JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M102312200 on April 3, 2001

J. Biol. Chem., Vol. 276, Issue 24, 20907-20912, June 15, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/24/20907    most recent
M102312200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krogh, B. O.
Right arrow Articles by Shuman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krogh, B. O.
Right arrow Articles by Shuman, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Effect of 2'-5' Phosphodiesters on DNA Transesterification by Vaccinia Topoisomerase*

Berit O. KroghDagger , Christopher D. Claeboe§, Sidney M. Hecht§, and Stewart ShumanDagger

From the Dagger  Molecular Biology Program, Sloan-Kettering Institute, New York, New York 10021 and the § Departments of Chemistry and Biology, University of Virginia, Charlottesville, Virginia 22901

Received for publication, March 14, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Vaccinia topoisomerase forms a covalent DNA-(3'-phosphotyrosyl)-enzyme intermediate at a pentapyrimidine target site 5'-CCCTTpdown-arrow in duplex DNA. By introducing single 2'-5' phosphodiesters in lieu of a standard 3'-5' phosphodiester linkage, we illuminate the contributions of phosphodiester connectivity to DNA transesterification. We find that the DNA cleavage reaction was slowed by more than six orders of magnitude when a 2'-5' linkage was present at the scissile phosphodiester (CCCTT2'pdown-arrow 5'A). Thus, vaccinia topoisomerase is unable to form a DNA-(2'-phosphotyrosyl)-enzyme intermediate. We hypothesize that the altered geometry of the 2'-5' phosphodiester limits the ability of the tyrosine nucleophile to attain a requisite, presumably apical orientation with respect to the 5'-OH leaving group. A 2'-5' phosphodiester located to the 3' side of the cleavage site (CCCTTpdown-arrow N2'p5'N) reduced the rate of transesterification by a factor of 500. In contrast, 2'-5' phosphodiesters at four other sites in the scissile strand (TpCGCCCTpTdown-arrow ATpTpC) and five positions in the nonscissile strand (3'-GGGpApApTpApA) had no effect on transesterification rate. The DNAs containing 2'-5' phosphodiesters were protected from digestion by exonuclease III. We found that exonuclease III was consistently arrested at positions 1 and 2 nucleotides prior to the encounter of its active site with the modified 2'-5' phosphodiester and that the 2'-5' linkage itself was poorly hydrolyzed by exonuclease III.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Type IB topoisomerases modulate the topological state of DNA by cleaving and rejoining one strand of the DNA duplex. Cleavage is a transesterification reaction in which the scissile Npdown-arrow N phosphodiester is attacked by a tyrosine of the enzyme, resulting in the formation of a DNA-(3'-phosphotyrosyl)enzyme intermediate and the expulsion of a DNA strand having a 5'-OH terminus. In the religation step, the DNA 5'-OH group attacks the covalent intermediate resulting in expulsion of the active site tyrosine and restoration of the DNA phosphodiester backbone. Vaccinia topoisomerase is a prototype of the type IB topoisomerase family (1). The poxvirus enzyme is distinguished from the nuclear topoisomerase I by its compact size (314 amino acids) and its site-specificity in DNA transesterification. Vaccinia topoisomerase binds and cleaves duplex DNA at a pentapyrimidine target sequence 5'-(T/C)CCTTdown-arrow . The Tpdown-arrow nucleotide (defined as the +1 nucleotide) is linked to Tyr-274 of the enzyme.

The stereochemical outcome of the net cleavage-religation reaction of vaccinia topoisomerase is a retention of configuration at the scissile phosphodiester. This suggests that the component cleavage and religation reactions entail in-line SN2-type displacements in which the attacking nucleophile is apical to the leaving group and each transesterification results in an inversion of configuration (2). Four conserved amino acid side chains of vaccinia topoisomerase (Arg-130, Lys-167, Arg-223, and His-265) are required for catalysis (3-5). Mutational and structural data suggest that the two arginines and the histidine interact directly with the scissile phosphodiester and enhance catalysis by stabilizing the developing negative charge on a pentacoordinate phosphorane transition state (2-7). Lys-167 serves as a general acid catalyst during the cleavage reaction, donating a proton to expel the 5'-OH leaving group (8).

Type IB topoisomerases engage the DNA target site circumferentially, forming a C-shaped clamp around the duplex (6, 7, 9). The DNA moieties that contribute to target site recognition and enable catalysis by vaccinia topoisomerase have been examined using synthetic substrates containing a single CCCTT site. Modification interference, modification protection, base and sugar analog substitution, and UV cross-linking experiments indicate that vaccinia topoisomerase makes contact with specific bases and phosphates of DNA in the vicinity of the CCCTT element (9-12). For example, dimethyl sulfate protection and interference experiments revealed interactions with the three guanine bases of the pentamer motif complementary strand (3'-GGGAA) (10), and permanganate oxidation interference highlighted a functional interaction with the +2T base of the scissile strand (CCCTT) (12).

Functionally relevant phosphates were initially identified by studying the effects of phosphate ethylation on topoisomerase binding (9). Ethylation of the +1, +2, +3, and +4 phosphates on the scissile strand (positions CpCpTpTpdown-arrow within the pentamer motif) and the +3, +4, and +5 phosphates on the nonscissile strand (3'-GpGpGpA) interfered with topoisomerase-DNA complex formation. The relevant topoisomerase-phosphate contacts are arrayed across the minor groove of the DNA helix (9). Phosphate ethylation is a relatively crude modification interference method, insofar as it simultaneously eliminates the negative charge on the phosphate and introduces a bulky aliphatic group. Subsequent studies of the catalytic contributions of individual phosphates have entailed less drastic modifications, for example replacing the standard 3'-5' phosphodiester by a 3'-OH/5'-PO4 nick (13). This modification interrupts the DNA backbone and introduces additional negative charge (net charge of about -1.5 at pH 7.0 at the nick versus -1.0 for the phosphodiester) but adds only minimal bulk (one extra oxygen). A 3'-OH/5'-PO4 nick in lieu of the scissile phosphodiester abolished transesterification by vaccinia topoisomerase, but did not affect the noncovalent binding of topoisomerase to the nicked DNA (13). This result indicated that vaccinia topoisomerase is an obligate nucleotidyl-3'-phosphotransferase that cannot transesterify to a 5' phosphomonoester. Placement of a 3'-OH/5'-PO4 nick at position +2 (CCCTpTpdown-arrow ) slowed the rate of transesterification by a factor of 500. A "missing phosphate" analysis of the DNA target site entailed replacement of phosphodiesters with a 3'-OH/5'-OH nick, a maneuver that eliminates one negative charge along with potential hydrogen bonding interactions between the topoisomerase and the nonbridging phosphate oxygens. This interference method revealed a contribution of the -1 phosphate of the scissile strand (CCCTTpdown-arrow NpN), which enhances the rate of transesterification by a factor of 40 (13).

Here we present a more subtle modification interference analysis in which we investigate the positional effects of introducing single 2'-5' phosphodiesters in lieu of a standard 3'-5' phosphodiester linkage (14, 15). This approach imposes no alteration in net charge or size of the phosphate moiety and is better suited than previous modification methods to dissect the role of phosphate orientation in site recognition and transesterification chemistry. The instructive findings are that vaccinia topoisomerase is insensitive to single 2'-5' phosphodiester modifications, with two exceptions: the rate of single-turnover transesterification is suppressed by six orders of magnitude by a 2'-5' substitution for the scissile phosphodiester (CCCTT2'pdown-arrow 5'N) and by a factor of 500 by 2'-5' modification of the -1 phosphate (CCCTTdown-arrow N2'p5'N). Vaccinia topoisomerase displays a more stringent requirement for natural phosphodiester geometry at the cleavage site than mammalian topoisomerase I.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DNA Substrates-- Modified oligonucleotides containing a single 2'-5' phosphodiester bond were synthesized as described (14-17). Unmodified oligonucleotides were purchased from BIOSOURCE International.

Vaccinia Topoisomerase-- Recombinant vaccinia topoisomerase was produced in Escherichia coli(BL21) by infection with bacteriophage lambda CE6 and then purified from the soluble bacterial lysate by phosphocellulose chromatography as described previously (18).

DNA Transesterification-- Standard or 2'-5' modified 18-mer scissile strands d(CGTGTCGCCCTTATTCCC) were 5' 32P-labeled by enzymatic phosphorylation in the presence of [gamma -32P]ATP and T4 polynucleotide kinase. The labeled oligonucleotides were gel-purified and hybridized to standard or 2'-5' modified 30-mer oligonucleotides d(TGTAGTCTATCGGAATAAGGGCGACACG) at a 1:4 molar ratio of 18-mer to 30-mer. Transesterification reactions containing (per 20 µl) 50 mM Tris-HCl (pH 7.5), 0.3 pmol 18-mer/30-mer DNA, and 75, 150, or 300 ng of vaccinia topoisomerase were incubated at 37 °C. Aliquots (20 µl) were withdrawn at the times specified and quenched immediately with SDS (1% final concentration). The products were analyzed by electrophoresis through a 10% polyacrylamide gel containing 0.1% SDS. Free DNA migrated near the dye front. Covalent complex formation was revealed by transfer of radiolabeled DNA to the topoisomerase polypeptide. The extent of covalent adduct formation was quantified by scanning the dried gel using a Fujix BAS2500 Phosphorimager. A plot of the percentage of input DNA cleaved versus time established the end point values for cleavage. The data were then normalized to the end point value (defined as 100%), and the cleavage rate constants (kobs) were calculated by fitting the normalized data to the equation 100 - %cleavage(norm) = 100e-kt. The values of kobs at the saturating level of input topoisomerase (either 75 or 150 ng) and the actual end point cleavage values are listed in Tables I and II.

Cleavage Site Specificity-- Reaction mixtures (20 µl) containing 50 mM Tris-HCl (pH 7.5), 0.3 pmol of standard or 2'-5' modified 18-mer/30-mer DNA, and 75 ng of vaccinia topoisomerase were incubated for 15 min at 37 °C. A mixture containing DNA modified at -1 phosphodiester on the 18-mer was incubated for 240 min at 37 °C. The reactions were quenched with 1% SDS. Half of the sample was digested for 2 h at 37 °C with 10 µg of proteinase K and the other half was not digested. The mixtures were adjusted to 47% formamide, heat-denatured, and electrophoresed through a 20% denaturing polyacrylamide gel containing 7 M urea in TBE (90 mM Tris-borate, 2.5 mM EDTA). The reaction products were visualized by autoradiographic exposure of the gel.

Exonuclease III Digestion-- 5' 32P-labeled standard and 2'-5' modified oligonucleotides were hybridized to complementary 60-mer DNAs at a 1:4 molar ratio of labeled strand to 60-mer. Exonuclease III reaction mixtures (90 µl) containing 66 mM Tris-HCl (pH 8.0), 0.66 mM MgCl2, 3 pmol of 18-mer/60-mer or 30-mer/60-mer DNA, and 2.5 units of E. coli exonuclease III (New England Biolabs) were incubated at 22 °C. Aliquots (10 µl) were withdrawn at the times specified and quenched by adding EDTA to 30 mM final concentration. The samples were adjusted to 47% formamide, heat-denatured, and electrophoresed through a 20% denaturing polyacrylamide gel containing 7 M urea in TBE. The reaction products were visualized by autoradiographic exposure of the gel.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Effects of Single 2'-5' Phosphodiester Modifications within the Scissile CCCTT Strand-- A series of 18-mer scissile strands containing a single 2'-5' phosphodiester at positions +8, +2, +1, -1, -2, and -3 were 5' 32P-labeled and annealed to an unlabeled 30-mer strand to form a "suicide" substrate for vaccinia topoisomerase (Fig. 1). Cleavage results in covalent attachment of a 5' 32P-labeled 12-mer (5'-pCGTGTCGCCCTTp) to the enzyme via Tyr-274. The unlabeled 6-mer leaving strand 5' HOATTCCC dissociates spontaneously from the protein-DNA complex. Loss of the leaving strand drives the reaction toward the covalent state.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 1.   Kinetic analysis of transesterification on substrates containing 2'-5' phosphodiesters. The 18-mer/30-mer substrate is shown with the cleavage site indicated by the arrow. Single 2'-5' phosphodiesters were introduced at the positions specified by the numbers above and below the DNA strands. The structure of the 2'-5' linkage is illustrated on the left. Reaction mixtures containing (per 20 µl) 50 mM Tris-HCl (pH 7.5), 0.3 pmol of 18-mer/30-mer DNA, and 75 ng of topoisomerase were incubated at 37 °C. The kinetics of covalent adduct formation are shown for the unmodified control substrate (middle panel) and the substrate containing a 2'-5' phosphodiester at position -1 of the scissile strand (right panel).

The reaction of topoisomerase with the unmodified control substrate attained an end point of 90% covalent adduct formation, and the reaction was completed within 20 s (Fig. 1). The extent of transesterification after 5 s was 80% of the end point value. From this datum, we calculated a single-turnover cleavage rate constant of 0.3 s-1 (Table I). Introduction of a 2'-5' phosphodiester at positions +8, +2, -2, or -3 had no significant effect on the reaction end point or the cleavage rate constant (Table I). In contrast, a 2'-5' phosphodiester at position -1 reduced the rate of transesterification by a factor of 500 (kobs = 6.2 × 10-4 s-1) (Fig. 1, Table I). The kobs for the -1 modified substrate did not increase when the concentration of topoisomerase in the reaction mixture was increased 2-fold (not shown). This indicated that the slowed cleavage rate was not caused by a defect in the initial binding of topoisomerase to the substrate.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Effect of single 2'-5' phosphodiesters on DNA cleavage by vaccinia topoisomerase

Placement of a 2'-5' phosphodiester directly at the cleavage site virtually abrogated the transesterification reaction. A mere 3% of the input DNA was cleaved after a 6-day reaction of topoisomerase with the +1 modified substrate (not shown). Although an end point was clearly not attained, we calculated an initial rate of cleavage of the +1 modified strand of 4.2 × 10-6 % s-1. This value reflects a rate decrement of at least 10-6.5 compared with the initial rate of cleavage of the unmodified control DNA. Thus we can estimate that cleavage rate constant for the +1 modified substrate was <1 × 10-7 s-1.

To address whether the 2'-5' phosphodiester substitutions altered the site of cleavage within the 18-mer scissile strand, the reaction products were digested with proteinase K in the presence of SDS to remove the covalently linked topoisomerase. The radiolabeled DNA reaction products were then analyzed by denaturing polyacrylamide gel electrophoresis (Fig. 2). Reaction of topoisomerase with the unmodified control substrate resulted in the appearance of a cluster of radiolabeled species migrating faster than the input 32P-labeled 18-mer strand but slower than a free 32P-labeled 12-mer 5'-pCGTGTCGCCCTTp. (The free 12-mer was generated by peroxidolysis of the covalent topoisomerase-DNA intermediate, Ref. 19.) The cluster consists of the 12-mer 5'-pCGTGTCGCCCTTp linked to one or more amino acids of the topoisomerase. Detection of the covalent oligonucleotide-peptide complex was completely dependent on prior digestion of the sample with proteinase K (Fig. 2). This is because the labeled DNA does not migrate into the polyacrylamide gel when it is bound covalently to the topoisomerase polypeptide. The instructive finding was that the same cluster was produced by proteinase K digestion of the covalent adduct formed by topoisomerase on the scissile strands containing 2'-5' phosphodiesters at positions -3, -2, -1, and +2 (Fig. 2). Thus, the site of covalent adduct formation was unchanged by the modifications. Any shift in the cleavage site, and hence the size of the covalently bound oligonucleotide, would have been readily detected by an altered mobility of the labeled oligonucleotide-peptide adducts. Additional experiments verified that the +8 modification also had no effect on the site of cleavage (not shown).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2.   2'-5' phosphodiesters do not affect the cleavage site specificity of vaccinia topoisomerase. Cleavage reactions and subsequent treatments of the reaction products were performed as described under "Experimental Procedures". An autoradiogram of the polyacrylamide gel is shown. The control substrate contained no modifications. Other substrates contained 2'-5' phosphodiesters in the 5' 32P-labeled scissile strands at the positions specified. The 18-mer scissile strand and a "protein-free" 12-mer produced by peroxidolysis of the covalent intermediate (lane M) (19) are indicated by arrows on the right.

Effects of Single 2'-5' Phosphodiester Modifications within the Nonscissile Strand-- A series of 30-mer nonscissile strands containing a single 2'-5' phosphodiester at positions +3, +2, +1, -1, and -2 were annealed to the unmodified 5' 32P-labeled 18-mer scissile strand (Fig. 1). None of these 2'-5' phosphodiester modifications had a significant effect on the reaction end point or the cleavage rate constant (Table I). The modifications of the nonscissile strand did not alter the site of cleavage within the 18-mer scissile strand (not shown).

Effects of Combining Scissile Strand 2'-5' Modifications with Nonscissile Strand 2'-5' Modifications-- A series of doubly modified substrates containing one 2'-5' phosphodiester in the scissile strand and one 2'-5' phosphodiester in the nonscissile strand was prepared by annealing the modified 32P-labeled 18-mer strands to each of the modified unlabeled 30-mer strands. The substrate combinations and the results of the analysis of transesterification kinetics are shown in Table II.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Cross-strand 2'-5' phosphodiester effects on DNA cleavage

We found that the modifications of the -3 and -2 positions of the scissile strand, which by themselves had no deleterious effect on transesterification, also had no significant effect on the rate of cleavage when combined with any of the five singly substituted complementary strands. (Our operational definition of a significant effect is one that elicits at least a 4-fold change in kobs.) In contrast, the +2 modification of the scissile strand, which also had no deleterious effect per se, was inhibitory when combined with 2'-5' phosphodiester modifications on the complementary strand that were also benign by themselves (Table II). A hierarchy of synergistic effects was evident, whereby "cross-strand" combination with a 2'-5' phosphodiester at position +2 on the nonscissile strand elicited a 100-fold decrement in cleavage rate (kobs = 0.002 s-1), combination with modifications at -1 (kobs = 0.02 s-1) or +3 (kobs = 0.013 s-1) resulted in an order of magnitude rate decrement, and combination with a 2'-5' linkage at +1 slowed cleavage by a factor of 4 (kobs = 0.051 s-1).

The already severe negative effect of the 2'-5' phosphodiester at position -1 of the scissile strand (kobs = 6.2 × 10-4 s-1) was exacerbated by a factor of 8 in combination with 2'-5' phosphodiesters at positions -1 or +2 on the complementary strand (kobs = 7.5 × 10-5 s-1) (Table II). Other modifications of the nonscissile strand did not have a significant impact on cleavage of the -1 modified 18-mer.

Effects of 2'-5' Phosphodiesters on Exonuclease III-- E. coli exonuclease III catalyzes unidirectional digestion of duplex DNA from the 3'-end to liberate 5' dNMP products. The phosphodiesterase activity of exonuclease III is impeded by chemical modifications of the phosphate backbone (20, 21), including the 2'-5' phosphodiester modification studied here (14, 15). To confirm the incorporation of the 2'-5' phosphodiesters during chemical synthesis of the topoisomerase substrate strands and further explore the effects of this modification on the phosphodiesterase activity of exonuclease III, we annealed the 5' 32P-labeled 30-mers containing the complement of the topoisomerase cleavage site to a complementary 60-mer strand and incubated the duplexes with exonuclease III. The 5'-labeled digestion products were resolved by denaturing gel electrophoresis (Fig. 3). All of the unmodified 30-mer was converted after 15-30 min to 5'-labeled species 8-10 nucleotides in length. A ladder of partially digested strands was evident at 5 min. Introduction of a 2'-5' phosphodiester at position -2 resulted in a kinetic roadblock to exonuclease III digestion located 1 nucleotide 3' of the site of the modification (-A2'p5'ApT). The paused species persisted at 30 min and was only slowly converted to a species arrested at the site of modification (-A2'p5'A). There was almost no digestion of the 32P-labeled DNA past this point. Changing the position of the 2'-5' phosphodiester modification elicited a corresponding shift in the site of the impediment to exonuclease III digestion (Fig. 3). In the case of the +1 phosphate modification, the progress of exonuclease III was arrested after 5 min at points 1 and 2 nucleotides 3' of the modified phosphate. After 15 and 30 min, the major products were arrested at the site of modification and 1 nucleotide upstream and only a minority of the DNA strands were degraded past the modified phosphodiester. The upstream block to digestion was apparent, but less pronounced, on the -1 phosphate-modified strand, so that most of the DNA was digested up to the site of the 2'-5' phosphodiester and no further (Fig. 3).


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 3.   Exonuclease III digestion of 2'-5' phosphodiester-modified nonscissile strands. 5' 32P-labeled control and 2'-5' phosphodiester-containing 30-mer oligonucleotides were annealed to a complementary 60-mer to form the tailed duplex molecule shown below the autoradiogram. The DNAs were digested with exonuclease III for 0, 5, 15, or 30 min, and the products were analyzed by polyacrylamide gel electrophoresis. The nucleotide sequences of the 30-mers are displayed next to the cleavage ladders with each letter specifying the 3' nucleotide of the indicated radiolabeled species. The sequence of the ladder was verified by coelectrophoresis of the digests with defined oligonucleotide markers (not shown). Filled diamonds (black-diamond ) are inserted into the sequences at the sites of the 2'-5' phosphodiester modifications.

The 5' 32P-labeled 18-mers containing the CCCTT topoisomerase cleavage site were also annealed to a complementary 60-mer strand and digested with exonuclease III (Fig. 4). Here again, the 2'-5' modifications arrest exonuclease III at sites 1 and 2 nucleotides 3' of the modified phosphodiester and, as the reaction proceeds, at the modified phosphodiester itself. These results indicate that exonuclease III can sense the conformation of the DNA backbone in advance of the position of its active site.


View larger version (64K):
[in this window]
[in a new window]
 
Fig. 4.   Exonuclease III digestion of 2'-5' phosphodiester-modified scissile strands. 5' 32P-labeled control and 2'-5' phosphodiester-containing 18-mer oligonucleotides were annealed to a 60-mer to form the tailed duplex molecule shown below the autoradiogram. The DNAs were digested with exonuclease III for 0, 2, 5, 15, or 30 min and the products were analyzed by polyacrylamide gel electrophoresis. The nucleotide sequences of the 18-mers are displayed next to the cleavage ladders with each letter specifying the 3' nucleotide of the indicated radiolabeled species. Filled diamonds (black-diamond ) are inserted into the sequences at the sites of the 2'-5' phosphodiester modifications.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Conformational Requirements at the Scissile Phosphodiester Differ between Poxvirus and Cellular Type IB Topoisomerases-- The rate of DNA transesterification by vaccinia topoisomerase was reduced by more than six orders of magnitude by a 2'-5' linkage at the scissile phosphodiester (CCCTT2'pdown-arrow 5'N). Thus, vaccinia topoisomerase is essentially unable to form a DNA-(2'-phosphotyrosyl)-enzyme intermediate. The 2'-5' modification is relatively subtle because it does not alter the charge on the scissile phosphate or introduce bulk. We hypothesize that the altered geometry of the 2'-5' phosphodiester limits the ability of the nucleophile Tyr-274 to attain its requisite apical orientation with respect to the 5'-OH leaving group. Additional perturbations of contacts of the phosphate oxygens with the catalytic Arg-130, Arg-223, His-265, and Lys-167 side chains in the ground state or the transition state may also contribute to the inability of the poxvirus enzyme to cleave the 2'-5' phosphodiester.

Arslan et al. (14, 15) showed that mammalian topoisomerase I is quite capable of cleaving a 2'-5' phosphodiester to form a DNA-(2'-phosphotyrosyl)-enzyme intermediate, although the extent of the reaction at the modified phosphodiester was reduced because the enzyme was diverted to an alternative (unmodified) cleavage site 2 nucleotides upstream. Apparently, the active site of the mammalian type IB topoisomerase is better able to accommodate the altered geometry of a 2'-5' phosphodiester. Note that the mammalian enzyme is also much less fastidious than the vaccinia topoisomerase with respect to the nucleotide sequence at the cleavage site. The cellular and poxvirus topoisomerases have a common fold and the same constellation of catalytic side chains (6, 7), but the structural nuances that account for the greater stringency of the poxvirus topoisomerase active site are entirely uncharted.

Interference Effects at the Phosphodiesters Immediately 3' and 5' of the Cleavage Site-- A 2'-5' modification of the -1 phosphate (CCCTTpdown-arrow N2'p5'N) reduced the rate of transesterification by vaccinia topoisomerase by a factor of 500. This effect was an order of magnitude more deleterious than simply removing the -1 phosphate and replacing it by a 3'-OH/5'-OH nick (13). We infer that the 2'-5' modification interference is not caused solely by a perturbation of functional contacts between the topoisomerase and the -1 phosphate. Rather, we invoke an additional effect of the unconventional 2'-5' linkage on the conformation of either the adjacent -2 nucleoside (CCCTTpdown-arrow A2'p5'T) or the -1 nucleoside (CCCTTpdown-arrow A2'p5'T) or both. Note that removal of the -1 phosphate plus the -2T nucleoside reduces the cleavage rate by three orders of magnitude (13), which is similar to the effect elicited by the 2'-5' modification of the -1 phosphate. It is also conceivable that a 2'-5' modification of the -1 phosphate affects the conformation of the adjacent (unmodified) scissile phosphodiester in such a way as to make it unfavorable for transesterification chemistry. Mammalian topoisomerase I also displays profound interference of cleavage by a 2'-5' phosphodiester immediately 3' of the cleavage site (14, 15).

A 2'-5' modification of the +2 phosphate (CCCT2'p5Tpdown-arrow N) had no effect on vaccinia topoisomerase. This result was remarkable, given that the introduction of a 3'-OH/5'-PO4 nick at the +2 position slowed the rate of cleavage by a factor of 500 (13). Thus, a modification that preserves the electrostatics on the +2 phosphate and the continuity of the backbone is benign compared to one that breaks the backbone and imposes an extra negative charge. Covalent intermediate formation was also suppressed by introduction of a single 2'-O-methyl moiety on the +2 sugar (10). Apparently, the combination of a 2'-OMe with the standard 3'-5' phosphodiester was more detrimental than substitution of the 2' carbon (as a phosphate ester) in the context of a 3' deoxy sugar. In the crystal structure of vaccinia topoisomerase, the side chains of Arg-84, Ser-268, and Ser-270 coordinate a sulfate proposed to correspond to the +2 phosphate of the scissile strand (6). In the mammalian topoisomerase-DNA cocrystal (7), the +2 phosphate interacts with Lys-433, which is the mammalian counterpart of vaccinia Arg-84. Mammalian topoisomerase I is also unaffected by a 2'-5' linkage immediately 5' of the cleavage site. Thus, the relevant contacts to the +2 phosphate appear not to be disrupted by the 2'-5' phosphodiester.

Cross-strand 2'-5' Modification Interference-- Single modifications at five phosphodiesters on the nonscissile strand had no significant effect on transesterification by vaccinia topoisomerase. However, some of the nonscissile strand modifications were inhibitory in concert with a 2'-5' phosphodiester at positions +2 or -1 on the scissile strand. Indeed, modification of the -1 or +2 phosphodiesters of the nonscissile strand elicited 10-fold synergistic effects in combination with scissile strands containing either +2 or -1 phosphate modifications. The most severe synergistic effect (100-fold) was observed with 2'-5' modifications at the +2 positions of both DNA strands. Insofar as the observed negative cross-strand effects involve phosphates located on opposite faces of the B-form DNA duplex, a simple interpretation of the data is that certain local distortions of the duplex in the vicinity of the scissile phosphate adversely affect the transesterification reaction.

2'-5' Phosphodiester Effects on Exonuclease III-- Exonuclease III employs a one-step in-line mechanism in which an activated water attacks the scissile phosphodiester (which is coordinated to an essential divalent cation) and expels the 3'-O of the upstream nucleotide of the DNA strand (22). Exonuclease III is clearly impeded from hydrolyzing a 2'-5' phosphodiester. We presume that the altered geometry affects the correct positioning of the attacking nucleophile relative to the new 2'-O leaving group. The block to cleavage at the modified phosphodiester, which is not surprising per se, is overshadowed by two other aspects of our findings. First, we observed that that exonuclease III, though slowed by the 2'-5' linkage, is nonetheless capable of degrading a fraction of the input DNA strands beyond the modification site. This result raises the interesting question of whether exonuclease III traverses the block directly by hydrolyzing the 2'-5' phosphodiester linkage or by skipping over the modified linkage and cleaving the DNA at the next available standard phosphodiester bond. (It is also possible that a contaminating endonuclease in the commercial exonuclease III preparation is responsible for traversal of the modified phosphodiester.) Second, we observed that exonuclease III is consistently arrested at positions 1 and 2 nucleotides prior to the encounter of its active site with the modified 2'-5' phosphodiester. This result implies that exonuclease III surveys or senses the phosphate backbone in advance of the active site.

    FOOTNOTES

* This work was supported by National Institutes of Health Grants GM46330 (to S. S.) and CA78415 (to S. M. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Tel.: 212-639-7145; Fax: 212-717-3623; E-mail: s-shuman@ski.mskcc.org.

Published, JBC Papers in Press, April 3, 2001, DOI 10.1074/jbc.M102312200

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Shuman, S. (1998) Biochim. Biophys. Acta 1400, 321-337
2. Stivers, J. T., Jagadeesh, G. J., Nawrot, B., Stec, W. J., and Shuman, S. (2000) Biochemistry 39, 5561-5572
3. Wittschieben, J., and Shuman, S. (1997) Nucleic Acids Res. 25, 3001-3008
4. Petersen, B. Ø., and Shuman, S. (1997) J. Biol. Chem. 272, 3891-3896
5. Cheng, C., Wang, L. K., Sekiguchi, J., and Shuman, S. (1997) J. Biol. Chem. 272, 8263-8269
6. Cheng, C., Kussie, P., Pavletich, N., and Shuman, S. (1998) Cell 92, 841-850
7. Redinbo, M. R., Stewart, L., Kuhn, P., Champoux, J. J., and Hol, W. G. J. (1998) Science 279, 1504-1513
8. Krogh, B. O., and Shuman, S. (2000) Mol. Cell 5, 1035-1041
9. Sekiguchi, J., and Shuman, S. (1994) J. Biol. Chem. 269, 31731-31734
10. Shuman, S., and Turner, J. (1993) J. Biol. Chem. 268, 18943-18950
11. Sekiguchi, J., and Shuman, S. (1996) EMBO J. 15, 3448-3457
12. Sekiguchi, J., and Shuman, S. (1996) J. Biol. Chem. 271, 19436-19442
13. Cheng, C., and Shuman, S. (1999) Biochemistry 38, 16599-16612
14. Arslan, T., Abraham, A. T., and Hecht, S. M. (1998) J. Biol. Chem. 273, 12383-12390
15. Arslan, T., Abraham, A. T., and Hecht, S. M. (1998) Nucleosides Nucleotides 17, 515-530
16. Rizzo, C. J., Dougherty, J. P., and Breslow, R. (1992) Tetrahedron Lett. 33, 4129-41332
17. Dougherty, J. P., Rizzo, C. J., and Breslow, R. (1992) J. Am. Chem. Soc. 114, 6254-6255
18. Shuman, S., Golder, M., and Moss, B. (1988) J. Biol. Chem. 263, 16401-16407
19. Krogh, B. O., and Shuman, S. (2000) Biochemistry 39, 6422-6432
20. Putney, S. D., Benkovic, S. J., and Schimmel, P. R. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 7350-7354
21. Porter, K. W., Briley, J. D., and Shaw, B. R. (1997) Nucleic Acids Res. 25, 1611-1617
22. Mol, C. D., Kuo, C. F., Thayer, M. M., Cunningham, R. P., and Tainer, J. A. (1995) Nature 374, 381-386


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Yakovleva, S. Chen, S. M. Hecht, and S. Shuman
Chemical and Traditional Mutagenesis of Vaccinia DNA Topoisomerase Provides Insights to Cleavage Site Recognition and Transesterification Chemistry
J. Biol. Chem., June 6, 2008; 283(23): 16093 - 16103.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Tian, J. M. Sayer, D. M. Jerina, and S. Shuman
Individual Nucleotide Bases, Not Base Pairs, Are Critical for Triggering Site-specific DNA Cleavage by Vaccinia Topoisomerase
J. Biol. Chem., September 17, 2004; 279(38): 39718 - 39726.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Yakovleva, C. J. Handy, J. M. Sayer, M. Pirrung, D. M. Jerina, and S. Shuman
Benzo[c]phenanthrene Adducts and Nogalamycin Inhibit DNA Transesterification by Vaccinia Topoisomerase
J. Biol. Chem., May 28, 2004; 279(22): 23335 - 23342.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Yakovleva, L. Tian, J. M. Sayer, G. P. Kalena, H. Kroth, D. M. Jerina, and S. Shuman
Site-specific DNA Transesterification by Vaccinia Topoisomerase: EFFECTS OF BENZO[{alpha}]PYRENE-dA, 8-OXOGUANINE, 8-OXOADENINE, AND 2-AMINOPURINE MODIFICATIONS
J. Biol. Chem., October 24, 2003; 278(43): 42170 - 42177.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Tian, J. M. Sayer, H. Kroth, G. Kalena, D. M. Jerina, and S. Shuman
Benzo[a]pyrene-dG Adduct Interference Illuminates the Interface of Vaccinia Topoisomerase with the DNA Minor Groove
J. Biol. Chem., March 7, 2003; 278(11): 9905 - 9911.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. O. Krogh and S. Shuman
Proton Relay Mechanism of General Acid Catalysis by DNA Topoisomerase IB
J. Biol. Chem., February 15, 2002; 277(8): 5711 - 5714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/24/20907    most recent
M102312200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krogh, B. O.
Right arrow Articles by Shuman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krogh, B. O.
Right arrow Articles by Shuman, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.