JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.C100140200 on April 24, 2001

J. Biol. Chem., Vol. 276, Issue 24, 20809-20812, June 15, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/24/20809    most recent
C100140200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dohadwala, M.
Right arrow Articles by Dubinett, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dohadwala, M.
Right arrow Articles by Dubinett, S. M.

ACCELERATED PUBLICATION
Non-small Cell Lung Cancer Cyclooxygenase-2-dependent Invasion Is Mediated by CD44*

Mariam DohadwalaDagger , Jie LuoDagger , Li ZhuDagger , Ying LinDagger , Graeme J. Dougherty§, Sherven SharmaDagger , Min Huang, Mehis PõldDagger , Raj K. BatraDagger , and Steven M. DubinettDagger ||**

From the || Lung Cancer Research Program of the UCLA Jonsson Comprehensive Cancer Center and the Dagger  Division of Pulmonary and Critical Care Medicine, Departments of Medicine and § Radiation Oncology, UCLA, School of Medicine, and the  Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles California 90095-1690

Received for publication, March 23, 2001, and in revised form, April 23, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Elevated tumor cyclooxygenase (COX-2) expression is associated with increased angiogenesis, tumor invasion, and suppression of host immunity. We have previously shown that genetic inhibition of tumor COX-2 expression reverses the immunosuppression induced by non-small cell lung cancer (NSCLC). To assess the impact of COX-2 expression in lung cancer invasiveness, NSCLC cell lines were transduced with a retroviral vector expressing the human COX-2 cDNA in the sense (COX-2-S) and antisense (COX-2-AS) orientations. COX-2-S clones expressed significantly more COX-2 protein, produced 10-fold more prostaglandin E2, and demonstrated an enhanced invasive capacity compared with control vector-transduced or parental cells. CD44, the cell surface receptor for hyaluronate, was overexpressed in COX-2-S cells, and specific blockade of CD44 significantly decreased tumor cell invasion. In contrast, COX-2-AS clones had a very limited capacity for invasion and showed diminished expression of CD44. These findings suggest that a COX-2-mediated, CD44-dependent pathway is operative in NSCLC invasion. Because tumor COX-2 expression appears to have a multifaceted role in conferring the malignant phenotype, COX-2 may be an important target for gene or pharmacologic therapy in NSCLC.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cyclooxygenase (also referred to as prostaglandin endoperoxidase or prostaglandin G/H synthase) is the rate-limiting enzyme for the production of prostaglandins (PGs)1 and thromboxanes from free arachidonic acid (1). The enzyme is bifunctional, with fatty acid cyclooxygenase (producing PGG2 from arachidonic acid) and PG hydroperoxidase activities (converting PGG2 to PGH2). Two forms of cyclooxygenase (COX) have now been described: a constitutively expressed enzyme, COX-1, present in most cells and tissues, and an inducible isoenzyme, COX-2 (also referred to as PGS-2), expressed in response to cytokines, growth factors, and other stimuli (1-4). COX-2 has been reported to be constitutively overexpressed in a variety of malignancies (4-11); we and others have reported that COX-2 is frequently constitutively elevated in human NSCLC (12-16). Previous studies indicate that overexpression of tumor COX-2 may be important in tumor invasion (17, 18), angiogenesis (19, 20), resistance to apoptosis (21-23), and suppression of host immunity (13, 24). Our current studies focus on the role of tumor COX-2 expression in modulating NSCLC invasion.

Tumor metastasis is a complex series of events in which cells migrate beyond tissue compartments and spread to distant organ sites. Cell surface CD44, the receptor for hyaluronate, has an important role in regulating tumor growth and metastasis because it mediates cellular adhesion to extracellular matrix, which is prerequisite for tumor cell migration (25, 26).

While COX-2 expression has previously been linked to enhanced matrix metalloproteinase (MMP) expression and invasion (27), the role of CD44 in this COX-2-induced invasion has not been defined. Here, we report that stable overexpression of COX-2 in NSCLC results in up-regulation of CD44. Furthermore, we demonstrate a CD44-dependent increase in invasion in Matrigel matrix assays. In contrast, abrogation of tumor-COX-2 expression results in decreased PGE2 production, diminished CD44 expression and decreased invasion. This is the first report documenting the critical role of tumor COX-2 expression in the regulation of CD44-dependent invasion by human NSCLC.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Transfection Protocol-- A 2.0-kilobase pair cDNA fragment of human COX-2 (generously provided by Dr. Harvey Herschman, UCLA) was cloned into the PmeI site of the retroviral vector pLNCX (CLONTECH, Palo Alto, CA). In this vector, transcription of the COX-2 cDNA is controlled by the cytomegalovirus promoter, and transduced cells can be enriched under G418 selection. Sense (COX-2-S) and antisense (COX-2-AS) oriented expression vectors were prepared. A549 (human lung adenocarcinoma) and H157 (squamous cell carcinoma) cells were obtained from American Type Culture Collection (ATCC, Manassas, VA) and the National Cancer Institute, respectively. Tumor cells were transfected with COX-2-S, COX-2-AS-expressing vectors, or pLNCX (vector alone) using calcium-phosphate-mediated transfection (Promega, Madison, WI). The transfected cells were grown in an atmosphere of 5% CO2 in air at 37 °C in cell culture medium consisting of RPMI 1640 (Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (Gemini Biological Products, Calabasas, CA), 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 2 mM glutamine (Life Technologies, Inc.). For selection, the medium also contained 0.5 mg/ml active G418 (Life Technologies, Inc.). Following G418 selection, the polymerase chain reaction (PCR) was used to confirm the positive COX-2-S and COX-2-AS clones. The PCR was done using the pLNCX 5' primer (AGCTTCGTTTAGTGAACCTCAGATCG) and pLNCX 3' primer (ACCTACAGGTGGGGTCTTTCATTCCC). PCR positive clones were then screened by Western blot and EIA analysis for COX-2 expression and PGE2 production, respectively. For each tumor cell line a high COX-2-expressing and PGE2-producing clone for COX-2-S, and a low COX-2-expressing and PGE2-producing COX-2-AS clone, were identified from a survey of 25 clones. These clones were then expanded for further studies.

Measurement of Prostaglandin E2-- Control, COX-2-S, and COX-2-AS cells (A549 and H157) were stimulated with IL-1beta (200 units/ml, Genzyme, Cambridge, MA) for 24 h. PGE2 concentration in each group (with or without IL-1beta stimulation) were measured by EIA using a PGE2 EIA kit (Cayman Chemical, Ann Arbor, MI) as reported previously (28). All measurements were made in triplicate and repeated in at least three separate experiments.

Western Blot Analysis for COX-2 and CD44 Expression-- The cells from each treatment group were lysed at 4 °C for 15 min in lysis buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 0.6% Nonidet P-40). The cell lysates were centrifuged at 13,000 rpm for 10 min and the supernatant collected. Total protein was measured with a protein assay reagent (Bio-Rad), and 20 µg of cell lysate protein were separated on 10% SDS-polyacrylamide gels. Following separation, the proteins were transferred to Hybond nitrocellulose membranes (Amersham Pharmacia Biotech) and the filters probed with anti-human COX-2 antibody (Cayman Chemical). For CD44 detection, the filters were probed with anti-human CD44 antibody 4A4 (29). The membranes were developed by the ECL chemiluminescence system (Amersham Pharmacia Biotech) and exposed to x-ray film (Fujifilm, Fuji Medical Systems Inc., Stamford, CT). Equal loading of samples was confirmed by probing the membranes with beta -actin antibody.

Invasion Assay-- To quantify invasion, the membrane invasion assay was carried out in Matrigel-coated invasion chambers (Becton Dickinson Labware, Franklin Lakes, NJ). Control and COX-2 transfectants were cultured in RPMI 1640 supplemented with 10% fetal bovine serum. Tumor cells in log phase growth were detached by trypsin-EDTA (Mediatech) and resuspended in RPMI 1640 with 0.1% bovine serum albumin. Serum-free A549- and H157-conditioned medium was obtained by incubation of these cells for 24 h. This tumor cell-conditioned medium was added in the lower chamber as a chemoattractant, and the resuspended cells (5 × 104) were plated in the upper chamber. Following 18-h incubation at 37 °C in a humidified 5% CO2 atmosphere, the cells in the upper chamber and on the Matrigel were mechanically removed with a cotton swab. The cells adherent to the outer surface of the membrane were fixed with methanol and stained with hematoxylin/eosin. The invading cells were examined, counted, and photographed by microscopy (Nikon Labphot-2 Microscope with an attached Spot Digital Camera, A. G. Heinz, Lake Forest, CA) at × 50 magnification. Six fields were counted per filter in each group, and the experiment was repeated five separate times. To assess the role of CD44 in mediating Matrigel invasion, the cells from COX-2-S-expressing clones were plated in the presence of 500 ng of anti-CD44 antibody (The Binding Site, Inc., San Diego, CA) or control mouse IgG (Dako Corp., Carpenteria, CA) and the cell numbers determined as described.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression of COX-2 and PGE2 Production in COX-2-transduced NSCLC Cells-- To evaluate the role of COX-2 expression in mediating the lung cancer invasiveness, two NSCLC cell lines were stably transduced with a retroviral vector encoding COX-2 and selected for G418 resistance. The COX-2-S clones (A549-S and H157-S) exhibited enhanced constitutive COX-2 protein expression by immunoblot (Fig. 1, A and B). In contrast, COX-2 was not detectable in COX-2-AS clones (Fig. 1, A and B). The COX-2 protein expression in the sense clones was found to be significantly higher (3-fold for H157 and 10-fold for A549 cells), as measured by densitometry, than that of parental or vector-transduced cells (data not shown). Compared with parental and vector-transduced cells, COX-2-S clones (H157-S and A549-S) exhibited a 5-12-fold increase in PGE2 production. In contrast, COX-2-AS clones showed decreased constitutive PGE2 production (Fig. 2, A and B). IL-1beta is one of several cytokines known to potently up-regulate COX-2 expression in a variety of cells (30). Consistent with our previous findings (28), parental and vector-transduced control cells exhibited a 5-10-fold increase in PGE2 production in response to IL-1beta (Fig. 2, A and B). In contrast, a similar induction of PGE2 secretion was not observed in COX-2-AS clones in the presence of IL-1beta (Fig. 2, A and B).


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1.   Elevated COX-2 expression in COX-2 modified NSCLC cells. NSCLC cells (parental (P), empty vector (V), COX-2-S (S), and COX-2-AS (AS) transfectants) were cultured in the presence or absence of IL-1beta (280 units/ml) for 24 h. Following incubation, 20 µg of cell lysate was fractionated on a 10% SDS-PAGE gel and transferred to nitrocellulose membranes and probed with COX-2-specific antibody A, A549 cells. COX-2-S (S) exhibits enhanced constitutive COX-2 protein, while COX-2-AS shows decreased protein production compared with controls (parental and vector). Increase in COX-2 expression in response to IL-1beta was only observed in control (parental and vector) but not in COX-2-S or COX-2-AS cells. B, H157 cells. COX-2-S cells exhibit COX-2 protein expression pattern that is similar to the A549 cells. Equal loading of cell lysate was confirmed with anti-beta -actin antibody.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 2.   Increased PGE2 production in COX-2 modified NSCLC cells. NSCLC cells (106 cells/ml of parental (P), empty vector (V), COX-2-S (S), and COX-2-AS (AS) transfectants) were cultured in complete medium with and without IL-1beta (280 units/ml). Following a 24-h incubation the supernatants were collected for PGE2 determination by enzyme immunoassay. A, A549 cells. Compared with parental and vector controls a 10-fold increase in constitutive PGE2 production is seen in COX-2-S cells (p < 0.01), while an inhibition of PGE2 production is seen in COX-2-AS cells (p < 0.05). B, H157 cells. Compared with parental and vector a 5-fold increase in constitutive PGE2 production is seen in COX-2-S cells (p < 0.05), while an inhibition of PGE2 production is seen in COX-2-AS cells (p < 0.05). In response to IL-1beta , increase in PGE2 production is seen in parental and vector control of both cell lines. The PGE2 EIA results are expressed as ng/ml/106 cells/24 h and are representative of four experiments performed in duplicate. Bars, S.E.

Overexpression of COX-2 Enhances the Invasive Capacity of NSCLC Cells-- COX-2 overexpression may be associated with enhanced invasiveness and metastasis in a variety of malignancies (27, 31). To examine its role in NSCLC, we tested cells overexpressing COX-2 in Matrigel matrix invasion assays. As depicted in Fig. 3A, COX-2-S cells were significantly more invasive than parental or antisense-transfected A549 and H157 cells. The invasiveness was found to be similar for both of the COX-2-S cell lines. By counting cells in random microscopic fields, we determined that the sense clones of both A549 and H157 were 3-fold more invasive than parental or vector-transfected controls (Fig. 3B). Furthermore, consistent with their undetectable COX-2 expression, COX-2-AS cells demonstrated a decreased invasiveness through Matrigel (Fig. 3, A and B).


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 3.   COX-2-S-modified NSCLC cells demonstrate enhanced invasive capacity. NSCLC cells (parental (P), empty vector (V), COX-2-S (S), and COX-2-AS (AS) transfectants) were used for Matrigel matrix assay. A, left panel, A549; right panel, H157. Significantly more COX-2-S cells invaded the matrix, while COX-2-AS cells showed decreased invasion compared with parental and vector. Anti-CD44 monoclonal antibody, but not control antibody, blocked the enhanced invasion of COX-2-S cells in both cell lines. B and C, bar graphs representing the number of cells that invaded in each group. A 3-fold increase in number of cells invading the matrix is seen in COX-2-S cells: B, A549 (p < 0.05) and C, H157 (p < 0.05).

NSCLC COX-2-dependent Invasion Is Mediated through CD44 Expression-- Because tumor CD44 expression is known to play an important role in tumor invasion and metastasis (26, 32), we hypothesized that CD44 expression may be important for NSCLC COX-2-dependent invasion. Indeed, CD44 expression was augmented in COX-2-S clones as determined by Western blot analysis (Fig. 4, A and B). In contrast, CD44 was not detectable in COX-2-AS cells (Fig. 4, A and B). Consistent with the expression of COX-2 and PGE2 production, CD44 expression was also found to be up-regulated in parental tumor cells in the presence of IL-1beta . This suggested that related signaling events could be mediating increased COX-2 and CD44 expression in NSCLC. Because IL-1beta could not induce COX-2 activity or CD44 expression in the COX-2-AS transfectants, COX-2 appears to be a proximal regulator of CD44 expression in NSCLC.


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 4.   CD44 expression is up-regulated in COX-2-S-modified NSCLC cells. The cell lysates from NSCLC cells (parental (P), empty vector (V), COX-2-S (S), and COX-2-AS (AS) transfectants) in the presence or absence of IL-1beta were produced, and 20 µg of lysate was fractionated on a 10% SDS-PAGE gel. CD44-specific monoclonal antibody was used to probe the membranes. An increase in CD44 protein is seen in COX-2-S, while a decrease in CD44 protein is seen in COX-2-AS. A, A549 cells. In response to IL-1beta , significant increase in CD44 protein was seen in parental, vector, and COX-2-S cells. B, H157 cells. Increase in CD44 protein was observed in parental, vector, and COX-2-S cells but not in COX-2-AS cells. Equal loading of cell lysate was confirmed with anti-beta -actin antibody.

Consistent with the findings of Western blot analysis, FACS analysis of the COX-2 transfected cells with a fluorescein isothiocyanate-labeled CD44 antibody showed an increase in the expression of CD44 in COX-2-S but decreased expression in COX-2-AS cells (data not shown). To determine the importance of CD44 expression in tumor COX-2-dependent invasion, we performed antibody blocking experiments with anti-CD44 antibody. The enhanced invasiveness of the COX-2-S clones was found to be inhibited with anti-CD44 antibody, whereas control monoclonal antibody had no effect (Fig. 3, A and B). Anti-CD44 antibody did not completely decrease COX-2-S invasion to the level of COX-2-AS cells, suggesting that CD44-independent mechanisms may also be operative.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mounting evidence from several studies indicates that tumor COX-2 activity has a multifaceted role in conferring the malignant and metastatic phenotypes. The data in the current study implicates COX-2 overexpression as a proximal mediator of CD44-dependent invasion in human NSCLC. We demonstrate that augmenting COX-2 expression leads to increased invasion by NSCLC cells. Importantly, this enhanced invasion is associated with increased CD44 expression, and blocking CD44 abrogates the COX-2-mediated enhancement of NSCLC cell mobilization through Matrigel.

Although multiple genetic alterations are necessary for lung cancer invasion and metastasis, COX-2 may be a central element in orchestrating this process (13-17). Studies indicate that overexpression of COX-2 is associated with apoptosis resistance (21-23, 33), angiogenesis (19, 20, 23, 34), decreased host immunity (13, 24), and enhanced invasion and metastasis (27). We reported previously that COX-2 is overexpressed in human NSCLC and the resultant high level PGE2 production-mediated dysregulation of host immunity by altering the balance of interleukins 10 and 12 (13). Indeed, specific inhibition of COX-2 led to significant in vivo tumor reduction in murine lung cancer models (24). Recently, other studies have corroborated and expanded on our initial findings documenting the importance of COX-2 expression in lung cancer (12, 14-16, 35, 36). COX-2 activity can be detected throughout the progression of a premalignant lesion to the metastatic phenotype (14). Markedly higher COX-2 expression was observed in lung cancer lymph node metastasis compared with primary adenocarcinoma (14). These reports, together with studies documenting an increase in COX-2 expression in precursor lesions (15, 16), suggest the involvement of COX-2 overexpression in the pathogenesis of lung cancer. Epidemiological studies that indicate a decreased incidence of lung cancer in subjects who regularly use aspirin have been interpreted as supporting this hypothesis (37).

In addition to regulating immune responses, tumor COX-2 has been implicated in inhibiting apoptosis (21, 38) and angiogenesis (3, 20). The inhibition of programmed cell death in COX-2-expressing cells is found to be associated with an increase in Bcl2 expression and a decrease in the expression of both the TGF-beta 2 receptor and E-cadherin protein (21). Experimental evidence suggests that ligation of the cell surface matrix adhesion receptor CD44 by anti-CD44 antibody induces cell detachment and triggers apoptosis in a variety of cells (39). Thus, inhibiting anchorage dependence mediated by CD44 may contribute to induction of apoptosis (40).

Overexpression of COX-2 also enhances tumor invasiveness and thus may increase metastatic potential (3, 27). Tumor cell invasion involves the active movement of cells across the extracellular matrix (41). Adhesion to extracellular matrix, a critical initial step in the metastatic process, has been found to be CD44-dependent in several tumors (26, 32, 42, 43). CD44 is a receptor for hyaluronate, a major glycosaminoglycan component of the extracellular matrix. In this capacity, CD44 also serves to induce co-clustering with MMP-9 and can therefore promote MMP-9 activity, tumor invasion, and angiogenesis (25, 44). Our findings indicate that tumor COX-2 overexpression in human NSCLC constitutes an important driving force for CD44 induction. Thus, COX-2 expression may form the basis for an important tumor-induced invasive pathway. The fact that CD44-induced MMP-2 and -9 have the capacity to activate latent TGF-beta suggests an autocrine and paracrine pathway in which collagen deposition and further invasion may be enhanced (44, 45). The activation of latent TFGbeta also provides an additional pathway for tumor-induced immune suppression (44, 46, 47). In addition, recent studies by Sun et al. (48) demonstrate that hyaluronate fragments have the capacity to up-regulate COX-2 by a CD44-dependent pathway. Thus, hyaluronate itself may serve to further enhance tumor COX-2 and CD44 expression leading to maintenance of the COX-2-dependent invasive phenotype.

Lung cancer is the leading cause of cancer death in men and women in the United States (49). Despite therapeutic efforts, 5-year survival in lung cancer patients is less than 15% (50). Defining new molecular targets will lead to more effective therapeutic strategies. Here we document for the first time a pathway whereby COX-2 overexpression leads to CD44-dependent invasion in NSCLC. These findings suggest that therapies targeting COX-2 may diminish the propensity for invasion and metastases in NSCLC.

    FOOTNOTES

* This work was supported by National Institutes of Health Grants 1P50 CA90388, RO1 CA71818, and RO1 CA78654; the American Lung Association; Merit Review Research Funds from the Department of Veterans Affairs; and by the Research Enhancement Award Program in Cancer Gene Medicine.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** To whom correspondence and reprint requests should be addressed: UCLA School of Medicine, 37-131 CHS, 10833 Le Conte Ave., Los Angeles, CA 90095. Tel.: 310-794-6566; Fax: 310-794-9808; E-mail address: sdubinett@mednet.ucla.edu.

Published, JBC Papers in Press, April 24, 2001, DOI 10.1074/jbc.C100140200

    ABBREVIATIONS

The abbreviations used are: PG, prostaglandin; COX, cyclooxygenase; NSCLC, non-small cell lung cancer; MMP, matrix metalloproteinase; PCR, polymerase chain reaction; EIA, enzyme immunoassay; IL, interleukin; TGF, transforming growth factor; PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Herschman, H. (1996) Biochim. Biophy. Acta 1299, 125-140
2. Herschman, H. R. (1994) Cancer Metastasis Rev. 13, 241-256
3. Williams, C. S., Tsujii, M., Reese, J., Dey, S. K., and DuBois, R. N. (2000) J. Clin. Invest. 105, 1589-1594
4. Soslow, R. A., Dannenberg, A. J., Rush, D., Woerner, B. M., Khan, K. N., Masferrer, J., and Koki, A. T. (2000) Cancer 89, 2637-2645
5. Yip-Schneider, M. T., Barnard, D. S., Billings, S. D., Cheng, L., Heilman, D. K., Lin, A., Marshall, S. J., Crowell, P. L., Marshall, M. S., and Sweeney, C. J. (2000) Carcinogenesis 21, 139-146
6. Shao, J., Sheng, H., Inoue, H., Morrow, J. D., and DuBois, R. N. (2000) J. Biol. Chem. 275, 33951-33956
7. Kirschenbaum, A., Klausner, A. P., Lee, R., Unger, P., Yao, S., Liu, X., and Levine, A. C. (2000) Urology 56, 671-676
8. Shamma, A., Yamamoto, H., Doki, Y., Okami, J., Kondo, M., Fujiwara, Y., Yano, M., Inoue, M., Matsuura, N., Shiozaki, H., and Monden, M. (2000) Clin. Cancer Res. 6, 1229-1238
9. Molina, M. A., Sitja-Arnau, M., Lemoine, M. G., Frazier, M. L., and Sinicrope, F. A. (1999) Cancer Res. 59, 4356-4362
10. Chan, G., Boyle, J. O., Yang, E. K., Zhang, F., Sacks, P. G., Shah, J. P., Edelstein, D., Soslow, R. A., Koki, A. T., Woerner, B. M., Masferrer, J. L., and Dannenberg, A. J. (1999) Cancer Res. 59, 991-994
11. Dannenberg, A. J., and Zakim, D. (1999) Semin. Oncol. 26, 499-504
12. Hida, T., Kozaki, K., Muramatsu, H., Masuda, A., Shimizu, S., Mitsudomi, T., Sugiura, T., Ogawa, M., and Takahashi, T. (2000) Clin. Cancer Res. 6, 2006-2011
13. Huang, M., Stolina, M., Sharma, S., Mao, J., Zhu, L., Miller, P., Wollman, J., Herschman, H., and Dubinett, S. (1998) Cancer Res. 58, 1208-1216
14. Hida, T., Yatabe, Y., Achiwa, H., Muramatsu, H., Kozaki, K.-I., Nakamura, S., Ogawa, M., Mitsudomi, T., Sugiura, T., and Takahashi, T. (1998) Cancer Res. 58, 3761-3764
15. Wolff, H., Saukkonen, K., Anttila, S., Karjalainen, A., Vainio, H., and Ristimaki, A. (1998) Cancer Res. 58, 4997-5001
16. Hosomi, Y., Yokose, T., Hirose, Y., Nakajima, R., Nagai, K., Nishiwaki, Y., and Ochiai, A. (2000) Lung Cancer 30, 73-81
17. Achiwa, H., Yatabe, Y., Hida, T., Kuroishi, T., Kozaki, K., Nakamura, S., Ogawa, M., Sugiura, T., Mitsudomi, T., and Takahashi, T. (1999) Clin. Cancer Res. 5, 1001-1005
18. Murata, H., Kawano, S., Tsuji, S., Tsuji, M., Sawaoka, H., Kimura, Y., Shiozaki, H., and Hori, M. (1999) Am. J. Gastroenterol. 94, 451-455
19. Masferrer, J. L., Leahy, K. M., and Koki, A. T. (2000) Curr. Med. Chem. 7, 1163-1170
20. Masferrer, J. L., Leahy, K. M., Koki, A. T., Zweifel, B. S., Settle, S. L., Woerner, B. M., Edwards, D. A., Flickinger, A. G., Moore, R. J., and Seibert, K. (2000) Cancer Res. 60, 1306-1311
21. Tsujii, M., and DuBois, R. (1995) Cell 83, 493-501
22. Ding, X. Z., Tong, W. G., and Adrian, T. E. (2000) Anticancer Res. 20, 2625-2631
23. Liu, X. H., Kirschenbaum, A., Yao, S., Lee, R., Holland, J. F., and Levine, A. C. (2000) J. Urol. 164, 820-825
24. Stolina, M., Sharma, S., Lin, Y., Dohadwala, M., Gardner, B., Luo, J., Zhu, L., Kronenberg, M., Miller, P. W., Portanova, J., Lee, J. C., and Dubinett, S. M. (2000) J. Immunol. 164, 361-370
25. Yu, Q., and Stamenkovic, I. (1999) Genes Dev. 13, 35-48
26. Yu, Q., Toole, B. P., and Stamenkovic, I. (1997) J. Exp. Med. 186, 1985-1996
27. Tsujii, M., Kawano, S., and DuBois, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3336-3340
28. Huang, M., Sharma, S., Mao, J. T., and Dubinett, S. M. (1996) J. Immunol. 157, 5512-5520
29. Droll, A., Dougherty, S. T., Chiu, R. K., Dirks, J. F., McBride, W. H., Cooper, D. L., and Dougherty, G. J. (1995) J. Biol. Chem. 270, 11567-11573
30. Endo, T., Ogushi, F., Sone, S., Ogura, T., Taketani, Y., Hayashi, Y., Ueda, N., and Yamamoto, S. (1995) Am. J. Respir. Cell Mol. Biol. 12, 358-365
31. Ryu, H. S., Chang, K. H., Yang, H. W., Kim, M. S., Kwon, H. C., and Oh, K. S. (2000) Gynecol. Oncol. 76, 320-325
32. Seiter, S., Arch, R., Reber, S., Komitowski, D., Hofmann, M., Ponta, H., Herrlich, P., Matzku, S., and Zoller, M. (1993) J. Exp. Med. 177, 443-455
33. Tanji, N., Kikugawa, T., and Yokoyama, M. (2000) Anticancer Res. 20, 2313-2319
34. Uefuji, K., Ichikura, T., and Mochizuki, H. (2000) Clin. Cancer Res. 6, 135-138
35. Watkins, D. N., Lenzo, J. C., Segal, A., Garlepp, M. J., and Thompson, P. J. (1999) Eur. Respir. J. 14, 412-418
36. Ochiai, M., Oguri, T., Isobe, T., Ishioka, S., and Yamakido, M. (1999) Jpn. J. Cancer Res. 90, 1338-1343
37. Schreinemachers, D. M., and Everson, R. B. (1994) Epidemiology 5, 138-146
38. Hsu, A. L., Ching, T. T., Wang, D. S., Song, X., Rangnekar, V. M., and Chen, C. S. (2000) J. Biol. Chem. 275, 11397-11403
39. Tian, B., Takasu, T., and Henke, C. (2000) Exp. Cell Res. 257, 135-144
40. Formby, B., and Wiley, T. S. (1999) Mol. Cell. Biochem. 202, 53-61
41. Kohn, E. C., and Liotta, L. A. (1995) Cancer Res. 55, 1856-1862
42. Lamb, R. F., Hennigan, R. F., Turnbull, K., Katsanakis, K. D., MacKenzie, E. D., Birnie, G. D., and Ozanne, B. W. (1997) Mol. Cell. Biol. 17, 963-976
43. Bartolazzi, A., Peach, R., Aruffo, A., and Stamenkovic, I. (1994) J. Exp. Med. 180, 53-66
44. Yu, Q., and Stamenkovic, I. (2000) Genes Dev. 14, 163-176
45. Taipale, J., Saharinen, J., and Keski-Oja, J. (1998) Adv. Cancer Res. 75, 87-134
46. Beck, C., Schreiber, H., and Rowley, D. A. (2001) Microsc. Res. Technol. 52, 387-395
47. Shah, A. H., and Lee, C. (2000) Prostate 45, 167-172
48. Sun, L. K., Beck-Schimmer, B., Oertli, B., and Wuthrich, R. P. (2001) Kidney Int. 59, 190-196
49. Ramanathan, R., and Belani, C. (1997) Semin. Oncol. 24, 440-454
50. Pass, H. I., Mitchell, J. B., Johnson, D. H., Turrisi, A. T., and Minna, J. D. (eds) (2000) in Lung Cancer. Etiology and Epidemiology of Lung Cancer (Schottenfeld, D., ed) , pp. 367-388, Lippincott Williams & Wilkins, Philadelphia


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Misra, L. M. Obeid, Y. A. Hannun, S. Minamisawa, F. G. Berger, R. R. Markwald, B. P. Toole, and S. Ghatak
Hyaluronan Constitutively Regulates Activation of COX-2-mediated Cell Survival Activity in Intestinal Epithelial and Colon Carcinoma Cells
J. Biol. Chem., May 23, 2008; 283(21): 14335 - 14344.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. J. Fidler, A. Argiris, J. D. Patel, D. H. Johnson, A. Sandler, V. M. Villaflor, J. Coon IV, L. Buckingham, K. Kaiser, S. Basu, et al.
The Potential Predictive Value of Cyclooxygenase-2 Expression and Increased Risk of Gastrointestinal Hemorrhage in Advanced Non-Small Cell Lung Cancer Patients Treated with Erlotinib and Celecoxib
Clin. Cancer Res., April 1, 2008; 14(7): 2088 - 2094.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. J. Nemunaitis
Are Vaccines Making a Comeback in Non-Small-Cell Lung Cancer?
J. Clin. Oncol., March 20, 2008; 26(9): 1402 - 1403.
[Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Liu, S.-C. Yang, S. Sharma, J. Luo, X. Cui, K. A. Peebles, M. Huang, M. Sato, R. D. Ramirez, J. W. Shay, et al.
EGFR Signaling Is Required for TGF-beta1 Mediated COX-2 Induction in Human Bronchial Epithelial Cells
Am. J. Respir. Cell Mol. Biol., November 1, 2007; 37(5): 578 - 588.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
J. Gray, J. T. Mao, E. Szabo, M. Kelley, J. Kurie, and G. Bepler
Lung Cancer Chemoprevention: ACCP Evidence-Based Clinical Practice Guidelines (2nd Edition)
Chest, September 1, 2007; 132(3_suppl): 56S - 68S.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Subbaramaiah and A. J. Dannenberg
Cyclooxygenase-2 Transcription Is Regulated by Human Papillomavirus 16 E6 and E7 Oncoproteins: Evidence of a Corepressor/Coactivator Exchange
Cancer Res., April 15, 2007; 67(8): 3976 - 3985.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Liu, P. Yue, A. H. Schonthal, F. R. Khuri, and S.-Y. Sun
Cellular FLICE-Inhibitory Protein Down-regulation Contributes to Celecoxib-Induced Apoptosis in Human Lung Cancer Cells
Cancer Res., December 1, 2006; 66(23): 11115 - 11119.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. Nemunaitis, R. O. Dillman, P. O. Schwarzenberger, N. Senzer, C. Cunningham, J. Cutler, A. Tong, P. Kumar, B. Pappen, C. Hamilton, et al.
Phase II Study of Belagenpumatucel-L, a Transforming Growth Factor Beta-2 Antisense Gene-Modified Allogeneic Tumor Cell Vaccine in Non-Small-Cell Lung Cancer
J. Clin. Oncol., October 10, 2006; 24(29): 4721 - 4730.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
L. M. Backhus, E. Sievers, G. Y. Lin, R. Castanos, R. D. Bart, V. A. Starnes, and R. M. Bremner
Perioperative cyclooxygenase 2 inhibition to reduce tumor cell adhesion and metastatic potential of circulating tumor cells in non-small cell lung cancer.
J. Thorac. Cardiovasc. Surg., August 1, 2006; 132(2): 297 - 303.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. L. Reckamp, K. Krysan, J. D. Morrow, G. L. Milne, R. A. Newman, C. Tucker, R. M. Elashoff, S. M. Dubinett, and R. A. Figlin
A phase I trial to determine the optimal biological dose of celecoxib when combined with erlotinib in advanced non-small cell lung cancer.
Clin. Cancer Res., June 1, 2006; 12(11): 3381 - 3388.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Hoang, L. Zhu, Y. Shi, P. Frost, H. Yan, S. Sharma, S. Sharma, L. Goodglick, S. Dubinett, and A. Lichtenstein
Oncogenic RAS mutations in myeloma cells selectively induce cox-2 expression, which participates in enhanced adhesion to fibronectin and chemoresistance
Blood, June 1, 2006; 107(11): 4484 - 4490.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Dohadwala, S.-C. Yang, J. Luo, S. Sharma, R. K. Batra, M. Huang, Y. Lin, L. Goodglick, K. Krysan, M. C. Fishbein, et al.
Cyclooxygenase-2-Dependent Regulation of E-Cadherin: Prostaglandin E2 Induces Transcriptional Repressors ZEB1 and Snail in Non-Small Cell Lung Cancer.
Cancer Res., May 15, 2006; 66(10): 5338 - 5345.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. T. Mao, M. C. Fishbein, B. Adams, M. D. Roth, L. Goodglick, L. Hong, M. Burdick, E. R. M. Strieter, C. Holmes, D. P. Tashkin, et al.
Celecoxib Decreases Ki-67 Proliferative Index in Active Smokers
Clin. Cancer Res., January 1, 2006; 12(1): 314 - 320.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Dalwadi, K. Krysan, N. Heuze-Vourc'h, M. Dohadwala, D. Elashoff, S. Sharma, N. Cacalano, A. Lichtenstein, and S. Dubinett
Cyclooxygenase-2-Dependent Activation of Signal Transducer and Activator of Transcription 3 by Interleukin-6 in Non-Small Cell Lung Cancer
Clin. Cancer Res., November 1, 2005; 11(21): 7674 - 7682.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
P. C. Rodriguez, C. P. Hernandez, D. Quiceno, S. M. Dubinett, J. Zabaleta, J. B. Ochoa, J. Gilbert, and A. C. Ochoa
Arginase I in myeloid suppressor cells is induced by COX-2 in lung carcinoma
J. Exp. Med., October 3, 2005; 202(7): 931 - 939.
[Abstract] [Full Text] [PDF]


Home page
QJMHome page
D. Mazhar, R. Gillmore, and J. Waxman
COX and cancer
QJM, October 1, 2005; 98(10): 711 - 718.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Csiki, J. D. Morrow, A. Sandler, Y. Shyr, J. Oates, M. K. Williams, T. Dang, D. P. Carbone, and D. H. Johnson
Targeting Cyclooxygenase-2 in Recurrent Non-Small Cell Lung Cancer: A Phase II Trial of Celecoxib and Docetaxel
Clin. Cancer Res., September 15, 2005; 11(18): 6634 - 6640.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Baratelli, Y. Lin, L. Zhu, S.-C. Yang, N. Heuze-Vourc'h, G. Zeng, K. Reckamp, M. Dohadwala, S. Sharma, and S. M. Dubinett
Prostaglandin E2 Induces FOXP3 Gene Expression and T Regulatory Cell Function in Human CD4+ T Cells
J. Immunol., August 1, 2005; 175(3): 1483 - 1490.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Krysan, K. L. Reckamp, H. Dalwadi, S. Sharma, E. Rozengurt, M. Dohadwala, and S. M. Dubinett
Prostaglandin E2 Activates Mitogen-Activated Protein Kinase/Erk Pathway Signaling and Cell Proliferation in Non-Small Cell Lung Cancer Cells in an Epidermal Growth Factor Receptor-Independent Manner
Cancer Res., July 15, 2005; 65(14): 6275 - 6281.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Sharma, L. Zhu, S. C. Yang, L. Zhang, J. Lin, S. Hillinger, B. Gardner, K. Reckamp, R. M. Strieter, M. Huang, et al.
Cyclooxygenase 2 Inhibition Promotes IFN-{gamma}-Dependent Enhancement of Antitumor Responses
J. Immunol., July 15, 2005; 175(2): 813 - 819.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Sharma, S.-C. Yang, L. Zhu, K. Reckamp, B. Gardner, F. Baratelli, M. Huang, R. K. Batra, and S. M. Dubinett
Tumor Cyclooxygenase-2/Prostaglandin E2-Dependent Promotion of FOXP3 Expression and CD4+CD25+ T Regulatory Cell Activities in Lung Cancer
Cancer Res., June 15, 2005; 65(12): 5211 - 5220.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
E. M. Sievers, R. D. Bart, L. M. Backhus, Y. Lin, M. Starnes, R. Castanos, V. A. Starnes, and Ross. M. Bremner
Evaluation of cyclooxygenase-2 inhibition in an orthotopic murine model of lung cancer for dose-dependent effect
J. Thorac. Cardiovasc. Surg., June 1, 2005; 129(6): 1242 - 1249.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y. Ding, M. Tong, S. Liu, J. A. Moscow, and H.-H. Tai
NAD+-linked 15-hydroxyprostaglandin dehydrogenase (15-PGDH) behaves as a tumor suppressor in lung cancer
Carcinogenesis, January 1, 2005; 26(1): 65 - 72.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. E. Baratelli, N. Heuze-Vourc'h, K. Krysan, M. Dohadwala, K. Riedl, S. Sharma, and S. M. Dubinett
Prostaglandin E2-Dependent Enhancement of Tissue Inhibitors of Metalloproteinases-1 Production Limits Dendritic Cell Migration through Extracellular Matrix
J. Immunol., November 1, 2004; 173(9): 5458 - 5466.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. T. Mao, I-H. Tsu, S. M. Dubinett, B. Adams, T. Sarafian, F. Baratelli, M. D. Roth, and K. J. Serio
Modulation of Pulmonary Leukotriene B4 Production by Cyclooxygenase-2 Inhibitors and Lipopolysaccharide
Clin. Cancer Res., October 15, 2004; 10(20): 6872 - 6878.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Krysan, H. Dalwadi, S. Sharma, M. Pold, and S. Dubinett
Cyclooxygenase 2-Dependent Expression of Survivin Is Critical for Apoptosis Resistance in Non-Small Cell Lung Cancer
Cancer Res., September 15, 2004; 64(18): 6359 - 6362.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Pold, K. Krysan, A. Pold, M. Dohadwala, N. Heuze-Vourc'h, J. T. Mao, K. L. Riedl, S. Sharma, and S. M. Dubinett
Cyclooxygenase-2 Modulates the Insulin-Like Growth Factor Axis in Non-Small-Cell Lung Cancer
Cancer Res., September 15, 2004; 64(18): 6549 - 6555.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
L. E. Raez, P. A. Cassileth, J. J. Schlesselman, K. Sridhar, S. Padmanabhan, E. Z. Fisher, P. A. Baldie, and E. R. Podack
Allogeneic Vaccination With a B7.1 HLA-A Gene-Modified Adenocarcinoma Cell Line in Patients With Advanced Non-Small-Cell Lung Cancer
J. Clin. Oncol., July 15, 2004; 22(14): 2800 - 2807.
[Abstract]