|
Originally published In Press as doi:10.1074/jbc.M007520200 on March 30, 2001
J. Biol. Chem., Vol. 276, Issue 24, 21262-21271, June 15, 2001
Autoregulation of Cell-specific MAP Kinase Control of the
Tryptophan Hydroxylase Promoter*
Jessica L.
Wood and
Andrew F.
Russo §¶
From the Genetics Ph.D. Program and
§ Department of Physiology and Biophysics, University of
Iowa, Iowa City, Iowa 52242
Received for publication, August 17, 2000, and in revised form, March 12, 2001
 |
ABSTRACT |
The neurotransmitter serotonin
controls a wide range of biological systems, including its own
synthesis and release. As the rate-limiting enzyme in serotonin
biosynthesis, tryptophan hydroxylase (TPH) is a potential target for
this autoregulation. Using the serotonergic neuron-like CA77
cell line, we have demonstrated that treatment with a
5-hydroxytryptamine autoreceptor agonist, CGS 12066A, can lower
TPH mRNA levels and promoter activity. We reasoned that this
repression might involve inhibition of MAP kinases, since 5-HT1
receptors can increase mitogen-activated protein (MAP) kinase
phosphatase levels. To test this hypothesis, we first showed that the
TPH promoter can be activated 20-fold by mitogen-activated
extracellular-signal regulated kinase kinase kinase (MEKK), an
activator of MAP kinases. This activation was then blocked by CGS
12066A. The maximal MAP kinase and CGS repression regulatory region was
mapped to between 149 and 45 base pairs upstream of the
transcription start site. The activation by MEKK appears to be
cell-specific, because MEKK did not activate the TPH promoter in
nonneuronal cell lines. At least part, but not all, of the MAP kinase
responsiveness was mapped to an inverted CCAAT box that binds the
transcription factor NF-Y. These data suggest a model for the
autoregulation of serotonin biosynthesis by repression of MAP kinase
stimulation of the TPH promoter.
 |
INTRODUCTION |
Serotonin (5-hydroxytryptamine;
5-HT)1 is a monoamine
neurotransmitter involved in diverse physiological functions including regulation of mood, aggression, anxiety, sleep, satiety, and sexual activity (1). Dysfunction in serotonergic systems has been implicated
in the etiology of depression, aggressive behavior, and anxiety
disorders (2, 3). The pathophysiological mechanisms behind these
illnesses, however, are poorly understood, and very little is known
about the control of serotonin levels in neurons.
Serotonin biosynthesis is restricted to serotonergic neurons in the
brain raphe and gut, the pineal gland, enterochromaffin cells in the
gastrointestinal tract, and rodent mast cells (4, 5). This is largely
due to the cell-specific expression of tryptophan hydroxylase (TPH),
the first and rate-limiting step in serotonin biosynthesis, which
catalyzes the conversion of tryptophan to 5-hydroxytryptophan. As the
rate-limiting enzyme, TPH is a potential target for control of
serotonin levels. There is extensive evidence for post-translational
regulation of TPH enzyme activity through phosphorylation by
Ca2+/calmodulin-dependent protein kinase,
cAMP-dependent protein kinase, and a member of the 14-3-3 protein family (6-8).
Another mechanism for the control of serotonin levels is through a
negative feedback loop via activation of presynaptic 5-HT1 autoreceptors, which inhibit neuronal firing and serotonin release (5,
9). Stimulation of 5-HT1 autoreceptors also decreases the conversion of
tryptophan to 5-hydroxytryptophan, suggesting that extracellular
serotonin can regulate TPH activity (5). No studies to date directly
demonstrate that 5-HT autoreceptor activation regulates TPH mRNA
levels; however, in rats, administration of parachlorophenylalanine, an
irreversible TPH inhibitor, depletes brain serotonin and causes
significant increases in TPH mRNA (10). Furthermore, temporal
changes in TPH mRNA are opposite and symmetric to changes in
serotonin levels and TPH activity following parachlorophenylalanine treatment (11). Taken together, these data suggest that feedback control of serotonin biosynthesis may occur by transcriptional regulation of TPH gene expression.
A significant obstacle to the study of TPH transcription has been the
absence of a good model system. Few neuronal cell lines express TPH.
Previous studies of TPH promoter activity have been conducted in mouse
mastocytoma cells (12-14), cultured pinealocytes (15), the RN46A raphe
cell line (16), or non-TPH-expressing cell lines (12, 13, 15).
Mastocytoma cells and pinealocytes are nonneuronal. RN46A cells are a
good model but have limitations due to culture and transfection
difficulties. We have used the rat CA77 thyroid C-cell cell line.
Thyroid C cells share a similar ontogeny from the neural crest with
TPH-expressing enteric neurons in the gut (17). CA77 cells express a
number of serotonergic and neuronal markers, including TPH, the 5-HT1B
autoreceptor, the 5-HT transporter, and regulated secretion of
serotonin (17, 18). These features make CA77 cells a reasonable model
for studying the regulation of serotonin biosynthesis in a neuronal setting.
In the present study, we demonstrate that the selective 5-HT1 agonist
CGS 12066A (CGS) decreases TPH mRNA levels and represses TPH
promoter activity. Previous studies have demonstrated that CGS acts
through 5-HT1 receptors in CA77 cells (19, 20). Using transient
transfection reporter gene assays, we also show that CGS blocks
activation of a cell-specific MAP kinase-responsive element in the TPH
promoter. In addition, we provide evidence for binding of the NF-Y
transcription factor and at least one other, possibly cell-specific,
factor to the MAP kinase-responsive element.
 |
MATERIALS AND METHODS |
Cell Culture--
CA77 cells were maintained in Ham's
F-12/Dulbecco's modified Eagle's medium (low glucose; 1:1) with 10%
fetal bovine serum (FBS) at 37 °C and 7% CO2. CHO-IR/ER
(CHO cell line stably transfected with the insulin and epidermal growth
factor receptors) cells were kindly provided by Jeffrey Pessin
(University of Iowa) (21). CHO-IR/ER (CHO) cells were maintained in
-minimal essential medium with 10% FBS and 2 mM
L-glutamine at 37 °C and 5% CO2. GH3 cells were maintained in Dulbecco's modified Eagle's medium (low glucose) with 2.5% FBS and 15% horse serum at 37 °C and 5%
CO2. NIH3T3 and N2A cells were maintained in Dulbecco's
modified Eagle's medium (high glucose) with 10% FBS at 37 °C and
5% CO2. P815 cells were kindly provided by John Harty
(University of Iowa) and were maintained in RPMI 1640 with 10% FBS, 5 mM HEPES, 1.375 mM L-glutamine, and 50 µM 2-mercaptoethanol at 37 °C and 5%
CO2. Adherent cell lines were subcultured by brief
treatment with trypsin-EDTA (Life Technologies, Inc.). For 24 h
prior to transfections and RNA isolation, all cells, except P815 cells,
were subcultured in serum-free media supplemented with insulin,
transferrin, and selenium (ITS; Collaborative Biomedical Products)
(18). P815 cells maintained in serum-free conditions for 24 h
prior to transfection yielded unusually low luciferase activities.
Results obtained under these conditions, however, were similar to those
from experiments without the serum-free period before transfection. All
media contained 100 units/ml penicillin and 100 µg/ml streptomycin.
CGS 12066A monomaleate (Research Biochemicals International) was
prepared as a 10 mM solution in 0.1 N HCl and diluted to a final concentration of 10 µM (19). SB203580
(Calbiochem), U0126 (Calbiochem), and U0124 (Calbiochem) were prepared
in Me2SO and diluted to a final concentration of 10 µM (22, 23). In all studies using CGS or MAP kinase
inhibitors, control cells were treated with an equivalent amount of
vehicle (final concentration 0.0001 N HCl or 0.125%
Me2SO, respectively).
RNA Isolation and Northern Blot Analysis--
Poly(A) RNA was
isolated from CA77 cells using the FastTrack 2.0 kit (Invitrogen).
Samples of 1 µg of poly(A) RNA were electrophoresed through a 1.2%
formaldehyde-agarose gel, blotted to nylon membrane, and hybridized as
previously described (24). Bases 942-1338 of the rat TPH cDNA were
cloned into plasmid pGEM-T Easy (Promega) by PCR to generate pcTPH400.
TPH cDNA probe (396 bp) was prepared by restriction digestion of
pcTPH400 with NcoI and NdeI and labeling with
[ -32P]dATP (20 µCi, 3000 Ci/mmol) (Amersham
Pharmacia Biotech) using a random hexamer priming kit (Roche Molecular
Biochemicals). Following quantification of the TPH probe signal,
membranes were hybridized with 32P-labeled rabbit
mitochondrial cytochrome oxidase II (COII) cDNA probe (25). Signals
were quantified using the InstantImager or NIH Image software. Analysis
of blots with both methods yielded similar results. To normalize for
RNA loading and nonspecific effects of CGS, total signals for
the 4.0- and 1.8-kb TPH bands were combined then divided by total COII
signal. Data were analyzed for statistical significance using
Student's paired t test.
Luciferase Reporter Gene Constructs--
Plasmid p6N2
containing 12 kb of DNA 5' to the murine TPH transcription start site
was kindly provided by David Neilsen (National Institute of Mental
Health) (26). TPH0.7-luc and TPH0.15-luc were generated by PCR
amplification of sequence from 717 to +90 and from 149 to +90,
respectively, from p6N2 with primers containing BamHI
( 149) and NcoI (+90) sites using the Extend high fidelity PCR amplification system (Roche Molecular Biochemicals) (forward primer TPH0.7-luc, ACGGATCCGTGTCCTAAGACTAGT; forward primer
TPH0.15-luc, 5'-ACGGATCCGGGGCAAGCTGCTCCCGCC-3'; reverse primer,
5'-CCATGGCCTTGCTGGGAGTCTTCTG-3'). The PCR product was cloned into
pGEM-T (Promega), excised with BamHI and NcoI,
and cloned into BglII/NcoI-digested pGL3-Basic (Promega). TPH0.045-luc was generated by PCR amplification of sequence from 45 to +90 bp from TPH0.15-luc (TPH0.045-luc forward primer, 5'-TGACGATGCGCTTCTCCTAT-3'; reverse primer,
5'-TCCTTGCTGGGAGTCTTCTG-3'). The PCR products were cloned into
pGEM-T Easy, excised with NcoI and SacI, and
cloned into SacI/SmaI-digested pGL3-Basic.
TPH0.069-luc was cloned by PCR amplification of 69 of the TPH
promoter to +134 bp of the luciferase gene from TPH0.15-luc (forward
primer, 5'-TGCGCCCGGCGCCCATTGGCCGTTCTGACG-3'; reverse primer (pGL3),
5'-GGATAGAATGGCGCCGGGCC-3'). Overhangs left by Taq
polymerase were removed with T4 DNA polymerase. The fragment was
digested with NcoI and cloned into
SmaI/NcoI-digested pGL3-Basic. The 5' T of the
forward primer was lost, yielding a construct with 69 bp of promoter
sequence. TPH7x2-SV40luc was constructed from complementary
oligonucleotides from 70 to 41 bp with partial KpnI
ends (5'-cTGCGCCCGGCGCCCATTGGCCGTTCTGACGggtac-3' and its complement
5'-cCGTCAGAACGGCCAATGGGCGCCGGGCGCAggtac-3'). Oligonucleotides were
phosphorylated on the 5' ends by T4 polynucleotide kinase, annealed,
and ligated into KpnI-digested pGL3 promoter (Promega).
TPH9-SV40luc was constructed by PCR amplification from TPH0.7-luc of
sequence from 151 to 65 bp with primers containing KpnI
(forward) or BglII (reverse) sites (forward primer,
5'-acgggtaccTCAGGGCAAGCTGCTCCC-3'; reverse primer, 5'
tcgagatctGGCGCACGGTTGAGGATA-3'). Following BglII and
KpnI digestion, the PCR product was cloned into
BglII/KpnI-digested pGL3-promoter (Promega).
TPHmut0.15-luc was generated by PCR from TPH0.15-luc of two overlapping
fragments containing the mutations. The first fragment extended from
the RVprimer3 site in pGL3-Basic to 48 of the TPH promoter (forward
primer, RVprimer3 (Promega); reverse primer (TPH),
5'-ACGGCTAAAGGGCGCCGGGCGCACGGTT-3'). The second fragment extended from
61 of the TPH promoter to base pair 134 of pGL3-Basic (forward primer
(TPH), 5'-CGCCCTTTAGCCGTTCTGACGATGCGC-3'; reverse primer (pGL3),
5'-GGATAGAATGGCGCCGGGCC-3'). Gel-purified PCR products were combined
and amplified using the pGL3-Basic primers. The resulting product
was cut with XbaI and NcoI and cloned into
XbaI/NcoI digested pGL3-Basic. All cloned DNA was confirmed by sequencing. The following plasmids are part of the Path
Detect System (Stratagene): MEKK (amino acids 380-672) expression vector, MEK1 (S218/222E, 32-51) expression vector, Elk1
transactivation domain (amino acids 307-428) fused to the Gal4 DNA
binding domain (amino acids 1-147) (pFA-Elk), ATF2 transactivation
domain (amino acids 1-96) fused to the Gal4 DNA binding domain (amino
acids 1-147) (pFA-ATF2), and the Gal4 luciferase reporter plasmid
(pFR-Luc).
Transfection and Reporter Gene Assays--
CA77 cells (3-5 × 106) were transfected by electroporation in PBS at 220 mV, 960 microfarads as previously described (27) with 2.5 µg of
reporter plasmid and 3.0 µg of MEKK using the Bio-Rad Gene Pulser
apparatus. CHO cells were similarly transfected, but at 340 V with
0.5-10 µg of MEKK. In transfections lacking MEKK, CMV5 vector
control plasmid DNA was used to provide equal amounts of DNA in all
transfections. In experiments using the Elk1/Gal4 or ATF2/Gal4 reporter
system, 2-3 µg of pFR-Luc, 0.5-1.0 µg of pFA-Elk or pFA-ATF2, and
0.5-1.0 µg of MEKK plasmid were used. To ensure equal transfection
efficiency between CGS or MAP kinase inhibitor-treated cells and
controls, electroporations were divided equally between 60-mm dishes
containing serum-free media. Cells were treated with 10 µM CGS or vehicle control (0.0001 N HCl) for
24 h immediately following transfection except for the CGS time
course, when cells were treated with 10 µM CGS for
varying amounts of time immediately following transfection and the
CGS-containing media were replaced with serum-free ITS media for
the time remaining until harvest. For MAP kinase inhibitor experiments,
cells were treated with 25 µM SB203580, 10 µM U0126, 10 µM U0124, or vehicle control
(0.125% Me2SO) in serum-free ITS media for 6 h
prior to harvest (22, 23). GH3, NIH3T3, N2A, and P815 cells were
transfected with LipofectAMINE 2000 (Life Technologies, Inc.). For
adherent cell lines, 1-2 × 105 cells were seeded in
12-well dishes in serum-free ITS media 24 h prior to
transfection. For P815 cells, 5 × 105 cells were
added to 12-well dishes in serum-free ITS media without antibiotics at the time of transfection. 0.5 µg of TPH0.15-luc or
SV40-luc (pGL3-promoter; Promega) were cotransfected with 50 ng to 2.0 µg of MEKK plasmid. For controls, 0.5 µg of pFR-Luc and 0.25 µg
of pFA-Elk or pFA-ATF2 were cotransfected with 50-250 ng of MEKK
plasmid. CMV5 vector DNA was used to bring total DNA amounts to 2.5 µg in each transfection. Transfections were performed in ITS
media without antibiotics with 4 µl (GH3), 6 µl (N2A), 7.5 µl (NIH3T3), or 6 µl (P815) of LipofectAMINE 2000/well. 1.0-2.0 µg of -galactosidase control vector (pSV- gal; Promega) was
included in some experiments (electroporations and LipofectAMINE
transfections) to correct for transfection efficiency; however, it was
activated ~2-fold by MEKK. CGS had no effect on pSV- gal. In
transfections lacking MEKK, no significant variations in transfection
efficiency were observed. After 20-24 h, cells were assayed for
luciferase activity using reagents from Promega and protein using the
Bradford assay (Bio-Rad). Luciferase activities were normalized to
protein concentration. In some experiments, activities were also
normalized to pGL3-Basic or pGL3-promoter activity to control for
variation in basal promoter activity between independent experiments.
All experiments were repeated at least three times with assays
performed in duplicate. Statistical analyses were done using the
Student's paired t test.
Western Blot Analysis--
CA77 cells were transfected with MEKK
or CMV5 and harvested 24 h later. For sorbitol-treated controls,
an equivalent number of cells were incubated in 0.6 M
sorbitol for 30 min before harvesting. Cells were washed in PBS,
removed from dishes by scraping, and centrifuged to pellet. Whole cell
extracts were prepared by lysis in 1× reporter lysis buffer
(Promega)/1× cell lysis buffer (MAP kinase assay kit; New England
Biolabs) and removal of cellular debris by centrifugation. 10 µg of
protein were subjected to SDS-polyacrylamide gel electrophoresis and
Western blotting as previously described (20). Polyclonal anti-active
MAP kinase antibodies (Promega) were used at the following dilutions:
ERK and JNK, 1:5000; p38, 1:2000. Membranes were stripped and reprobed
with antibodies recognizing total (active and inactive) forms of ERK,
JNK, or p38 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) diluted
1:200.
Electrophoretic Mobility Shift Assay
(EMSA)--
Oligonucleotides used for EMSA were synthesized with
partial BamHI ends (lowercase): TPH7 (wild type
inverted CCAAT), 5'-gatccTGCGCCCGGCGCCCATTGGCCGTTCTGACGg-3', and its
complement, 5'-gatccCGTCAGAACGGCCAATGGGCGCCGGGCGCAg-3'; TPHmut 7 (mutant inverted CCAAT),
5'-gatccTGCGCCCGGCGCCCTTTAGCCGTTCTGACGg-3', and
its complement,
5'-gatccCGTCAGAACGGCTAAAGGGCGCCGGGCGCAg-3' (mutations in boldface type). NF-Y, Sp1, and C/EBP consensus
oligonucleotides were obtained from Santa Cruz Biotechnology.
Oligonucleotides were annealed, labeled with
[ -32P]dATP (20 µCi, 3000 Ci/mmol) using Klenow
polymerase, and purified through a Sephadex G-25 column. Cold
competitor oligonucleotides were similarly prepared in the absence of
[ -32P]dATP. Nuclear extracts were prepared with a
modified Dignam protocol (28). Binding reactions contained 0.02 pmol of
labeled oligonucleotide (100,000-150,000 cpm), 3 µg of nuclear
extract, 0.1 µg of poly(dI-dC) (Roche Molecular Biochemicals),
and binding buffer (27). For some experiments, nuclear extracts were
prepared from CA77 cells treated with CGS for 24 h. For
competition assays, competitor oligonucleotides (1.0 pmol) and nuclear
extract were preincubated for 15 min on ice prior to the addition of
probe. For supershift assays, probe and nuclear extracts were
preincubated on ice for 15 min prior to the addition of antibody (1-3
µl of Trans-X). The following rabbit polyclonal IgG antibodies
were obtained from Santa Cruz Biotechnology, Inc.: NF-Y-B (c-18), Sp1 (PEP-2), and C/EBP2 (14AA). Reactions were incubated on ice for 15 min
and then resolved on a 6% polyacrylamide gel (29:1
acrylamide/bisacrylamide) in 0.25× TBE (Tris, borate, EDTA, pH 8.5) at
250 V for 2 h at 4 °C. Gels were dried and exposed to film with
an intensifying screen for 2-20 h.
 |
RESULTS |
CGS Represses TPH mRNA Levels--
To examine the effects of
5-HT1 agonists on TPH expression, CA77 cells were treated with the
selective 5-HT1 receptor agonist CGS. Pharmacological studies have
demonstrated that CGS preferentially interacts with rat and human
5-HT1B, 5-HT1D (29), and presumably 5-HT1F receptors. The selectivity
of CGS for 5-HT1 receptors in CA77 cells has previously been
demonstrated in CA77 cells using the 5-HT1 antagonist methiothepin
(19). CA77 cells were treated for 24 h with CGS or vehicle control
prior to isolation of poly(A) RNA. These conditions gave maximal
effects of CGS on TPH promoter activity in transient transfection
assays (data not shown). Northern blot analysis detected two TPH
mRNA species of ~4.0 and 1.8 kb, as previously identified in
neuronal cells (18, 30) (Fig. 1A). To demonstrate
specificity of CGS effects, blots were also hybridized with a
cytochrome oxidase II (COII) probe, and TPH signals were normalized to
COII. Total TPH mRNA levels were decreased by nearly one-half in
CGS-treated cells, compared with levels in control-treated cells
(p = 0.02) (Fig. 1B). These results indicate that TPH mRNA levels are decreased by 5-HT1 receptor
activation.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 1.
Northern blot analysis demonstrating CGS
repression of TPH mRNA levels in CA77 cells. A,
CA77 cells were treated with CGS (10 µM) or control
(0.0001 N HCl) for 24 h prior to isolation of poly(A)
RNA and Northern blot analysis. TPH was detected with a radiolabeled
cDNA probe spanning bases 942-1338 of the TPH gene. Following
hybridization with the TPH probe, membranes were hybridized with a
radiolabeled COII probe. The two TPH signals at 4.0 and 1.8 kb
and the CO II signal are noted. B, histogram showing
quantification from five independent experiments. Signals were
quantified using the InstantImager or NIH Image software. Analysis of
some blots with both methods yielded similar results. To normalize for
RNA loading and nonspecific effects of CGS, the total signals for 4.0- and 1.8-kb TPH were summed and then divided by total COII signal for
each lane. Data are plotted as percentage of the signal of control
treated cells ± S.E.
|
|
CGS Represses the TPH Promoter--
To determine if the observed
changes in mRNA levels were due to CGS repression of transcription
from the TPH promoter, CA77 cells were transiently transfected with TPH
promoter luciferase reporter gene constructs. Transfected cells were
divided equally between two dishes and treated with CGS or vehicle
control for 24 h. CGS repressed basal transcriptional activity of
the proximal 149 bp of the TPH promoter (TPH0.15-luc) to 57% of
control levels (p < 0.001) (Fig.
2A). A construct containing 69 bp of TPH 5'-flanking sequence (TPH0.069-luc) was repressed to 55% of
control levels (p = 0.005). No significant differences
in luciferase activity were observed with a construct containing the
proximal 45 bp of the TPH promoter (TPH0.045-luc) or promoterless
reporter gene vector (pGL3-Basic). These data indicate that the element
mediating CGS responsiveness is located between 69 and 45 bp (Fig.
2B).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
Repression of TPH promoter activity by CGS
treatment. A, TPH promoter reporter gene constructs
were transiently transfected into CA77 cells. Cells were treated with
CGS (10 µM) or vehicle (0.0001 N HCl) for
24 h prior to harvest. Promoter constructs diagrammed from
top to bottom are as follows: pGL3-Basic,
TPH0.045-luc, TPH0.069-luc, and TPH0.15-luc. Luciferase activity is
expressed as relative light units per 20 µg of protein ± S.E.
Data represent at least three independent experiments. B,
sequence of the proximal 150 bp of the TPH promoter. Bases are numbered
relative to the transcription start site. The inverted CCAAT box is in
boldface type, GC boxes are
underlined, and the TATA box is boxed. The
inverted CCAAT box probe (TPH7) used in EMSA and construction of
TPH7x2-SV40luc is highlighted in gray.
|
|
CGS Represses MEKK Stimulation of the TPH Promoter--
Next, we
investigated the mechanism of CGS repression of TPH promoter activity.
Two pieces of data suggested that MAP kinase signal transduction
pathways may be involved in CGS regulation of the TPH promoter. First,
osmotic shock of RN46A cell lines stably transfected with a 3.1-kb TPH
promoter-luciferase plasmid resulted in a 50-fold increase in
luciferase activity (31). Osmotic shock is a strong activator of ERK,
JNK, and p38 MAP kinase pathways (32). Second, treatment of CA77 cells
with CGS results in increased levels of MAP kinase phosphatase-1
(MKP-1), a repressor of MAP kinase activity (20). Together, these data
suggested that MAP kinases might stimulate TPH gene transcription.
To test this hypothesis, the effects of MAP kinases on TPH promoter
activity were examined. MAP kinase signal transduction pathways in CA77
were activated by transfection of a plasmid encoding amino acids
380-672 of MEKK. This truncation of MEKK deletes the regulatory
NH2-terminal domain to create a constitutively active protein that acts as an upstream activator of the three major MAP
kinases: ERK, JNK, and p38 (32, 33). Western blot analysis with
phosphospecific antibodies showed increased levels of the active forms
of ERK, JNK, and p38 in cells transfected with MEKK plasmid compared
with control plasmid (Fig.
3A). Phosphorylation of ERK by
MEKK was considerably less pronounced than activation of JNK and p38
due to much higher basal levels of ERK phosphorylation. These data
confirm that MEKK transfection can activate all three MAP kinase
pathways in CA77 cells. CA77 cells were also cotransfected with MEKK
and a Gal4/Elk1 or Gal4/ATF2 reporter system. These synthetic reporters
contain a luciferase gene with Gal4 DNA-binding sites (pFR-Luc) and a
plasmid encoding the Elk1 transactivation domain (pFA-Elk) or ATF2
transactivation domain (pFA-ATF2) linked to the yeast Gal4 DNA-binding
domain. The transcription factor Elk can be activated by all three
major MAP kinases, while ATF2 is activated by JNK and p38 (34).
Consistent with the Western blot data, the pFA-Elk transactivator
stimulated pFR-Luc promoter activity ~50-fold when cotransfected with
MEKK in CA77 cells (p < 0.001), and the pFA-ATF2
construct stimulated the pFR-Luc promoter about 700-fold
(p = 0.002) (data not shown). Previous studies in CA77
cells have described CGS effects on MAP kinase activity. When
transfected with plasmid encoding constitutively active MEK1, CGS
represses ERK phosphorylation (20). In cells cotransfected with MEKK
plasmid, pFR-Luc, and pFA-Elk or pFA-Jun, a similar construct encoding
the c-Jun transactivation domain, CGS, blocks transactivation of the
reporter by both the Elk and Jun constructs (20). The effects of CGS on
p38 have not been directly tested, but MKP-1, the effector of CGS,
dephosphorylates all three major MAP kinases in other cell lines (34,
35).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Activation of the TPH promoter by activated
MEKK and repression by CGS. A, Western blot analysis of
MAP kinase activation by MEKK plasmid transfection. CA77 cells were
transfected with plasmid encoding constitutively active MEKK or control
CMV5 vector. As a positive control for MAP kinase phosphorylation,
untransfected cells were treated with 0.6 M sorbitol for 30 min ("osmotic shock") prior to harvest. Whole cell extracts were
prepared 24 h after transfection and subjected to Western
blotting. Blots were hybridized with antibodies specific for the
phosphorylated, active forms of ERK, JNK, or p38 MAP kinases. Blots
were stripped and reprobed with antibodies specific for total (active
and inactive) ERK, JNK, or p38 to ensure equal loading. B,
TPH promoter luciferase reporter plasmids were transiently
cotransfected into CA77 cells with a plasmid encoding constitutively
active MEKK or vector control and then treated with CGS (10 µM) or vehicle (0.0001 N HCl) for 24 h
prior to harvest. Promoter constructs from top to
bottom are as follows: pGL3-Basic, TPH0.045-luc,
TPH0.069-luc, and TPH0.15-luc. Luciferase activity is expressed as
relative light units per 20 µg of protein ± S.E. Data represent
at least three independent experiments. C, CA77 cells were
transiently transfected with a TPH promoter luciferase vector
containing 716 bp of the murine TPH promoter and MEKK plasmid.
Immediately following transfection, cells were treated with CGS (10 µM) or vehicle control (0.0001 N HCl) for
varying amounts of time. Luciferase activity was normalized for protein
and is expressed as a percentage of the mean MEKK-activated
activity ± S.E. for all five time points.
|
|
Next, CA77 cells were transiently cotransfected with TPH luciferase
reporter gene plasmids and MEKK plasmid or vector control. Following
transfection, cells were treated with CGS or vehicle control for
24 h. When MEKK and TPH0.15-luc was cotransfected, a 20-fold
increase in transcriptional activity was observed over vector control
cotransfected cells (p < 0.001) (Fig. 3B).
MEKK activation was also observed with reporter gene constructs
containing the proximal 3100, 1400, and 700 bp of the TPH promoter,
although to a lesser degree (4-12- fold) (data not shown). A reporter
with only 69 bp of the TPH promoter (TPH0.069-luc) was activated
6-10-fold by MEKK (p = 0.02) (Fig. 3B).
Hence, maximal activation was observed with the 149-bp TPH promoter
fragment. In contrast, the construct containing only 45 bp of the TPH
promoter was only slightly stimulated by MEKK. This latter activation
was variable and not statistically significant. As controls, MEKK did
not significantly activate the promoterless luciferase vector (Fig.
3B) or an SV40 promoter -galactosidase reporter construct
(data not shown). These data show that the TPH promoter is stimulated
through MAP kinase signal transduction cascades that require elements
between 149 and 45 for maximal activation.
As predicted, CGS treatment significantly repressed the stimulatory
effects of MEKK on TPH0.15-luc and TPH0.069 to 20% (p < 0.001) and 38% (p = 0.04), respectively, of
MEKK-stimulated levels (Fig. 3B). To ensure that we used the
optimal length of CGS treatment time for maximal repression of MEKK
activation of the TPH promoter, a time course was performed. CA77 cells
were cotransfected with a 716-bp TPH promoter luciferase plasmid
(TPH0.7-luc) and MEKK. Immediately following transfection, cells were
divided equally between dishes and treated with CGS or vehicle control for 1.5-24 h. After the specified period, CGS was washed from the
cells and replaced with serum-free media for the remaining time
until harvest 24 h after transfection. CGS repression of MEKK
activation increased with the length of time of CGS treatment (Fig.
3C). Importantly, considerable repression to about half that
of MEKK-stimulated levels was seen after only 1.5 h of CGS treatment. These results demonstrate that CGS can repress MEKK activation of the TPH promoter and that repression can be detected following a relatively short treatment time.
Multiple MAP Kinase Pathways Activate the TPH
Promoter--
Because MKP-1, the effector of 5-HT1 receptor
activation (20), inactivates ERK, JNK, and p38, all three MAP kinase
pathways are potential regulators of TPH transcription (34). We sought to elucidate the MAP kinase pathway mediating the TPH promoter response
to CGS by two approaches. First, CA77 cells were cotransfected with TPH
promoter reporter gene constructs and a plasmid encoding constitutively
active MEK1. Unlike MEKK, MEK1 is a protein kinase highly specific for
ERK (36). Following transfection, cells were treated with CGS or
vehicle control for 24 h prior to harvest. MEK1 cotransfection
resulted in a 2.7-fold increase in luciferase activity with the
TPH0.15-luc reporter (p = 0.004) (Fig.
4). CGS treatment blocked MEK1 activation
(p = 0.01). Similar to MEKK, no significant effects
were observed with the 45-bp minimal TPH promoter construct. Therefore,
MEK1 activates the TPH promoter, but only weakly compared with the
20-fold stimulation by MEKK, suggesting that other pathways are also
important.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 4.
Activation of the TPH promoter by activated
MEK1 and repression by CGS. TPH promoter luciferase reporter
plasmids were transiently cotransfected into CA77 cells with a plasmid
encoding constitutively active MEK1 or vector control and then treated
with CGS (10 µM) or vehicle (0.0001 N HCl)
for 24 h prior to harvest. Promoter constructs from top
to bottom are TPH0.045-luc and TPH0.15-luc. Luciferase
activity is expressed as relative light units per 20 µg of
protein ± S.E. Data represent at least three independent
experiments.
|
|
As an alternative approach to evaluate the contributions of the three
major MAP kinases on TPH promoter activation, pharmacological inhibitors of MAP kinase activity were used. CA77 cells were
cotransfected with TPH0.15-luc and MEKK. Eighteen hours following
transfection, cells were treated with SB203580, U0126, or U0124 for
6 h before harvesting. SB203580 is a potent inhibitor of p38
kinase (37). U0126 is an inhibitor of MEK1 and MEK2, highly specific
activators of ERK, and U0124 is an inactive analog of U0126 and a
negative control (23). Because luciferase has a half-life of 3 h
in mammalian cells, 6 h of inhibitor treatment was judged to be
sufficient time for luciferase turnover, while minimizing effects of
cellular compensatory mechanisms (38).
In cells cotransfected with MEKK and TPH0.15-luc, MEKK stimulation was
partially repressed by both SB203580 and U0126 to 71% (p = 0.009) and 55% (p = 0.03) of
MEKK-stimulated levels, respectively (Fig.
5A). This demonstrates that
both ERK and p38 pathways contribute to regulation of the TPH promoter
and is consistent with the MEK1 cotransfection experiments. As a
control, cells were cotransfected with MEKK and the Gal4/Elk reporter
system, which is activated by all three major MAP kinases. As expected,
SB203580 repressed transactivation by Elk (p = 0.008)
(Fig. 5B). U0126 also inhibited Elk, although this was not
statistically significant (p = 0.13) (Fig.
5B). The inactive U0124 had no effect. Together, SB203580 and U0126 repressed both TPH0.15-luc and control activation to a
greater extent than either compound alone. This is evident for TPH0.15-luc when data within a single experiment are compared (data not
shown), although variation in repression obscures this in the pooled
data. Therefore, MAP kinase regulation of the TPH promoter may occur
via multiple pathways.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 5.
SB203580 and U0126 inhibition of MEKK
activation of the TPH promoter. Luciferase reporter plasmids were
transiently cotransfected into CA77 cells with a plasmid encoding
constitutively active MEKK. Eighteen hours following transfection,
cells were treated with 25 µM SB203580, 10 µM U0126, 10 µM U0124, or vehicle control
(0.125% Me2SO) for 6 h and then harvested. Luciferase
activity normalized for protein is expressed as percentage of activity
of MEKK-stimulated control-treated cells ± S.E. Data represent at
least three independent experiments. A, TPH0.15-luc.
B, Elk1/Gal4 reporter system (pFR-Luc and pFA-Elk).
|
|
MAP Kinase Responsiveness of the TPH Promoter Is
Cell-specific--
We also investigated whether the MAP kinase
regulation of the TPH promoter was cell-specific using the nonneuronal
and nonserotonergic CHO, GH3, and NIH3T3 cell lines; the neuronal but
nonserotonergic N2A cell line; and the serotonergic but nonneuronal
P815 mastocytoma cell line. Cells were cotransfected with the 149-bp
TPH promoter (TPH0.15-luc) or SV40 (SV40-luc) luciferase reporter gene
construct and increasing amounts of MEKK. When reporter gene constructs were electroporated with up to 10 µg of MEKK plasmid in CHO cells, no
significant difference in promoter activity was detected (Fig. 6A). This is in contrast to
CA77 cells, where 3 µg of MEKK caused a 20-fold increase in reporter
gene activity. GH3, 3T3, N2A, and P815 cells were transfected by lipid;
thus, proportionally smaller amounts of cells and plasmid were used. No
difference in promoter activity between TPH and SV40 control was
observed with MEKK cotransfection in GH3 (Fig. 6B), 3T3
(Fig. 6C), or P815 (Fig. 6E) cells. In N2A cells,
however, statistically significant 3-fold activation of the TPH
promoter construct was observed with 250 ng of MEKK plasmid (p = 0.02) (Fig. 6D). As a positive control,
cells were cotransfected with MEKK and the Gal4/Elk1 reporter system. A
significant increase in luciferase activity was observed in each cell
line, indicating that the lack of response with the TPH promoter in
CHO, GH3, 3T3, and P815 cells was not due to a lack of MEKK signal
transduction. Therefore, the TPH promoter response to MEKK appears to
be specific to neuron-like cells.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 6.
MEKK activation of the TPH promoter in CHO,
GH3, NIH3T3, N2A, or P815 cells. Cells were transiently
cotransfected by electroporation (CHO) or LipofectAMINE 2000 (GH3,
NIH3T3, N2A, and P815) with TPH0.15-luc or SV40-luc (pGL3-promoter) and
increasing amounts of MEKK plasmid or vector control. As a positive
control, MEKK plasmid was cotransfected with the Elk1/Gal4 reporter
system. For each reporter vector, average luciferase activity in
relative light units per 20 µg of protein was normalized to vector
control cotransfected cells. Relative activity ± S.E. is plotted
for each of the reporter gene constructs at each concentration of MEKK
used. Data represent at least three independent experiments, except the
Elk1/Gal4-luc control in CHO and GH3 cells, which is from one
experiment. A, CHO; B, GH3; C, NIH3T3;
D, N2A; E, P815.
|
|
MAP Kinase Regulation Requires Multiple Elements--
Our data
demonstrate that maximal MAP kinase responsiveness requires the
proximal 149 bp of the TPH promoter. MEKK activation and CGS
responsiveness, however, are retained with 69 bp of the promoter and
lost when the promoter is truncated to 45 bp, suggesting the presence
of crucial regulatory elements between 69 and 45. Additional MAP
kinase-responsive or enhancer elements upstream of 69 could account
for the maximal MAP kinase stimulation observed with TPH0.15-luc. These
two regions of the TPH promoter were evaluated separately for the
presence of MAP kinase-responsive elements. It is notable that there
are no known MAP kinase-responsive elements, such as consensus sites
for AP1 or Elk, within the promoter region required for maximal MAP
kinase activation. The sequence spanning 151 to 65 was cloned into
a luciferase reporter vector upstream of the SV40 promoter
(TPH9-SV40luc). Two tandem repeats of the sequence from 70 to 41
were also cloned into the same vector (TPH7x2-SV40luc). Reporter
constructs were cotransfected into CA77 cells with MEKK or control
plasmid. As expected, MEKK cotransfection strongly stimulated activity
with the TPH0.15-luc reporter. Surprisingly, the TPH7x2-SV40luc
reporter was not activated to a greater degree than the parent vector
(SV40-luc) (Fig. 7). In addition, no
significant activation was noted with TPH9-SV40luc. Basal activity of
both TPH7x2-SV40luc (p = 0.03) and TPH9-SV40luc
(p = 0.03) was increased nearly 4-fold over SV40-luc,
indicating the presence of transcriptional elements. Therefore, these
experiments imply that MAP kinase regulation of TPH transcription may
require two or more interdependent promoter elements.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7.
Lack of MEKK activation of TPH promoter
fragments with a heterologous promoter. TPH promoter luciferase
reporter plasmids were constructed by inserting the TPH sequence from
151 to 65 or two tandem repeats of the sequence from 70 to 41
bp into an SV40 promoter luciferase reporter plasmid (pGL3-promoter),
yielding TPH9-SV40luc and TPH7x2-SV40luc. TPH promoter luciferase
reporter plasmids or SV40-luc (pGL3-promoter) were transiently
cotransfected into CA77 cells with a plasmid encoding constitutively
active MEKK or vector control. Promoter constructs diagrammed from
top to bottom are as follows: SV40-luc,
TPH7x2-SV40luc, TPH9-SV40luc, and TPH0.15-luc. Luciferase activity is
expressed as relative light units per 20 µg of protein ± S.E.
Data represent at least three independent experiments.
|
|
Mutation of an Inverted CCAAT Box Only Partially Reduces MAP Kinase
Stimulation--
Because MAP kinase responsiveness was lost upon
transfer of the sequence between 71 and 45 to a heterologous
promoter, it was then necessary to examine this region in the context
of the complete TPH promoter. An inverted CCAAT box between 57 and
49 bp had been previously identified (26), and it lies within the smaller MEKK-responsive region (Fig. 2B). Interestingly, the
inverted CCAAT box has been shown to mediate cAMP responsiveness of the human promoter in pinealocyte cultures and PC12 cells (15). Increasing
evidence supports cross-talk between MAP kinase and cAMP signal
transduction pathways (39-41). In addition, a recent report
demonstrated ERK activation of C/EBP, a CCAAT box-binding transcription
factor (42). Therefore, we suspected that the inverted CCAAT box may
also mediate MEKK responsiveness of the TPH promoter. To test this
hypothesis, a 2-bp mutation previously shown to disrupt protein binding
(15) was introduced in the inverted CCAAT box in the 149-bp luciferase
reporter (TPHmut0.15-luc). We compared MEKK-stimulated promoter
activity between TPH0.15-luc and TPHmut0.15-luc in transient
transfection assays (Fig. 8). MEKK
activation was partially reduced in the CCAAT mutant in comparison with
the wild-type promoter sequence (p = 0.02). CGS
repression of the MEKK stimulation was comparable for both the
wild-type and mutant CCAAT element promoters (20 and 21%,
respectively, of MEKK-stimulated levels). Furthermore, no significant
differences in basal promoter activity or CGS repression of basal
activity were detected between wild-type and the mutant CCAAT promoter constructs. The wild-type and mutant CCAAT promoters were repressed by
CGS treatment to 56% (p = 0.002) and 52%
(p = 0.007), respectively, of control levels. Thus,
basal promoter activity and CGS repression do not require the inverted
CCAAT box. These data suggest that the inverted CCAAT box contributes
to the regulation by MAP kinases, but it is not the only MAP
kinase-responsive regulatory element, which could account for the
ability of CGS to still repress the mutant CCAAT promoter.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 8.
Mutation of the inverted CCAAT box partially
blocks MEKK activation. A TPH promoter luciferase reporter plasmid
containing a 2-bp mutation in the inverted CCAAT box (TPHmut0.15-luc)
was transiently cotransfected into CA77 cells with plasmid encoding
constitutively active MEKK or vector control and then treated with CGS
(10 µM) or vehicle (0.0001 N HCl) for 24 h prior to harvest. Data for TPH0.15-luc from the same experiments are
shown for comparison. Luciferase activity is expressed as relative
light units per 20 µg of protein ± S.E. Data represent at least
three independent experiments.
|
|
The Inverted CCAAT Box Mediates DNA-Protein
Interactions--
EMSAs were used to evaluate protein interactions
with the MEKK- and CGS-responsive region of the TPH promoter. The
minimally responsive region of 70 to 41 bp was used as a probe
(TPH7) (Fig. 2B). This region encompasses the inverted CCAAT
box. CA77 extracts yielded three distinct bands (CA1, CA2, CA3) (Fig.
9). All three complexes were competed in
a dose-dependent manner by unlabeled TPH7 oligonucleotide,
indicating specific DNA-protein interactions. Band CA2 varied greatly
in intensity between experiments and was at least partially competed by
all oligonucleotides. This suggests that it is a low affinity,
nonspecific complex. In contrast to the three complexes observed with
CA77 nuclear extracts, CHO nuclear extracts generated two distinct
bands (CH1, CH2) when incubated with radiolabeled TPH7. Complex CH1
migrated at approximately the same rate as CA1; however, complex CH2
migrated slightly slower than CA3. Both complexes were competed in a
dose-dependent manner with excess unlabeled TPH7.

View larger version (109K):
[in this window]
[in a new window]
|
Fig. 9.
EMSA of the TPH inverted CCAAT box probe with
CA77 and CHO nuclear extracts. CA77 and CHO nuclear extracts were
preincubated with a 50-fold excess of double-stranded competitor
oligonucleotides and then incubated with radiolabeled double-stranded
oligonucleotide probe (TPH7). Competitors included the unlabeled
inverted CCAAT box oligonucleotide (TPH7); mutated inverted CCAAT box
oligonucleotide (mut7); and consensus Sp1, NF-Y, and C/EBP consensus
binding site oligonucleotides. CA1, CA2, and CA3 denote the complexes
formed with CA77 extracts. CH1 and CH2 denote the complexes formed with
CHO extracts.
|
|
Binding of these complexes to the inverted CCAAT box sequence was then
demonstrated by competition assays using an unlabeled competitor
oligonucleotide identical to the TPH7 probe but containing the 2-bp
mutation in the inverted CCAAT box (mut7) (Fig. 9). CA1 and CH1 were
not competed by the mutant oligonucleotide, and CA3 and CH2 were only
weakly competed. When mut7 was radioactively labeled and used as a
probe in similar experiments, the formation of CA1, CA3, CH1, and CH2
was almost completely absent (data not shown). Thus, the inverted CCAAT
box is necessary for formation of these DNA-protein complexes.
NF-Y (CBF, CP1) Interacts with the Inverted CCAAT Box--
CCAAT
boxes have been demonstrated to bind a number of transcription factors
including NF-Y (also called CBF or CP1), CP2, NF-1, and C/EBP (43, 44).
In addition to the CCAAT box, the region between 70 and 41 bp used
as a probe contains two GC boxes that commonly bind Sp1, a relatively
ubiquitous transcription factor. The murine and human TPH promoter
inverted CCAAT box has been shown to bind the transcription factor NF-Y
in mastocytoma and non-TPH-expressing cell line nuclear extracts (12,
13). Because the MAP kinase responsiveness is neuron-specific,
alternative or additional cell-specific factors may bind this region of
the TPH promoter. Competition with unlabeled Sp1, NF-Y, and C/EBP oligonucleotides was performed in an attempt to identify the complexes forming with the TPH7 probe in the neuron-like serotonergic CA77 cells (Fig. 9). When a 50-fold molar excess of NF-Y consensus oligonucleotide was used, CA1 and CH1 were strongly competed, implying
that NF-Y is a component of these complexes. CA3 and CH2 were
unaffected by NF-Y competitor. This suggests that the protein competed
away from the probe by the NF-Y competitor is not necessary for
formation of CA3 and CH2 despite the fact that they both appear
to bind the inverted CCAAT box. The addition of a 50-fold molar
excess of Sp1 or C/EBP consensus oligonucleotides had no significant
effect on any of the complexes formed with CA77 or CHO nuclear
extracts, with the exception of CA2, which, as previously discussed, we
suspect is due to nonspecific interactions.
To further test the identities of proteins forming these complexes, Sp1
and NF-Y antibodies were added to the binding reactions following
incubation of the probe and nuclear extract (Fig.
10). NF-Y antibody generated a clear
supershift of complexes CA1 and CH1. Sp1 antibody did not generate a
supershifted complex, suggesting that Sp1 is not a constituent of any
of the observed complexes. Thus, the transcription factor NF-Y or an
NF-Y-like protein binds to the MAP kinase-responsive region of the TPH
promoter.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 10.
NF-Y antibody supershift. CA77 and CHO
nuclear extracts were incubated with radiolabeled double-stranded
oligonucleotide probe (TPH7) and then with antibody to transcription
factor NF-Y or Sp1. The CA77 and CHO extract complexes are indicated.
The arrow indicates the supershifted complex generated by
the addition of NF-Y antibody.
|
|
 |
DISCUSSION |
We have demonstrated that a selective 5-HT1 receptor agonist, CGS,
represses TPH mRNA levels and promoter activity in a
neuron-like cell line. This observation suggests a mechanism by
which serotonin neurotransmitter levels may be controlled in the brain.
Many enzymes are subject to end product inhibition. For example,
tyrosine hydroxylase, the rate-limiting enzyme in catecholamine
biosynthesis, is inactivated by the binding of catecholamines to its
active site, providing a physiologically important negative feedback
loop (45). However, TPH enzyme activity is not directly regulated by
serotonin in a similar manner (5). By acting at autoreceptors coupled
to signal transduction pathways that regulate the activity of
transcription factors, we propose that serotonin could negatively
control its own biosynthesis by modulating the transcription of TPH. We
propose the following model by which serotonin regulates TPH gene
transcription (Fig. 11). Extracellular
stimuli acting through MAP kinases stimulate transcription of TPH to
increase serotonin biosynthesis. As the neuron fires and long term
serotonin levels increase, 5-HT1 autoreceptors are activated, and MKP-1
levels rise. MAP kinases are dephosphorylated and inactivated, reducing
activation of the TPH promoter. TPH mRNA and enzyme levels decline,
and serotonin biosynthesis falls, completing the negative feedback
loop.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 11.
Model for the autoregulation of serotonin
biosynthesis through transcriptional regulation of TPH. In
response to extracellular stimuli, MAP kinase phosphorylation of
transcription factors activates transcription of the TPH gene,
increasing serotonin biosynthesis. As synaptic levels of serotonin
increase, 5-HT1 autoreceptor stimulation increases MAP kinase
phosphatase-1 in the cell. MAP kinases are dephosphorylated, the
activation of the TPH promoter is reduced, and TPH gene transcription
declines.
|
|
The mechanism of 5-HT1 autoreceptor feedback regulation is at least in
part conveyed through repression of MAP kinase signal transduction
pathways. Traditionally, 5-HT1 receptors have been classified as
Gi-coupled receptors that inhibit adenylyl cyclase activity
(9, 46); however, 5-HT1 receptors also increase intracellular calcium
(47, 48). In CA77 cells, CGS and other 5-HT1 agonists do not affect
cAMP levels, but they do cause a prolonged pertussis toxin-independent
increase in intracellular calcium that leads to an increase in the
levels of MKP-1 (19, 20). This rise in MKP-1 would account for the
repression of MAP kinase activation of the TPH promoter that we have observed.
This is the first report that the TPH promoter is stimulated by MAP
kinases. A variety of stressors are well known activators of MAP kinase
signaling, and these pathways play physiologically important roles in
mediating responses to stress in rat models (29, 34). For example,
activity of the MAP kinase JNK is increased in selected brain
structures by immobilization stress (49). Importantly, stress appears
to modulate TPH activity. Sound stress in rats increases TPH activity
in the brain (50). Immobilization stress has been shown by Sabban and
co-workers (51) to significantly increase TPH mRNA levels in the
rat raphe nuclei. Interestingly, this increase was not seen in the
pineal gland, suggesting a neuron-specific mechanism. Although
extrapolation of in vitro data using osmotic shock and MEKK
transfections to whole animal models of stress is risky, in
vitro studies are valuable tools in guiding studies in more
complex paradigms. Our data imply there may be a connection between the
observed stress-induced increases in MAP kinase signaling and TPH
mRNA and activity. The stress-activated p38 kinase was shown to
contribute to MAP kinase stimulation of the TPH promoter. In addition,
residual stimulation following treatment with both mitogen-activated
protein kinase/extracellular signal-regulated kinase kinase and
p38 inhibitors may be due to stress-activated JNK, the MAP kinase
elevated by immobilization stress. MAP kinases may coordinate a cell's
response to stress, including increased serotonin production via
stimulation of TPH transcription. Because repression of MAP kinase
activation was maintained for almost 24 h after a relatively short
1.5 h of CGS treatment, 5-HT1 receptor activation could be a
biologically significant mechanism for long term regulation of TPH
expression in response to stress-induced serotonin levels. In addition,
the observed maximal repression after 24 h of CGS treatment is in
agreement with a mechanism requiring increased synthesis of MKP-1.
Given the highly restricted nature of TPH expression and the diverse
functions of the different cell types expressing TPH, cell-specific
gene regulation could be crucial for a cell to respond appropriately to
stress. The lack of a MEKK response in CHO, GH3, 3T3, and P815 cells
argues that the MAP kinase regulation is cell-specific, perhaps
operating through a cell-specific transcription factor. Because MEKK
induced a modest increase in TPH promoter activity in N2A cells, the
response may be in part neuron-specific. The lack of MEKK
responsiveness in P815 cells, a serotonergic mouse mastocytoma cell
line, suggests distinct mechanisms for TPH transcriptional regulation
in neuronal and nonneuronal serotonergic cells. The maximal activation
occurring in CA77 cells may result from additional serotonergic
neuron-specific elements.
We narrowed the maximal MEKK-responsive element to between bases 149
and 45 of the TPH promoter with modest responsiveness maintained by
the 69 to 45 bp region. When transferred to a heterologous
promoter, this region did not facilitate MEKK activation, although it
did confer a severalfold increase in basal promoter activity. Several
reasons may account for the apparent discrepancy between the absence of
MEKK responsiveness of TPH7x2-SV40luc and the 6-10-fold MEKK
activation of TPH0.069-luc. For example, spacing with the TATA box may
be crucial or downstream elements may be necessary for stimulation by
MAP kinases. The absence of MEKK responsiveness of TPH9-SV40luc
suggests that sequence downstream of 65, such as the inverted CCAAT
box, is required. Mutations in the inverted CCAAT box located in this
minimal region ( 69 to 45 bp) caused only a partial reduction in
activation by MEKK. The lack of complete inhibition may be due to the
involvement of multiple MAP kinase-responsive elements between 149
and 45. Consistent with the retention of activation by MEKK, the
inverted CCAAT mutations did not affect the response to CGS. We showed that the inverted CCAAT box binds NF-Y or an NF-Y-like protein in both
the serotonergic neuronal CA77 cell line and the nonneuronal CHO cell
line. This is in complete agreement with previous studies by Carr and
colleagues using other cell lines (12, 13). Hence, NF-Y alone is
unlikely to account for the cell-specific MAP kinase responsiveness.
Taken together, our data imply complex MAP kinase regulation of the TPH
promoter involving perhaps several pathways and interdependent sequence
elements including the inverted CCAAT box. NF-Y modulates
transcriptional activity through recruitment of other transcription
factors, acting as a general promoter organizer rather than a direct
transcriptional activator (52-56). Thus, NF-Y may stabilize the
interaction of a cell-specific MAP kinase-responsive protein with the
promoter to enhance transcriptional activation. One candidate is
complex CA3 in the CA77 nuclear extract, although further studies are
needed on this complex.
In summary, these data provide evidence for the autoregulation of
serotonin biosynthesis through the transcriptional regulation of
tryptophan hydroxylase. By this mechanism, we would predict that any
gene responsive to MAP kinases could be coordinately regulated by this
serotonergic feedback loop. Thus, MAP kinase signal transduction
pathways may provide a common mechanism for coordinating effects of
extracellular stimuli and 5-HT1 receptor activation on transcription of
genes in serotonergic neurons.
 |
ACKNOWLEDGEMENTS |
We thank David Neilsen for the TPH plasmid,
and we thank Scott Whittemore and members of the Russo laboratory for
helpful discussions.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant HD 25969 with tissue culture support provided by the Diabetes and
Endocrinology Center (Grant DK 25295).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Dept.
of Physiology and Biophysics, 5-632 BSB, University of Iowa, Iowa City, IA 52242. Tel.: 319-335-7872; Fax: 319-335-7330; E-mail:
andrew-russo@uiowa.edu.
Published, JBC Papers in Press, March 30, 2001, DOI 10.1074/jbc.M007520200
 |
ABBREVIATIONS |
The abbreviations used are:
5-HT, 5-hydroxytryptamine;
TPH, tryptophan hydroxylase;
MAP, mitogen-activated protein;
FBS, fetal bovine serum;
ITS, insulin/transferrin/selenium;
COII, cytochrome oxidase II;
CHO, Chinese
hamster ovary;
PCR, polymerase chain reaction;
MEKK, mitogen-activated
extracellular-signal regulated kinase kinase kinase;
EMSA, electrophoretic mobility shift assay;
ERK, extracellular
signal-regulated kinase;
JNK, c-Jun NH2-terminal kinase;
MKP-1, MAP kinase phosphatase-1;
bp, base pair(s);
kb, kilobase pair(s);
C/EBP, CCAAT/enhancer-binding protein.
 |
REFERENCES |
| 1.
|
Azmitia, E. C.,
and Whitaker-Azmitia, P. M.
(1991)
J. Clin. Psychiatry
52,
4-16
|
| 2.
|
Graeff, F. G.,
Guimaraes, F. S.,
De Andrade, T. G. C. S.,
and Deakin, J. F. W.
(1996)
Pharmacol. Biochem. Behav.
54,
129-141
|
| 3.
|
Saudou, F.,
Amara, D. A.,
Dierich, A.,
LeMeur, M.,
Ramboz, S.,
Segu, L.,
Buhot, M. C.,
and Hen, R.
(1994)
Science
265,
1875-1878
|
| 4.
|
Tyce, G. M.
(1990)
J. Cardiovasc. Pharmacol.
16,
S1-S7
|
| 5.
|
Boadle-Biber, M. C.
(1993)
Prog. Biophys. Mol. Biol.
60,
1-15
|
| 6.
|
Ehret, M.,
Cash, C. D.,
Hamon, M.,
and Maitre, M.
(1989)
J. Neurochem.
52,
1886-1891
|
| 7.
|
Johansen, P. A.,
Jennings, I.,
Cotton, R. G. H.,
and Kuhn, D. M.
(1995)
J. Neurochem.
65,
882-888
|
| 8.
|
Banik, U.,
Wang, G. A.,
Wagner, P. D.,
and Kaufman, S.
(1997)
J. Biol. Chem.
272,
26219-26225
|
| 9.
|
Hoyer, D.,
Clarke, D. E.,
Fozard, J. R.,
Hartig, P. R.,
Martin, G. R.,
Mylecharane, E. J.,
Saxena, P. R.,
and Humphrey, P. P. A.
(1994)
Pharmacol. Rev.
46,
157-192
|
| 10.
|
Park, D. H.,
Stone, D. M.,
Baker, H.,
Kim, K. S.,
and Joh, T. H.
(1994)
Mol. Brain Res.
22,
20-28
|
| 11.
|
Cortes, R.,
Mengod, G.,
Celasa, P.,
and Artigas, F.
(1993)
J. Neurochem.
60,
761-764
|
| 12.
|
Reed, G. E.,
Kirchner, J. E.,
and Carr, L. G.
(1995)
Brain Res.
682,
1-12
|
| 13.
|
Teerawatanasuk, N.,
and Carr, L. G.
(1998)
Mol. Brain Res.
55,
61-70
|
| 14.
|
Teerawatanasuk, N.,
Skalnik, D. G.,
and Carr, L. G.
(1999)
J. Neurochem.
72,
29-39
|
| 15.
|
Boularand, S.,
Darmon, M. C.,
Ravassard, P.,
and Mallet.
(1995)
J. Biol. Chem.
270,
3757-3764
|
| 16.
|
Siuciak, J. A.,
Clark, M. S.,
Rind, H. B.,
Whittemore, S. R.,
and Russo, A. F.
(1998)
J. Neurosci. Res.
52,
149-158
|
| 17.
|
Clark, M. S.,
Lanigan, T. M.,
Page, N. M.,
and Russo, A. F.
(1995)
J. Neurosci.
15,
6167-6178
|
| 18.
|
Clark, M. S.,
Lanigan, T. M.,
and Russo, A. F.
(1995)
Methods
7,
253-261
|
| 19.
|
Durham, P. L.,
Sharma, R.,
and Russo, A. F.
(1997)
J. Neurosci.
17,
9545-9553
|
| 20.
|
Durham, P. L.,
and Russo, A. F.
(1998)
Mol. Endocrinol.
12,
1002-1009
|
| 21.
|
Okada, S.,
Yamauchi, K.,
and Pessin, J. E.
(1995)
J. Biol. Chem.
270,
20737-20741
|
| 22.
|
Kultz, D.,
Madhany, S.,
and Burg, M. B.
(1998)
J. Biol. Chem.
273,
13645-13651
|
| 23.
|
Favata, M. F.,
Horiuchi, K. Y.,
Manos, E. J.,
Dauleria, A. J.,
Stradley, D. A.,
Feeser, W. S.,
Van Dyk, D. E.,
Pitts, W. J.,
Earl, R. A.,
Hobbs, F.,
Copeland, R. A.,
Magolda, R. L.,
Scherle, P. A.,
and Trzaskos, R. L.
(1998)
J. Biol. Chem.
273,
18623-18632
|
| 24.
|
Russo, A. F.,
Lanigan, T. M.,
and Sullivan, B. E.
(1992)
Mol. Endocrinol.
6,
207-218
|
| 25.
|
Durham, P. L.,
Nanthakumar, E. J.,
and Snyder, J. M.
(1992)
Exp. Lung Res.
18,
775-793
|
| 26.
|
Stoll, J.,
and Goldman, D.
(1991)
J. Neurosci. Res.
28,
457-465
|
| 27.
|
Lanigan, T. M.,
Tverberg, L. A.,
and Russo, A. F.
(1993)
Mol. Cell. Biol.
13,
6079-6088
|
| 28.
|
Tverberg, L. A.,
and Russo, A. F.
(1993)
J. Biol. Chem.
268,
15965-15973
|
| 29.
|
Boess, F. G.,
and Martin, I. L.
(1994)
Neuropharmacology
33,
275-317
|
| 30.
|
Darmon, M. C.,
Guibert, B.,
Leviel, V.,
Ehret, M.,
Maitre, M.,
and Mallet, J.
(1988)
J. Neurochem.
51,
312-316
|
| 31.
|
Rind, H. B.,
Russo, A. F.,
and Whittemore, S. R.
(2000)
Neuroscience
101,
665-677
|
| 32.
|
Seger, R.,
and Krebs, E. G.
(1995)
FASEB J.
9,
726-735
|
| 33.
|
Lange-Carter, C. A.,
Pleiman, C. M.,
Gardner, A. M.,
Blumer, K. J.,
and Johnson, G. L.
(1993)
Science
260,
315-319
|
| 34.
|
Lewis, T. S.,
Shapiro, P. S.,
and Ahn, N. G.
(1998)
Adv. Cancer Res.
74,
49-139
|
| 35.
|
Franklin, C. C.,
and Kraft, A. S.
(1997)
J. Biol. Chem.
272,
16917-16923
|
| 36.
|
Mansour, S. J.,
Matten, W. T.,
Hermann, A. S.,
Candia, J. M.,
Rong, S.,
Fukasawa, K.,
Vande Woude, G. F.,
and Ahn, N. G.
(1994)
Science
265,
966-970
|
| 37.
|
Cuenda, A.,
Rouse, J.,
Doza, Y. N.,
Meier, R.,
Cohen, P.,
Gallagher, T. F.,
Young, P. R.,
and Lee, J. C.
(1995)
FEBS Lett.
364,
229-233
|
| 38.
|
Thopmson, J. F.,
Hayes, L. S.,
and Lloyd, D. B.
(1991)
Gene (Amst.)
103,
171-177
|
| 39.
|
Vossler, M. R.,
Yao, H.,
York, R. D.,
Pan, M. G.,
Rim, C. S.,
and Stork, P. J. S.
(1997)
Cell
89,
73-82
|
| 40.
|
Xing, J.,
Kornhauser, J. M.,
Xia, Z.,
Thiele, E. A.,
and Greenberg, M. E.
(1998)
Mol. Cell. Biol.
18,
1946-1955
|
| 41.
|
Seternes, O. M.,
Johansen, B.,
and Moens, U.
(1999)
Mol. Endocrinol.
13,
1071-1082
|
| 42.
|
Hu, J.,
Sanjut, K. R.,
Shapiro, P. S.,
Rodig, S. R.,
Reddy, S. P. M.,
Platanias, L. D.,
Schreiber, R. D.,
and Kalvakolanu, D. V.
(2001)
J. Biol. Chem.
276,
287-297
|
| 43.
|
Chodosh, L. A.,
Baldwin, A. S.,
Carthew, R. W.,
and Sharp, P. A.
(1988)
Cell
53,
11-24
|
| 44.
|
Dorn, A.,
Bollekens, J.,
Staub, A.,
Benoist, C.,
and Mathis, D.
(1987)
Cell
50,
863-872
|
| 45.
|
Hufton, S. E.,
Jennings, I. G.,
and Cotton, G. H.
(1995)
Biochem. J.
311,
353-366
|
| 46.
|
Gerhardt, C. C.,
and van Heerikhuizen, H.
(1997)
Eur. J. Pharmacol.
334,
1-23
|
| 47.
|
Zgombick, J. M.,
Borden, L. A.,
Cochran, T. L.,
Kucharewicz, S. A.,
Weinshank, R. L.,
and Branchek, T. A.
(1993)
Mol. Pharmacol.
44,
575-582
|
| 48.
|
Durham, P. L.,
and Russo, A. F.
(1999)
J. Neurosci.
19,
3423-3429
|
| 49.
|
Nankova, B. B.,
Fuchs, S. Y.,
Serova, L. I.,
Ronai, Z.,
Wild, D.,
and Sabban, E. L.
(1998)
Stress
2,
289-298
|
| 50.
|
Boadle-Biber, M. C.,
Corley, K. C.,
Graves, L.,
Phan, T. H.,
and Rosencrans, J.
(1989)
Brain Res.
482,
306-316
|
| 51.
|
Chamas, F.,
Serova, L.,
and Sabban, E. L.
(1999)
Neurosci. Lett.
267,
157-160
|
| 52.
|
Wright, K. L.,
Vilen, B. J.,
Itoh-Lindstrom, Y.,
Moore, T. L.,
Li, G.,
Criscitiello, M.,
Cogswell, P.,
Clarke, J. B.,
and Ting, J. P.
(1994)
EMBO J.
13,
4042-4053
|
| 53.
|
Eggers, A.,
Siemann, G.,
Blume, R.,
and Knepel, W.
(1998)
J. Biol. Chem.
273,
18499-18508
|
| 54.
|
Jin, S.,
and Scotto, K. W.
(1998)
Mol. Cell. Biol.
18,
4377-4384
|
| 55.
|
Chang, Z. F.,
Huang, D. Y.,
and Hu, S. F.
(1999)
J. Cell. Biochem.
75,
300-309
|
| 56.
|
Di Silvio, A.,
Imbriano, C.,
and Montovani, R.
(1999)
Nucleic Acids Res.
27,
2578-2584
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K.-Y. Park and A. F. Russo
Control of the Calcitonin Gene-related Peptide Enhancer by Upstream Stimulatory Factor in Trigeminal Ganglion Neurons
J. Biol. Chem.,
February 29, 2008;
283(9):
5441 - 5451.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|