|
Originally published In Press as doi:10.1074/jbc.M101964200 on March 29, 2001
J. Biol. Chem., Vol. 276, Issue 24, 21184-21191, June 15, 2001
Functional Domains of the Yeast Splicing Factor
Prp22p*
Susanne
Schneider and
Beate
Schwer
From the Department of Microbiology and Immunology, Weill Medical
College of Cornell University, New York, New York 10021
Received for publication, March 5, 2001
 |
ABSTRACT |
The essential Saccharomyces cerevisiae
PRP22 gene encodes a 1145-amino acid DEXH box RNA
helicase. Prp22p plays two roles during pre-mRNA splicing as
follows: it is required for the second transesterification step and for
the release of mature mRNA from the spliceosome. Whereas the step 2 function of Prp22p does not require ATP hydrolysis, spliceosome
disassembly is dependent on the ATPase and helicase activities. Here we
delineate a minimal functional domain, Prp22(262-1145), that
suffices for the activity of Prp22p in vivo when expressed
under the natural PRP22 promoter and for pre-mRNA
splicing activity in vitro. The biologically active domain
lacks an S1 motif (residues 177-256) that had been proposed to play a
role in RNA binding by Prp22p. The deletion mutant Prp22(351-1145) can
function in vivo when provided at a high gene dosage. We
suggest that the segment from residues 262 to 350 enhances Prp22p
function in vivo, presumably by targeting Prp22p to the
spliceosome. We characterize an even smaller catalytic domain,
Prp22(466-1145) that suffices for ATP hydrolysis, RNA binding, and RNA
unwinding in vitro and for nuclear localization in
vivo but cannot by itself support cell growth. However, the ATPase/helicase domain can function in vivo if the
N-terminal region Prp22(1-480) is co-expressed in
trans.
 |
INTRODUCTION |
The Saccharomyces cerevisiae PRP22 gene encodes an
essential 130-kDa protein that plays two roles in pre-mRNA
splicing. Prp22p promotes the second transesterification reaction,
which entails attack of the 3'-OH of the exon on the 3' splice site,
and it then catalyzes the ATP-dependent release of mature
mRNA from the spliceosome (1-4). Prp22p is a member of the
DEXH box family of nucleic acid-dependent
NTPases, which is defined by a set of six conserved motifs that are
located in the central portion of Prp22p. The central NTPase region is
flanked by a 505-amino acid segment N-terminal to motif I
(GETGSGKT513) and a 334-amino acid domain C-terminal
to motif VI (QRKGRAGR811) (Fig. 1). Three other yeast
DEXH box splicing factors, Prp2p, Prp16p, and Prp43p, are
organized likewise and share extensive sequence similarity in their
central and C-terminal portions (5-7). Prp22p, Prp2p, and Prp16p are
RNA-dependent ATPases. Prp22p and Prp16p, but not Prp2p,
can utilize the energy of ATP hydrolysis to unwind duplex RNA (2,
3, 8-10).
ATP hydrolysis by Prp2p, Prp16p, and Prp22p drives sequential steps in
the splicing pathway. Prp2p propels the first transesterification step,
Prp16p the second transesterification step, and Prp22p the disassembly
of the spliceosome (11). Prp43p may also participate in spliceosome
disassembly (7).
The segments flanking the NTPase region of DEXH proteins are
likely to contribute to their biological specificity, e.g.
by facilitating protein-RNA or protein-protein interactions within the
spliceosome. Deletion analysis of Prp16p showed that its unique N-terminal segment is important for Prp16p function in vivo
and in vitro (12, 13). The N terminus of Prp16p appears to
play a role in binding Prp16p to the spliceosome (13).
The ATPase and helicase activities are required for the function of
Prp22 in pre-mRNA splicing. Alanine substitutions in motifs I-III
and VI abolish ATP hydrolysis or uncouple ATP hydrolysis from duplex
unwinding. The ATPase-defective Prp22 mutants are lethal in
vivo and inactive in spliceosome disassembly in vitro, as are Prp22 mutants that retain ATPase activity but are
helicase-defective (2-4). However, nothing is known about the role of
the N- and C-terminal extensions that flank the conserved
ATPase/helicase region. Of particular interest is the N-terminal
segment, which contains an "S1 motif" spanning amino acids 177-256
(1). The S1 motif, which is encountered in a wide variety of
RNA-associated proteins, was originally noted in the ribosomal S1
protein from Escherichia coli (14). It has been suggested
that the S1 motif in Prp22p constitutes an RNA binding domain that may
be important for the function of Prp22 in pre-mRNA splicing
(1).
Here we examine the effects of several N-terminal deletions on Prp22p
function in vivo and in vitro. We delineate a
minimal functional domain, Prp22(262-1145), that lacks the S1 motif
yet suffices for the activity of Prp22p in vivo and for
pre-mRNA splicing activity in vitro. We characterize an
even smaller catalytic domain, Prp22(466-1145), that suffices for ATP
hydrolysis and RNA unwinding in vitro and for nuclear
localization in vivo. We find that the segment 262-350,
located upstream of the catalytic domain, enhances Prp22p function
in vivo by targeting Prp22p to the spliceosome.
 |
EXPERIMENTAL PROCEDURES |
Deletion Mutants of PRP22--
N-terminal deletion mutants were
generated by PCR1
amplification, using oligonucleotide primers that either introduced
NdeI restriction sites at the codons for Met-202, Met-385,
Met-447, and Met-530 or introduced NdeI sites and methionine
codons in lieu of the codons for Glu-50, Ser-109, Lys-261, Gln-301,
Glu-350, Ile-421, Ser-465, and Asn-499. NdeI-XhoI
fragments of the PCR-amplified DNA fragments were inserted into
p358-PRP22 (CEN TRP1) in place of the wild-type
NdeI-XhoI fragment. In this plasmid the Prp22 deletion mutants 50, 109, 201, 261, 301, 350, 384,
421, 446, 465, and 499 were under the control of the
natural PRP22 promoter. The inserts were sequenced
completely in order to exclude the acquisition of unwanted mutations
during amplification and cloning. The open reading frames encoding
wild-type and N-terminal deletion variants 301, 350, 384,
421, 446, and 465 were inserted into the multicopy vector
pYX232 (2 µm TRP1). In this plasmid, expression of
PRP22 was driven by the strong constitutive TPI1 promoter.
Test of Mutational Effects on PRP22 Function in Vivo by Plasmid
Shuffle--
Viability of the prp22 strain YBST1
(Mata ura3-52 trp1-63 his3-200 leu2-1 ade2-101 lys2-801
prp22::LEU2) depends on the plasmid
p360-Prp22 (PRP22 URA3 CEN) (4). YBST1 was transformed with
TRP1 plasmids carrying the various PRP22
mutants. Trp+ transformants were selected and streaked to agar medium
containing 0.75 mg/ml 5-fluoroorotic acid (5-FOA) to select against the
URA3 PRP22 plasmid. The ability of the mutant
PRP22 alleles to support growth on 5-FOA was tested at 25 and 30 °C. 5-FOA survivors were streaked onto YPD medium and
incubated at different temperatures from 14 to 37 °C.
GFP Fluorescence--
The coding sequence for green fluorescent
protein was amplified by PCR and inserted into pYX132 (TRP1
CEN) so that its expression is driven by the TPI1
promoter. An NdeI site was introduced at the end of the
coding sequence to allow insertion of DNA fragments for in-frame
fusions to GFP. The resulting plasmid is p132/GFP (TRP1
CEN). The coding sequences for PRP22 and N-terminal
deletion variants were fused to the 3' end of the GFP sequence.
Wild-type PRP22 cells containing p132/GFP and the various
p132/GFP-PRP22 and p132/GFP-PRP22 plasmids were grown in
SD( Trp) medium. Aliquots of logarithmically growing cultures were
mixed with 50% glycerol and visualized with a fluorescence microscope
(Nikon Eclipse E600). Pictures of the same frame were taken with a SPOT
camera with Nomarski optics and under fluorescent light.
Dominant-negative Effects of ATPase-defective D603A
Mutation--
The PRP22 genes were inserted into pYX133
(CEN TRP1), where their expression is under the
transcriptional control of the GAL1 promoter (4). A
restriction fragment containing the D603A mutation was inserted into
these constructs. The p133Prp22 and p133Prp22 D603A plasmids were
introduced into a wild-type PRP22 strain and transformants
were selected on glucose-containing SC( Trp) medium. Trp+
transformants were streaked onto SC( Trp) agar medium containing
glucose or galactose as the carbon source. The plates were incubated at
30, 25, 19, and 15 °C.
Expression and Purification of Recombinant Prp22
Protein--
Plasmid pET16b-PRP22 expresses an N-terminal His-tagged
version of wild-type Prp22p in bacteria under the control of a T7 promoter (2). Here we constructed pET-based plasmids for expression of
His-tagged Prp22p N-terminal truncation mutants 261, 301, 350,
384, 421, 446, 465, 499, 529, and Prp22(1-480). The expression plasmids were transformed into E. coli strain
BL21-Codon Plus(DE3)RIL (Stratagene). Cultures were inoculated from
single colonies of freshly transformed cells and maintained in
logarithmic growth at 37 °C in LB medium containing 0.1 mg/ml
ampicillin to a final volume of 1 liter. When the
A600 reached 0.6 to 0.8, the cultures were
chilled on ice for 30 min and then adjusted to 0.4 mM
isopropyl -D-thiogalactopyranoside and 2% ethanol. The
cultures were incubated for 16 h at 17 °C with constant
shaking. Cells were harvested by centrifugation, and the pellets were
stored at 80 °C.
All subsequent operations were performed at 4 °C. The cell pellets
were suspended in 100 ml of buffer A (50 mM Tris-HCl, pH 7.4, 250 mM NaCl, 10% sucrose). Lysozyme was added to 0.2 mg/ml, and the suspensions were mixed gently for 30 min and then
adjusted to 0.1% Triton X-100. The lysates were sonicated to reduce
viscosity, and insoluble material was removed by centrifugation for 30 min at 14,000 rpm in a Sorvall SS34 rotor. The solubility of the
N-terminal deletion proteins 261, 301, 350, 384, 421,
446, and 465 was similar to wild-type Prp22p.
The soluble lysates were mixed for 1 h with 10 ml of a 50% slurry
of Ni2+-nitrilotriacetic acid-agarose (Qiagen) that had
been equilibrated in buffer A. The resin was recovered by
centrifugation, resuspended in 40 ml of buffer A, and collected again
by centrifugation. The washed resin was suspended in 40 ml of buffer A
and poured into a column. Adsorbed proteins were eluted stepwise with
25, 100, and 500 mM imidazole in buffer E (50 mM Tris-HCl, pH 7.4, 250 mM NaCl, 10%
glycerol). The elution profiles of recombinant Prp22p were monitored by
SDS-PAGE of the column fractions. Wild-type Prp22p and the truncated
polypeptides were recovered predominantly in the 100 mM
imidazole eluate (comprising 2-10 mg of protein). Peak fractions were
pooled, and aliquots (2-5 mg) of the nickel-agarose Prp22p
preparations were diluted 1:5 with buffer D (50 mM Tris, pH
7.4, 2 mM DTT, 1 mM EDTA, 10% glycerol) and
then mixed for 1 h with 1 ml of phosphocellulose resin that had
been equilibrated with buffer D containing 50 mM NaCl. The
resin was recovered by centrifugation, washed twice with 5 ml of the
same buffer, and then poured into a column, which was eluted stepwise
with buffer D containing 100, 200, 300 and 500 mM NaCl.
Wild-type Prp22p and the Prp22 mutants were recovered predominantly
in the 300 mM NaCl eluate. Aliquots (160-200 µg) of the
phosphocellulose protein preparations were applied to 4.8 ml of
15-30% glycerol gradients containing 250 mM NaCl, 50 mM Tris-HCl, pH 8.0, 2 mM DTT, 1 mM EDTA, 0.1% Triton X-100. The gradients were centrifuged for 18 h
at 47,000 rpm in a Sorvall SW50 rotor. Fractions (0.18 ml) were collected from the tops of the tubes. The elution profiles of the Prp22
variants were gauged by SDS-PAGE. Protein concentrations were
determined by using the Bio-Rad dye-binding reagent with bovine serum
albumin as the standard.
Pre-mRNA Splicing in Vitro--
Yeast whole cell extract
from strain BJ2168 was prepared using the liquid nitrogen method (15).
The extract was immunodepleted using Prp22p affinity-purified
polyclonal antibodies (4). Splicing reaction mixtures (10 µl)
contained 50% Prp22p-depleted extract, 105 cpm (~2 fmol)
of 32P-GMP-labeled actin precursor RNA, 60 mM
potassium phosphate, 2.5 mM MgCl2, and 2 mM ATP. The reaction mixtures were incubated for 10 min at
23 °C, and then 4-5 ng of wild-type or mutant Prp22p was added and
incubation continued for 15 min at 23 or 30 °C. The reactions were
halted by transfer to ice. For the analyses of spliceosome disassembly,
the reaction volumes were increased to 100 µl, and the amounts of
proteins added were 80-100 ng. An aliquot (5 µl) was removed from
each mixture and saved for analysis (Input). The remaining aliquots (95 µl) were layered onto 15-40% glycerol gradients containing 20 mM HEPES, pH 6.5, 100 mM KCl, 2 mM
MgCl2, and then centrifuged at 4 °C for 12 h at
35,000 rpm in a Sorvall TH641 rotor. Fractions (400 µl) were
collected from the tops of the tubes. RNA was recovered by phenol
extraction and ethanol precipitation. RNAs from alternate fractions
were analyzed by electrophoresis through a 6% polyacrylamide (19:1) gel containing 7 M urea in TBE (89 mM Tris
borate, 2 mM EDTA). Radiolabeled RNA was visualized by
autoradiographic exposure of the dried gel and quantitated by scanning
the gel using a STORM PhosphorImager.
ATPase Assay--
Reaction mixtures (20 µl) containing 40 mM Tris-HCl, pH 8.0, 2 mM DTT, 2 mM
MgCl2, 1 mM [ -32P]ATP, 0.5 µg of poly(A), and Prp22 proteins as specified were incubated for 30 min at 30 °C. The reactions were stopped by the addition of 280 µl
of a 5% (w/v) suspension of activated charcoal (Sigma) in 20 mM phosphoric acid. The samples were incubated on ice for
10 min, and the charcoal was recovered by centrifugation. 32P radioactivity in the supernatant was quantitated by
liquid scintillation counting. The results are average values from
duplicate reaction mixes with a deviation of less than 5%.
RNA Binding Assay--
Reaction mixtures (20 µl) contained 40 mM Tris-HCl, pH 8.0, 2 mM DTT, 25 fmol of RNA
substrate, and Prp22 mutant proteins as specified. Mixtures were
incubated at 30 °C for 30 min and transferred to ice, and glycerol
was added to a final concentration of 8%. The reaction products (free
substrate and protein-RNA complex) were resolved by electrophoresis
through an 8% polyacrylamide (30:0.8) gel containing 50 mM
Tris borate, 1 mM EDTA and visualized by autoradiographic
exposure of the dried gel.
RNA Unwinding Assay--
Radiolabeled double-stranded RNA
helicase substrate was prepared as described (16). Briefly, the
component RNA strands were transcribed in vitro from linear
plasmid DNA templates using SP6 and T7 RNA polymerase. The
103-nucleotide lower strand
5'-GGGAGACCGGAAUUAGCUUGUAUUCUAUAGUGUCUCCUAAAUCGUAUGUGUAUGAUACAUAAGGUUAUGUAUUAAUUGUAGCCGCGUUCUAACGACAAUAUGU-3' was labeled to high specific activity with [ -32P]GTP.
The partially complementary 107-mer strand 5'-
GAAUACAAGCUAAUUCCGGUCUCCCUAUAGUGAGUCGUAUUAAUUUCGAUAAGCCAGCUGCAUUAAUGAAUCGGCCAACGCGCGGGGAGAGGCGGUUUGCGUAUUGU-3' was labeled at 300-fold lower specific activity. The 25-bp
complementary region is underlined. The transcription reaction products
were gel-purified and annealed at a 2:1 molar ratio of the 107-mer to
103-mer. The tailed RNA duplexes were then purified by native gel
electrophoresis (17). Reaction mixtures (20 µl), containing 40 mM Tris-HCl, pH 8.0, 2 mM ATP, 2 mM
MgCl2, 2 mM DTT, 25 fmol of RNA substrate, and
20 ng of the indicated proteins, were incubated for 30 min at 37 °C.
Reactions were halted by transfer to ice and addition of 4 µl of
loading buffer (100 mM Tris-HCl, 5 mM EDTA,
0.5% SDS, 50% glycerol, 0.1% (w/v) bromphenol blue and xylene cyanol
dyes, 0.1% Nonidet P-40). Samples were analyzed by electrophoresis through an 8% polyacrylamide gel (30:0.8) containing 50 mM
Tris borate, 1 mM EDTA, and 0.1% SDS.
Trans-complementation in Vivo by N- and C-terminal Domains of
Prp22p--
The N-terminal mutant Prp22(1-480) was generated by PCR
amplification. A 1440-bp NdeI/BamHI fragment was
inserted into the plasmid pG1 (2 µm TRP1) (18), so
that expression of prp22(1-480) was driven by
the constitutive GPD1 promoter. A DNA fragment containing GPD-prp22(1-480) was excised and inserted into an ADE2 CEN
plasmid (pSA360) to yield pSA/GPD-prp22(1-480). The DNA fragment
encoding Prp22(466-1145) was inserted into pYN132 (TRP1
CEN). In the plasmid p132- 465, expression of
prp22(466-1145) was driven by the
TPI1 promoter. The prp22 strain was
transformed with combinations of TRP1 and ADE2
plasmids as follows: PRP22, pSA360 and p358-PRP22 (TRP1 CEN); prp22(466-1145), pSA360
and p132- 465; prp22(1-480), pSA/GPD-prp22(1-480) and pYN132;
prp22(466-1145) + prp22(1-480), p132- 465 and pSA/GPD-prp22(1-480).
Trp+ Ade+ transformants were selected and analyzed by plasmid shuffle.
 |
RESULTS |
Mutational Analysis of the S1 Motif--
Prp22p contains near its
N terminus an S1 motif (aa 177-256), which is found in many
RNA-associated proteins. The S1 motif is conserved in the N termini of
Prp22p homologues from S. pombe, Caenorhabditis
elegans, and human (19-21). The solution structure of the S1 RNA
binding domain from E. coli polynucleotide phosphorylase has
been determined (22), and residues that are important for folding and
implicated in RNA binding have been identified (Fig. 1).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
The minimum functional domain of Prp22p.
The 1145-amino acid Prp22p is depicted as a horizontal bar.
The ATPase/helicase motifs I-VI, which are conserved among members of
the DEXH box family, are indicated as blocks. The
S1 motif spans residues 177-256, and a segment of this region in Prp22
is aligned with S1 motifs from polynucleotide phosphorylase
(EcoPNP) and ribosomal S1 protein from E. coli
(EcoS1). The asterisks above the Prp22 sequence
indicate residues that were substituted by alanines. YBST1 was
transformed with TRP1 plasmids containing the indicated
alleles encoding full-length (WT) and N-terminal truncation
mutants (the designations refer to the number of residues that are
deleted from the N terminus). The PRP22 alleles were either
expressed from the natural PRP22 promoter on CEN
plasmids or from the TPI1 promoter on 2-µm
plasmids. Trp+ transformants were selected and then streaked to medium
containing 5-FOA. Growth was scored as + and failure to form colonies
after 10 days is indicated by .
|
|
In order to assess the importance of these conserved residues for the
biological function of Prp22p, we substituted Gly-183, Arg-186,
Phe-191, Phe-194, His-210, Gly-229, Gln-240, and Lys-244 (Fig. 1) by
alanine. The mutant PRP22 Ala alleles were cloned into
CEN TRP1 plasmids, and their function was tested in
vivo in a prp22 strain using the plasmid shuffle
procedure. Growth of prp22 is dependent on a CEN
URA3 PRP22 plasmid (4). Trp+ transformants were selected and then
tested for growth on medium containing 5-FOA, a drug that selects
against URA3. Wild-type PRP22 cells and the
mutant strains G183A, R186A, F191A,
F196A, H210A, H210A/G229A, and
K244A grew under counterselective conditions. The 5-FOA
survivors all formed colonies on YPD medium at 15, 25, 30, and 37 °C
(data not shown), indicating that individual residues within the S1
motif of Prp22p are not important for growth. This finding prompted us
to determine the minimal domain that was essential for Prp22p function.
Prp22 Deletion Mutants Define a Minimum Essential Domain--
A
series of N-terminal deletion mutants was designed to progressively
truncate the 1145 amino acid Prp22 protein. The in vivo function of the truncated alleles, under the transcriptional control of
the natural PRP22 promoter, was tested using the plasmid
shuffle procedure. Deletion of 50, 109, 201, and 261 amino acid
residues from the N terminus did not affect the biological activity of Prp22p as the deletion mutants all formed colonies on 5-FOA medium (Fig. 1), and they grew as well as wild-type cells on YPD medium at 14, 25, 30, 34, and 37 °C (not shown). Thus, elimination of the S1 motif
had no effect on Prp22p function in vivo.
Deletion alleles prp22 301 and prp22 350,
which were lethal when expressed from the natural PRP22
promoter on a CEN plasmid, could complement the
prp22 strain when provided on a 2-µm plasmid under the transcriptional control of the strong TPI1
promoter. The more extensively truncated mutants
prp22 384, prp22 421, prp22 446, and prp22 465 failed to sustain growth of
prp22 on 5-FOA even when the mutants were expressed at
high gene dosage (not shown).
Determinants of Nuclear Localization of Prp22p--
The green
fluorescent protein (GFP) was fused to the N terminus of wild-type
Prp22p and truncated Prp22 variants. The GFP-PRP22 alleles
were placed on CEN TRP1 plasmids under the control of the
TPI1 promoter and then tested for complementation of the
prp22 strain. The fusion of GFP to full-length Prp22p was
functional in vivo as was GFP-Prp22 350. In contrast,
GFP-Prp22 384, GFP-Prp22 421, GFP-Prp22 446, and GFP-Prp22 465
were unable to sustain growth of prp22 cells (data not shown).
Fluorescence microscopy showed that GFP itself was distributed
throughout the cell (Fig. 2). However,
when GFP was fused to wild-type Prp22p, the fluorescence was
concentrated in the nucleus. Truncated variants GFP-Prp22 350 and
GFP-Prp22 446 were also localized to the nucleus (Fig. 2) as was
GFP-Prp22 465 (not shown). The GFP fluorescence coincided with
4,6-diamidino-2-phenylindole staining of DNA (not shown). These
findings show that (i) a nuclear localization (and/or retention) signal
resides in Prp22(466-1145) and (ii) the lethality of the truncated
alleles 384, 421,
446, and 465 is not
attributable to the failure of nuclear localization of the truncated
polypeptides but most likely to a functional defect of these
proteins.

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 2.
Localization of GFP-Prp22p. Green
fluorescent protein (GFP) was fused to the N terminus of
wild-type Prp22p (GFP-Prp22) and the truncated variants
350 (GFP- 350) and 446
(GFP- 446). The right panel shows
GFP fluorescence, and the left panel shows the outline of
the same cells with Nomarski optics. The photographs were taken with a
Nikon SPOT digital camera at × 1,000 magnification.
|
|
Dominant-negative Growth Inhibition by ATPase-defective
Mutants--
Previous work showed that ATPase-defective
Prp22 mutants inhibit growth of wild-type cells when they are
overexpressed (4). The dominant-negative effects arise because
ATPase-defective mutant proteins bind to spliceosomes and compete with
wild-type Prp22p but then fail to release mature
RNA.2 We reasoned that
introduction of the ATPase-inactivating D603A mutation (in motif II,
the DEAH box) into the 261 and
350 alleles might uncover effects of the
N-terminal region on spliceosome binding. The PRP22 genes
were cloned into CEN TRP1 plasmids under the transcriptional
control of a GAL1 promoter and then introduced into
wild-type PRP22 cells. Trp+ transformants were selected and streaked on agar medium containing either glucose or galactose (Fig.
3). All of the strains grew on
glucose-containing medium, when expression of the plasmid-encoded Prp22
protein was repressed. PRP22, 261,
and 350 grew on galactose. However,
galactose-induced expression of the Prp22-D603A protein inhibited cell
growth (Fig. 3). A strain carrying the
261-D603A mutant formed pinpoint colonies on
galactose-containing medium at 30 °C (Fig. 3) and failed to grow at
lower temperatures (25, 19, and 15 °C, not shown). Overexpression of
the 350-D603A allele caused a modest
inhibition of growth (Fig. 3). The levels of 261 and 350 proteins
at 30 °C were comparable to the level of wild-type Prp22p in
galactose-containing medium as determined by Western blotting using
polyclonal Prp22-specific antibodies (data not shown). We infer from
these findings that 261-D603A was capable of competing with
wild-type Prp22p. However, 350-D603A was less effective, suggesting
a role for residues 262-350 in the interaction of Prp22p with the
spliceosome. This finding agrees with the observed requirement for
increased expression of 350 for cell growth (Fig. 1).

View larger version (78K):
[in this window]
[in a new window]
|
Fig. 3.
Dominant-negative phenotypes. Wild-type
PRP22 cells were transformed with TRP1 CEN
plasmids carrying the indicated PRP22 alleles under the
transcriptional control of the GAL1 promoter.
GAL-PRP22 cells were streaked onto glucose and
galactose-containing medium. The plates were photographed after growth
at 30 °C for 3 and 4 days on glucose and galactose,
respectively.
|
|
Effect of N-terminal Deletions on Prp22 Function in Pre-mRNA
Splicing--
We assayed the deleted Prp22 proteins for their ability
to splice actin pre-mRNA in vitro. Prp22p and the
truncated variants were expressed in bacteria as His-tagged fusions (2,
4). The proteins were purified from soluble lysates by
Ni2+-nitrilotriacetic acid-agarose and phosphocellulose
chromatography and glycerol gradient sedimentation. SDS-PAGE gel
analysis of the peak glycerol gradient fractions showed that the
protein preparations were substantially pure (Fig.
4A).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
N-terminal Prp22p deletion mutants.
A, protein gel. Wild-type (WT) and the indicated
mutant variants of Prp22p were expressed in bacteria and purified by
Ni2+-nitrilotriacetic acid-agarose and phosphocellulose
chromatography, followed by glycerol gradient sedimentation. One µg
of the glycerol gradient preparations was separated by electrophoresis
in an 8% polyacrylamide gel containing 0.1% SDS. Polypeptides were
visualized by staining with Coomassie Blue dye. The positions and sizes
(in kDa) of marker proteins are indicated at the left.
B, effects of N-terminal deletion mutants on actin
pre-mRNA splicing in vitro. Prp22-depleted extract
catalyzed the formation of lariat-exon 2 and exon 1 during 10 min of
incubation at 23 °C. Aliquots of the reaction mixtures were
supplemented with either buffer ( ) or 5 ng of wild-type
(WT) and the indicated truncated Prp22 polypeptides for 15 min at 30 °C. The reaction products were resolved by denaturing PAGE
and visualized by autoradiography. The symbols at the
left indicate the positions of the labeled RNA species (from
top to bottom) as follows: lariat-exon 2; intron
lariat, actin precursor RNA; mature spliced mRNA.
|
|
We tested whether the truncated Prp22 proteins were capable of
complementing the step 2 defect in extracts depleted of Prp22p (Fig.
4B). 32P-Labeled actin pre-mRNA was
incubated in depleted extract to allow for spliceosome assembly and
step 1 transesterification. Aliquots of the reaction mixture were then
supplemented with buffer, wild-type Prp22p, or the mutant proteins
261, 301, 350, 384, 421, or 446. After 15 min at
30 °C, the RNAs were extracted, and the products analyzed by
denaturing PAGE. In the absence of added protein, very little mature
RNA was formed and lariat-exon 2 persisted. Wild-type Prp22p and the
261 protein both promoted step 2 efficiently. The more extensively
truncated Prp22 mutants 301, 350, 384, 421, 446, and
465 were inactive for step 2 complementation in vitro,
i.e. lariat-exon 2 persisted and little mRNA was
produced (Fig. 4B).
Effect of N-terminal Deletion Mutants on Spliceosome
Disassembly--
Prp22p is also important for the release of mature
mRNA from the spliceosome (2). In order to test whether the
truncated Prp22 proteins were active for mRNA release, we used a
customized precursor RNA (Act7) that does not require
Prp22p for step 2 complementation. In the ACT7
pre-mRNA, the distance between the branchpoint and the 3' splice
site is reduced, and splicing of this pre-mRNA in vitro
is independent of the participation of Prp22p and other splicing
factors (2, 23-25). However, complete release of mature Act7 mRNA from the spliceosome still does require
Prp22p (2). We incubated ACT7 pre-mRNA substrate in
Prp22-depleted extract and supplemented the reactions either with
wild-type Prp22p, buffer, or the truncated polypeptides 261, 350,
and 465. Mature mRNA was formed in every case (Fig.
5A). Aliquots of the reaction
mixtures were sedimented in 15-40% glycerol gradients to assess
whether mRNA was released from the spliceosome complex. Fractions
were collected, and the RNA species in every odd fraction were analyzed by denaturing PAGE. The distribution of spliced mRNA across each gradient from top to bottom is shown in Fig. 5B. When the
reactions were carried out in the presence of wild-type Prp22p or the
261 mutant, released mature mRNA sedimented near the top of the
gradient in fractions 7-11. In contrast, when Prp22p was omitted,
mRNA sedimented in two peaks, one corresponding to the released
mRNA (fractions 7-11) and a second heavier peak (fractions 19-23)
corresponding to the spliceosomes. The same two-peak profile was
observed when extracts were supplemented with 350 and 465 (Fig.
5B). We conclude that 261 is active in spliceosome
disassembly, whereas 350 and 465 are defective.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of Prp22p deletion mutants on the
release of mature RNA from the spliceosome. Prp22-depleted extract
was reacted with ACT7 pre-mRNA in the absence ( ) or
presence of wild-type Prp22p (WT), or the mutants 261,
350, and 465. A, aliquots of the reaction mixtures
were analyzed by denaturing PAGE. B, the remainders were
sedimented in 15-40% glycerol gradients. Fractions were collected
from the tops of the gradients, and the RNA species from odd-numbered
fractions were analyzed by denaturing PAGE. The amount of mature RNA in
every fraction was quantitated using a PhosphorImager and is expressed
as percent of total mRNA (sum of mRNA in all fractions). The % of mRNA in each fraction is blotted as a function of the fraction
number (top to bottom).
|
|
ATP Hydrolysis by Truncated Prp22 Polypeptides--
Spliceosome
disassembly is dependent on ATP hydrolysis by Prp22p. To determine if
loss of disassembly function was attributable to the effects of
deletions on ATP hydrolysis, we measured the ATPase activities of the
Prp22p deletion variants (Fig. 4). The proteins were incubated with 1 mM ATP in the presence of poly(A) homopolymer as the RNA
cofactor for 30 min at 30 °C. The extents of ATP hydrolysis
increased linearly with the amounts of Prp22 proteins added (Fig.
6A). Titrations of the 261,
350, 44, and 465 polypeptides indicated that the mutants were
more active than the wild-type Prp22p (Fig. 6A). The
turnover numbers are shown in Fig. 6B. Wild-type Prp22p
hydrolyzed 43 and 400 ATP per min in the absence and presence of an RNA
cofactor, respectively. The 446 mutant protein hydrolyzed 870 ATP
per min in the presence of poly(A) and 128 without RNA cofactor.
Further N-terminal deletions of Prp22p to positions 500 or 530 were
insoluble when expressed in bacteria. These mutants were thus
refractory to purification and biochemical analysis. We conclude that
the N-terminal 465 amino acids of Prp22p are not part of the ATPase
domain. Indeed, deletion of the N-terminal 465 aa results in increased
ATPase activity with and without the poly(A) cofactor.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6.
ATP hydrolysis by N-terminal deletion mutants
of Prp22p. The ATPase activity of wild-type (WT) and
the truncated mutant versions (as indicated) of Prp22p was measured in
the presence of poly(A) cofactor and is plotted as a function of input
Prp22p (in ng). A, the ATPase activity of wild-type Prp22p,
measured in the absence of the RNA cofactor, is also shown
(WT[-RNA]). B, ATPase activities are expressed
as turnover numbers (per min) for the various Prp22p variants.
|
|
RNA Binding and Unwinding of Duplex RNA by Prp22-deletion
Mutants--
The ATPase activity of full-length and truncated Prp22p
variants was stimulated by an RNA cofactor. We surmised that the
proteins retained their capability to bind to RNA and to unwind duplex RNAs. In order to test this directly, a 3'-tailed RNA substrate containing a 25-bp duplex (Fig.
7A) was incubated with the
261 and 446 proteins in the absence of ATP. The mixtures were
analyzed by native PAGE (Fig. 7B). In the absence of
protein, the labeled RNA molecule migrated as a single species in the
native gel. Addition of increasing amounts of 261 and 446
proteins resulted in the appearance of protein-RNA complexes of reduced
mobility. We presume that the appearance of two shifted bands at higher
protein concentrations reflects the sequential binding of one and two
molecules of protein to a single RNA molecule. Note that the 261-RNA
complex migrates more slowly than the complexes formed with 446
polypeptide, which we presume reflects the difference in size of the
RNA-bound Prp22 proteins. Other truncated polypeptides of intermediate
size formed protein-RNA complexes that migrated between the 261-RNA
and 465-RNA complexes (data not shown).

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 7.
RNA binding and unwinding by truncated Prp22p
versions. A, the 3'-tailed RNA duplex used as a
substrate. B, 25 fmol of radiolabeled duplex RNA was
incubated without protein ( ) and increasing amounts (in fmol) of
261 or 446 polypeptides at 30 °C in the absence of ATP. The
reaction mixtures were analyzed by native PAGE. An autoradiograph of
the dried gel is shown, and the positions of the free RNA substrate and
the protein-RNA complex are indicated on the left.
C, the 3'-tailed RNA substrate was incubated in the presence
of ATP with buffer ( ) or with 20 ng of each of wild-type Prp22p
(WT) and the truncated mutant polypeptides as indicated. The
reaction products were resolved by PAGE in the presence of 0.1% SDS;
an autoradiograph of the gel is shown. The positions of the duplex
substrate RNA (ds) and the displaced single-stranded product
(ss) are denoted on the left. An aliquot of the
duplex substrate that was heat-denatured at 95 °C for 5 min and then
quenched ( ) serves as a marker for the position of single-stranded
RNA.
|
|
The same duplex RNA substrate (Fig. 7A) was used to assess
the helicase activity of the truncated Prp22 proteins. Substrate RNA
was incubated with the Prp22p variants in the presence of ATP, and the
products were analyzed by PAGE after disruption of the RNA-protein
interactions by 0.1% SDS (Fig. 7C). The unwound single-stranded RNA species migrated faster than the duplex RNA substrate. Full-length Prp22p (wild type) and the truncated mutant 261, 350, 385, 421, 446, and 465 all were active in
RNA unwinding. Their helicase activities were dependent on ATP (data not shown). The helicase activities of truncated proteins (adjusted to
measure equal molar amounts) were increased compared with wild-type Prp22p. This increase may be due, at least in part, to the higher ATPase activities of the Prp22 deletion mutants. We conclude that the
N-terminal 465 amino acids of the Prp22 protein are not involved in ATP
hydrolysis, RNA binding, and helicase activities.
Prp22(1-480) and Prp22(466-1145) Can Function in Trans to Support
Cell Viability--
Neither the ATPase/helicase domain
Prp22(466-1145) nor the N-terminal polypeptide Prp22(1-480) were
active in pre-mRNA splicing (Fig. 4B and not shown). As
expected, Prp22(1-480) did not hydrolyze ATP (not shown). Neither
Prp22(1-480) nor Prp22(466-1145) alone could support growth of
prp22 cells even when the N- and C-terminal domains were
overexpressed at high gene dosage (not shown and Fig.
8). However, the two segments
Prp22(1-480) and Prp22(466-1145) did support growth of the
prp22 strain when they were expressed in trans
on different plasmid vectors (Fig. 8). The 5-FOA survivors were
streaked to YPD medium at temperatures from 14 to 37 °C. The strain
carrying the prp22(1-480) and the
prp22(466-1145) alleles grew at 25, 30, and
34 °C, but the cells exhibited cold-sensitive and heat-sensitive
growth phenotypes; they failed to grow at 14 and 19 °C and formed
only pinpoint colonies at 37 °C. Wild-type PRP22 cells
grew well at all temperatures. We conclude that the N- and C-terminal
domains can function in trans to sustain cell growth at
temperatures from 25 to 34 °C.

View larger version (96K):
[in this window]
[in a new window]
|
Fig. 8.
Prp22(466-1145) and Prp22(1-480) can
function in trans. prp22 cells were
transformed with PRP22 (WT),
prp22(1-480), or
prp22(466-1145) (see "Experimental
Procedures"). The ability of these alleles to sustain growth of the
prp22 cells was tested using the plasmid shuffle
procedure. The 5-FOA plate was photographed after 3 days at
30 °C.
|
|
 |
DISCUSSION |
Prp22(466-1145) Constitutes an ATPase/Helicase Domain--
Prior
studies have shown that conserved residues in motifs I-III and VI are
essential for the function of Prp22p in pre-mRNA splicing.
Mutational analyses of DEX(H/D) RNA helicases, including Prp22p, vaccinia virus NPH-II, eIF-4A, and hepatitis C virus NS3 highlight the importance of conserved amino acids in these motifs for
NTP hydrolysis and duplex unwinding (2-4, 26-32). Structural studies
of the NS3 helicase show that the catalytic core consists of three
globular domains. Motifs I and II are located in domain 1 and motif VI
in domain 2. Domains 1 and 2 are connected via a flexible linker
segment that includes motif III (33, 34). Motif III (T/SAT) couples ATP
hydrolysis to duplex unwinding (4, 27, 28, 30). Kim et al.
(34) surmised from their crystal structure of NS3 that (i) ATP bridges
domains 1 and 2 and (ii) a conformational change upon ATP hydrolysis
leads to opening of the interdomain cleft and translocation of the
protein along the polynucleotide.
Whereas the importance of the conserved motifs for ATPase/helicase
function is well studied, the impact of the protein regions flanking
motifs I-VI on the biological and enzymatic activities of the
DEXH proteins is poorly understood. Prp22p contains an N-terminal segment of 505 amino acids, but only 46 amino acids upstream
of Lys-512 in motif I (GETGSGKT) are required for ATPase/helicase activity. The helicase domain of NS3 contains a segment 21 aa N-terminal to the lysine in motif I. In the vaccinia DEXH
box protein NPH-I, a DNA-dependent ATPase, the
corresponding lysine residue is at position 61 (35). Thus, a functional
ATPase domain does not require extensive segments upstream of motif I. In Prp22p, residues 1-465 are not only dispensable for ATP hydrolysis
and RNA unwinding, but they appear to repress the enzymatic activities because the deletion mutants are more active than full-length Prp22p.
The C-terminal region of Prp22p is conserved in a subset of
DEXH NTPases, including the splicing factors Prp2p, Prp16p,
and Prp43p. For example, Prp22p is 40% identical and 62% similar to Prp16p over a 300-aa region downstream of motif VI. The RNA helicases vaccinia NPH-II, Drosophila MLE1, and human RNA helicase A
also show similarity to Prp22p beyond motifs I-VI. The structure of NS3 complexed with nucleic acid implicates amino acids in the C-terminal region (domain 3) in RNA binding. The region in Prp22p downstream of motif VI (QRKGRXGR) is 334 amino acids.
Preliminary experiments showed that truncating Prp22p by 87 residues,
leaving a 247-aa segment downstream of motif VI, abrogated Prp22
function in vivo.2 Deletion analyses of Prp16p
have established that 275 amino acids downstream of motif VI sufficed
for cell viability but that 225 did not (12, 13). The viral RNA
helicases NPH-II and NS3 contain 178 and 159 amino acids, respectively,
downstream of motif VI. In the case of the DEXH box protein
NPH-I, deletion analysis has established that 65 amino acids downstream
of motif VI sufficed for full ATP hydrolysis activity (35). Thus, it
appears that a functional ATPase or ATPase/helicase domain requires
amino acids beyond motif VI, but the minimum essential length of the
C-terminal segments may vary for different DEXH proteins.
The C-terminal margin of the ATPase/helicase domain of Prp22(465-1145)
remains to be determined.
The Biologically Active Domains of Prp22p--
The in
vivo and in vitro activities of Prp22(261-1145) are
indistinguishable from those of wild-type Prp22p, demonstrating that
the N-terminal 260 residues, which include an S1 motif (aa 177-256),
are not essential for Prp22p function. However, the minimal
ATPase/helicase domain Prp22(466-1145) does not suffice for the role
of Prp22p in pre-mRNA splicing, thereby indicating the importance
of residues N-terminal to position 465 in Prp22p. However,
Prp22(466-1145) can function in vivo if Prp22(1-480) is
co-expressed, demonstrating that the protein domains can act in
trans. We suggest that both domains are required for the
productive interaction of Prp22p with the splicing apparatus.
The inference that the N-terminal region in Prp22p from aa
262-465 is involved in spliceosome binding is based on the findings that deletion of 350 and 465 amino acids in the ATPase-deficient Prp22-D603A reduced and abolished, respectively, its effectiveness as a
dominant-negative growth inhibitor, whereas 261-D603A was a potent
inhibitor. Although the segment from aa 262 to 465 in Prp22p appears to
be necessary, it is not sufficient to afford spliceosome binding
because Prp22(1-480) did not compete effectively with wild-type
Prp22p. Overexpression of Prp22(1-480) in wild-type PRP22
cells did not lead to growth inhibition, and preincubation of
spliceosomes with Prp22(1-480) protein did not prevent splicing by subsequently added Prp22p in vitro (not shown). Thus,
Prp22p requires both the ATPase/helicase and a region within the
N-terminal domain for spliceosome association. How the two domains
cooperate to provide biological activity in trans remains to
be investigated. It is possible that they interact directly, or
indirectly via another splicing component, to provide a functional
Prp22 protein. Alternatively, the N-terminal domain and the
ATPase/helicase domain may bind independently to the splicing apparatus
and effect splicing.
The DEAH box splicing factor Prp16p also requires its N terminus for
spliceosome binding (13). Prp16(1-300)p alone is capable of binding to
the spliceosome; however, the binding is stabilized by the C-terminal
region (13). As is the case for Prp22p, the two domains of Prp16p do
not need to be physically linked, and the N-terminal 300-aa segment
functions in trans with Prp16(301-1071) to sustain growth
of a prp16 strain (13).
The DEAH box ATPases, Prp2p, Prp16p, and Prp22p act sequentially; each
of the proteins associates with the spliceosome at a distinct stage
during the splicing pathway and dissociates upon ATP hydrolysis (2, 9,
36). It will be interesting to determine whether each of these proteins
makes similar contacts within the splicing apparatus and to analyze the
nature of these contacts at the molecular level.
 |
ACKNOWLEDGEMENTS |
We thank Tamar Meszaros for contributions in
the initial phase of this project. The Department of Microbiology and
Immunology gratefully acknowledges the support of the William Randolph
Hearst Foundation.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant GM50288.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 212-746-6518;
Fax: 212-746-8587; E-mail: bschwer@mail.med.cornell.edu.
Published, JBC Papers in Press, March 29, 2001, DOI 10.1074/jbc.M101964200
2
S. Schneider and B. Schwer, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
PCR, polymerase
chain reaction;
5-FOA, 5-fluoroorotic acid;
GFP, green fluorescent
protein;
PAGE, polyacrylamide gel electrophoresis;
DTT, dithiothreitol;
aa, amino acids;
bp, base pair.
 |
REFERENCES |
| 1.
|
Company, M.,
Arenas, J.,
and Abelson, J.
(1991)
Nature
349,
487-493
|
| 2.
|
Schwer, B.,
and Gross, C. H.
(1998)
EMBO J.
17,
2086-2094
|
| 3.
|
Wagner, J. D. O.,
Jankowsky, E.,
Company, M.,
Pyle, A. M.,
and Abelson, J. N.
(1998)
EMBO J.
17,
2926-2937
|
| 4.
|
Schwer, B.,
and Meszaros, T.
(2000)
EMBO J.
19,
6582-6591
|
| 5.
|
Chen, J. H.,
and Lin, R. J.
(1990)
Nucleic Acids Res.
18,
6447
|
| 6.
|
Burgess, S.,
Couto, J. R.,
and Guthrie, C.
(1990)
Cell
60,
705-717
|
| 7.
|
Arenas, J. E.,
and Abelson, J. N.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
11798-11802
|
| 8.
|
Kim, S. H.,
Smith, J.,
Claude, A.,
and Lin, R. J.
(1992)
EMBO J.
11,
2319-2326
|
| 9.
|
Schwer, B.,
and Guthrie, C.
(1991)
Nature
349,
494-499
|
| 10.
|
Wang, Y.,
Wagner, J. D. O.,
and Guthrie, C.
(1998)
Curr. Biol.
8,
441-451
|
| 11.
|
Kim, S. H.,
and Lin, R. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
888-892
|
| 12.
|
Hotz, H. R.,
and Schwer, B.
(1998)
Genetics
149,
807-814
|
| 13.
|
Wang, Y.,
and Guthrie, C.
(1998)
RNA (NY)
4,
1216-1229
|
| 14.
|
Subramanian, A. R.
(1983)
Prog. Nucleic Acids Res. Mol. Biol.
28,
101-142
|
| 15.
|
Ansari, A.,
and Schwer, B.
(1994)
EMBO J.
14,
4001-4009
|
| 16.
|
Gross, C. H.,
and Shuman, S.
(1995)
J. Virol.
69,
4727-4736
|
| 17.
|
Lee, C. G.,
and Hurwitz, J.
(1992)
J. Biol. Chem.
267,
4398-4407
|
| 18.
|
Shena, M.,
Picard, D.,
and Yamamoto, K.
(1991)
Methods Enzymol.
194,
389-398
|
| 19.
|
Käufer, N. F.,
and Potashkin, J.
(2000)
Nucleic Acids Res.
28,
3001-3010
|
| 20.
|
Puoti, A.,
and Kimble, J.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
3276-3281
|
| 21.
|
Ono, Y.,
Ohno, M.,
and Shimura, Y.
(1994)
Mol. Cell. Biol.
14,
7611-7620
|
| 22.
|
Bycroft, M.,
Hubbard, T. J. P.,
Proctor, M.,
Freund, S. M. V.,
and Murzin, A. G.
(1997)
Cell
88,
235-242
|
| 23.
|
Brys, A.,
and Schwer, B.
(1996)
RNA (NY)
2,
707-717
|
| 24.
|
Zhang, X.,
and Schwer, B.
(1997)
Nucleic Acids Res.
25,
2146-2152
|
| 25.
|
McPheeters, D. S.,
Schwe, B.,
and Muhlenkamp, P.
(2000)
Nucleic Acids Res.
28,
1313-1321
|
| 26.
|
Gross, C. H.,
and Shuman, S.
(1996)
J. Virol.
70,
1706-1713
|
| 27.
|
Gross, C. H.,
and Shuman, S.
(1998)
J. Virol.
72,
4729-4736
|
| 28.
|
Heilek, G. M.,
and Peterson, M. G.
(1997)
J. Virol.
71,
6264-6266
|
| 29.
|
Kim, D. W.,
Kim, J.,
Gwack, Y.,
Han, J. H.,
and Choe, J.
(1997)
J. Virol.
71,
9400-9409
|
| 30.
|
Pause, A.,
and Sonenberg, N.
(1992)
EMBO J.
11,
2643-2654
|
| 31.
|
Pause, A.,
Methot, N.,
and Sonenberg, N.
(1993)
Mol. Cell. Biol.
13,
6789-6798
|
| 32.
|
Chang, S. C.,
Cheng, J. C.,
Kou, Y. H.,
Kao, C. H.,
Chiu, C. H.,
Wu, H. Y.,
and Chang, M. F.
(2000)
J. Virol.
74,
9732-9737
|
| 33.
|
Yao, N.,
Hesson, T.,
Cable, M.,
Hong, Z.,
Kwong, A. D.,
Le, H. V.,
and Weber, P. C.
(1997)
Nat. Struct. Biol.
4,
463-467
|
| 34.
|
Kim, J. L.,
Morgenstern, K. A.,
Griffith, J. P.,
Dwyer, M. D.,
Thomson, J. A.,
Murcko, M. A.,
Lin, C.,
and Caron, P. R.
(1998)
Structure
6,
89-100
|
| 35.
|
Martins, A.,
Gross, C. H.,
and Shuman, S.
(1999)
J. Virol.
73,
1302-1308
|
| 36.
|
Teigelkamp, S.,
McGarvey, M.,
Plumpton, M.,
and Beggs, J.
(1994)
EMBO J.
13,
888-897p22p
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Chalupnikova, S. Lattmann, N. Selak, F. Iwamoto, Y. Fujiki, and Y. Nagamine
Recruitment of the RNA Helicase RHAU to Stress Granules via a Unique RNA-binding Domain
J. Biol. Chem.,
December 12, 2008;
283(50):
35186 - 35198.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-B. Boule and V. A. Zakian
Roles of Pif1-like helicases in the maintenance of genomic stability
Nucleic Acids Res.,
September 10, 2006;
34(15):
4147 - 4153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Granneman, K. A. Bernstein, F. Bleichert, and S. J. Baserga
Comprehensive Mutational Analysis of Yeast DEXD/H Box RNA Helicases Required for Small Ribosomal Subunit Synthesis
Mol. Cell. Biol.,
February 15, 2006;
26(4):
1183 - 1194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Silverman, A. Maeda, J. Wei, P. Smith, J. D. Beggs, and R.-J. Lin
Interaction between a G-Patch Protein and a Spliceosomal DEXD/H-Box ATPase That Is Critical for Splicing
Mol. Cell. Biol.,
December 1, 2004;
24(23):
10101 - 10110.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. B. Bessler and V. A. Zakian
The Amino Terminus of the Saccharomyces cerevisiae DNA Helicase Rrm3p Modulates Protein Function Altering Replication and Checkpoint Activity
Genetics,
November 1, 2004;
168(3):
1205 - 1218.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schneider, E. Campodonico, and B. Schwer
Motifs IV and V in the DEAH Box Splicing Factor Prp22 Are Important for RNA Unwinding, and Helicase-defective Prp22 Mutants Are Suppressed by Prp8
J. Biol. Chem.,
March 5, 2004;
279(10):
8617 - 8626.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. EDWALDS-GILBERT, D.-H. KIM, E. SILVERMAN, and R.-J. LIN
Definition of a spliceosome interaction domain in yeast Prp2 ATPase
RNA,
February 1, 2004;
10(2):
210 - 220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Shomron, H. Malca, I. Vig, and G. Ast
Reversible inhibition of the second step of splicing suggests a possible role of zinc in the second step of splicing
Nucleic Acids Res.,
October 1, 2002;
30(19):
4127 - 4137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Martin, S. Schneider, and B. Schwer
Prp43 Is an Essential RNA-dependent ATPase Required for Release of Lariat-Intron from the Spliceosome
J. Biol. Chem.,
May 10, 2002;
277(20):
17743 - 17750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schneider, H.-R. Hotz, and B. Schwer
Characterization of Dominant-negative Mutants of the DEAH-box Splicing Factors Prp22 and Prp16
J. Biol. Chem.,
May 3, 2002;
277(18):
15452 - 15458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Campodonico and B. Schwer
ATP-Dependent Remodeling of the Spliceosome: Intragenic Suppressors of Release-Defective Mutants of Saccharomyces cerevisiae Prp22
Genetics,
February 1, 2002;
160(2):
407 - 415.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|