![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 24, 20907-20912, June 15, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, March 14, 2001
Vaccinia topoisomerase forms a
covalent DNA-(3'-phosphotyrosyl)-enzyme intermediate at a
pentapyrimidine target site 5'-CCCTTp Type IB topoisomerases modulate the topological state of DNA by
cleaving and rejoining one strand of the DNA duplex. Cleavage is a
transesterification reaction in which the scissile Np The stereochemical outcome of the net cleavage-religation reaction of
vaccinia topoisomerase is a retention of configuration at the scissile
phosphodiester. This suggests that the component cleavage and
religation reactions entail in-line SN2-type displacements in which the attacking nucleophile is apical to the leaving group and
each transesterification results in an inversion of configuration (2).
Four conserved amino acid side chains of vaccinia topoisomerase (Arg-130, Lys-167, Arg-223, and His-265) are required for catalysis (3-5). Mutational and structural data suggest that the two arginines and the histidine interact directly with the scissile phosphodiester and enhance catalysis by stabilizing the developing negative charge on
a pentacoordinate phosphorane transition state (2-7). Lys-167 serves
as a general acid catalyst during the cleavage reaction, donating a
proton to expel the 5'-OH leaving group (8).
Type IB topoisomerases engage the DNA target site circumferentially,
forming a C-shaped clamp around the duplex (6, 7, 9). The DNA moieties
that contribute to target site recognition and enable catalysis by
vaccinia topoisomerase have been examined using synthetic substrates
containing a single CCCTT site. Modification interference, modification
protection, base and sugar analog substitution, and UV cross-linking
experiments indicate that vaccinia topoisomerase makes contact with
specific bases and phosphates of DNA in the vicinity of the CCCTT
element (9-12). For example, dimethyl sulfate protection and
interference experiments revealed interactions with the three guanine
bases of the pentamer motif complementary strand (3'-GGGAA)
(10), and permanganate oxidation interference highlighted a functional
interaction with the +2T base of the scissile strand
(CCCTT) (12).
Functionally relevant phosphates were initially identified by studying
the effects of phosphate ethylation on topoisomerase binding (9).
Ethylation of the +1, +2, +3, and +4 phosphates on the scissile
strand (positions
CpCpTpTp Here we present a more subtle modification interference analysis in
which we investigate the positional effects of introducing single 2'-5'
phosphodiesters in lieu of a standard 3'-5' phosphodiester linkage (14,
15). This approach imposes no alteration in net charge or size of the
phosphate moiety and is better suited than previous modification
methods to dissect the role of phosphate orientation in site
recognition and transesterification chemistry. The instructive
findings are that vaccinia topoisomerase is insensitive to single
2'-5' phosphodiester modifications, with two exceptions: the rate of
single-turnover transesterification is suppressed by six orders of
magnitude by a 2'-5' substitution for the scissile phosphodiester
(CCCTT2'p DNA Substrates--
Modified oligonucleotides containing a
single 2'-5' phosphodiester bond were synthesized as described
(14-17). Unmodified oligonucleotides were purchased from
BIOSOURCE International.
Vaccinia Topoisomerase--
Recombinant vaccinia topoisomerase
was produced in Escherichia coli(BL21) by infection with
bacteriophage DNA Transesterification--
Standard or 2'-5' modified 18-mer
scissile strands d(CGTGTCGCCCTTATTCCC) were 5' 32P-labeled
by enzymatic phosphorylation in the presence of
[ Cleavage Site Specificity--
Reaction mixtures (20 µl)
containing 50 mM Tris-HCl (pH 7.5), 0.3 pmol of standard or
2'-5' modified 18-mer/30-mer DNA, and 75 ng of vaccinia topoisomerase
were incubated for 15 min at 37 °C. A mixture containing DNA
modified at Exonuclease III Digestion--
5' 32P-labeled
standard and 2'-5' modified oligonucleotides were hybridized to
complementary 60-mer DNAs at a 1:4 molar ratio of labeled strand to
60-mer. Exonuclease III reaction mixtures (90 µl) containing 66 mM Tris-HCl (pH 8.0), 0.66 mM
MgCl2, 3 pmol of 18-mer/60-mer or 30-mer/60-mer DNA, and
2.5 units of E. coli exonuclease III (New England Biolabs)
were incubated at 22 °C. Aliquots (10 µl) were withdrawn at the
times specified and quenched by adding EDTA to 30 mM final
concentration. The samples were adjusted to 47% formamide,
heat-denatured, and electrophoresed through a 20% denaturing
polyacrylamide gel containing 7 M urea in TBE. The reaction
products were visualized by autoradiographic exposure of the gel.
Effects of Single 2'-5' Phosphodiester Modifications within the
Scissile CCCTT Strand--
A series of 18-mer scissile strands
containing a single 2'-5' phosphodiester at positions +8, +2, +1,
The reaction of topoisomerase with the unmodified control substrate
attained an end point of 90% covalent adduct formation, and the
reaction was completed within 20 s (Fig. 1). The extent of
transesterification after 5 s was 80% of the end point value. From this datum, we calculated a single-turnover cleavage rate constant
of 0.3 s
Placement of a 2'-5' phosphodiester directly at the cleavage site
virtually abrogated the transesterification reaction. A mere 3% of the
input DNA was cleaved after a 6-day reaction of topoisomerase with the
+1 modified substrate (not shown). Although an end point was clearly
not attained, we calculated an initial rate of cleavage of the +1
modified strand of 4.2 × 10
To address whether the 2'-5' phosphodiester substitutions altered the
site of cleavage within the 18-mer scissile strand, the reaction
products were digested with proteinase K in the presence of SDS to
remove the covalently linked topoisomerase. The radiolabeled DNA
reaction products were then analyzed by denaturing polyacrylamide gel
electrophoresis (Fig. 2). Reaction of
topoisomerase with the unmodified control substrate resulted in the
appearance of a cluster of radiolabeled species migrating faster than
the input 32P-labeled 18-mer strand but slower than a free
32P-labeled 12-mer 5'-pCGTGTCGCCCTTp. (The free 12-mer was
generated by peroxidolysis of the covalent topoisomerase-DNA
intermediate, Ref. 19.) The cluster consists of the 12-mer
5'-pCGTGTCGCCCTTp linked to one or more amino acids of the
topoisomerase. Detection of the covalent oligonucleotide-peptide
complex was completely dependent on prior digestion of the sample with
proteinase K (Fig. 2). This is because the labeled DNA does not migrate
into the polyacrylamide gel when it is bound covalently to the
topoisomerase polypeptide. The instructive finding was that the same
cluster was produced by proteinase K digestion of the covalent adduct formed by topoisomerase on the scissile strands containing 2'-5' phosphodiesters at positions Effects of Single 2'-5' Phosphodiester Modifications within the
Nonscissile Strand--
A series of 30-mer nonscissile strands
containing a single 2'-5' phosphodiester at positions +3, +2, +1,
Effects of Combining Scissile Strand 2'-5' Modifications with
Nonscissile Strand 2'-5' Modifications--
A series of doubly
modified substrates containing one 2'-5' phosphodiester in the scissile
strand and one 2'-5' phosphodiester in the nonscissile strand was
prepared by annealing the modified 32P-labeled 18-mer
strands to each of the modified unlabeled 30-mer strands. The substrate
combinations and the results of the analysis of transesterification
kinetics are shown in Table II.
We found that the modifications of the
The already severe negative effect of the 2'-5' phosphodiester at
position Effects of 2'-5' Phosphodiesters on Exonuclease III--
E.
coli exonuclease III catalyzes unidirectional digestion of duplex
DNA from the 3'-end to liberate 5' dNMP products. The phosphodiesterase
activity of exonuclease III is impeded by chemical modifications of the
phosphate backbone (20, 21), including the 2'-5' phosphodiester
modification studied here (14, 15). To confirm the incorporation of the
2'-5' phosphodiesters during chemical synthesis of the topoisomerase
substrate strands and further explore the effects of this modification
on the phosphodiesterase activity of exonuclease III, we annealed the
5' 32P-labeled 30-mers containing the complement of the
topoisomerase cleavage site to a complementary 60-mer strand and
incubated the duplexes with exonuclease III. The 5'-labeled digestion
products were resolved by denaturing gel electrophoresis (Fig.
3). All of the unmodified 30-mer was
converted after 15-30 min to 5'-labeled species 8-10 nucleotides in
length. A ladder of partially digested strands was evident at 5 min.
Introduction of a 2'-5' phosphodiester at position
The 5' 32P-labeled 18-mers containing the CCCTT
topoisomerase cleavage site were also annealed to a complementary
60-mer strand and digested with exonuclease III (Fig.
4). Here again, the 2'-5' modifications
arrest exonuclease III at sites 1 and 2 nucleotides 3' of the modified
phosphodiester and, as the reaction proceeds, at the modified
phosphodiester itself. These results indicate that exonuclease
III can sense the conformation of the DNA backbone in advance of the
position of its active site.
Conformational Requirements at the Scissile Phosphodiester Differ
between Poxvirus and Cellular Type IB Topoisomerases--
The rate of
DNA transesterification by vaccinia topoisomerase was reduced by
more than six orders of magnitude by a 2'-5' linkage at the scissile
phosphodiester (CCCTT2'p
Arslan et al. (14, 15) showed that mammalian topoisomerase I
is quite capable of cleaving a 2'-5' phosphodiester to form a
DNA-(2'-phosphotyrosyl)-enzyme intermediate, although the extent of the
reaction at the modified phosphodiester was reduced because the enzyme
was diverted to an alternative (unmodified) cleavage site 2 nucleotides
upstream. Apparently, the active site of the mammalian type IB
topoisomerase is better able to accommodate the altered geometry of a
2'-5' phosphodiester. Note that the mammalian enzyme is also much less
fastidious than the vaccinia topoisomerase with respect to the
nucleotide sequence at the cleavage site. The cellular and poxvirus
topoisomerases have a common fold and the same constellation of
catalytic side chains (6, 7), but the structural nuances that account
for the greater stringency of the poxvirus topoisomerase active site
are entirely uncharted.
Interference Effects at the Phosphodiesters Immediately 3' and 5'
of the Cleavage Site--
A 2'-5' modification of the
A 2'-5' modification of the +2 phosphate
(CCCT2'p5Tp Cross-strand 2'-5' Modification Interference--
Single
modifications at five phosphodiesters on the nonscissile strand had no
significant effect on transesterification by vaccinia topoisomerase.
However, some of the nonscissile strand modifications were inhibitory
in concert with a 2'-5' phosphodiester at positions +2 or 2'-5' Phosphodiester Effects on Exonuclease III--
Exonuclease
III employs a one-step in-line mechanism in which an activated water
attacks the scissile phosphodiester (which is coordinated to an
essential divalent cation) and expels the 3'-O of the upstream
nucleotide of the DNA strand (22). Exonuclease III is clearly impeded
from hydrolyzing a 2'-5' phosphodiester. We presume that the altered
geometry affects the correct positioning of the attacking nucleophile
relative to the new 2'-O leaving group. The block to cleavage at the
modified phosphodiester, which is not surprising per se, is
overshadowed by two other aspects of our findings. First, we observed
that that exonuclease III, though slowed by the 2'-5' linkage, is
nonetheless capable of degrading a fraction of the input DNA strands
beyond the modification site. This result raises the interesting
question of whether exonuclease III traverses the block directly by
hydrolyzing the 2'-5' phosphodiester linkage or by skipping over the
modified linkage and cleaving the DNA at the next available standard
phosphodiester bond. (It is also possible that a contaminating
endonuclease in the commercial exonuclease III preparation is
responsible for traversal of the modified phosphodiester.) Second, we
observed that exonuclease III is consistently arrested at positions 1 and 2 nucleotides prior to the encounter of its active site with the
modified 2'-5' phosphodiester. This result implies that exonuclease III
surveys or senses the phosphate backbone in advance of the active site.
*
This work was supported by National Institutes of Health
Grants GM46330 (to S. S.) and CA78415 (to S. M. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. Tel.:
212-639-7145; Fax: 212-717-3623; E-mail: s-shuman@ski.mskcc.org.
Published, JBC Papers in Press, April 3, 2001, DOI 10.1074/jbc.M102312200
Effect of 2'-5' Phosphodiesters on DNA Transesterification by
Vaccinia Topoisomerase*
,
¶
Molecular Biology Program, Sloan-Kettering
Institute, New York, New York 10021 and the § Departments of
Chemistry and Biology, University of Virginia, Charlottesville,
Virginia 22901
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
in duplex DNA. By
introducing single 2'-5' phosphodiesters in lieu of a standard
3'-5' phosphodiester linkage, we illuminate the contributions of
phosphodiester connectivity to DNA transesterification. We find
that the DNA cleavage reaction was slowed by more than six orders of
magnitude when a 2'-5' linkage was present at the scissile
phosphodiester (CCCTT2'p
5'A). Thus,
vaccinia topoisomerase is unable to form a DNA-(2'-phosphotyrosyl)-enzyme intermediate. We hypothesize that the
altered geometry of the 2'-5' phosphodiester limits the ability of the
tyrosine nucleophile to attain a requisite, presumably apical
orientation with respect to the 5'-OH leaving group. A 2'-5'
phosphodiester located to the 3' side of the cleavage site (CCCTTp
N2'p5'N) reduced the rate of
transesterification by a factor of 500. In contrast, 2'-5'
phosphodiesters at four other sites in the scissile strand
(TpCGCCCTpT
ATpTpC) and five positions in the nonscissile strand
(3'-GGGpApApTpApA) had no effect on transesterification rate. The DNAs
containing 2'-5' phosphodiesters were protected from digestion by
exonuclease III. We found that exonuclease III was
consistently arrested at positions 1 and 2 nucleotides prior to the
encounter of its active site with the modified 2'-5' phosphodiester and
that the 2'-5' linkage itself was poorly hydrolyzed by exonuclease III.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
N
phosphodiester is attacked by a tyrosine of the enzyme, resulting in
the formation of a DNA-(3'-phosphotyrosyl)enzyme intermediate and
the expulsion of a DNA strand having a 5'-OH terminus. In the
religation step, the DNA 5'-OH group attacks the covalent intermediate
resulting in expulsion of the active site tyrosine and restoration of
the DNA phosphodiester backbone. Vaccinia topoisomerase is a prototype of the type IB topoisomerase family (1). The poxvirus enzyme is
distinguished from the nuclear topoisomerase I by its compact size (314 amino acids) and its site-specificity in DNA transesterification. Vaccinia topoisomerase binds and cleaves duplex DNA at a
pentapyrimidine target sequence 5'-(T/C)CCTT
. The Tp
nucleotide
(defined as the +1 nucleotide) is linked to Tyr-274 of the enzyme.
within the
pentamer motif) and the +3, +4, and +5 phosphates on the
nonscissile strand (3'-GpGpGpA)
interfered with topoisomerase-DNA complex formation. The relevant
topoisomerase-phosphate contacts are arrayed across the minor
groove of the DNA helix (9). Phosphate ethylation is a relatively crude
modification interference method, insofar as it simultaneously
eliminates the negative charge on the phosphate and introduces a bulky
aliphatic group. Subsequent studies of the catalytic contributions of
individual phosphates have entailed less drastic modifications, for
example replacing the standard 3'-5' phosphodiester by a
3'-OH/5'-PO4 nick (13). This modification interrupts the
DNA backbone and introduces additional negative charge (net charge of
about
1.5 at pH 7.0 at the nick versus
1.0 for the
phosphodiester) but adds only minimal bulk (one extra oxygen). A
3'-OH/5'-PO4 nick in lieu of the scissile phosphodiester
abolished transesterification by vaccinia topoisomerase, but did not
affect the noncovalent binding of topoisomerase to the nicked DNA (13).
This result indicated that vaccinia topoisomerase is an obligate
nucleotidyl-3'-phosphotransferase that cannot transesterify to a 5'
phosphomonoester. Placement of a 3'-OH/5'-PO4 nick at
position +2 (CCCTpTp
) slowed the rate of
transesterification by a factor of 500. A "missing phosphate"
analysis of the DNA target site entailed replacement of phosphodiesters
with a 3'-OH/5'-OH nick, a maneuver that eliminates one negative charge
along with potential hydrogen bonding interactions between the
topoisomerase and the nonbridging phosphate oxygens. This
interference method revealed a contribution of the
1 phosphate of the
scissile strand (CCCTTp
NpN), which enhances the rate of
transesterification by a factor of 40 (13).
5'N) and by a factor of
500 by 2'-5' modification of the
1 phosphate
(CCCTT
N2'p5'N). Vaccinia
topoisomerase displays a more stringent requirement for natural
phosphodiester geometry at the cleavage site than mammalian
topoisomerase I.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
CE6 and then purified from the soluble bacterial
lysate by phosphocellulose chromatography as described previously
(18).
-32P]ATP and T4 polynucleotide kinase. The labeled
oligonucleotides were gel-purified and hybridized to standard or 2'-5'
modified 30-mer oligonucleotides d(TGTAGTCTATCGGAATAAGGGCGACACG) at a
1:4 molar ratio of 18-mer to 30-mer. Transesterification reactions containing (per 20 µl) 50 mM Tris-HCl (pH 7.5), 0.3 pmol
18-mer/30-mer DNA, and 75, 150, or 300 ng of vaccinia topoisomerase
were incubated at 37 °C. Aliquots (20 µl) were withdrawn at the
times specified and quenched immediately with SDS (1% final
concentration). The products were analyzed by electrophoresis through a
10% polyacrylamide gel containing 0.1% SDS. Free DNA migrated near
the dye front. Covalent complex formation was revealed by transfer of
radiolabeled DNA to the topoisomerase polypeptide. The extent of
covalent adduct formation was quantified by scanning the dried gel
using a Fujix BAS2500 Phosphorimager. A plot of the percentage of input
DNA cleaved versus time established the end point values for
cleavage. The data were then normalized to the end point value (defined as 100%), and the cleavage rate constants
(kobs) were calculated by fitting the normalized
data to the equation 100
%cleavage(norm) = 100e
kt. The values of kobs at the
saturating level of input topoisomerase (either 75 or 150 ng) and the
actual end point cleavage values are listed in Tables I and II.
1 phosphodiester on the 18-mer was incubated for 240 min
at 37 °C. The reactions were quenched with 1% SDS. Half of the
sample was digested for 2 h at 37 °C with 10 µg of proteinase
K and the other half was not digested. The mixtures were adjusted to
47% formamide, heat-denatured, and electrophoresed through a 20%
denaturing polyacrylamide gel containing 7 M urea in TBE
(90 mM Tris-borate, 2.5 mM EDTA). The reaction
products were visualized by autoradiographic exposure of the gel.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1,
2, and
3 were 5' 32P-labeled and annealed to an
unlabeled 30-mer strand to form a "suicide" substrate for vaccinia
topoisomerase (Fig. 1). Cleavage results
in covalent attachment of a 5' 32P-labeled 12-mer
(5'-pCGTGTCGCCCTTp) to the enzyme via Tyr-274. The unlabeled 6-mer
leaving strand 5' HOATTCCC dissociates spontaneously from
the protein-DNA complex. Loss of the leaving strand drives the reaction
toward the covalent state.

View larger version (14K):
[in a new window]
Fig. 1.
Kinetic analysis of transesterification
on substrates containing 2'-5' phosphodiesters. The 18-mer/30-mer
substrate is shown with the cleavage site indicated by the arrow.
Single 2'-5' phosphodiesters were introduced at the positions specified
by the numbers above and below the DNA strands. The structure of the
2'-5' linkage is illustrated on the left. Reaction mixtures
containing (per 20 µl) 50 mM Tris-HCl (pH 7.5), 0.3 pmol
of 18-mer/30-mer DNA, and 75 ng of topoisomerase were incubated at
37 °C. The kinetics of covalent adduct formation are shown for the
unmodified control substrate (middle panel) and the
substrate containing a 2'-5' phosphodiester at position
1 of the
scissile strand (right panel).
1 (Table I).
Introduction of a 2'-5' phosphodiester at positions +8, +2,
2, or
3
had no significant effect on the reaction end point or the cleavage
rate constant (Table I). In contrast, a 2'-5' phosphodiester at
position
1 reduced the rate of transesterification by a factor of 500 (kobs = 6.2 × 10
4
s
1) (Fig. 1, Table I). The kobs
for the
1 modified substrate did not increase when the concentration
of topoisomerase in the reaction mixture was increased 2-fold (not
shown). This indicated that the slowed cleavage rate was not caused by
a defect in the initial binding of topoisomerase to the substrate.
Effect of single 2'-5' phosphodiesters on DNA cleavage by vaccinia
topoisomerase
6 % s
1.
This value reflects a rate decrement of at least 10
6.5
compared with the initial rate of cleavage of the unmodified control
DNA. Thus we can estimate that cleavage rate constant for the +1
modified substrate was <1 × 10
7
s
1.
3,
2,
1, and +2 (Fig. 2). Thus, the
site of covalent adduct formation was unchanged by the modifications. Any shift in the cleavage site, and hence the size of the covalently bound oligonucleotide, would have been readily detected by an altered
mobility of the labeled oligonucleotide-peptide adducts. Additional
experiments verified that the +8 modification also had no effect on the
site of cleavage (not shown).

View larger version (42K):
[in a new window]
Fig. 2.
2'-5' phosphodiesters do not affect the
cleavage site specificity of vaccinia topoisomerase. Cleavage
reactions and subsequent treatments of the reaction products were
performed as described under "Experimental Procedures". An
autoradiogram of the polyacrylamide gel is shown. The control substrate
contained no modifications. Other substrates contained 2'-5'
phosphodiesters in the 5' 32P-labeled scissile strands at
the positions specified. The 18-mer scissile strand and a
"protein-free" 12-mer produced by peroxidolysis of the covalent
intermediate (lane M) (19) are indicated by
arrows on the right.
1, and
2 were annealed to the unmodified 5' 32P-labeled
18-mer scissile strand (Fig. 1). None of these 2'-5' phosphodiester
modifications had a significant effect on the reaction end point or the
cleavage rate constant (Table I). The modifications of the nonscissile
strand did not alter the site of cleavage within the 18-mer scissile
strand (not shown).
Cross-strand 2'-5' phosphodiester effects on DNA cleavage
3 and
2 positions of the
scissile strand, which by themselves had no deleterious effect on
transesterification, also had no significant effect on the rate of
cleavage when combined with any of the five singly substituted
complementary strands. (Our operational definition of a significant
effect is one that elicits at least a 4-fold change in
kobs.) In contrast, the +2 modification of the
scissile strand, which also had no deleterious effect per
se, was inhibitory when combined with 2'-5' phosphodiester
modifications on the complementary strand that were also benign by
themselves (Table II). A hierarchy of synergistic effects was evident,
whereby "cross-strand" combination with a 2'-5' phosphodiester at
position +2 on the nonscissile strand elicited a 100-fold decrement in
cleavage rate (kobs = 0.002 s
1),
combination with modifications at
1 (kobs = 0.02 s
1) or +3 (kobs = 0.013 s
1) resulted in an order of magnitude rate decrement, and
combination with a 2'-5' linkage at +1 slowed cleavage by a factor of 4 (kobs = 0.051 s
1).
1 of the scissile strand (kobs = 6.2 × 10
4 s
1) was exacerbated by a
factor of 8 in combination with 2'-5' phosphodiesters at positions
1
or +2 on the complementary strand (kobs = 7.5 × 10
5 s
1) (Table II). Other
modifications of the nonscissile strand did not have a significant
impact on cleavage of the
1 modified 18-mer.
2 resulted in
a kinetic roadblock to exonuclease III digestion located 1 nucleotide
3' of the site of the modification (
A2'p5'ApT). The paused species persisted at
30 min and was only slowly converted to a species arrested at the site
of modification (
A2'p5'A). There was almost
no digestion of the 32P-labeled DNA past this point.
Changing the position of the 2'-5' phosphodiester modification elicited
a corresponding shift in the site of the impediment to exonuclease
III digestion (Fig. 3). In the case of the +1 phosphate modification,
the progress of exonuclease III was arrested after 5 min at points 1 and 2 nucleotides 3' of the modified phosphate. After 15 and 30 min, the major products were arrested at the site of modification and 1 nucleotide upstream and only a minority of the DNA strands were degraded past the modified phosphodiester. The upstream block to
digestion was apparent, but less pronounced, on the
1
phosphate-modified strand, so that most of the DNA was digested up to
the site of the 2'-5' phosphodiester and no further (Fig. 3).

View larger version (84K):
[in a new window]
Fig. 3.
Exonuclease III digestion of 2'-5'
phosphodiester-modified nonscissile strands. 5'
32P-labeled control and 2'-5' phosphodiester-containing
30-mer oligonucleotides were annealed to a complementary 60-mer to form
the tailed duplex molecule shown below the autoradiogram. The DNAs were
digested with exonuclease III for 0, 5, 15, or 30 min, and the products
were analyzed by polyacrylamide gel electrophoresis. The nucleotide
sequences of the 30-mers are displayed next to the cleavage ladders
with each letter specifying the 3' nucleotide of the indicated
radiolabeled species. The sequence of the ladder was verified by
coelectrophoresis of the digests with defined oligonucleotide markers
(not shown). Filled diamonds (
) are inserted into the
sequences at the sites of the 2'-5' phosphodiester modifications.

View larger version (64K):
[in a new window]
Fig. 4.
Exonuclease III digestion of 2'-5'
phosphodiester-modified scissile strands. 5'
32P-labeled control and 2'-5' phosphodiester-containing
18-mer oligonucleotides were annealed to a 60-mer to form the tailed
duplex molecule shown below the autoradiogram. The DNAs were digested
with exonuclease III for 0, 2, 5, 15, or 30 min and the products were
analyzed by polyacrylamide gel electrophoresis. The nucleotide
sequences of the 18-mers are displayed next to the cleavage ladders
with each letter specifying the 3' nucleotide of the indicated
radiolabeled species. Filled diamonds (
) are inserted
into the sequences at the sites of the 2'-5' phosphodiester
modifications.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
5'N).
Thus, vaccinia topoisomerase is essentially unable to form a
DNA-(2'-phosphotyrosyl)-enzyme intermediate. The 2'-5' modification is
relatively subtle because it does not alter the charge on the scissile
phosphate or introduce bulk. We hypothesize that the altered geometry
of the 2'-5' phosphodiester limits the ability of the nucleophile
Tyr-274 to attain its requisite apical orientation with respect to the
5'-OH leaving group. Additional perturbations of contacts of the
phosphate oxygens with the catalytic Arg-130, Arg-223, His-265, and
Lys-167 side chains in the ground state or the transition state may
also contribute to the inability of the poxvirus enzyme to cleave the
2'-5' phosphodiester.
1 phosphate
(CCCTTp
N2'p5'N) reduced the rate
of transesterification by vaccinia topoisomerase by a factor of 500. This effect was an order of magnitude more deleterious than simply
removing the
1 phosphate and replacing it by a 3'-OH/5'-OH nick (13).
We infer that the 2'-5' modification interference is not caused solely
by a perturbation of functional contacts between the topoisomerase and
the
1 phosphate. Rather, we invoke an additional effect of the
unconventional 2'-5' linkage on the conformation of either the adjacent
2 nucleoside
(CCCTTp
A2'p5'T) or the
1 nucleoside
(CCCTTp
A2'p5'T) or
both. Note that removal of the
1 phosphate plus the
2T nucleoside
reduces the cleavage rate by three orders of magnitude (13),
which is similar to the effect elicited by the 2'-5' modification of
the
1 phosphate. It is also conceivable that a 2'-5' modification of
the
1 phosphate affects the conformation of the adjacent (unmodified)
scissile phosphodiester in such a way as to make it unfavorable for
transesterification chemistry. Mammalian topoisomerase I also displays
profound interference of cleavage by a 2'-5' phosphodiester immediately
3' of the cleavage site (14, 15).
N) had no effect on
vaccinia topoisomerase. This result was remarkable, given that the
introduction of a 3'-OH/5'-PO4 nick at the +2 position slowed the rate of cleavage by a factor of 500 (13). Thus, a modification that preserves the electrostatics on the +2 phosphate and
the continuity of the backbone is benign compared to one that breaks
the backbone and imposes an extra negative charge. Covalent intermediate formation was also suppressed by introduction of a single
2'-O-methyl moiety on the +2 sugar (10). Apparently, the
combination of a 2'-OMe with the standard 3'-5' phosphodiester was more detrimental than substitution of the 2' carbon (as a phosphate
ester) in the context of a 3' deoxy sugar. In the crystal structure of
vaccinia topoisomerase, the side chains of Arg-84, Ser-268, and Ser-270
coordinate a sulfate proposed to correspond to the +2 phosphate of the
scissile strand (6). In the mammalian topoisomerase-DNA cocrystal (7),
the +2 phosphate interacts with Lys-433, which is the mammalian
counterpart of vaccinia Arg-84. Mammalian topoisomerase I is also
unaffected by a 2'-5' linkage immediately 5' of the cleavage site.
Thus, the relevant contacts to the +2 phosphate appear not to be
disrupted by the 2'-5' phosphodiester.
1 on the
scissile strand. Indeed, modification of the
1 or +2 phosphodiesters
of the nonscissile strand elicited 10-fold synergistic effects in
combination with scissile strands containing either +2 or
1 phosphate
modifications. The most severe synergistic effect (100-fold) was
observed with 2'-5' modifications at the +2 positions of both DNA
strands. Insofar as the observed negative cross-strand effects involve
phosphates located on opposite faces of the B-form DNA duplex, a simple
interpretation of the data is that certain local distortions of the
duplex in the vicinity of the scissile phosphate adversely affect the
transesterification reaction.
![]()
FOOTNOTES
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Shuman, S.
(1998)
Biochim. Biophys. Acta
1400,
321-337
2.
Stivers, J. T.,
Jagadeesh, G. J.,
Nawrot, B.,
Stec, W. J.,
and Shuman, S.
(2000)
Biochemistry
39,
5561-5572
3.
Wittschieben, J.,
and Shuman, S.
(1997)
Nucleic Acids Res.
25,
3001-3008
4.
Petersen, B. Ø.,
and Shuman, S.
(1997)
J. Biol. Chem.
272,
3891-3896
5.
Cheng, C.,
Wang, L. K.,
Sekiguchi, J.,
and Shuman, S.
(1997)
J. Biol. Chem.
272,
8263-8269
6.
Cheng, C.,
Kussie, P.,
Pavletich, N.,
and Shuman, S.
(1998)
Cell
92,
841-850
7.
Redinbo, M. R.,
Stewart, L.,
Kuhn, P.,
Champoux, J. J.,
and Hol, W. G. J.
(1998)
Science
279,
1504-1513
8.
Krogh, B. O.,
and Shuman, S.
(2000)
Mol. Cell
5,
1035-1041
9.
Sekiguchi, J.,
and Shuman, S.
(1994)
J. Biol. Chem.
269,
31731-31734
10.
Shuman, S.,
and Turner, J.
(1993)
J. Biol. Chem.
268,
18943-18950
11.
Sekiguchi, J.,
and Shuman, S.
(1996)
EMBO J.
15,
3448-3457
12.
Sekiguchi, J.,
and Shuman, S.
(1996)
J. Biol. Chem.
271,
19436-19442
13.
Cheng, C.,
and Shuman, S.
(1999)
Biochemistry
38,
16599-16612
14.
Arslan, T.,
Abraham, A. T.,
and Hecht, S. M.
(1998)
J. Biol. Chem.
273,
12383-12390
15.
Arslan, T.,
Abraham, A. T.,
and Hecht, S. M.
(1998)
Nucleosides Nucleotides
17,
515-530
16.
Rizzo, C. J.,
Dougherty, J. P.,
and Breslow, R.
(1992)
Tetrahedron Lett.
33,
4129-41332
17.
Dougherty, J. P.,
Rizzo, C. J.,
and Breslow, R.
(1992)
J. Am. Chem. Soc.
114,
6254-6255
18.
Shuman, S.,
Golder, M.,
and Moss, B.
(1988)
J. Biol. Chem.
263,
16401-16407
19.
Krogh, B. O.,
and Shuman, S.
(2000)
Biochemistry
39,
6422-6432
20.
Putney, S. D.,
Benkovic, S. J.,
and Schimmel, P. R.
(1981)
Proc. Natl. Acad. Sci. U. S. A.
78,
7350-7354
21.
Porter, K. W.,
Briley, J. D.,
and Shaw, B. R.
(1997)
Nucleic Acids Res.
25,
1611-1617
22.
Mol, C. D.,
Kuo, C. F.,
Thayer, M. M.,
Cunningham, R. P.,
and Tainer, J. A.
(1995)
Nature
374,
381-386
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
L. Yakovleva, S. Chen, S. M. Hecht, and S. Shuman Chemical and Traditional Mutagenesis of Vaccinia DNA Topoisomerase Provides Insights to Cleavage Site Recognition and Transesterification Chemistry J. Biol. Chem., June 6, 2008; 283(23): 16093 - 16103. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tian, J. M. Sayer, D. M. Jerina, and S. Shuman Individual Nucleotide Bases, Not Base Pairs, Are Critical for Triggering Site-specific DNA Cleavage by Vaccinia Topoisomerase J. Biol. Chem., September 17, 2004; 279(38): 39718 - 39726. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yakovleva, C. J. Handy, J. M. Sayer, M. Pirrung, D. M. Jerina, and S. Shuman Benzo[c]phenanthrene Adducts and Nogalamycin Inhibit DNA Transesterification by Vaccinia Topoisomerase J. Biol. Chem., May 28, 2004; 279(22): 23335 - 23342. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yakovleva, L. Tian, J. M. Sayer, G. P. Kalena, H. Kroth, D. M. Jerina, and S. Shuman Site-specific DNA Transesterification by Vaccinia Topoisomerase: EFFECTS OF BENZO[{alpha}]PYRENE-dA, 8-OXOGUANINE, 8-OXOADENINE, AND 2-AMINOPURINE MODIFICATIONS J. Biol. Chem., October 24, 2003; 278(43): 42170 - 42177. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tian, J. M. Sayer, H. Kroth, G. Kalena, D. M. Jerina, and S. Shuman Benzo[a]pyrene-dG Adduct Interference Illuminates the Interface of Vaccinia Topoisomerase with the DNA Minor Groove J. Biol. Chem., March 7, 2003; 278(11): 9905 - 9911. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. O. Krogh and S. Shuman Proton Relay Mechanism of General Acid Catalysis by DNA Topoisomerase IB J. Biol. Chem., February 15, 2002; 277(8): 5711 - 5714. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |