![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 24, 20898-20906, June 15, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From Phylos, Inc., Lexington, Massachusetts 02421
Received for publication, December 22, 2000, and in revised form, March 9, 2001
The covalent coupling of an mRNA to the
protein that it encodes (mRNA display) provides a powerful tool for
analysis of protein function in the post-genomic era. This coupling
allows the selective enrichment of individual members from libraries of
displayed proteins and the subsequent regeneration of an enriched
library using the RNA moiety. Tissue-specific libraries from
poly(A)+ mRNA were prepared by priming first and
second strand cDNA synthesis with oligonucleotides containing nine
random 3' nucleotides, the fixed regions of which encoded the requisite
sequences for formation of mRNA display constructs and a
library-specific sequence tag. Starting with a pool of uniquely tagged
libraries from different tissues, an iterative selection was performed
for binding partners of the anti-apoptotic protein Bcl-XL.
After four rounds of selection, the pool was deconvoluted by polymerase
chain reaction amplification with library-specific primers. Subsequent
clonal sequence analysis revealed the selection of three members of the
Bcl-2 family known to bind to Bcl-XL. In addition, several
proteins not previously demonstrated to interact with
Bcl-XL were identified. The relative binding affinities of
individual selected peptides were determined, as was their
susceptibility to competition with a BH3 domain peptide. Based on these
data, a putative BH3 domain was identified in most peptides.
The Bcl-2 family of proteins plays an important role in moderating
the cellular program of apoptosis (for reviews see Refs. 1 and 2).
Normal cellular homeostasis appears dependent on a balance between the
actions of anti-apoptotic members of the Bcl-2 family (Bcl-2,
Bcl-XL, etc.) and those of pro-apoptotic members (Bax, Bak,
Bad, etc.). These proteins all share significant homology to Bcl-2 in a
number of regions designated BH1-3 with the antiapoptotic members also
having a BH4 domain. An additional sub-family is made up of proteins
whose only homology to Bcl-2 is in the BH3 domain (Bad, Bik, Bid, Bim,
etc.; reviewed in Ref. 3). These appear to fall exclusively into the
pro-apoptotic class. At least part of this Bcl-2 family balancing act
appears to be controlled by direct binding interactions between the
family members. Both homo- and heterodimeric interactions between
family members are mediated by the binding of the BH3 domain in a
hydrophobic cleft formed by three helices in its corresponding partner
(4, 5).
The Bcl-2 family proteins containing multiple BH domains may function
in part through the regulation of mitochondrial membrane potential and
a corresponding release of cytochrome c into the cytoplasm.
Due to their structural homology with pore-forming bacterial toxins, it
was postulated that these proteins could act directly by forming ion
channels in mitochondria (6). Indeed, this was demonstrated in an
in vitro lipid membrane system (7). More recently, it was
demonstrated that Bcl-2 family proteins can act indirectly to affect
membrane potential through interactions with the mitochondrial channel
VDAC1 (8). Unlike the
channels formed by Bcl-2 family members themselves, the VDAC is capable
of directly passing cytochrome c out of the mitochondria.
However, this model still leaves open the issue of how protein
interactions within the Bcl-2 family could regulate apoptosis. One
possibility is that BH3 domain binding of a family member causes the
competitive release of other interacting proteins. This is a
particularly attractive model for the BH3-only class of molecules, as
each may serve to monitor a specific cellular activity and respond to
insult by stimulating apoptosis (3). Indeed, in addition to forming
dimers with other members of the Bcl-2 family, both Bcl-2 and
Bcl-XL have been shown to interact with a number of
heterologous proteins. By discovering what proteins interact with Bcl-2
family members, insight may be gained into the cellular processes that
are monitored by the apoptotic machinery. In addition, the identity of
proteins released in response to these signals may be discovered.
The major tool used in the identification and characterization of
dimerizing pairs within the Bcl-2 family has been the yeast two-hybrid
assay (9, 10). Whereas two-hybrid has emerged as the leading technology
for mapping protein-protein interactions, it is not without significant
limitations that arise because the interaction takes place in the yeast
nucleus (11). Display technologies provide a powerful alternative
because the interaction between library and target occurs in
vitro, allowing optimal binding conditions to be used for
different targets (12). Additionally, large libraries are screened
iteratively, thus allowing even very low copy number proteins to be
identified. However, the use of phage display, the most widely
practiced display technology, has been similarly hampered by the
limitations of producing libraries in a living system.
We have chosen to investigate the binding interactions of the
anti-apoptotic protein Bcl-XL by direct mRNA display
(13), a technology that circumvents many of the difficulties associated with yeast two-hybrid and phage display. In mRNA display, a newly translated mRNA molecule is covalently coupled to its corresponding nascent protein chain through a puromycin moiety ligated to the 3' end
of the RNA. The subsequent synthesis of a cDNA copy stabilizes the
RNA and provides a template for PCR amplification. Because mRNA
display is a completely in vitro technique, many of the
problems inherent in cloning and expression are circumvented. The
elimination of cloning bottlenecks in library preparation allows the
generation of very large libraries, routinely in the range of
1013 members. Toxicity of display molecules in a particular
host is not a problem because no living system is involved. In
addition, mRNA display constructs form readily in mammalian
in vitro translation systems that provide suitable
chaperones for the folding of human proteins and the potential for
appropriate post-translational modifications.
Herein is described a set of Bcl-XL binding interactions
identified by mRNA display. Included are interactions with novel as
well as previously identified protein partners.
Choice of UTR Sequence Tags--
In order to increase the
diversity of the pool of mRNA displayed proteins used in the
selection, it was desirable to mix together libraries prepared from
different tissue sources. In order not to lose the potentially valuable
information of which starting library a particular isolated clone came
from, a tag sequence was incorporated into the 5'-UTR during
construction. Unique UTR sequences that are compatible with translation
in rabbit reticulocyte lysates were identified by selection from a
library of c-myc mRNAs with a partially randomized
5'-UTR. The c-myc construct described by Roberts and Szostak
(13) was amplified by PCR using the 5' primer TAA TAC GAC TCA CTA TAG
GGA CAA TTA CTA TTT ACA ATT HHH HHH HHA CAA TGG CTG AAG AAC AGA AAC TG
(where H is an equimolar mixture of A, C, and T). This inserted 8 random bases into the 5'-UTR upstream of the ATG start codon, to give a
library of 38 (6561) different mRNA molecules after
in vitro transcription with T7 RNA polymerase. Fusion
formation, reverse transcription, and immunoprecipitation with an
anti-c-myc antibody were carried out as described (13) to
separate mRNAs that had undergone translation from those that had
not. The successfully translated and fused sequences were amplified by
PCR using the 5' primer
TAATACGACTCACTATAGGGACAATTACTATTTACAATT, in which the T7
promoter is underlined, to preserve the information in the randomized
region. Sequences obtained from individual clones were subsequently
used in the construction of tagged libraries.
Library Preparation--
Poly(A)+ mRNA
(CLONTECH) was primed using the oligonucleotides
GGAACTTGCTTCGTCTTTGCAATCN9 or
GGATGATGCTTCGTCTTTGTAATCN9 and cDNA synthesized using
SuperScript II RT (Promega). Two primers were used initially to allow
the investigation of different ligation sequences. These sequences were
subsequently altered and made uniform by the use of a single PCR primer
under conditions that would allow it to anneal to either template (see
below). After RNase H treatment, unextended primer was removed by
purification over an S-300 (Amersham Pharmacia Biotech) size exclusion
column. Second strand synthesis by the Klenow fragment of
Escherichia coli DNA polymerase was primed using
oligonucleotides of the form GGACAATTACTATTTACAATT(H8)ACAATGN9,
which include a 5'-UTR with sequence tag H8 derived as
above and a start codon (underlined). In the production of libraries
from human kidney, liver, marrow, and brain mRNAs, the tags
CTCCTAAC, CTTTCTCT, CTTACTTC, and ATTTCAAT were used, respectively.
Unextended primer was again removed by S-300 size exclusion
chromatography, and the cDNA product was then PCR-amplified using a
forward primer encoding the T7 promoter (underlined) and 5'-UTR,
TAATACGACTCACTATAGGGACAATTACTATTTACAATT, and reverse
primers corresponding to the fixed regions of the first strand primers
above. After PCR product purification using spin columns (Qiagen),
short fragments were removed by S-300 size exclusion chromatography.
mRNA Display Construct Formation--
Libraries prepared as
PCR products (see above) were reamplified using the forward primer
described above
(TAATACGACTCACTATAGGGACAATTACTATTTACAATT) and a
single reverse primer,
TTTTAAATAGCGCATGCCTTATCGTCATCGTCTTTGTAATC, encoding the FLAG-M2 epitope (underlined) and a region
complementary to the photoligation linker (italics). The single reverse
primer was used to amplify libraries containing each of the initial
first strand primer sequences in order to produce a single uniform end. These amplicons were then used as templates for transcription using T7
RNA polymerase (Ambion MegaScript). The resulting RNA was purified by
phenol/chloroform/isoamyl alcohol extraction and NAP column (Amersham
Pharmacia Biotech) purification. The puromycin-containing linker
5'-Psoralen-TAGCGGATGCA18XXCCPu (X
indicates PEG spacer 9; Pu indicates 3'-puromycin) was
photo-ligated to the 3' end of the RNA essentially as described (14).
Ligated RNA was translated for 30 min at 30 °C in a 300-µl
reaction containing 200 µl of Rabbit Reticulocyte Lysate (Ambion),
120 pmol of ligated RNA, 10 µl of Target Protein Preparation--
Bcl-XL was
PCR-amplified using the primers AGTATCGAATTCATGTCTCAGAGCAACCGG and
TACAGTCTCGAGCTAGTTGAAGCGTTCCTGGCCCT and then cloned into the expression
vector 4T-1 (Amersham Pharmacia Biotech). Competent E. coli
(BL21(DE3) pLysS) cells were transformed and grown on LB/carbenicillin
plates overnight at 37 °C. A single colony was picked and grown
overnight in 5 ml of LB/carbenicillin. Two ml of this starter culture
was used to inoculate a fresh 100-ml culture, and this was grown at
37 °C until an A600 of 0.6 was reached.
Protein expression was induced by the addition of
isopropyl-1-thio- Binding Assay--
20 µl of glutathione-Sepharose 4B slurry
(Amersham Pharmacia Biotech) was aliquoted to a microcentrifuge
tube and washed with PBS. 60 µg of Bcl-XL-GST fusion
protein (100 µl) was added, allowed to bind for 1 h at 4 °C,
and the beads rewashed in selection buffer (50 mM Tris-HCl
(pH 7.5), 150 mM KCl, 0.05% Triton X-100, 0.5 mg/ml bovine
serum albumin, 0.1 mg/ml salmon sperm DNA). The Bcl-XL-GST beads were resuspended in 100 µl of selection buffer (~11.5
µM Bcl-XL), and 35S-labeled
mRNA display construct or free peptide was added (~10-60 nM final concentration) and incubated on a rotator for
1 h at 4 °C. The reaction was then transferred to a
microcentrifuge column (Bio-Rad), and unbound material was removed by a
10-s spin at 1,000 rpm. The beads were washed 3 times with 500 µl of
selection buffer. The extent of binding was determined by scintillation counting each fraction including the recovered beads.
Selection--
The general scheme of the selection is given in
Fig. 1. Bcl-XL-GST was immobilized and incubated with the
mRNA display library and washed under the conditions described
above for the binding assay. For the first round of selection the input
was ~0.06 pmol of each of four libraries (kidney, liver, marrow, and
brain) mixed prior to selection. For subsequent rounds of selection the
input ranged from 0.25 to 0.92 pmol in total. After washing, the
cDNA strand of bound material was recovered in three elutions with 100 µl of 0.1 N KOH. Eluates were subsequently
neutralized by the addition of 2 µl of 1 M Tris-HCl (pH
7) and 8 µl of 1 N HCl. A small scale PCR optimization
was performed with the eluate to determine the number of cycles
required to produce a strong signal without overamplification
(typically 18-28 cycles). The library was then regenerated by PCR
using the remainder of the eluate.
Cloning and Sequencing--
After selection, PCR products were
cloned into the TOPO-TA vector (Invitrogen), and after isolation of
individual colonies, the plasmids were purified (Qiagen) and sequenced.
In Vitro Peptide Synthesis--
RNAs were prepared from PCR
templates and purified as described above. After translation in rabbit
reticulocyte lysate (Ambion) peptides were purified directly from the
lysate by immunoprecipitation and peptide elution based on a C-terminal
FLAG-M2 epitope (Sigma).
Model Binding Study--
In order to demonstrate the feasibility
of using mRNA display technology to identify proteins that bind to
Bcl-XL, a model study was performed using known BH3
domains. The target protein used in this study was the human
Bcl-XL protein produced as a GST fusion and immobilized on
glutathione-Sepharose beads. The BH3 domains of three different Bcl-2
family proteins (Fig. 2) were prepared as mRNA display constructs
along with control peptides derived from unrelated proteins Stat-1 and
Raf-1. The constructs were radiolabeled by incorporation of
[35S]Met during in vitro translation. These
mRNA displayed peptides were then incubated with immobilized
Bcl-XL, and the unbound material was removed by washing.
The amount of peptide bound to the beads was determined by
scintillation counting and graphed in Fig. 2 as the percent of input
counts bound.
Binding was specific to the BH3 helices, with Bak bound most
efficiently (40%) followed by Bax (6%); no binding was observed for
the BH3 helix from Bcl-2 or either control. The ordering of Bax and Bak
is in good agreement with published IC50 values, which indicate that Bcl-XL has an affinity for the Bak BH3 domain
that is ~5-fold higher than that for Bax (4). There are several possible explanations for the lack of binding observed for the BH3
domain of Bcl-2. Published interactions between Bcl-2 and Bcl-XL (15, 16) utilized full-length proteins, so perhaps the chosen BH3 domain peptide fails to form a helix by itself. Alternatively, previously observed interactions may be due to the
recognition of the BH3 domain of Bcl-XL by Bcl-2 rather
than the reverse. Finally, the affinity may be below that required to
generate a signal in this assay.
Selection--
By having established the binding to
Bcl-XL of control peptides in the form of mRNA display
constructs, a selection to identify binders from within the complex
mixture of an mRNA display library was initiated (Fig.
1). Four libraries, individually prepared from the tissue-specific mRNAs of human kidney, liver, marrow, and
brain, were pooled prior to the start of selection. Each library contained a unique 8-nucleotide tag within the 5'-UTR to allow specific
amplification of an individual library, as well as to provide for the
identification of the tissue of origin during sequence analysis of
individual selected clones.
As a target for the selection, a GST fusion protein of
Bcl-XL was immobilized on glutathione-Sepharose beads. The
selection was initiated with a combined library of ~1.5 × 1011 molecules. After incubation of the library with the
target, unbound members of the library were washed away, and the bound
material was eluted. An enriched library was then regenerated by PCR,
transcription, ligation, translation, fusion, reverse transcription,
and purification. This enriched library was then used for the
subsequent round of selection.
After four rounds of selection, the enriched pool from the combined
libraries bound the Bcl-XL target at about 40%, an extent similar to the Bak control construct (Fig.
2). In order to determine if the winning
molecules came from one or multiple libraries, the enriched pool was
deconvoluted by PCR with library-specific amplification primers. The
pool derived from the brain library was omitted due to cross-reaction
of the PCR amplification primers. A test of binding revealed that each
tissue-specific pool bound to the target to an extent similar to the
mixed pool. The bound material from each of the individual pools was
then recovered by elution, PCR-amplified, and analyzed by cloning and
sequencing.
Sequence Analysis--
A total of 378 sequences were obtained as
follows: 181 from the kidney, 85 from the liver, and 112 from the
marrow library. Initial analysis of the sequences revealed a total of
71 distinct sequence clusters. Six of the clusters originated from all
three libraries, 14 from two of the three libraries and the remaining 51 from only one library. The sequences were then subjected to both
nBLAST and pBLAST searches to identify the proteins represented by each
cluster. Thirty-seven of the clones were from known proteins, 22 from
hypothetical or unknown proteins whose nucleic acid sequences were
found in the data base, and 12 were unique sequences not yet present in
the public data base at the time of the search. Twenty of the most
frequently found proteins are given in Table I.
Included among the top 20 were four members of the Bcl-2 family. The
most abundant sequence (~25% of the total) was that of Bim, which
was originally identified as a partner of Bcl-2 in a protein
interaction screen and subsequently shown to bind to Bcl-XL
(17). Two other proteins, Bak and Bax, contain BH3 domains known to
interact with Bcl-XL (4). A fourth member of the Bcl-2 family, BCL2L12, was also found in this screen. However, no data on the
interaction of BCL2L12 with Bcl-XL have been reported.
Bcl-XL has recently been reported to bind directly to the
mitochondrial voltage-dependent anion channel (VDAC1) (8).
Two isoforms of this protein, VDAC2 and VDAC3, have also been reported (18, 19). Among the less frequently observed proteins was a single
clone from the latter, VDAC3, which this screen identifies as a binder
of Bcl-XL. None of the other proteins found has previously been reported to bind to Bcl-XL.
Further analysis of the known proteins was done to determine whether
the selected sequence was from the coding region or UTR and if the
reading frame matched that of the native protein. This analysis was
used as a filter to eliminate false positives; proteins that failed at
this step were not further characterized. Twenty seven of the 35 clusters from known proteins were in frame and within the native open
reading frames. Only 1 of 35, proline/glutamine-rich splicing factor,
was from the incorrect reading frame. Two clusters had inserts in the
reversed orientation relative to the parent mRNA and probably arose
due either to incomplete removal of the first strand primer after
cDNA synthesis or re-priming on the cDNA strand after first
strand synthesis. An additional six clusters were derived from
reportedly noncoding regions of the parent mRNA, either the 3'-UTR
or introns.
Of the clusters with multiple clones, several included more than one
unique sequence with distinct N and/or C termini. This variety reflects
the random priming used to prepare the library. Alignment of these
fragments against parental protein sequences allowed minimal functional
regions required for binding to be delineated based on the overlap of
individual family members (Fig. 3). For
the Bcl-2 family members BimL and Bax, these overlaps clearly define
the BH3 domains. In the case of Bax, this overlap domain,
Lys58-Gln77, is only 12 amino acids
longer than the BH3 core, Leu63-Leu70 (Fig.
3B). Greater variety was observed at the C terminus than at
the N terminus. This may be due to the different enzymes, reverse transcriptase, and Klenow fragment used for first and second strand synthesis, respectively. The N termini show a distinct pattern of
starting immediately after methionine residues in the native protein
(Fig. 3, A and C). This is apparently due to
annealing of the primer-encoded ATG start codon (immediately adjacent
to the nine random nucleotides of the second strand primer) to
corresponding sequences in the cDNA.
It should be noted that the information obtained upon cloning and
sequencing represents a snapshot of the status of the selection at a
specific point. Additional rounds of selection may change the
population distribution significantly. A rare sequence from the
starting pool that binds tightly might be enriched only to the point of
appearing once among the clones, whereas a poorer binding sequence that
was abundant in the starting pool might still be found at high copy
number. Also, sequencing more clones might lead to the identification
of other proteins still present at low copy number.
Affinity and Specificity--
Although the most prevalent binder
was the known Bcl-XL-binding protein Bim, the number of
clones represented in each sequence cluster may not be a good indicator
of which clones are biologically relevant. Therefore, post-selection
characterization was performed to determine the relevance of selected
proteins. One inherent benefit of this in vitro system is
the ability to manipulate the binding conditions to obtain additional
information. By varying the concentration of the immobilized target
protein Bcl-XL, the relative affinities of individual
peptides were determined.
Each cluster of sequences was aligned, and the shortest sequence was
generally chosen as representing the minimal binding domain for that
particular cluster. It should be noted that this shortest fragment may
represent only a partial binding sequence, and longer fragments might
be tighter binders. The chosen clones were prepared as free peptides
and used in the binding assay described below.
Purified protein from these individual clones was incubated with
immobilized Bcl-XL for 1 h, and after washing, the
amount bound was determined by scintillation counting (Fig.
4). To determine the affinity, the data
were fitted to a binding curve using non-linear regression. In this
assay, all of the clones except one showed binding that was clearly
dependent on target concentration. However, only binding curves that
gave a high correlation coefficient (R value) were used to
determine an affinity.
Binding affinities ranged from ~2 nM to 10 µM, demonstrating the great range of affinities
accessible by in vitro selection. The 20 clones with the
highest affinity are given in Table II. A
comparison of Kd values to the frequency in the pool (Table I) showed a 65% overlap; of the 20 lowest Kd values, 13 were found within the top 20 most abundant winners, indicating a correlation between Kd and frequency.
However, 5 of the tightest binders were observed only a single time,
and conversely, 4 of the most abundant proteins had affinities lower than 2 µM. Among those was translocated promoter
region which, despite appearing 23 times among the sequences, bound
very poorly. This disparity between rankings by frequency and affinity
emphasizes the importance of post-selection characterization. The final
representation of any given protein within the selected pool may be
determined by a number of factors as follows: its abundance within the
initial mRNA population used to prepare the library; the sum of
efficiencies at each step in the mRNA display process (PCR,
transcription, translation, fusion, etc.); and its affinity to the
target.
Because the target used in this selection was a GST fusion protein of
Bcl-XL, the specificity of each selected protein was tested
by binding to immobilized GST. The vast majority of proteins gave
background levels of binding (less than 2%) to GST (data not shown).
Of the 8 proteins that bound >2% to GST, 5 bound 8-10-fold higher to
the Bcl-XL fusion protein and so were deemed specific. The
3 remaining proteins bound poorly to the Bcl-XL fusion
protein relative to GST alone and so were deemed nonspecific. Whether these were binding to GST or to the glutathione-Sepharose beads was not determined.
Competition--
The Bcl-2 family of proteins has been shown to
form homo- and heterodimers through the binding of the BH3 domain of
one protein in the corresponding binding pocket on its partner. Only
three of the selected proteins (Bim, Bak, and Bax) were previously
known to contain a BH3 domain. In order to determine if the other
proteins bound to the BH3 domain binding site on Bcl-XL, a
competition assay was performed. The Bak BH3 domain peptide used as a
positive control was prepared by chemical synthesis and used to compete with individual Bcl-XL binders. This peptide competed
effectively with the representative selected peptide Talin at 20 µM or above (Fig. 5).
A competition assay was performed for many of the selected
Bcl-XL-binding proteins using 20 µM
competitor (100 µM where indicated) based on the
titration shown in Fig. 5. Each peptide was incubated with immobilized
Bcl-XL in the presence of competitor and the amount bound
normalized to a comparable reaction without competitor (Table
III).
Nearly all of the peptides were competed by the BH3 domain, indicating
that they probably bind to the same site on Bcl-XL. However, a decrease in binding of the selected protein at one site, due
to a change in conformation of the target upon binding the competitor
at a different site, cannot be ruled out. Only three of the proteins
tested were not competed at all by the BH3 domain, indicating that they
may bind to a different site on Bcl-XL.
Alignment of Selected Proteins--
Competition for binding with
the Bak BH3 domain indicated that most of the peptides selected were
binding in the same site. Therefore, each of the peptides was examined
for the presence of a BH3 domain sequence. A tentative assignment could
be made for most peptides, and those of the tightest binders (Table II) are shown aligned in Table III. The amino acid alignments do not include the initiator methionine or the C-terminal FLAG epitopes which
were encoded for by the fixed regions of the library primers. It is
possible that for some peptides the region recognized by Bcl-XL included these conserved sequences. Based on this
alignment, one such protein might be the Toll-like receptor 3. Most of
the peptides have the hallmark periodicity of hydrophobic amino acids indicative of an amphipathic In four rounds of iterative selection from an mRNA display
library, a pool of proteins that bound to the target protein
Bcl-XL was isolated. The identity of these selected
proteins was readily determined by the sequencing of individual clones
and their comparison to the public data base. The more than 70 Bcl-XL-binding proteins identified included both known and
novel proteins.
For this selection, four independently prepared libraries derived from
human liver, kidney, bone marrow, and brain tissues were mixed prior to
selection. The presence of a unique sequence tag in the 5'-UTR of each
library allowed simultaneous selection while retaining the information
of the tissue of origin within each molecule. Sequencing analysis
revealed that ~28% of the selected proteins were represented in two
or more tissues, whereas the remaining 72% came from a single tissue.
The ability to mix libraries not only increased the size and diversity
of the starting pool, but the identification of tissue of origin for
each selected protein may provide additional information normally
derived from an mRNA expression analysis. Whereas the selection of
a protein from a given tissue-specific library clearly demonstrates its
presence in that tissue, failure to select it from another library does not prove its absence. Indeed, a comparison of the tissue of origin data for five of the most frequent clones (Table I) to the tissue distribution reported in the Bodymap data base (20) showed no significant correlation (data not shown).
The identities of selected proteins were determined by a comparison to
sequences obtained from the public data base. Each fragment of a known
protein was aligned to the parental mRNA and/or gene sequence, and
its reading frame and location within the message were determined.
Fragments found in introns, the UTRs, or in the wrong reading frame
were not considered further. This led to the elimination of 8 false
positives out of 71 proteins, including the abundant
proline/glutamine-rich splicing factor. The sequence data also provided
a preliminary means of ranking the clones based on the frequency with
which each appeared (Table I). Subsequent characterization of
individual clones provided a means of evaluating this initial ranking
and revealed both its power and limitations (see below).
Four members of the Bcl-2 family were among the most frequently
observed clones (Table I), three of which have been reported previously
to bind to Bcl-XL as follows: Bim, Bak, and Bax (10, 17).
Each of these was represented by multiple fragments, all containing the
BH3 domain responsible for heterodimer formation among Bcl-2 family
members (Fig. 3). The fourth newly reported family member, BCL2L12, was
not present in the data base during the initial search. It was
therefore quite exciting to find that a protein initially categorized
as novel is indeed a member of the Bcl-2 family. This result reinforces
the possibility that the other proteins that currently fall into the
novel category may also be validated as members of the Bcl-2 family.
The heterologous protein VDAC3 was found only a single time; however,
it was later demonstrated to be a high affinity binder of
Bcl-XL (Table II). The isolated fragment of VDAC3 (amino
acids 85-123) competed for binding with the BH3 domain of Bak (Table III). An alignment with the three isoforms of VDAC reveals the selected
fragment to be in a region spanning exon 4 through exon 6 (data not
shown). Although variability is seen in this region, many conserved
elements of the BH3-like motif identified in VDAC3 (Table III) can also
be found in VDAC1 and VDAC2. The idea that VDAC3 is binding to
Bcl-XL by donation of a BH3-like domain is consistent with
the observation that the BH3-only proteins Bid and Bik do not bind
VDAC1 (8).
Although previously identified binders of Bcl-XL may be
considered true positives from this selection, additional filters based
on readily assayable characteristics were used to eliminate potential
false positives. The generation of a revised ranking of clones based on
binding affinity was straightforward. Individual clones were prepared
by in vitro translation using much the same methods as used
for the mRNA displayed pool. Application of the same basic assay
that was used for the selection, while varying the concentration of
immobilized target, gave a relative Kd for each
clone. Although the choice of a cut-off is somewhat arbitrary, the
known BH3 domains all fell within the top 20 with affinities below 1 µM. For a case in which no prior knowledge of binding partners exists, an affinity consistent with the cellular
concentrations of the interacting proteins has been proposed as a
litmus test for biological significance (21).
The relative affinities of the known Bcl-2 family members may be of
particular interest. Apoptosis assays using Bak and Bax have implicated
them as significant effectors of Bcl-XL. The affinities determined in our binding assay correlate with the extents of binding
of the control constructs (Fig. 2) and with published IC50
values (4). However, the observation that the BH3 domain-containing fragment of Bim binds to Bcl-XL more than 100-fold more
tightly than either Bak or Bax may imply that it is a particularly
important counterpart. The affinity data provide a biochemical basis
for the observation that, uniquely among Bcl-2 family members, stable overexpressing cell lines of Bim could not be made (17).
As discussed previously, the BH3 domain of Bcl-2 family proteins
provides the means of heterodimerization. Therefore, new members of the
Bcl-2 family identified in this selection could reasonably be assumed
to interact with Bcl-XL in a similar manner. To determine
the mode of binding, the BH3 domain of the known Bcl-XL-binding protein Bak was used in a competition assay.
The results showed that the majority of selected proteins were
interacting at the BH3 domain binding site of Bcl-XL. A
corresponding region of homology to the known BH3 domains could be
found in most proteins (Table III). For selection targets for which
there is no known interactor, selected proteins could be tested in
competition with each other to establish groups of proteins that
compete for the same binding sites.
Applying this series of filters leaves 16 proteins with affinities of
less than 1 µM for Bcl-XL. Those that were
tested in a competition assay all competed for binding with a known BH3 domain. Of these, 25% are known Bcl-2 family members, a very promising success rate. Among the remaining 12 proteins are five for which no
function is yet known. Perhaps additional characterization of these
newly identified Bcl-XL-binding proteins will help to clarify the role of the Bcl-2 family in apoptosis. The use of an
in vitro selection method greatly simplified the subsequent performance of in vitro assays, thereby allowing us to
quickly identify a subset of proteins for more laborious and
time-consuming assays such as those that address in vivo activity.
With the recent publication of the human genome sequence interest is
shifting to the emergent field of proteomics, one critical aspect of
which is the creation of a comprehensive map of protein-protein interactions. Such interactions are responsible for most signal transductions, making them attractive targets for drug therapy. The
creation of such a map presents an enormous task for which the primary
methodology currently in use is the yeast two-hybrid assay. Recently,
genome-wide efforts to map protein-protein interactions have been
reported for Saccharomyces cerevisiae (22, 23), Helicobacter pylori (24), and to a more limited extent for
Caenorhabditis elegans (25).
The work described herein has demonstrated the utility of a new
methodology, mRNA display, for rapidly mapping these interactions. The great flexibility and precise control over assay conditions, such
as target concentration and the presence of additives, is just
one of the advantages of this in vitro selection method. All
of the procedures used in these experiments were essentially microcentrifuge tube-based. Such systems are readily scalable through
the use of microtiter techniques and are amenable to automation. In
addition, the relatively laborious step of sequencing can be supplemented or replaced by array-based analysis of the
pool.2 These ongoing
refinements to mRNA display technology will enable its application
to high-throughput, genome-wide identification of protein-protein interactions.
We thank Patti Aha for production of the
Bcl-XL target protein and Laird Bloom for critical reading
of the manuscript.
After submission of our manuscript, a
paper describing the cloning and characterization of BCL2L12 has been
published (26).
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, March 30, 2001, DOI 10.1074/jbc.M011641200
2
T. Cujec, P. Medeiros, P. W. Hammond, C. E. Rise, and B. L. Kreider, submitted for publication.
The abbreviations used are:
VDAC, voltage-dependent anion channel;
PCR, polymerase chain
reaction;
UTR, untranslated region;
GST, glutathione
S-transferase.
In Vitro Selection and Characterization of
Bcl-XL-binding Proteins from a Mix of Tissue-specific
mRNA Display Libraries*
,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Met amino acid mix (Ambion), and
15 µl of [35S]Met (Amersham Pharmacia Biotech).
Subsequently, 100 µl of 2 M KCl and 25 µl of 1 M MgCl2 was added to facilitate formation of
the mRNA display complex. The mRNA display constructs were then
purified by binding to 100 µl of 50% oligo(dT)-cellulose slurry in a
total volume of 10 ml (100 mM Tris-HCl (pH 8), 10 mM EDTA, 1 M NaCl, 0.25% Triton X-100) at
4 °C for 1 h. The binding reaction was then transferred to a
column (Bio-Rad), washed 3 times with 1 ml of binding buffer containing
no EDTA, and then eluted with 100-µl aliquots of 2 mM
Tris-HCl (pH 8), 0.05% Triton X-100, 0.5 mg/ml bovine serum albumin. A
cDNA strand was synthesized using SuperScript II RT (Promega) and
the reverse sense PCR primer in the manufacturer-supplied buffer. The
reverse transcription reaction was then diluted to 1 ml in TBK buffer
(50 mM Tris-HCl (pH 7.5), 150 mM KCl, 0.05%
Triton X-100) and incubated with 200 µl of anti-FLAG antibody
immobilized on agarose beads (Sigma) for 1 h at 4 °C. The
binding reaction was transferred to a column, and the beads were washed
3 times with 1 ml of TBK buffer. mRNA-display constructs were then
eluted with 100-µl aliquots of TBK buffer containing 100 µM FLAG-M2 peptide, 0.5 mg/ml bovine serum albumin, and
0.1 mg/ml salmon sperm DNA. The yield of mRNA-protein fusion product was based on an estimated specific activity of methionine in
the lysate (5 µM total concentration) and determined by
scintillation counting both the purified product and the crude
translation mixture. For the libraries containing a heterogeneous
population of proteins, the prevalence of methionine was approximated
as one initiator methionine per molecule plus one for each 60 amino acids.
-D-galactopyranoside to 0.4 mM, and the culture was shaken at 25 °C overnight. The cells were harvested by centrifugation at 12,000 × g
for 30 min. The pellet was resuspended in 1/10th volume 100 mM Tris-HCl (pH 8.0), 100 mM NaCl, 0.1% Triton
X-100, and 1.0% glycerol, and the cells were lysed by Dounce
homogenization and three freeze/thaw cycles. The lysate was clarified
by centrifugation at 16,000 × g for 30 min, and 5 ml
of the clarified lysate was applied to a 2-ml RediPack GST column
(Amersham Pharmacia Biotech). The column was washed with 20 ml of lysis
buffer and eluted, in a stepwise manner, with lysis buffer to which
reduced glutathione had been added, to final concentrations of 1, 5, 10, 15, and 20 mM. Fractions were analyzed on 4-12%
NuPAGE gels (NOVEX), and positive fractions were pooled. The protein
was dialyzed against 100 mM Tris-HCl (pH 8.0), 100 mM NaCl, 0.05% Triton X-100, 1.0% glycerol, and the
protein concentration was determined by BCA (Pierce).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (25K):
[in a new window]
Fig. 1.
Iterative selection using mRNA
display. A PCR template is used to transcribe an engineered
mRNA molecule possessing suitable flanking sequences. A poly(dA)
linker containing a 3'-puromycin moiety (Pu) is then added
by photo-cross-linking. When this RNA is translated in
vitro, the puromycin becomes incorporated at the C terminus of the
nascent peptide. The resulting mRNA display construct is then
purified after dissociation from the ribosome. A cDNA strand is
then synthesized to protect the RNA and to provide a template for
future PCR amplification. A library of such constructs is then
incubated with an immobilized target, and unbound material is washed
away. Bound cDNAs are recovered by KOH elution, and subsequent PCRs
are used to regenerate a library enriched for target-binding
peptides.

View larger version (39K):
[in a new window]
Fig. 2.
Binding of control constructs to
Bcl-XL. The BH3 domains of Bcl-2, Bax, and Bak as well
as non-BH3 control peptides derived from Stat-1 and Raf-1 were prepared
as mRNA display constructs. A, these BH3 domains are
shown with the consensus regions aligned and highlighted.
Each peptide included the C-terminal FLAG epitope for use in
purification. B, individual mRNA display constructs were
incubated with either the target GST-Bcl-XL fusion protein
bound to glutathione beads or with the beads alone. Unbound materials
were collected and the beads washed, and the percent of input counts
that bound was determined for each sample by scintillation
counting.
The most abundant protein winners from selection

View larger version (27K):
[in a new window]
Fig. 3.
Alignment of selected fragments with parental
proteins. Each unique fragment was analyzed to determine the
location of the N and C termini within the parental protein sequence,
and these amino acids are indicated by residue and number. The number
of isolated clones corresponding to each unique fragment was determined
and is indicated next to the fragment ID. These fragments are mapped
against the parental sequences of BimL, Bax, HSPC300, and
translocated promoter region. The BH3 domain core sequence is
underlined for the BimL and Bax proteins. Splice variants
are indicated by a * in the ID and the use of
in place of = in the fragment map.

View larger version (22K):
[in a new window]
Fig. 4.
Determination of relative binding
affinities. A selected Bak fragment was produced as a free protein
and used in a binding assay in which the concentration of immobilized
Bcl-XL was varied from 11 nM to 28 µM. The amount of peptide bound to Bcl-XL was
determined by scintillation counting and normalized to that bound at
the highest concentration. Normalized binding was then plotted
versus Bcl-XL concentration and fitted to a
binding curve using nonlinear regression.
Affinities of the 20 tightest binders

View larger version (18K):
[in a new window]
Fig. 5.
Competition with a known BH3 domain. At
a fixed concentration of immobilized Bcl-XL, the Bak BH3
domain (underlined) containing peptide
MGQVGRQLAIIGDDINRDYKDDDDKASA was added at the
indicated concentration along with a trace amount of a selected Talin
fragment. After binding for 1 h, the unbound material was removed
and the bound protein quantitated. The bound protein was assayed by
scintillation counting, normalized to that bound in the absence of
competitor, and plotted versus competitor
concentration.
Competition with a known BH3 domain and corresponding domain alignment
-helix. Additional homologies among the
sequences are indicated by shading.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENTS
![]()
Note Added in Proof
![]()
FOOTNOTES
To whom correspondence should be addressed: Phylos, 128 Spring
St., Inc., Lexington, MA 02421. Tel.: 781-862-6400, ext. 238; Fax:
781-402-8800; E-mail: phammond@phylos.com.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Kelekar, A.,
and Thompson, C. B.
(1998)
Trends Cell Biol.
8,
324-330
2.
Reed, J. C.
(1998)
Oncogene
17,
3225-3236
3.
Huang, D. C.,
and Strasser, A.
(2000)
Cell
103,
839-842
4.
Diaz, J. L.,
Oltersdorf, T.,
Horne, W.,
McConnell, M.,
Wilson, G.,
Weeks, S.,
Garcia, T.,
and Fritz, L. C.
(1997)
J. Biol. Chem.
272,
11350-11355
5.
Sattler, M.,
Liang, H.,
Nettesheim, D.,
Meadows, R. P.,
Harlan, J. E.,
Eberstadt, M.,
Yoon, H. S.,
Shuker, S. B.,
Chang, B. S.,
Minn, A. J.,
Thompson, C. B.,
and Fesik, S. W.
(1997)
Science
275,
983-986
6.
Muchmore, S. W.,
Sattler, M.,
Liang, H.,
Meadows, R. P.,
Harlan, J. E.,
Yoon, H. S.,
Nettesheim, D.,
Chang, B. S.,
Thompson, C. B.,
Wong, S. L.,
Ng, S. L.,
and Fesik, S. W.
(1996)
Nature
381,
335-341
7.
Minn, A. J.,
Velez, P.,
Schendel, S. L.,
Liang, H.,
Muchmore, S. W.,
Fesik, S. W.,
Fill, M.,
and Thompson, C. B.
(1997)
Nature
385,
353-357
8.
Shimizu, S.,
Narita, M.,
and Tsujimoto, Y.
(1999)
Nature
399,
483-487
9.
Wong, C.,
and Naumovski, L.
(1997)
Anal. Biochem.
252,
33-39
10.
Simonen, M.,
Keller, H.,
and Heim, J.
(1997)
Eur. J. Biochem.
249,
85-91
11.
Luban, J.,
and Goff, S. P.
(1995)
Curr. Opin. Biotechnol.
6,
59-64
12.
Zozulya, S.,
Lioubin, M.,
Hill, R. J.,
Abram, C.,
and Gishizky, M. L.
(1999)
Nat. Biotechnol.
17,
1193-1198
13.
Roberts, R. W.,
and Szostak, J. W.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
12297-12302
14.
Kurz, M.,
Gu, K.,
and Lohse, P. A.
(2000)
Nucleic Acids Res.
28,
83
15.
Zhang, H.,
Saeed, B.,
and Ng, S. C.
(1995)
Biochem. Biophys. Res. Commun.
208,
950-956
16.
Xie, Z.,
Schendel, S.,
Matsuyama, S.,
and Reed, J. C.
(1998)
Biochemistry
37,
6410-6418
17.
O'Connor, L.,
Strasser, A.,
O'Reilly, L. A.,
Hausmann, G.,
Adams, J. M.,
Cory, S.,
and Huang, D. C.
(1998)
EMBO J.
17,
384-395
18.
Rahmani, Z.,
Maunoury, C.,
and Siddiqui, A.
(1998)
Eur. J. Hum. Genet.
6,
337-340
19.
Blachly-Dyson, E.,
Zambronicz, E. B., Yu, W. H.,
Adams, V.,
McCabe, E. R.,
Adelman, J.,
Colombini, M.,
and Forte, M.
(1993)
J. Biol. Chem.
268,
1835-1841
20.
Kawamoto, S.,
Yoshii, J.,
Mizuno, K.,
Ito, K.,
Miyamoto, Y.,
Ohnishi, T.,
Matoba, R.,
Hori, N.,
Matsumoto, Y.,
Okumura, T.,
Nakao, Y.,
Yoshii, H.,
Arimoto, J.,
Ohashi, H.,
Nakanishi, H.,
Ohno, I.,
Hashimoto, J.,
Shimizu, K.,
Maeda, K.,
Kuriyama, H.,
Nishida, K.,
Shimizu-Matsumoto, A.,
Adachi, W.,
Ito, R.,
Kawasaki, S.,
and Chae, K. S.
(2000)
Genome Res.
10,
1817-1827
21.
Mayer, B. J.
(1999)
Mol. Biotechnol.
13,
201-213
22.
Ito, T.,
Tashiro, K.,
Muta, S.,
Ozawa, R.,
Chiba, T.,
Nishizawa, M.,
Yamamoto, K.,
Kuhara, S.,
and Sakaki, Y.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
1143-1147
23.
Uetz, P.,
Giot, L.,
Cagney, G.,
Mansfield, T. A.,
Judson, R. S.,
Knight, J. R.,
Lockshon, D.,
Narayan, V.,
Srinivasan, M.,
Pochart, P.,
Qureshi-Emili, A.,
Li, Y.,
Godwin, B.,
Conover, D.,
Kalbfleisch, T.,
Vijayadamodar, G.,
Yang, M.,
Johnston, M.,
Fields, S.,
and Rothberg, J. M.
(2000)
Nature
403,
623-627
24.
Rain, J. C.,
Selig, L.,
De Ruse, H.,
Battaglia, V.,
Reverdy, C.,
Simon, S.,
Lenzen, G.,
Petel, F.,
Wojcik, J.,
Schachter, V.,
Chemama, Y.,
Labigne, A.,
and Legrain, P.
(2001)
Nature
409,
211-215
25.
Walhout, A. J.,
Sordella, R.,
Lu, X.,
Hartley, J. L.,
Temple, G. F.,
Brasch, M. A.,
Thierry-Mieg, N.,
and Vidal, M.
(2000)
Science
287,
116-122
26.
Scorilas, A.,
Kyriakopoulou, L.,
Yousef, G. M.,
Ashworth, L. K.,
Kwamie, A.,
and Diamandis, E. P.
(2001)
Genomics
72,
217-221
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
S.-C. Lo and M. Hannink PGAM5, a Bcl-XL-interacting Protein, Is a Novel Substrate for the Redox-regulated Keap1-dependent Ubiquitin Ligase Complex J. Biol. Chem., December 8, 2006; 281(49): 37893 - 37903. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Matsuzaki, Y. Xu, M. Ikegami, V. Besnard, K.-S. Park, W. M. Hull, S. E. Wert, and J. A. Whitsett Stat3 Is Required for Cytoprotection of the Respiratory Epithelium during Adenoviral Infection J. Immunol., July 1, 2006; 177(1): 527 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tateyama, K. Horisawa, H. Takashima, E. Miyamoto-Sato, N. Doi, and H. Yanagawa Affinity selection of DNA-binding protein complexes using mRNA display Nucleic Acids Res., February 14, 2006; 34(3): e27 - e27. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Ja, B. N. Olsen, and R. W. Roberts Epitope mapping using mRNA display and a unidirectional nested deletion library Protein Eng. Des. Sel., July 1, 2005; 18(7): 309 - 319. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Miyamoto-Sato, M. Ishizaka, K. Horisawa, S. Tateyama, H. Takashima, S. Fuse, K. Sue, N. Hirai, K. Masuoka, and H. Yanagawa Cell-free cotranslation and selection using in vitro virus for high-throughput analysis of protein-protein interactions and complexes Genome Res., May 1, 2005; 15(5): 710 - 717. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Shen, C. A. Valencia, J. W. Szostak, B. Dong, and R. Liu Scanning the human proteome for calmodulin-binding proteins PNAS, April 26, 2005; 102(17): 5969 - 5974. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Horisawa, N. Doi, H. Takashima, and H. Yanagawa Application of Quantitative Real-Time PCR for Monitoring the Process of Enrichment of Clones on In Vitro Protein Selection J. Biochem., February 1, 2005; 137(2): 121 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Horisawa, S. Tateyama, M. Ishizaka, N. Matsumura, H. Takashima, E. Miyamoto-Sato, N. Doi, and H. Yanagawa In vitro selection of Jun-associated proteins using mRNA display Nucleic Acids Res., December 2, 2004; 32(21): e169 - e169. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Sawata, E. Suyama, and K. Taira A system based on specific protein-RNA interactions for analysis of target protein-protein interactions in vitro: successful selection of membrane-bound Bak-Bcl-xL proteins in vitro Protein Eng. Des. Sel., June 1, 2004; 17(6): 501 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yonezawa, N. Doi, T. Higashinakagawa, and H. Yanagawa DNA Display of Biologically Active Proteins for In Vitro Protein Selection J. Biochem., March 1, 2004; 135(3): 285 - 288. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Sawata and K. Taira Modified peptide selection in vitro by introduction of a protein-RNA interaction Protein Eng. Des. Sel., December 1, 2003; 16(12): 1115 - 1124. [Abstract] [Full Text] [PDF] |
||||