-Src-SH2 or GST alone were subjected to immunoblot analysis with
anti-RACK1. Lane 1, lysate containing 5 µg of
total cellular protein was loaded directly on the gel prior to transfer
and immunoblot analysis with anti-RACK1. B, tyrosine
phosphorylation of RACK1 by Src increases binding of RACK1 to in
vitro translated Src, and dephosphorylation of the
tyrosine-phosphorylated RACK1 decreases binding. Y527F Src
immunoprecipitates were incubated with 1 µg of GST-RACK1
(lanes 1, 2, and 4-6) or
GST alone (lane 7) in the presence (+) or absence
( ) of cold ATP (1 mM) and in vitro protein
kinase reactions were performed. Aliquots from the reaction mixture
containing both GST-RACK1 and ATP (lane 2) or
GST-RACK1 without the addition of ATP (lane 1)
were subjected to immunoblot analysis with anti-phosphotyrosine. The
unphosphorylated GST-RACK1 (lane 4), the
tyrosine-phosphorylated GST-RACK1 (lanes 5 and
6) or GST alone (lane 7) were then
incubated with purified alkaline phosphatase (lane
6) or with phosphatase buffer alone (lanes
4, 5, and 7) as described in
A, and assayed for binding to
[35S]methionine/cysteine-labeled in vitro
translated Src. Lane 3, 1/20 of the unbound
translation reaction product (FT for flow-through) was
loaded directly on the gel as a marker for in vitro
translated Src. 35S-Labeled proteins were visualized by
autoradiography. C, dephosphorylation of RACK1 on tyrosine
decreases binding of RACK1 to Src. CHO cells were transiently
transfected with vector alone (V; lanes
1 and 3-6) or with HA-RACK1 and wild-type Src
(lanes 2 and 7-12). Proteins were
immunoprecipitated from RIPA lysates (containing 100 µg of total
cellular protein) with anti-Src N16 (lanes 3,
4, 7, and 8), anti-Src R7
(lanes 9 and 10), or
anti-phosphotyrosine (lane 5, 6,
11, and 12). Immunoprecipitates were treated with
purified alkaline phosphatase (+, even lanes
4-12) or phosphatase buffer ( , odd
lanes 3-11) and subjected to immunoblot analysis
with anti-RACK1. Lanes 1 and 2, lysate
containing 5 µg of total cell protein was loaded directly on the gel
prior to transfer and immunoblot analysis with anti-RACK1. Data are
representative of at least three independent experiments.
|
|
To determine whether it is specifically tyrosine phosphorylation of
RACK1 that enhances binding, we incubated GST-RACK1 with constitutively
active Y527F Src (4-7) in the presence or absence of cold ATP,
performed an in vitro kinase reaction, and subjected aliquots to immunoblot analysis with anti-phosphotyrosine (Fig. 3B, lanes 1 and 2). We
observed increased tyrosine phosphorylation of GST-RACK1 by Src when
ATP was added to the reaction mixture. We treated the
tyrosine-phosphorylated or unphosphorylated GST-RACK1 with alkaline
phosphatase or phosphatase buffer and assayed for binding to
[35S]methionine/cysteine-labeled, in vitro
translated Src (lanes 3-7). We observed more
binding of Src to tyrosine-phosphorylated GST-RACK1 (lane
5) than to dephosphorylated GST-RACK1 (lane 6) or to
unphosphorylated GST-RACK1 (lane 4). When we
repeated the experiment using potato acid phosphatase instead of
alkaline phosphatase, we observed similar results (data not shown).
To further analyze the effect of tyrosine phosphorylation of RACK1 on
the interaction of RACK1 and Src, we transiently expressed HA-RACK1 and
Src in CHO cells, treated Src immunoprecipitates with alkaline
phosphatase or phosphatase buffer and tested for binding of RACK1 to
Src (Fig. 3C). We used two Src antibodies for
immunoprecipitation: one that recognizes the unique domain of Src (N16)
and another that recognizes the C terminus of Src (R7). When we
immunoprecipitated Src with either antibody and tested for RACK1
binding by immunoblot analysis with anti-RACK1, we observed decreased
binding of RACK1 and Src when alkaline phosphatase was added to the
immunoprecipitate (Fig. 3C, compare lanes
7 and 8 or lanes 9 and
10). Immunoprecipitation with anti-phosphotyrosine followed
by immunoblot analysis with anti-RACK1 demonstrated that lysate RACK1
was tyrosine-phosphorylated (lane 11) and that
tyrosine phosphorylation on RACK1 decreased with the addition of
alkaline phosphatase to the immunoprecipitate (compare lanes
11 and 12). Immunoblot analysis with anti-Src
revealed an equivalent amount of immunoprecipitated Src in each lane
(data not shown). Additional studies showed that RACK1 is
phosphorylated on more than one tyrosine, and that the RACK1 antibody
recognizes both phosphorylated and unphosphorylated forms of RACK1
equally well (data not shown). Together, these results suggested that
phosphorylation of RACK1 on tyrosine enhances binding of RACK1 to Src.
Phosphotyrosines in the Sixth WD Repeat of RACK1 Mediate the
Interaction of RACK1 with Src's SH2 Domain--
Together, the results
of the binding assays shown in Figs. 2 and 3 suggested that a
phosphorylated tyrosine(s) on RACK1 might mediate the interaction of
RACK1 with Src's SH2 domain of Src. Thus, we searched for tyrosines in
the RACK1 sequence that, when phosphorylated, could potentially
interact with the SH2 domain of Src. Analysis of the amino acid
sequence of RACK1 revealed six tyrosines (Fig.
4A): Tyr-52 (located at the
boundary of WD40 repeats 1 and 2), Tyr-140 (in repeat 4), Tyr-194 (in
repeat 5), Tyr-228 and Tyr-246 (in repeat 6), and Tyr-302 (in repeat
7).

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 4.
A, structure of RACK1: location of
tyrosines within WD repeat domains. B,
tyrosine-phosphorylated peptides of RACK1 compete with lysate RACK1 for
binding to a GST-fusion containing the SH2 domain of Src. CHO cell
lysates (containing 200 µg of total cellular protein) were incubated
with 5 µg of GST (lane 3), GST-Src-SH2
(lane 2), or GST-Src-SH2 together with 100 µM unphosphorylated RACK1 peptide (even
lanes 4-14) or the corresponding
tyrosine-phosphorylated RACK1 peptide (odd lanes
5-15). Protein complexes were collected on
glutathione-agarose beads. Proteins bound to GST-Src-SH2 or GST were
subjected to immunoblot analysis with anti-RACK1 (upper
panel). Lane 1, lysate containing 5 µg of total cellular protein was loaded directly on the gel prior to
transfer and immunoblot analysis with anti-RACK1. Peptides correspond
to the sequence surrounding each tyrosine of RACK1. Lower
panel, the membrane shown in the upper
panel was stripped of antibody and re-blotted with anti-Src.
Data are representative of three independent experiments.
|
|
To determine which phosphotyrosine(s) on RACK1 might interact with
Src's SH2 domain, we first performed phosphopeptide competition assays. To do so, we synthesized tyrosine-phosphorylated or
unphosphorylated peptides corresponding to the sequence surrounding
each tyrosine of RACK1 and tested the peptides for their ability to
compete with RACK1 from HeLa cell lysate for binding to a GST fusion
protein containing Src's SH2 domain (GST-SH2). We incubated lysates
with GST, GST-SH2, or GST-SH2 together with the tyrosine-phosphorylated RACK1 peptide or the corresponding unphosphorylated peptide, collected protein complexes on glutathione-agarose beads, and performed immunoblot analysis with anti-RACK1 (Fig. 4B,
upper panel). We observed that lysate RACK1
(lane 1) bound GST-SH2 (lane
2) but not GST alone (lane 3). We
observed less binding of lysate RACK1 to GST-SH2 when the Y228
phosphopeptide was present in the incubation mixture (lane
11) than when the corresponding unphosphorylated peptide was
present (lane 10). Similarly, we observed less
binding of lysate RACK1 to GST-SH2 when the Tyr-246 phosphopeptide was present in the mixture (lane 13) than when the
unphosphorylated Tyr-246 peptide was present (lane
12). Interestingly, we observed more binding of lysate RACK1
to GST-SH2 in the presence of the unphosphorylated Tyr-246 peptide
(lane 12) than in the absence of peptide
(lane 2). In all other cases, the binding of
RACK1 to GST-SH2 was similar in the presence of either the
phosphorylated or the unphosphorylated peptide and not different than
in the absence of peptide. When the blot was stripped of anti-RACK1, re-probed with anti-Src, and exposed for a longer time period, similar
amounts of GST-SH2 fusion protein were present in each lane
(lower panel). Thus, a RACK1 phosphopeptide
corresponding to the sequence surrounding Tyr-246 or Tyr-228 can
competed with lysate RACK1 for binding to Src's SH2 domain in
vitro. These results suggested that phosphorylated Tyr-228 and/or
Tyr-246 on RACK1 (both located in WD repeat 6) might mediate, at least
in part, the interaction of RACK1 with Src's SH2 domain in
vivo.
To further analyze the site on RACK1 that mediates the interaction with
Src's SH2 domain, we introduced mutations into RACK1, substituting
phenylalanine for tyrosine at residue 52, 140, 194, 228, 246, or 302, and tested the RACK1 mutants for binding to Src. To do so, we
transiently expressed wild-type or mutant (Y52F, Y140F, Y194F, Y228F,
Y246F, or Y302F) HA-tagged RACK1 together with Src in CHO cells,
immunoprecipitated proteins with anti-Src, and performed immunoblot
analysis with anti-RACK1 (Fig.
5A). We observed that RACK1
mutant Y246F did not bind to Src (lane 6), whereas all other RACK1 mutants did bind to Src (lanes
2-5 and 7) and the amount bound was similar to
that of wild-type RACK1 (lane 1). When the blot
was stripped of RACK1 antibody and re-probed with Src antibody, similar
amounts of immunoprecipitated Src were present in each lane (Fig.
5B). RACK1 immunoblot analysis of cell lysates revealed that
HA-RACK1 protein was expressed at equivalent levels in all transfected
cells and the levels were ~10 fold higher than those of endogenous
RACK1 (Fig. 5C). These results suggested that
phosphotyrosine 246 of RACK1 mediates the interaction of RACK1 with
Src's SH2 domain. Together, the results from the peptide competition
assays and the mutational analyses indicate that phosphotyrosines in
the sixth WD repeat of RACK1 mediate the interaction of RACK1 with
Src's SH2 domain.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 5.
Src does not bind to a RACK1 mutant that
contains a phenylalanine substitution for tyrosine at residue 246. CHO cells were transiently transfected with wild-type HA-RACK1
(wt-RK; lane 1) or with mutant
HA-RACK1 Y52F (lane 2), Y140F (lane
3), Y194F (lane 4), Y228F
(lane 5), Y246F (lane 6),
or Y302F (lane 7). A, proteins were
immunoprecipitated with anti-Src from RIPA lysates (containing 100 µg
of total cellular protein) and subjected to immunoblot analysis with
anti-RACK1. B, the membrane shown in A was
stripped of antibody and re-blotted with anti-Src. C,
proteins from lysate containing 5 µg of total cellular protein were
subjected to immunoblot analysis with anti-RACK1. Data are
representative of three independent experiments.
|
|
Serum, PDGF, and Activation of PKC Enhance the Tyrosine
Phosphorylation of RACK1 and the Interaction of RACK1 and
Src--
RACK1 is known to be an intracellular receptor for activated
PKC (reviewed in Refs. 9-11). To determine whether PKC activation influences the interaction of RACK1 and Src and the tyrosine
phosphorylation of RACK1, we treated cells with mitogens that activate
PKC (the tumor promoter PMA or serum) and analyzed their effect. To do so, we expressed vector alone or HA-RACK1 together with Src in CHO
cells, treated serum-starved quiescent cells with PMA (10 ng/ml) or
10% serum, immunoprecipitated proteins with anti-Src or
anti-phosphotyrosine, and performed immunoblot analysis with anti-RACK1
(Fig. 6A). We and others have
been unsuccessful in attempts to generate antibodies that
immunoprecipitate RACK1 efficiently from cell lysates. Thus, to study
tyrosine-phosphorylated RACK1, we immunoprecipitated proteins with
anti-phosphotyrosine and performed immunoblot analysis with anti-RACK1.
After treating cells for 15 min with either PMA or serum, we observed a
striking increase in the amount of RACK1 bound to Src (compare
lanes 4 and 5 or lanes
4 and 7, respectively) and a striking increase in
tyrosine phosphorylation of RACK1 (compare lanes
10 and 11 or lanes 10 and
13, respectively). The effect of PMA was transient; after sustained treatment for 60 min, binding of RACK1 and Src and tyrosine phosphorylation of RACK1 had returned to base-line levels (compare lanes 5 and 6 or lanes
11 and 12, respectively). When the blot was
stripped of antibody and re-probed with Src antibody (Fig. 6B), similar amounts of Src protein were present in all Src
immunoprecipitates of Src-transfected cells (compare lanes
4-7) and similar amounts of tyrosine-phosphorylated Src
were present in all anti-phosphotyrosine immunoprecipitates of
Src-transfected cells (compare lanes 10-13). These results indicated that treatment of cells with serum or PMA
increases the tyrosine phosphorylation of RACK1 and the binding of
RACK1 to Src.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of PMA or serum treatment of cells on
the tyrosine phosphorylation of RACK1 and the binding of RACK1 to
Src. CHO cells were transfected with vector alone
(lanes 2, 3, 8, and
9) or HA-RACK1 and Src (lanes 1,
4-7, and 10-13). 24 h after transfection,
cells were placed in fresh media containing 0.5% serum. 48 h
after transfection, cells were treated with PMA (10 ng/ml) for 15 min
(lanes 3, 5, 9, and
11) or 60 min (lanes 6 and
12), FBS for 15 min (lanes 7 and
13), or left untreated (lanes 2,
4, 8, and 10) before lysis in RIPA
buffer. A, proteins were immunoprecipitated with anti-Src
(lanes 2-7) or anti-phosphotyrosine
(lanes 8-13) from lysate containing 100 µg of
total cellular protein and subjected to immunoblot analysis with
anti-RACK1. Lane 1, lysate of cells expressing
both HA-RACK and Src (and containing 5 µg of total cellular protein)
was loaded directly on the gel prior to transfer and immunoblotting
with anti-RACK1. B, the membrane shown in A was
stripped of antibody and re-blotted with anti-Src. The band running
below Src in lanes 8-13 has a mobility
consistent with that predicted for the tyrosine-phosphorylated heavy
chain of the anti-phosphotyrosine antibody. Data are representative of
three independent experiments.
|
|
To determine whether PDGF, a growth factor in serum that can indirectly
activate PKC through PLC
(39), influences the association of RACK1
and Src, we treated serum-starved fibroblasts that overexpress the
-PDGF receptor with purified PDGF-BB (10 ng/ml) for various time
periods, immunoprecipitated proteins with anti-Src, and performed immunoblot analysis with anti-RACK1 (Fig.
7). We observed an increase in RACK1
bound to Src after 2 and 5 min of PDGF treatment (compare lanes 1-3 of Fig. 7A, and
lanes 1 and 2 of Fig. 7B).
The effect of PDGF was transient; after treatment for 10, 30, or 120 min, binding of RACK1 and Src had returned to near base-line levels (Fig. 7A, compare lanes 4-6 with
lane 3). When the blot was stripped of anti-RACK1
and re-probed with anti-Src, similar amounts of Src protein were
present in all Src immunoprecipitates (compare lanes
7-12). Immunoblot analysis of lysate proteins with
anti-RACK1 revealed that equivalent amounts of RACK1 protein were
present in all lanes (compare lanes 13-18). The
effect of PDGF on the RACK1-Src interaction was
concentration-dependent, with the maximal effect achieved
with 10 ng/ml (data not shown; Ref. 18).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of PDGF treatment of cells on the
tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src.
NIH 3T3 cells that were stably overexpressing the PDGFR were maintained
in 0.5% serum for 48 h before treatment with PDGF (10 ng/ml) for
2, 5, 10, 30, or 120 min and lysis in RIPA buffer. A,
upper panel, proteins were immunoprecipitated
with anti-Src from lysate containing 200 µg of total cellular protein
and subjected to immunoblot analysis with anti-RACK1. Middle
panel, the membrane shown in the upper
panel was stripped of antibody and re-blotted with anti-Src.
The band running below Src is mouse IgG heavy chain. Lower
panel, proteins from lysate containing 2 µg of total
cellular protein were subjected to immunoblot analysis with anti-RACK1.
B, proteins were immunoprecipitated with anti-Src
(lanes 1 and 2) or
anti-phosphotyrosine (lanes 3 and 4)
as described in A and subjected to immunoblot analysis with
anti-RACK1. Data are representative of three independent
experiments.
|
|
To determine whether PDGF enhances the tyrosine phosphorylation of
RACK1, we treated serum-starved cells that overexpress the PDGF
receptor with PDGF for 5 min, immunoprecipitated lysate proteins with
anti-phosphotyrosine, and performed immunoblotting with anti-RACK1
(Fig. 7B). We observed increased tyrosine phosphorylation on
RACK1 following PDGF treatment (compare lanes 3 and 4). Thus, PDGF stimulation enhances the tyrosine
phosphorylation of RACK1 and the binding of RACK1 to Src.
To determine the time course of PMA effect on RACK1-Src binding, we
treated CHO cells that were transiently expressing HA-RACK1 and Src for
varying time periods with PMA, immunoprecipitated proteins with
anti-Src, and performed immunoblot analysis with anti-RACK1. We
observed that the maximum binding of RACK1 and Src occurred after 15 min of PMA treatment (Fig. 8A,
lanes 2-5 and 7). Again, immunoblot
analysis with anti-Src revealed that similar amounts of Src protein
were present in all Src immunoprecipitates (lanes
9-14). Likewise, immunoblot analysis of lysate proteins with anti-RACK1 revealed that similar amounts of RACK1 protein were
expressed in all cells (lanes 15-20). RACK1 was
not detected in IgG immunoprecipitates of PMA-treated cells (Fig.
8B, lane 9). Moreover, when we
co-expressed Src and a RACK1 mutant (Y246F) that does not bind Src, we
did not detect RACK1 in Src immunoprecipitates of PMA-treated cells
(Fig. 8B, lane 8). The effect of PMA
on the RACK1-Src interaction was concentration-dependent,
with the maximal effect achieved with 10 ng/ml (data not shown; Refs.
35 and 36). Together, these results showed that the effect of PMA on the interaction of RACK1 and Src is both time- and
dose-dependent.

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of PKC inhibitors on PMA-induced
tyrosine phosphorylation of RACK1 and binding of RACK1 to Src.
A, CHO cells were transiently transfected with HA-RACK1 and
Src, and serum-starved as described in the legend to Fig. 6. Cells were
left untreated (0), treated for varying time periods with
PMA (10 ng/ml) or pre-treated with the PKC inhibitor GF109203X (0.1 µM; +) for 30 min prior to treatment with PMA for 15 min
(lanes 6, 13, and 19).
Proteins were immunoprecipitated with anti-Src (lanes
2-7 and 9-14) from RIPA lysate containing 100 µg of total cellular protein and subjected to immunoblot analysis
with anti-RACK1 (top panel) or with anti-Src
(middle panel). Lanes 1 and
8, cell lysate containing 5 µg of total cellular protein
was loaded directly on the gel prior to transfer and immunoblot
analysis. Bottom panel, proteins from lysate
containing 5 µg of total cellular protein were subjected to
immunoblot analysis with anti-RACK1. B, CHO cells were
transiently transfected with Src and HA-tagged, wild-type RACK1
(lanes 1-7 and 9) or with Src and
HA-tagged, mutant Y246F RACK1 (lane 8).
Serum-starved cells were left untreated (lane 1),
treated with PMA for 5 min (lane 2) or 15 min
(lanes 3, 6, 8, and
9), or treated with the PKC inhibitor GF109203X (0.1 µM) (lanes 4 and 7) or
chelerythrine (0.1 µM) (lane 5) for
30 min prior to treatment with PMA for 15 min. Proteins were
immunoprecipitated with anti-Src (lanes 1-8) or
mouse IgG (lane 9) from RIPA lysates containing
50 µg of total cellular protein and subjected to immunoblot analysis
with anti-RACK1. C, CHO cells were transiently transfected
with HA-RACK1 and Src, serum-starved and left untreated
(lanes 1, 4, 7, and
10), treated for 15 min with PMA (lanes
2, 5, 8, and 11) or treated
with GF109203X prior to PMA treatment (lanes 3,
6, 9, and 12). Proteins were
immunoprecipitated with anti-phosphotyrosine (lanes
1-3) or anti-Src (lanes 4-6) from
RIPA lysates containing 100 µg of total cellular protein and
subjected to immunoblot analysis with anti-RACK1. Lanes
7-9, the membrane shown in lanes 4-6
was stripped of antibody and re-blotted with anti-Src. Lanes
10-12, proteins from lysate containing 5 µg of total
cellular protein were subjected to immunoblot analysis with anti-RACK1.
Data are representative of at least three independent
experiments.
|
|
To confirm that activation of PKC is necessary for PMA-enhanced binding
of RACK1 and Src, we pre-treated cells with inhibitors of PKC and
analyzed the effect of PMA on the Src-RACK1 interaction (Fig. 8). When
we pre-treated cells with GF109203X (a bisindoylmaleimide I
derivative), at a concentration that inhibits PKC and not Src activity
(0.1 µM; Refs. 40 and 41), we detected little increase in
binding of RACK1 and Src after treating cells with PMA for 15 min (Fig.
8, A (lane 6) and B
(lanes 4 and 7)). Similarly, when we
pre-treated cells with another inhibitor of PKC activity, chelerythrine
(0.1 µM) (10), we observed little enhancement of binding
of RACK1 and Src after treating cells with PMA (Fig. 8B,
lane 5). Treatment of cells with a third PKC
inhibitor, calphostin C (0.1 µM) (10), also blocked the
PMA-induced enhancement of RACK1-Src binding (data not shown). These
results confirmed that PKC activation is required for PMA-enhanced
binding of RACK1 and Src.
To confirm that activation of PKC is necessary for PMA-enhanced
tyrosine phosphorylation of RACK1, we pre-treated cells with inhibitors
of PKC activity prior to PMA treatment, immunoprecipitated proteins
with anti-phosphotyrosine and performed immunoblot analysis with
anti-RACK1 (Fig. 8C). As we observed previously, PMA
treatment for 15 min resulted in a marked increase in tyrosine
phosphorylation of RACK1 (compare lanes 1 and
2). When we pre-treated cells with the PKC inhibitor
GF109203X (0.1 µM) prior to PMA treatment, we did not
detect an increase in tyrosine phosphorylation of RACK1 (lane 3). Similar results were seen with other
PKC inhibitors (data not shown). As we showed previously, PMA treatment
increased binding of Src and RACK1 (compare lanes
4 and 5), whereas pretreatment with GF109203X did
not (lane 6). When the blot shown in
lanes 4-6 was stripped of antibody and re-probed
with Src antibody, we observed that Src protein levels were equivalent
in all Src immunoprecipitates (lanes 7-9).
Immunoblot analyses of lysate proteins with anti-RACK1 showed that
equivalent amounts of RACK1 protein were present in all lysates
(lanes 10-12). These results confirmed that PKC
activation is required for PMA-enhanced tyrosine phosphorylation of
RACK1 and binding of RACK1 to Src.
In a complementary approach to analyze the effect of PMA on the
interaction of RACK1 and Src, we treated serum-starved, NIH 3T3 cells
that were stably overexpressing c-Src (6) with PMA (10 ng/ml) for
varying time periods and localized Src and RACK1 using confocal
immunofluorescence microscopy (Fig. 9).
In quiescent cells (row 1), we observed both Src
(column 1) and RACK1 (column 2) in the cytoplasm (particularly in the perinuclear region)
but there was little colocalization of the two proteins:
yellow regions in the double immunofluorescent-labeled cells
(column 3), and white regions in the
computer-generated images of the double immunofluorescent-labeled cells
(column 4). After treatment of cells with PMA for
2 (row 2) or 5 (row 3) min,
a subpopulation of Src molecules (column 1)
translocated to the cell periphery (presumably to the plasma membrane),
whereas most RACK1 molecules (column 2) remained
more centrally located. After treatment of cells with PMA for 10 min (rows 4 and 5), a subpopulation of
RACK1 molecules translocated to the cell periphery (column
2) and appeared to colocalize with Src: yellow
regions in the double immunofluorescent-labeled cells (column 3), and white regions in the
computer-generated images of the double immunofluorescent-labeled cells
(column 4). These findings are internally
consistent with those of our biochemical studies; both show that PMA
stimulation enhances the association of RACK1 and Src. In addition, the
immunofluorescence studies suggested that the association of the two
proteins occurs at the cell periphery, presumably at the plasma
membrane.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 9.
Localization of Src and RACK1 in cells
following treatment with PMA. NIH 3T3 cells stably overexpressing
Src were maintained in media containing 0.5% serum for 72 h and treated with PMA (10 ng/ml) for 2 (row 2),
5 (row 3), or 10 (rows
4-6) min, or left untreated (row 1).
Cells were fixed in 3.7% paraformaldehyde, permeabilized in 0.4%
Triton X-100, and incubated with primary antibodies (anti-Src and
anti-RACK1) for 60 min before adding secondary antibodies
(FITC-conjugated goat anti-mouse IgG and rhodamine-conjugated goat
anti-mouse IgM) for 40 min. Stained proteins were visualized by
confocal microscopy using 400× or 100× (low) magnification, and using
the FITC (column 1), rhodamine (column
2), or both (column 3) filters.
Composite (column 4), computer-generated images
of the double immunofluorescent-labeled cells (anti-Src and anti-RACK1)
shown in column 3. C, cells incubated
with secondary antibodies alone. Data are representative of three
independent experiments.
|
|
 |
DISCUSSION |
This study shows that RACK1 interacts with the SH2 domain of Src
and several other intracellular signaling molecules. The Src-RACK1
interaction is mediated, at least in part, by the SH2 domain of Src and
by phosphotyrosines in the sixth WD repeat of RACK1, and is enhanced by
PKC activation and tyrosine phosphorylation of RACK1.
Evidence that RACK1 interacts with the SH2 domains of multiple
signaling molecules in vitro is that GST fusions containing an SH2 domain of Src, PLC
1, or rasGAP bind to RACK1 from HeLa cell
lysate (Fig. 1). Evidence that the Src-RACK1 interaction is mediated by
the SH2 domain of Src in vivo is that a Src mutant, which
contains a 3-amino acid deletion in the phosphotyrosine-binding pocket
of the SH2 domain (dl155), does not bind to RACK1 (Fig. 2). In
addition, in vitro studies show that RACK1 binds to a Src mutant that contains an intact SH2 domain and has an 80-amino acid
deletion in the SH3 domain, yet does not bind to dl155 Src (data not
shown), indicating that it is specifically the SH2 and not the SH3
domain that mediates Src's interaction with RACK1. Evidence that the
Src-RACK1 interaction is mediated by phosphotyrosines in the sixth WD
repeat of RACK1 is that a phosphopeptide corresponding to the sequence
surrounding Tyr-246 or Tyr-228 can compete with RACK1 from HeLa cell
lysate for binding to GST-Src-SH2 (Fig. 4), and that a mutant of RACK1
that contains a phenylalanine substitution for tyrosine at residue 246 does not bind Src (Fig. 5). Evidence that the Src-RACK1 interaction is
enhanced by tyrosine phosphorylation of RACK1 is that: 1)
phosphorylation of RACK1 on tyrosine by Src in an in vitro
kinase assay increases binding of RACK1 to Src, and phosphatase
treatment of the tyrosine-phosphorylated RACK1 decreases binding (Fig.
3B); 2) phosphatase treatment of endogenous RACK1 decreases
tyrosine phosphorylation of RACK1 and binding of RACK1 to Src (Fig.
3C); and 3) treatment of cells with agents that enhance the
tyrosine phosphorylation of RACK1 (serum, PDGF, or PMA) also enhance
the binding of RACK1 to Src (Figs. 6-8). Finally, evidence that the
Src-RACK1 interaction is enhanced by PKC activation is that treatment
of cells with specific activators of PKC increases the association of
RACK1 and Src (as shown by both biochemical and immunofluorescence
studies; Figs. 8 and 9, respectively), and pre-treatment of cells with
specific inhibitors of PKC decreases the association (Fig. 8).
Although RACK1 has been reported to interact with the PKC family of
serine/threonine kinases (reviewed in Refs. 9-11), this is the first
report of RACK1 interacting with a tyrosine kinase and of RACK1 being
tyrosine-phosphorylated. Moreover, although serine/threonine
phosphorylation of members of the WD repeat family of proteins has been
observed (42), to the best of our knowledge, this is the first report
of tyrosine phosphorylation of a member of this family. We believe that
tyrosine phosphorylation of RACK1 and other WD repeat proteins may be
important "switches" that link these molecules to other signaling
molecules and relays signals across multiple pathways. Because each WD
repeat protein contains multiple WD domains and multiple tyrosines, the
"switches" may be many, and the signals may be amplified and diverse.
A clear correlation exists between enhanced tyrosine phosphorylation of
RACK1 and enhanced binding of RACK1 to Src (Figs. 3, 4, and 6). Thus,
it is tempting to suggest that the two are linked, that RACK1 is a
substrate for the Src tyrosine kinase, and that signals (like PKC or
PDGFR activation) which bring Src and RACK1 in close proximity to each
other result in phosphorylation of RACK1 by Src and, in turn, enhanced
binding of RACK1 to Src's SH2 domain. However, Src is only one of many
tyrosine kinases that could potentially phosphorylate RACK1 in cells,
and factors in addition to tyrosine phosphorylation of RACK1 may
regulate the interaction of RACK1 and Src. Nonetheless, we believe that both tyrosine phosphorylation of RACK1, and the interaction of Src and
RACK1 are important mechanisms of signal transduction in cells.
Our finding that the intracellular localization of RACK1 in NIH 3T3
cells changes in response to PKC activation (moving from a perinuclear
to another intracellular site; Fig. 9) confirms recent findings of Ron
et al. (15). Moreover, our finding that PKC activation
induces the co-localization of RACK1 and Src (Figs. 6, 8, and 9) is
similar to the finding of Ron and co-workers that PKC activation
induces the co-localization of RACK1 and
IIPKC. Together, these
findings suggest that RACK1 is involved in the intracellular
trafficking of protein kinases from one intracellular site to another,
perhaps bringing the enzymes into close proximity with their specific substrates.
RACK1 has been shown to interact with at least six different proteins:
PKC (16), PLC-
1 (43), Src (8), integrin
subunit (44),
cAMP-specific phosphodiesterase PDE4D5 isoform (45), and p65
synaptotagmin (46). The interaction of RACK1 and PKC, Src, or integrin
subunit is inducible by PMA treatment (44), and in the case of Src
and PKC, specifically by PKC activation. PKC activation appears to
occur before RACK1 binds to Src because blocking PKC activation
prevents most binding. PKC activation may induce a post-translational
modification of RACK1 (other than serine/threonine phosphorylation)
that allows RACK1 to interact with other signaling proteins. Here we
report that one modification induced, indirectly, by PKC activation is
tyrosine phosphorylation of RACK1 (Figs. 6 and 8). Others have shown
that PMA stimulation results in tyrosine phosphorylation of several
proteins including Shc and ErbB2 (35). Perhaps PKC activation brings
RACK1 and other signaling proteins into close proximity with tyrosine
kinases. Here we show that Src is one tyrosine kinase that associates
with RACK1 following PKC activation (Figs. 6, 8, and 9). Alternatively, PKC activation may induce a conformational change in RACK1 that exposes
an otherwise inaccessible tyrosine for phosphorylation. Because PKC
does not directly phosphorylate RACK1 (16), the simplest explanation
for how activated PKC might induce a conformational change in RACK1 is
by directly binding to RACK1. Whether activated PKC is required to bind
RACK1 before and/or in order that Src or integrin
subunit bind
RACK1, is unknown (see below).
Interestingly, Src, PLC-
1, and rasGAP are all known to associate via
their SH2 domains with the PDGFR following PDGF stimulation (18, 39).
Here we report that Src, PLC-
1, and rasGAP also associate via their
SH2 domains (at least in vitro) with RACK1 from HeLa cell
lysate (Fig. 1) and that PDGF treatment of cells enhances both the
tyrosine phosphorylation of RACK1 and the binding of RACK1 to Src (Fig.
7). This suggests intriguing similarities, and possibly a link between
PDGFR and RACK1 signaling; perhaps RACK1 in involved in the
recruitment, assembly, and/or regulation of signaling molecules at the
PDGFR following PDGF stimulation. Here we show that RACK1 interacts
with the SH2 domains of some signaling proteins (Fig. 1). Rodriquez
et al. (47) have shown that RACK1 interacts with the
pleckstrin homology domain of other signaling proteins.
Overall, RACK1 appears to serve as a scaffold, anchor, or adaptor
protein that is involved in the recruitment, assembly, and/or regulation of a variety of different signaling molecules (48). In the
case of the PKC and Src protein kinases, RACK1 may help to recruit
substrates or regulatory proteins and/or to stabilize the kinases in
protein complexes. Examples of other proteins that work in similar ways
include protein kinase A-anchoring proteins which interact with PKC,
protein kinase A, and protein phosphatase 2B (49).
Of the large family of WD repeat proteins to which RACK1 belongs, RACK1
most closely resembles G
subunit, which interacts with the
-adrenergic receptor kinase, and like RACK1, has seven WD repeats
(50, 51). (Interestingly,
-adrenergic receptor kinase associates
with Src after stimulation of
-arrestin (52, 53).) Although the
crystal structure of RACK1 has not been determined, it is very likely
similar to that of G
subunit (54). G
folds into a symmetric
"propeller" structure with seven "propeller blades," each
corresponding to one of the seven WD repeats (reviewed in Refs. 12, 13,
and 55). The blades of the propeller are thought to be the sites of
interaction of G
subunit with other proteins. Each blade may be
specialized for interacting with specific proteins. Moreover, there is
an insert of 3 amino acids into repeat 6 of G
that helps generate a
very hydrophobic region that runs from the top of the propeller down
the side of blades 5 and 6 (12, 13, 55). This hydrophobic region is
thought to be a potential binding site for an interacting protein(s)
(reviewed in Ref. 55). Interestingly, repeat 6 of RACK1 is known to
contain, at least in part, the binding site for both Src (Figs. 4 and
5) and PKC (16, 56). Thus, specific regions of RACK1 may serve as
common "docking sites" for various intracellular signaling
molecules. Whether different signaling proteins compete with each other
for binding to the same site on one RACK1 molecule, bind near each other on the same RACK1 molecule, or bind to different RACK1 molecules but at the same site, is unknown. Because RACK1 is far more abundant in
cells than are the Src or PKC protein kinases, the kinases are not
obligated to compete with each other on an "either/or" basis or
even to share a common "docking site" on the same RACK1 molecule.
However, our preliminary studies suggest that
IIPKC may interact
with RACK1 and Src in a trimolecular
complex.2 Interestingly, Ron
et al. (57) showed recently that
PKC associates with, and
is phosphorylated by the Src-related kinase
p59fyn in T cells. Similarly, PKC
associates
with, and is phosphorylated by, v-Src in v-Src-transformed cells (58,
59). Thus, PKCs, Src kinases, and RACK1 may interact cooperatively in
signaling pathways.
Our mutational analyses of RACK1 suggested that phosphotyrosine 246 mediates the interaction of RACK1 with Src's SH2 domain (Fig. 5). Our
results from the peptide competition assays, showing that the
phosphorylated Tyr-246 peptide inhibited binding (relative to the
unphosphorylated control peptide) of lysate RACK1 to GST-Src-SH2 (Fig.
4), were internally consistent with results from the mutant RACK1
binding assays. Surprisingly, though, the presence of the unphosphorylated Tyr-246 peptide enhanced binding of lysate RACK1 to
GST-Src-SH2. One possible explanation for this is that the Tyr-246
peptides interact with RACK1 in such a way as to increase the
accessibility of the Src SH2-binding site. Another possible explanation
is that the Tyr-246 peptides remove or displace a RACK1 binding protein
that is partially covering the Src-SH2 binding site. Nonetheless, there
is relatively less binding of RACK1 to GST-Src-SH2 in the presence of
the phosphorylated than the unphosphorylated Tyr-246 peptide,
indicating that the tyrosine-phosphorylated Tyr-246 peptide competes
with RACK1 for binding to GST-Src-SH2.
Introducing a phenylalanine substitution for tyrosine at residue 228 in
RACK1 did not affect the ability of RACK1 to interact with Src (Fig.
5). However, a phosphorylated Tyr-228 peptide inhibited binding of
lysate RACK1 to GST-Src-SH2 in phosphopeptide competition assays (Fig.
4). One possible explanation for the discrepancy between these results
is that either Tyr-246 or Tyr-228 of RACK1, if phosphorylated, can
mediate the interaction with Src's SH2 domain, but normally only
Tyr-246 is phosphorylated in cells. Another possibility is that
phosphotyrosine 228 represents a minor, secondary site on RACK1 for
interacting with Src's SH2 domain. Although the amino acid sequences
flanking Tyr-228 and Tyr-246 of RACK1 are not predicted to be those
most likely to interact with Src's SH2 domain (19, 60, 61), they are
highly conserved evolutionarily from Neurospora to human
(62).
Our findings that PLC-
1 interacts with RACK1 in vitro
(Fig. 1) confirm previous observations of other investigators (43) and
provide new observations about the RACK1 binding site on PLC-
1. PLC-
1 contains a region homologous to the C2 region of PKC, which is
known to mediate, in part, the binding of PKCs to RACKs (43). Thus, a
previous hypothesis was that the C2 region of PLC-
1 might, like the
C2 region of PKC, contain part of the RACK1 binding site (43). We found
that the N-terminal SH2 domain of PLC-
1 mediates, at least in part,
the interaction of PLC-
1 and RACK1 in vitro (Fig. 1). It
is possible that there are regions of PLC-
1 in addition to the SH2
domain (such as the C2 domain) that also mediate the binding of
PLC-
1 to RACK1.
In summary, we have shown that RACK1 interacts with the SH2 domain of
Src and several other intracellular signaling molecules. In the case of
Src, binding is mediated by phosphotyrosines in the sixth WD repeat of
RACK1, and enhanced by PKC activation and by tyrosine phosphorylation
of RACK1. We believe that tyrosine-phosphorylated RACK1 plays an
important role in protein-protein interactions and signal transduction
pathways, perhaps by serving as a scaffold, anchor, or adaptor protein
that helps to recruit, assemble, and/or regulate signaling molecules.
 |
ACKNOWLEDGEMENTS |
We thank Rachel Harte for assistance with
data analysis and figure preparation. We thank Lewis Cantley for pGEX
plasmids containing the SH2 domains of PLC
, Shp-1, Shp-2, p85, Abl,
Grb2, rasGAP, Csk, and Shc; Sara Courtneidge for NIH 3T3 cells
overexpressing the PDGFR; Sarah Parsons for pM5Hc-src and
pMdl155c-src; Tony Hunter for pGEMsrc; and Anson
Lowe for antibodies to GST. We are grateful to Rosemary Fernandez and
Gary Schoolnik for synthesis and purification of RACK1 peptides and
phosphopeptides (Protein Structure Core Facility, Stanford Digestive
Disease Center), and Evelyn Resurreccion, Eugene Butcher, Jou
Tzuu-Shuh, and James Nelson for assistance with immunofluorescence
studies (Cell Biology Core Facility, Stanford Digestive Disease
Center). We thank Daria Mochly-Rosen, Anson Lowe, and Bishr Omary for
critical review of the data and Daria Mochly-Rosen for critical review
of the manuscript.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant R01 DK43743 (to C. A. C.) and National Research Service Award CA69810 (to B. Y. C.).
To whom correspondence should be addressed: CCSR Bldg., Rm. 3115C,
269 Campus Dr., Stanford University School of Medicine, Stanford, CA
94305-5187. Tel.: 650-725-8464; Fax: 650-723-5488; E-mail:
chris.cartwright@stanford.edu.
Published, JBC Papers in Press, March 8, 2001, DOI 10.1074/jbc.M101375200
2
B. Y. Chang and C. A. Cartwright,
unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
RACK, receptor for activated protein kinase C;
PKC, protein kinase C;
SH2, Src homology 2;
SH3, Src homology 3;
WD, tryptophan-aspartic acid;
PDGF, platelet-derived growth factor;
PDGFR, platelet-derived growth
factor receptor;
DMEM, Dulbecco's modified Eagle medium;
mAb, monoclonal antibody;
TBS, Tris-buffered saline;
PBS, phosphate-buffered
saline;
FBS, fetal bovine serum;
GST, glutathione
S-transferase;
PMA, phorbol-12-myristate-13-acetate;
BSA, bovine serum albumin;
HA, hemagglutinin;
FITC, fluorescein
isothiocyanate;
PAGE, polyacrylamide gel electrophoresis;
GAP, GTPase-activating protein;
CHO, CHinese hamster ovary;
RIPA, radioimmunoprecipitation assay;
PLC, phospholipase C;
HPLC, high
performance liquid chromatography.