|
Originally published In Press as doi:10.1074/jbc.M100463200 on April 5, 2001
J. Biol. Chem., Vol. 276, Issue 24, 21292-21302, June 15, 2001
Proteolytic Degradation and Impaired Secretion of an
Apolipoprotein A-I Mutant Associated with Dominantly Inherited
Hypoalphalipoproteinemia*
Dan C.
McManus §,
Brian R.
Scott§¶,
Vivian
Franklin,
Daniel L.
Sparks, and
Yves L.
Marcel
From the Lipoprotein and Atherosclerosis Research Group,
Departments of Pathology and Laboratory Medicine and Biochemistry,
Microbiology, and Immunology, University of Ottawa Heart Institute,
Ottawa, Ontario K1Y 4W7, Canada
Received for publication, January 17, 2001, and in revised form, March 13, 2001
 |
ABSTRACT |
We have devised a combined in vivo,
ex vivo, and in vitro approach to elucidate the
mechanism(s) responsible for the hypoalphalipoproteinemia in
heterozygous carriers of a naturally occurring apolipoprotein A-I
(apoA-I) variant (Leu159 to Arg) known as apoA-I Finland
(apoA-IFIN). Adenovirus-mediated expression of
apoA-IFIN decreased apoA-I and high density lipoprotein cholesterol concentrations in both wild-type C57BL/6J mice and in
apoA-I-deficient mice expressing native human apoA-I (hapoA-I). Interestingly, apoA-IFIN was degraded in the plasma, and
the extent of proteolysis correlated with the most significant
reductions in murine apoA-I concentrations. ApoA-IFIN had
impaired activation of lecithin:cholesterol acyltransferase in
vitro compared with hapoA-I, but in a mixed lipoprotein
preparation consisting of both hapoA-I and apoA-IFIN there
was only a moderate reduction in the activation of this enzyme.
Importantly, secretion of apoA-I was also decreased from primary
apoA-I-deficient hepatocytes when hapoA-I was co-expressed with
apoA-IFIN following infection with recombinant
adenoviruses, a condition that mimics secretion in heterozygotes. Thus,
this is the first demonstration of an apoA-I point mutation that
decreases LCAT activation, impairs hepatocyte secretion of apoA-I, and
makes apoA-I susceptible to proteolysis leading to dominantly inherited hypoalphalipoproteinemia.
 |
INTRODUCTION |
Plasma concentrations of high density lipoprotein
(HDL)1 cholesterol (HDL-C)
are inversely correlated with the risk of developing coronary heart
disease (1). However, the complex and often poorly understood etiology
for variations in HDL-C concentrations within the general population
has made the therapeutic control of HDL levels an elusive target to
date. This is attributed to the intricate nature of HDL metabolism that
involves many components including the major HDL structural protein
apolipoprotein A-I (apoA-I) and multiple factors required for
cholesteryl ester (CE) formation, lipolysis, lipid transfer, cellular
lipid efflux, and cell surface interactions (reviewed in Refs.
2-4).
Nascent HDLs that are derived from the liver and intestine are poorly
lipidated (2, 5) and must acquire additional lipids for their
maturation into the more stable -migrating HDLs in plasma. Defective
clearance of triglyceride-rich lipoproteins (TRL) is recognized as a
major determinant of HDL-C concentrations. Recessive mutations in
lipoprotein lipase and its major activator protein apolipoprotein C-II,
which result in impaired hydrolysis of TRL, also contribute to low
HDL-C concentrations. Also the efficient conversion of free cholesterol
(FC) to CE on HDL by lecithin:cholesterol acyltransferase (LCAT) is
necessary for HDL maturation and depends on apoA-I as its physiological
activator (reviewed in Refs. 2-4). Recent work has also highlighted
the importance of both the ATP-binding cassette transporter A1 (ABCA1) protein and phospholipid transfer protein (PLTP) in maintaining normal
HDL-C concentrations. PLTP-deficient mice have HDL-C levels that are
reduced by 60-70% (6) as a result of enhanced catabolism of HDL
apparently due to defective transfer of lipids from TRL to nascent HDL
(7). Mutations in the ABCA1 cause Tangier disease (8-10) in which
affected individuals have less than 5% of the normal HDL-C
concentrations due to impaired cellular lipid efflux to nascent
HDL.
Isolated familial hypoalphalipoproteinemia (FHA) is more common than
Tangier disease, and heterozygous mutations in ABCA1 can give rise to
FHA (8, 11, 12). However, mutations in apoA-I also contribute
significantly to FHA in the general population. A recent study has
shown that in a group of 1264 Japanese school children, 6% of FHA
cases defined as HDL-C concentrations below the 5th percentile matched
for age and sex were related to apoA-I mutations (13). This would
represent an incidence of 0.3% for apoA-I mutations in the general
population, which is significant and warrants mechanistic studies on
the relationships between these mutations and hypoalphalipoproteinemia.
Many apoA-I mutations have been identified (reviewed in Refs. 3, 14),
but particularly interesting among them are those associated with a
dominant FHA phenotype, such as apoA-I Finland (apoA-IFIN).
This mutation was originally identified in a Finnish kindred and
results from a Leu to Arg substitution at amino acid (aa) 159 (15).
These individuals are heterozygous carriers of this mutation and yet
have HDL-C and apoA-I concentrations that are 20 and 25% of the normal
plasma concentrations, respectively (15). The cause for this dominant negative effect on HDL-C concentrations remains largely unknown. ApoA-IFIN was shown to have reduced LCAT activation
compared with native human apoA-I (hapoA-I) (16), but it has not been
established whether this mutant can inhibit LCAT activation by hapoA-I
and confer its dominant negative phenotype in this manner. We present the results of a combined in vivo, ex vivo, and
in vitro study of the mechanisms responsible for the
dominant negative effects on HDL-C brought about by
apoA-IFIN, and we demonstrate that the mutation exerts its
effects at multiple levels.
 |
EXPERIMENTAL PROCEDURES |
Mutagenesis of ApoA-I cDNA--
The apoA-IFIN
cDNA was generated by the QuikChangeTM mutagenesis
protocol from Stratagene (La Jolla, CA) with sense
5'GTGGACGCGCGGCGCACGCATC3' and antisense
5'GATGCGTGCGCCGCG-CGT3' primers (Life Technologies, Inc.).
The underlined sequence indicates the mutagenic bases required for the Leu to Arg conversion at aa 159 within apoA-I. To generate the
purified recombinant His-tagged apoA-IFIN (see below),
mutagenesis was carried out on plasmid pXL2116. This plasmid is a
modified pET3a vector (Stratagene) that contains the apoA-I cDNA
(minus the region coding for the prepro sequence) and an upstream
region coding for an 11-aa N-terminal extension containing a
His6 tag as described previously (17). For
generation of the recombinant adenovirus (Ad5) carrying the
apoA-IFIN cDNA (apoA-IFIN.Ad5, see below),
the mutagenesis was carried out on plasmid pCA13 (Microbix Biosystems
Inc., Toronto, Canada) harboring the hapoA-I cDNA. For both sets of
mutagenesis reactions, positive clones were determined by the loss of
the FspI restriction site that occurs as a result of a
T to G substitution for this mutation as documented previously (15). The full-length apoA-IFIN cDNAs were sequenced
prior to generation of the recombinant apoA-IFIN protein
and the apoA-IFIN.Ad5.
Production and Screening of First Generation ApoA-I Recombinant
Adenoviruses--
The apoA-IFIN.Ad5 was generated and
purified in the same manner as the hapoA-I adenovirus (hapoA-I.Ad5)
recently described by our laboratory (18). Prior to the studies with
the primary hepatocytes and mice (see below), we confirmed that
apoA-IFIN was produced and secreted from COS-7 cells
following infection with the recombinant adenovirus. Medium was
analyzed 2-3 days after infection by 12% SDS-polyacrylamide
gel electrophoresis (PAGE) performed under reducing conditions, which
was then subjected to Western blot analysis following transfer to
nitrocellulose membrane. The membrane was probed with anti-apoA-I
monoclonal antibodies 4H1 and 5F6, and the apoA-IFIN
protein in the medium was detected by chemiluminescence (WestPico
SuperSignal Substrate, Pierce) following treatment with horseradish
peroxidase-conjugated anti-mouse IgG (Amersham Pharmacia Biotech).
Animals--
ApoA-I-deficient
(ApoA1tm1Unc) and wild-type C57BL/6J mice were
obtained from Jackson Laboratories (Bar Harbor, ME) and Charles River
Laboratories (Wilmington, MA), respectively. Mice were maintained on a
12-h light/12-h dark schedule and were fed either a normal chow
(Charles River rodent diet 5075, 18% protein and 4.5% fat) or high
fat Western (Harlan Teklad TD 88137, 19.5% protein, 42% fat, 0.15%
cholesterol) diet as indicated. All experiments were performed in
accordance with protocols approved by the University of Ottawa Animal
Care Committee. Mice used for these studies were 3-8-month-old
females, except where indicated.
In Vivo Metabolism of HapoA-I and
ApoA-IFIN--
Wild-type and apoA-I-deficient C57BL/6J
mice were injected via the tail vein with either the hapoA-I.Ad5, the
apoA-IFIN.Ad5, or the control luciferase adenovirus
(luc.Ad5) at a dose of 2 × 109
plaque-forming units (pfu) (~3.7 × 1010
adenoviruses). ApoA-I-deficient mice were also co-injected with 1 × 109 pfu of each of the hapoA-I.Ad5 and the
apoA-IFIN.Ad5. Blood was collected in K3-EDTA
tubes at various times following the injections, and plasma samples
isolated were immediately placed on ice and incubated with a protease
inhibitor mixture consisting of aprotinin (0.15 µM),
leupeptin (1 µM), and a protease inhibitor mixture
(complete EDTA-free®) (Roche Molecular Biochemicals). The plasma and
HDL total cholesterol (TC), FC, and phospholipid concentrations were measured with enzymatic kits as described (18), and human apoA-I concentrations (hapoA-I and apoA-IFIN) were measured by a
solid-phase radioimmunoassay (19, 20). HDL fractions were isolated
from the plasma by discontinuous gradient density ultracentrifugation (18). ApoA-I present in - and pre- -migrating HDL was determined by agarose gel electrophoresis (Beckman Lipogel) and Western blot analysis. Western blots for apoA-I were also performed on plasma after
it was subjected to 12% SDS-PAGE under reducing conditions or 4-20%
polyacrylamide gradient gel electrophoresis (PAGGE) under native
conditions. For anti-human apoA-I Western blots, monoclonal antibodies
4H1 and 5F6 were biotinylated with Sulfo-NHS-Biotin (Pierce), and
chemiluminescence was performed following treatment with horseradish
peroxidase-conjugated streptavidin (Amersham Pharmacia Biotech). Murine
apoA-I (mapoA-I) was detected with an anti-mouse apoA-I antibody
(BIODESIGN International, Kennebunk, ME), and chemiluminescence was
carried out as above following treatment with anti-rabbit horseradish
peroxidase-conjugated IgG (Amersham Pharmacia Biotech).
Secretion of HapoA-I and ApoA-IFIN from Primary Mouse
Hepatocytes--
Primary hepatocytes were prepared from
apoA-I-deficient mice according to an established protocol (21, 22).
Briefly, the cells were seeded in fibronectin-coated (25 µg/well)
6-well plates at an initial density of 1-2 × 106
cells per well in William's medium containing penicillin (100 units/ml), streptomycin sulfate (100 units/ml), Fungizone® (250 ng/ml)
(Life Technologies, Inc.), and 10% fetal bovine serum (FBS) (Sigma).
Cells were infected the following day (24 h) with either the
hapoA-I.Ad5 or the apoA-IFIN.Ad5 at a multiplicity of
infection (m.o.i.) of 75:1 (pfu/cell) or with a mixture of hapoA-I.Ad5
and apoA-IFIN.Ad5 each at an m.o.i. of 37.5:1 (total m.o.i. = 75:1). 24 h after the initial infection, the William's medium
was removed, and the hepatocytes were incubated in Dulbecco's minimal
essential medium (DMEM) without methionine and cysteine containing 10%
FBS (pre-labeling medium) for 1 h. Following this, the cells were pulse-labeled for 1 h with labeling medium (pre-labeling medium plus 150 µCi/well [35S]methionine). The labeling medium
was then removed, and growth medium (DMEM plus 10% FBS) was added.
Cells and medium were collected at the various time points up to 4 h after the initial pulse and harvested as described by McLeod et
al. (23). ApoA-I was immunoprecipitated from the media and cell
lysates with anti-human apoA-I antisera (Roche Molecular Biochemicals)
and protein G-Sepharose (Amersham Pharmacia Biotech) and then subjected
to 12% SDS-PAGE. The radioactivity associated with apoA-I at each time
point was determined by PhosphorImager analysis (Personal Molecular
Imager® FX, Bio-Rad) and is represented as a percentage of the initial
cell apoA-I-associated radioactivity counts (t = 0).
Statistical significance was determined by Student's t
test. The data presented are the mean of triplicate measurements (± S.E.) and are representative of three independent experiments.
Purification of Recombinant His-tagged Proteins--
The
recombinant His-tagged hapoA-I (rec.hapoA-I) and apoA-IFIN
proteins (rec.apoA-IFIN) used for these studies were
prepared as described previously (17) with some minor changes.
Escherichia coli strain BL21(DE3) (Stratagene) was used
instead of strain BL21(DE3)pLysS (Stratagene); LB broth and not M9
minimal medium was used for expression of the proteins, and rifampicin
was omitted from the bacterial cultures. Following purification on
nickel-nitrilotriacetic acid-agarose (Qiagen) columns, the proteins
were dialyzed against sodium bicarbonate (5 mM, pH 8)
containing EDTA (1 mM) and azide (0.02%), lyophilized, and
stored at 20 °C. Prior to the in vitro studies, the
lyophilized recombinant proteins were solubilized in 6 M
guanidine hydrochloride and dialyzed extensively against phosphate-buffered saline or Tris-buffered saline as required.
Preparation of Reconstituted Lipoproteins
(Lp2A-I)--
Discoidal reconstituted lipoproteins containing two
apoA-I molecules per particle (Lp2A-I) were prepared by the cholate
dispersion/Bio-Beads removal technique using a starting
1-palmitoyl-2-oleoyl-phosphatidylcholine (POPC)/FC/apoA-I ratio of
80:10:1 as published by Sparks et al. (24). The homogeneity
and hydrodynamic diameters of the Lp2A-I were determined by
non-denaturing PAGGE as described previously (17). The reconstituted
lipoproteins were shown to contain two molecules of recombinant apoA-I
by cross-linking with dimethyl suberimidate according to an established
protocol (25). The Lp2A-I phospholipid compositions were determined
with an enzymatic kit (Wako Chemicals, Neuss, Germany) as was FC (Roche
Molecular Biochemicals). The apoA-I concentrations were measured by the Markwell Lowry method (26) using bovine serum albumin (BSA) as the standard.
Stability of Association on Lp2A-I--
The stability of
association of rec.hapoA-I and rec.apoA-IFIN on the Lp2A-I
was measured by CD spectroscopy using a Jasco J41A spectropolarimeter.
The change in molar ellipticity at 222 nm in the presence of increasing
amounts of guanidine hydrochloride was used to calculate the standard
free energy of denaturation ( GD0) as
described previously (24).
Lecithin:Cholesterol Acyltransferase Assay--
LCAT was
purified according to Albers et al. (27) and the cholesterol
esterification studies were performed as outlined previously (28). The
Lp2A-I used in these studies (initial POPC/FC/apoA-I ratio of 80:10:1)
were labeled with [1 ,2 -3H]cholesterol (PerkinElmer
Life Sciences) and contain either rec.hapoA-I alone
(Lp2A-IWT), rec.apoA-IFIN alone
(Lp2A-IFIN), or an equimolar mixture of the two
(Lp2A-IWT/FIN). The Lp2A-IWT/FIN are hybrid populations that were prepared to resemble most closely the nascent lipoproteins formed in heterozygous carriers of the
apoA-IFIN mutation. Since rec.hapoA-I and
apoA-IFIN have equal lipid binding capabilities and given
that all proteins were incorporated into the particles, the
Lp2A-IWT/FIN represent a heterogeneous lipoprotein population, similar to those that might form in vivo.
Approximately 50% of the Lp2A-I contain one molecule of each, 25% two
molecules of rec.hapoA-I, and 25% two molecules of
rec.apoA-IFIN. Two different types of experiments were
performed. The initial rate constants apparent Km
(appKm) and Vmax were
calculated by incubating the Lp2A-I at the concentrations indicated
(given as µM of apoA-I) with the enzyme for 10 min at
37 °C and terminating the reaction with the addition of 2 ml of
ethanol. Under these conditions, there is minimal substrate conversion
as documented previously (28). In the second experiment, the time
course of CE formed was followed over 5 h by incubating Lp2A-I
particles at a final apoA-I concentration of 2.0 µM with
3.5 units of LCAT. For both sets of experiments, the values are the
mean (± S.E.) of triplicate measurements and represent the average of
two independent experiments. Statistical analysis was performed using
the Student's t test. One unit of LCAT is defined as the
amount required to convert 1 nmol of FC to CE per h using a standard
Lp2A-I particle (prepared as described above) at a final apoA-I
concentration of 2.0 µM.
Cholesterol Efflux Studies--
Efflux of cholesterol from mouse
J774 macrophages (ATCC TIB-67) to rec.hapoA-I or
rec.apoA-IFIN with or without stimulation by cAMP was
performed as outlined previously (29). Briefly, J774 macrophages in
12-well plates were loaded with [1 ,2 -3H]cholesterol
(10 µCi/well) using acetylated low density lipoproteins (75 µg/ml)
in DMEM containing 10% FBS, penicillin (100 units/ml), and
streptomycin sulfate (100 µg/ml). After 36 h, the loading medium
was removed and replaced with serum-free DMEM containing 0.2% (w/v)
BSA (DMEM/BSA) with or without the membrane-permeable cAMP analog
8-(4-chlorophenylthio)-cAMP (pCPT-cAMP) (0.15 mM final) (Sigma). Cholesterol was allowed to equilibrate with the cells for
10-12 h at which time the medium was removed and replaced with
DMEM/BSA with or without pCPT-cAMP containing rec.hapoA-I or
rec.apoA-IFIN as lipid-free proteins or as Lp2A-I (1.7 µM final apoA-I concentration). Efflux was measured over
3 h after subtracting the basal 3H-FC efflux to medium
of cells without apoA-I (DMEM/BSA control) which was less than 10% of
the apoA-I-specific efflux.
 |
RESULTS |
Since apoA-IFIN causes hypoalphalipoproteinemia in
carriers of this mutation, we first sought to reproduce this phenotype in a mouse model by de novo expression of
apoA-IFIN. This was accomplished by two different
approaches. First, wild-type C57BL/6J mice were injected with either
the apoA-IFIN.Ad5 or the hapoA-I.Ad5, and their effects on
mapoA-I (Fig. 1) and HDL-C concentrations were compared. The concentrations of mapoA-I were decreased
significantly by apoA-IFIN (Fig. 1B, lower
right panel, lanes 1-4) but not by hapoA-I (Fig.
1A, lower right panel, lanes 1-4).
Interestingly, evidence of apoA-IFIN proteolysis was seen
in the plasma (Fig. 1B, upper right panel), and the greatest
decreases in mapoA-I concentrations correlated with plasma samples that
had the most significant amounts of apoA-IFIN degradation
(Fig. 1B, lower right panel, lanes 3 and 4). Overall, low concentrations of circulating apoA-IFIN (50 ± 4.6 mg/dl) caused a statistically
significant decrease (p < 0.03) in mapoA-I
concentrations (to 32 ± 22% of pre-injected values) that was not
found for higher and more physiological concentrations (141 ± 27 mg/dl) of hapoA-I (p = 0.14) (Fig. 1C). Furthermore, apoA-IFIN decreased the HDL-C concentrations
and caused a remodeling of HDL in these mice converting the large HDL2 to smaller HDL3 (not shown). This is
similar to what was observed when hapoA-I and apoA-IFIN
were co-expressed in apoA-I-deficient mice (below).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 1.
Proteolysis of apoA-IFIN is
correlated with reductions in murine apoA-I concentrations in C57BL/6J
mice expressing sub-physiological concentrations of this human apoA-I
mutant. Plasma (1.5 µl) was isolated from mice and subjected to
12% SDS-PAGE and then Western blot analysis following transfer to
nitrocellulose. The blots were probed with either a mixture of
biotinylated anti-human apoA-I monoclonal antibodies ( -human)
(upper panels) or a polyclonal anti-mouse ( -mouse) apoA-I
antibody (lower panels) as described under "Experimental
Procedures." A, plasma was isolated from 4 mice prior to
(left panels) or 4 days after injections of 2 × 109 pfu of the hapoA-I.Ad5 (right panels).
B, plasma was isolated from 4 mice prior to (left
panels) or 4 days after injections of 2 × 109
pfu of the apoA-IFIN.Ad5 (right panels).
C, densitometric scanning of the mapoA-I bands before
(white bars) or following injections of the hapoA-I.Ad5
(gray bar) or the apoA-IFIN.Ad5 (black
bar). There is a statistically significant reduction
(p < 0.03) in mapoA-I concentrations (33 ± 22%
of normal values) following expression of apoA-IFIN
(50 ± 4.6 mg/dl) but not with hapoA-I at higher and more
physiological concentrations (141 ± 27 mg/dl). The greatest
reductions in mapoA-I concentrations correlate with the most extensive
proteolysis of apoA-IFIN.
|
|
To confirm these results and more closely mimic the human heterozygous
state, apoA-I-deficient mice were co-injected with the hapoA-I.Ad5 and
the apoA-IFIN.Ad5, and the circulating apoA-I and total
cholesterol concentrations were compared with mice injected with either
the hapoA-I.Ad5 or the apoA-IFIN.Ad5 alone (Fig.
2). Mice injected with the hapoA-I.Ad5
had high circulating concentrations of hapoA-I that reached
physiological concentrations by 4 days and peaked at high levels
between 7 and 9 days before returning to lower concentrations at 12 days (Fig. 2A, ). In contrast, co-expression of hapoA-I
and apoA-IFIN (Fig. 2A, ) resulted in only
moderate concentrations of circulating apoA-I (50-70 mg/dl) that were
3-8-fold lower in these mice throughout the time course of expression
compared with hapoA-I. In fact, the apoA-I concentrations following
co-expression of the two proteins were similar to mice expressing only
apoA-IFIN (Fig. 2A, ), except that apoA-I
levels were sustained longer in the plasma when both proteins were
present. The increases in total cholesterol concentrations were
confined to the HDL pool ( > 1.06 g/ml) and paralleled the
expression of the human apoA-I proteins in these mice (Fig.
2B). Native hapoA-I increased the HDL-TC concentrations
reaching a maximum between 7 and 9 days (Fig. 2B, ),
whereas co-expression of hapoA-I and apoA-IFIN had only a
moderate effect on the HDL-TC concentrations (2-3-fold increase) (Fig.
2B, ) throughout the time course (Table I). ApoA-IFIN (Fig.
2B, ) produced a similar effect, but the return to
base-line plasma cholesterol concentrations occurred more rapidly (by
6-8 days) (Table I) and followed the more transient expression of this
protein in apoA-I-deficient mice.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2.
ApoA-I-deficient mice co-expressing hapoA-I
and apoA-IFIN or apoA-IFIN alone have greatly
reduced apoA-I and HDL total cholesterol concentrations compared with
mice expressing only hapoA-I over the time course of expression.
ApoA-I-deficient mice were pre-bled and then injected with either
2 × 109 pfu of the hapoA-I.Ad5 alone (3 males),
1 × 109 pfu of each of the hapoA-I.Ad5 and the
apoA-IFIN.Ad5 (2 males and 1 female), and for comparison
2 × 109 pfu of the apoA-IFIN.Ad5 alone (3 females) as described under "Experimental Procedures."
A, the apoA-I concentrations in mouse plasma samples were
measured with a standard radioimmunoassay as described previously (19,
20). In mice expressing hapoA-I alone ( ), the apoA-I concentrations
reach physiological concentrations 4 days following injections of the
adenoviruses and peaks between days 7 and 9 before returning to
physiological concentrations once again by day 12. In contrast, mice
co-expressing hapoA-I and apoA-IFIN ( ) have a delayed
appearance of apoA-I in the plasma, and the apoA-I concentrations
attained are much lower. The apoA-I concentrations are more similar to
mice expressing only apoA-IFIN ( ), except the duration
of expression is sustained longer in mice expressing both proteins.
B, the plasma total cholesterol concentrations were
determined as described under "Experimental Procedures," and the
increases following apoA-I expression are confined to the HDL pool.
Mice expressing hapoA-I alone ( ) have large increases in HDL total
cholesterol that parallel the apoA-I concentrations over the time
course of expression. Mice co-expressing hapoA-I and
apoA-IFIN ( ) or apoA-IFIN alone ( ) have
only moderate increases in HDL total cholesterol concentrations, which
demonstrate the dominant negative effect of this human mutation in
these mice. The transient expression of apoA-IFIN is
paralleled by a return to normal plasma cholesterol concentrations in
these mice 6 days post-injection ( ).
|
|
View this table:
[in this window]
[in a new window]
|
Table I
The changes in apoA-I-deficient plasma lipid concentrations as a
function of time of expression of either hapoA-I or apoA-IFIN
alone or co-expression of hapoA-I and apoA-IFIN
The increases in plasma lipid concentrations were found in HDL
fractions ( > 1.06 g/ml). Mice (n = 3 for each group) were injected with either 2 × 109 pfu of
either the hapoA-I.Ad5 or the apoA-IFIN.Ad5 or co-injected with
1 × 109 pfu of each. Plasma was collected, and lipids
were measured the same day as outlined under "Experimental
Procedures." Plasma lipid concentrations are shown for day 2, day 4, and day 8 following injections of the apoA-I recombinant adenoviruses.
The values are compared for statistical significance (Student's
t test) as outlined below.
|
|
A more detailed analysis of the effects of the different adenovirus
injections on plasma lipid concentrations in these mice is provided in
Table I. Shown are the changes for 3 different days (2, 4, and 8 days)
and are representative of early, intermediate, and late time points
following injections of the adenoviruses. Statistically significant
increases (p < 0.05) in all pre-injected plasma lipid
concentrations occur following expression of hapoA-I by 4 days
post-injection and are maintained at day 8 and beyond. Expression of
apoA-IFIN or co-expression of hapoA-I and
apoA-IFIN, on the other hand, did not produce these large
changes in plasma lipid concentrations. Therefore, by 4 days
post-injections there were significant differences in plasma lipid
concentrations between mice expressing apoA-IFIN alone or
co-expressing hapoA-I and apoA-IFIN and mice expressing
hapoA-I (p < 0.05). Co-expressing hapoA-I and
apoA-IFIN produced significant changes by 8 days
post-injections compared with mice expressing apoA-IFIN
alone (p < 0.05) due to the return to base-line plasma
lipid concentrations in mice expressing only the mutant protein.
HDL size and charge were also monitored 4 days following injections of
the different adenoviruses (Fig. 3).
Interestingly, small HDL only were formed (8-9 nm) in apoA-I-deficient
mice injected with the hapoA-I.Ad5 and the apoA-IFIN.Ad5
(Fig. 3A, lanes 3 and 5) similar in size although
somewhat larger than in mice injected with the
apoA-IFIN.Ad5 (lane 6). The absence of large HDL
in mice expressing both proteins is consistent with that found in
heterozygous carriers of the apoA-IFIN mutation (16). In
contrast, hapoA-I formed mostly large HDL2 in these mice
(Fig. 3A, lanes 2 and 4). Despite the decrease in
HDL pool size and concentrations, both - and pre- -migrating HDL
were present in mice co-expressing apoA-IFIN and hapoA-I
(Fig. 3B, lanes 4 and 5) as was found for mice
expressing only hapoA-I (Fig. 3B, lanes 2 and 3).
In contrast, apoA-IFIN was found predominantly as
pre- -HDL with a minor population that migrated between the pre- -
and -migrating species. Negative staining electron microscopy also
revealed that discoidal HDL were formed by apoA-IFIN (not
shown) similar to what we observed previously for apoA-I central domain
deletion mutants (18). Of note, the antibodies used (which were
generated against lipid-free apoA-I) reacted much more strongly with
pre- -HDL on transferred agarose gels, and no quantitative
information on HDL charge distribution is implied or can be determined
from this figure (Fig. 3B). As such, there appeared to be
more pre- - than -migrating HDL in mice expressing hapoA-I than
was the case. Most of the hapoA-I was -migrating as demonstrated by
lipid and protein staining (not shown), large (Fig. 3A) and
very buoyant (Fig. 4). The pre- -HDL containing the human apoA-I proteins in these mice were predominantly larger pre- 2-HDL that co-migrated with the -HDL on
native gels (Fig. 3A). There were also smaller amounts of
lipid-poor pre- 1-HDL that appeared on the native gels
(bottom of Fig. 3A) and when HDL were isolated by
discontinuous gradient ultracentrifugation (Fig. 4).

View larger version (82K):
[in this window]
[in a new window]
|
Fig. 3.
Differences in HDL size and charge are
observed in apoA-I-deficient mice expressing either hapoA-I or
apoA-IFIN alone or co-expressing hapoA-I and
apoA-IFIN. Plasma was isolated from apoA-I-deficient
mice 4 days following injections with the hapoA-I.Ad5, the
apoA-IFIN.Ad5, or both as described for Fig. 2.
A, plasma was subjected to 4-20% nondenaturing PAGGE and
then to Western blot analysis following transfer to nitrocellulose.
Lanes 1 and 7 contain biotinylated high molecular
weight markers of known hydrodynamic diameters as indicated on the
left; lanes 2 and 4, hapoA-I plasma
(0.33 µl); lanes 3 and 5, hapoA-I/apoA-IFIN plasma (1 µl); and lane 6, apoA-IFIN plasma (1 µl). Large HDL2 are
absent in mice that co-express apoA-IFIN and hapoA-I, which
mimic the phenotype observed in individuals heterozygous for this
mutation. Mice expressing hapoA-I alone form predominantly large
HDL2 species, whereas mice expressing apoA-IFIN
form smaller HDL (8-9 nm) similar in size to mice co-expressing
hapoA-I and apoA-IFIN. B, the charge of the
apoA-I lipoproteins was determined by Western blot analysis of an
agarose gel electrophoresis. The antibodies react much more strongly
with the pre- -HDL, and no quantitative information on HDL charge
distribution is implied from this figure. However, apoA-I circulates as
a mixture of - and pre- -migrating HDL following expression of
hapoA-I alone (1 µl, lanes 2 and 3) or
following co-expression of hapoA-I and apoA-IFIN (5 µl,
lanes 4 and 5). In contrast,
apoA-IFIN (1 µl, lane 6) is found
predominantly as pre- -HDL with minor population that migrates in
between the - and pre- -species. Lipid-free apoA-I (0.2 µg)
prepared from human plasma (lane 1) is run as a
standard.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 4.
Proteolysis of apoA-IFIN is
confined to HDL3 and lipid-poor species in the plasma of
apoA-I-deficient mice expressing this human apoA-I mutant.
ApoA-I-deficient mice were maintained on the Teklad Western diet for 3 weeks prior to injection of either the hapoA-I and the
apoA-IFIN recombinant adenoviruses (2 × 109 pfu). A, plasma isolated from
apoA-I-deficient mice at the given days following injections with
either the hapoA-I.Ad5 or the apoA-IFIN.Ad5 was subjected
to 12% SDS-PAGE under reducing conditions followed by Western blot
analysis. Proteolysis of apoA-IFIN is detected in the
plasma, and the size of the major fragment ( ) was found to be 18.5 kDa. This is the size predicted for an N-terminal fragment if cleavage
occurs at or very close to the site of the apoA-IFIN
mutation (antibodies used recognize N-terminal epitopes on apoA-I).
B, selected HDL fractions were isolated from the plasma of
fasted (9-11 h) apoA-I-deficient mice 4 days following injections of
the recombinant adenoviruses and were subjected to 12% SDS-PAGE and
Western blot analysis as described under "Experimental Procedures."
Degradation products for apoA-IFIN are confined to the
smaller HDL (HDL3) and lipid-poor species, and none are
detected for hapoA-I.
|
|
Proteolysis of apoA-IFIN was also also evident following
adenovirus-mediated expression in apoA-I-deficient mice (Fig. 4), similar to that observed in C57BL/6J mice (Fig. 1). For these experiments, female apoA-I-deficient mice between 4 and 6 months of age
were maintained on a Western diet 3 weeks prior to injection of the
recombinant adenoviruses. Under these dietary conditions, apoA-IFIN reached significantly higher levels (>100 mg/dl)
allowing direct detection of the degradation products in the plasma by both Ponceau staining (not shown) and Western blot analysis (Fig. 4A). The monoclonal antibodies used for Western blot
analysis recognize epitopes N-terminal to the Leu159 Arg mutation (4H1 and 5F6 epitopes map to residues 1-8 and 118-148 of
human apoA-I, respectively). Therefore, the major 18.5-kDa fragment
represents an N-terminal degradation product and corresponds to the
size expected if cleavage occurred at or near the site of the mutation.
HDL fractions were isolated by centrifugation of pooled plasma
collected from fasted (9-11 h) apoA-I-deficient mice on the Western
diet 4 days after injection with either the hapoA-I or the
apoA-IFIN recombinant adenoviruses (Fig. 4B).
The apoA-IFIN degradation products were confined to the
smaller HDL and lipid-poor fractions where the majority of this mutant
was located ( > 1.13 g/ml). In contrast, no degradation
products were found for hapoA-I which was found predominantly as
buoyant HDL2 ( = 1.07 g/ml).
The delayed appearance of apoA-I in the plasma of apoA-I-deficient mice
either co-expressing the two proteins or expressing apoA-IFIN alone (Fig. 2) suggested that the
apoA-IFIN mutation might also impair hepatocyte
secretion of apoA-I. To address this, apoA-I secretion was monitored in
primary apoA-I-deficient murine hepatocytes infected with either the
hapoA-I.Ad5 or apoA-IFIN.Ad5 (m.o.i. = 75:1 pfu/cell). As
well, in order to simulate hepatic secretion of this mutant in
heterozygous individuals, cells were co-infected with equal amounts of
both recombinant adenoviruses at a half-dose (m.o.i. = 37.5 each) in
which the combined titer was equivalent to that used to study secretion
independently (Fig. 5). These results are
representative of three separate experiments, and significant
differences in the amounts of secreted and cell-associated 35S-apoA-I were detected under the different conditions
during the initial chase period (t = 1 h)
(p < 0.05). Less apoA-I was secreted in cells
co-infected with the two adenoviruses (Fig. 5A, )
compared with hepatocytes infected with the hapoA-I.Ad5 alone (Fig.
5A, ). The apoA-I secreted was decreased further when
apoA-IFIN was expressed alone (Fig. 5A, ).
Interestingly, there was also less 35S-apoA-I associated
with the hepatocytes expressing both apoA-I proteins (Fig.
5B, ) at 1 h compared to hepatocytes expressing only
hapoA-I (Fig. 5B, ), and between 20 and 30% of the
35S-apoA-I is unaccounted for in these cells during the
chase. Likewise, there was also less cell-associated
35S-apoA-I than expected in apoA-IFIN
expressing hepatocytes throughout the chase even though this mutant
accumulated in the hepatocytes (Fig. 5B, ) as anticipated
from its poor secretion.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 5.
The apoA-IFIN mutation impairs
apoA-I secretion from hepatocytes and enhances its intracellular
clearance. Primary hepatocytes from apoA-I-deficient mice were
prepared as described previously (21, 22) and infected with the
recombinant adenoviruses as described under "Experimental
Procedures." 24 h after the initial infection, the cells were
labeled with [35S]methionine for 1 h and chased for
up to 4 h. A, the accumulation of
35S-apoA-I (given as the percentage of initial
cell-associated apoA-I) in the medium is reported as a function of
chase time following expression of hapoA-I ( ), apoA-IFIN
( ), or both ( ). The initial rates of apoA-I secretion at the 1-h
time point during the chase (before the plateaus are reached) show that
hepatocytes co-expressing hapoA-I and apoA-IFIN ( ) have
impaired apoA-I secretion compared with hepatocytes expressing hapoA-I
( ) (p < 0.05, Student's t test). ApoA-I
secretion is reduced further in hepatocytes expressing
apoA-IFIN ( ) (p < 0.05 at 1 h).
B, the amount of 35S-apoA-I remaining in the
cells (as a percentage of initial cell associated apoA-I) is reported
as a function of chase time following expression of hapoA-I ( ),
apoA-IFIN ( ), or both ( ). Interestingly, at the 1-h
time point less cell-associated apoA-I is found in hepatocytes
co-expressing hapoA-I and apoA-IFIN ( ) compared with
hepatocytes expressing hapoA-I ( ) (p < 0.05)
despite the fact these cells also secrete less apoA-I into the medium.
This suggests that the apoA-IFIN mutation not only
interferes with hepatocyte secretion but makes apoA-I susceptible to
intracellular clearance as well. This finding is supported by the
observation that less than the expected amount of apoA-IFIN
accumulates in the cells ( ). Statistically significant differences
in medium and cell-associated apoA-I between hepatocytes co-expressing
the two proteins or expressing apoA-IFIN alone and
hepatocytes expressing hapoA-I are shown (*, p < 0.05, or **, p < 0.10).
|
|
The physicochemical properties of rec.hapoA-I and
rec.apoA-IFIN purified from E. coli were also
compared and found to be very similar. The two proteins have identical
kinetics of association with dimyristoylphosphatidylcholine and behaved
similarly to apoA-I purified from human plasma in this assay (not
shown). When recombined with lipids in vitro, there were
also no significant differences in the final molar compositions of
Lp2A-IWT, Lp2A-IFIN, or
Lp2A-IWT/FIN (Table II). All
reconstituted lipoproteins contained two molecules of apoA-I as
demonstrated by cross-linking with dimethyl suberimidate and were
homogeneous in size (single band between 10.0 and 10.6 nm in diameter),
and all proteins were incorporated into the lipoproteins as assessed by
native 8-25% PAGGE (not shown). In addition, the stability of
association ( GD0) of
rec.apoA-IFIN with lipids was similar to rec.hapoA-I (Table II).
View this table:
[in this window]
[in a new window]
|
Table II
Physical properties and LCAT kinetic data for reconstituted
lipoproteins (Lp2A-I) prepared with recombinant hapoA-I,
apoA-IFIN, or a 1:1 molar mixture of the two
proteins
|
|
The effect of the apoA-IFIN mutation on LCAT activation was
assessed (Fig. 6). As mentioned (see
"Experimental Procedures"), the Lp2A-IWT/FIN were
prepared to represent the nascent lipoprotein population that would
most likely form in heterozygotes for the apoA-IFIN
mutation. They consist of a heterogeneous mixture of reconstituted
lipoproteins that contain one molecule of each recombinant protein
( 50% of total), two molecules of rec.hapoA-I ( 25% of total), or
two molecules of rec.apoA-IFIN ( 25% of total). The Michaelis-Menten constants, appKm and
Vmax (Table II), were determined for the three
sets of Lp2A-I particles from the double-reciprocal Lineweaver-Burk
plot (Fig. 6C). There was both a large increase in
appKm and decrease in Vmax
for Lp2A-IFIN ( ) over Lp2A-IWT ( ) (Fig.
6A and Table II). Interestingly, the Lp2A-IWT/FIN ( ) exhibited only a small increase in
appKm over the Lp2A-IWT and no
difference in Vmax (Fig. 6A and Table II). In addition, the Lp2A-IWT/FIN activated LCAT more
efficiently than a 1:1 mixture of preformed Lp2A-IWT and
Lp2A-IFIN ( ), which had an expected activation of LCAT
that was intermediate between that found for Lp2A-IWT ( )
and Lp2A-IFIN ( ) (Fig. 6B). There were also
only small differences in the LCAT activation of Lp2A-IWT ( ) and the Lp2A-IWT/FIN ( ) (measured as total CE
formed) over an extended period at a set lipoprotein concentration (2.0 µM apoA-I) (Fig. 6D). However, the
Lp2A-IFIN ( ) had a greatly reduced LCAT activation,
similar to what was found during the shorter incubation at varying
substrate concentrations.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6.
ApoA-IFIN has impaired LCAT
activation on its own but does not interfere with the activation of
this enzyme by native human apoA-I. The three sets of
reconstituted lipoproteins (Lp2A-I) were prepared as described under
"Experimental Procedures." A, the esterification of
[3H]cholesterol in three different reconstituted Lp2A-I
particles by LCAT is shown. The Lp2A-I prepared with rec.hapoA-I alone
(Lp2A-IWT) ( ), rec.apoA-IFIN alone
(Lp2A-IFIN) ( ), or a 1:1 molar ratio of two
(Lp2A-IWT/FIN) ( ) were incubated with purified LCAT as
described under "Experimental Procedures." Values are the mean
(±S.E.) of duplicate experiments with triplicate measurements at each
data point. B, as in A, except LCAT activation of
a 1:1 molar mixture of pre-formed Lp2A-IWT and
Lp2A-IFIN ( ) instead of the hybrid particles is compared
with Lp2A-IWT ( ) and Lp2A-IFIN ( ).
C, the double-reciprocal plot of cholesterol esterification
for the 4 sets of Lp2A-I preparations is shown. The reciprocals of the
initial velocities (VO) are plotted against the
reciprocals of apoA-I concentration (µM) for each of the
Lp2A-I preparations and are used to calculate the rate constants
appKm and Vmax values for
three sets of Lp2A-I (excluding the mixture of the two Lp2A-I) given in
Table II. D, the nmol of CE formed over a 5-h period with
3.5 units of LCAT was determined for the Lp2A-IWT ( ),
Lp2A-IFIN ( ), and Lp2A-IWT/FIN ( )
particles each at a final apoA-I concentration of 2.0 µM.
Taken together, the results demonstrate that apoA-IFIN has
impaired LCAT activation due to an apparent decrease in the affinity
for the enzyme. However, apoA-IFIN does not inhibit LCAT
activation of hapoA-I since the Lp2A-IWT/FIN (70-80% of
which contain at least one molecule of apoA-IFIN) activates
LCAT almost as efficiently as the Lp2A-IWT.
|
|
Finally, the effect of the apoA-IFIN mutation on the
ability of apoA-I, both as lipid-free and as Lp2A-I, to promote efflux of cholesterol from macrophages was also determined. There were no
differences between rec.apoA-IFIN and rec.hapoA-I in their abilities to promote cholesterol efflux from J774 macrophages as either
lipid-free proteins or when reconstituted as Lp2A-I (not shown).
Therefore, these data are consistent with the initial observations that
the apoA-IFIN mutation does not negatively affect cholesterol efflux from cells in culture (16).
 |
DISCUSSION |
This study offers new insights into the multiple and complex
effects of apoA-IFIN on HDL metabolism. The cause for the
dominant hypoalphalipoproteinemia induced by this mutation in
heterozygous carriers has remained poorly understood since it was first
identified by Miettinen et al. (15). The mutation was found
to impair the ability of apoA-I to activate LCAT, but it was suggested
that this could not account for the 4-5-fold reduction in HDL-C and apoA-I concentrations in these individuals (16). Therefore, we have
expanded on these initial in vitro LCAT studies and designed informative in vivo experiments using recombinant
adenoviruses to study the effect of the apoA-IFIN mutation
on the metabolism of HDL. Our results show that while impaired LCAT
activation may contribute to the dominant hypoalphalipoproteinemia in
carriers of apoA-IFIN, it is clear that other mechanisms
are also responsible for conferring this dominant negative phenotype.
Furthermore, this study illustrates the advantages of using recombinant
adenoviruses in expression of apoA-I variants in mice and primary
hepatocytes when in vitro studies alone are not sufficiently
informative for the study of HDL metabolism.
The apoA-IFIN mutation (Leu159 to Arg)
occurs on the hydrophobic face of helix 6 (aa 143-165), a region of
the protein that has been shown by both in vitro studies
(30-38) and more recently by in vivo studies (18, 39, 40)
to be important for LCAT activation. This helix is highly conserved
among species (41), and therefore non-conserved amino acid
substitutions in this region might be expected to interfere with LCAT
activation by apoA-I. This was demonstrated for apoA-IFIN
(16) and more recently in a study where three conserved Arg residues in
this region were mutated (38). However, it remains unclear how
lipoproteins containing both apoA-IFIN and hapoA-I activate
LCAT compared with lipoproteins that contain only hapoA-I (see below).
Also, the effect of apoA-IFIN on LCAT activity has not been
analyzed in vivo in the homozygous state. In this study
apoA-IFIN generates HDL with predominantly pre-
migration in apoA-I-deficient mice (Fig. 3B, lane 6), and analysis of plasma lipoproteins from these mice by negative staining EM
demonstrates that this mutant but not hapoA-I forms discoidal HDL (not
shown). As well, even during peak expression of this mutant (2-3 days)
the CE/TC ratio in the plasma samples averaged only 0.39 and is even
lower than pre-injected values (derived from Table I). Therefore, these
in vivo findings support previous and current (see below)
in vitro data that apoA-IFIN has impaired LCAT
activation in the absence of hapoA-I.
Detailed in vitro LCAT experiments were next performed to
address the possibility that the apoA-IFIN mutation might
inhibit LCAT activation in lipoproteins containing both
apoA-IFIN and hapoA-I and contribute to its dominant
negative effect on HDL-C and apoA-I concentrations in this manner (Fig.
6). Lp2A-I of similar size, lipid composition, and stability are formed
with rec.hapoA-I (Lp2A-IWT), rec.apoA-IFIN
(Lp2A-IFIN), or both (Lp2A-IWT/FIN) (Table II).
This ensures that we are studying an effect of the mutation on LCAT
activation and not secondary effects due to differences in lipid
composition that can independently alter the activity of this enzyme
(28, 42). The Lp2A-IWT/FIN are important because they most
closely represent the nascent HDL that would form in apoA-IFIN heterozygotes. This heterogeneous lipoprotein
population consists of Lp2A-I with either one molecule each of
rec.hapoA-I and rec.apoA-IFIN or Lp2A-I containing two
molecules of rec.hapoA-I or two molecules of rec.apoA-IFIN.
As such, the majority (70-80%) of the Lp2A-I would contain at least
one molecule of rec.hapoA-I and one molecule of
rec.apoA-IFIN. Therefore, if apoA-IFIN is dominant over hapoA-I with respect to LCAT activation, the
Lp2A-IWT/FIN should behave similarly to the
Lp2A-IFIN in this assay. If not, the LCAT activation of the
Lp2A-IWT/FIN should more closely resemble that of the
Lp2A-IWT. The latter is observed here. We find that the
Lp2A-IFIN (Fig. 6A, , and Table II) does have
a marked reduction in the affinity for the enzyme (large increase in
appKm) which is consistent with our in
vivo data (above), whereas the Lp2A-IWT/FIN (Fig.
6A, ) have only slightly impaired LCAT activation compared with Lp2A-IWT. There is a small increase in the
appKm and no difference in
Vmax for the Lp2A-IWT/FIN compared
with Lp2A-IWT (Table II). Furthermore, the
Lp2A-IWT/FIN are more efficient at activating LCAT than is
a 1:1 mixture of preformed Lp2A-IWT and Lp2A-IFIN (Fig. 6B, ). These data clearly
demonstrate that the apoA-IFIN mutation does not negatively
affect LCAT activation of hapoA-I, and hapoA-I even appears to overcome
some of the inhibition of apoA-IFIN. Our in vivo
data support these in vitro results. Both pre- - and
mature -migrating HDL are present in apoA-I-deficient mice
expressing both proteins (Fig. 3B, lanes 4 and 5)
but not in mice expressing only apoA-IFIN (Fig. 3B,
lane 6). Taken together, these data indicate that LCAT activation
is only moderately impaired in the heterozygous state and can not fully
account for the hypoalphalipoproteinemia in carriers of
apoA-IFIN.
Since many prohormones are cleaved at paired basic amino acids
(43), it was suggested that the presence of two consecutive arginines
within apoA-I produced by the Leu159 Arg substitution
may make the mutant protein susceptible to proteolytic cleavage (15).
Of note, the pro-sequences of both human and mouse apolipoprotein A-II
(apoA-II) are cleaved in the plasma at a paired basic sequences
immediately downstream ( 1, 2) of the first amino acid in the mature
proteins. Nonetheless, proteolysis of apoA-IFIN was not
detected by Western blot analysis of plasma samples isolated from
heterozygotes in the initial studies of Miettinen et al.
(15) and the possibility that apoA-IFIN was degraded was
not explored further in these studies. However, it is clear in this
study that even with precautions to reduce degradation artifacts that
apoA-IFIN but not hapoA-I undergoes proteolysis in both
wild-type (Fig. 1) and apoA-I-deficient mice (Fig. 4) following
adenovirus-mediated expression. The higher concentrations of
apoA-IFIN obtained following injections of the recombinant adenoviruses have made possible the detection of these proteolytic cleavage products of apoA-IFIN, which under normal
circumstances are likely cleared rapidly from the circulation and
escape detection. This proteolysis appears to play an important role in
reducing HDL-C and apoA-I concentrations. In our in vivo
system, we show that there is a direct correlation between the extent
of apoA-IFIN proteolysis and the decrease in mapoA-I
concentrations (Fig. 1). In fact, mapoA-I is barely detectable in the
plasma sample where there is greatest amount of detectable
apoA-IFIN proteolysis (Fig. 1B, lane 4, lower right
panel). This reduction in mapoA-I levels occurs with only low to
moderate concentrations of apoA-IFIN (50 ± 4.6 mg/dl)
and is specific for the mutant protein. Higher and more physiological
concentrations of hapoA-I (147 ± 26 mg/dl) do not have this
statistically significant effect (Fig. 1). This finding appears
different from that reported previously with human apoA-I transgenic
mice, in which high expression of hapoA-I was shown to reduce mapoA-I
concentrations (44). However, the two systems are not directly
comparable. Two major differences between this study and the previous
one is that in the prior study the human apoA-I transgenic mice were
fasted overnight and had higher circulating concentrations of human
apoA-I. In the present study, the C57BL/6J mice were not fasted and
hapoA-I is found only to slightly reduce mapoA-I plasma concentrations
without reaching statistical significance (p = 0.14).
In contrast, sub-physiological concentrations of apoA-IFIN
significantly reduce mapoA-I levels (p < 0.03) (Fig.
1C). Furthermore, we observe a similar and dominant effect
of apoA-IFIN on apoA-I and HDL-C concentrations when this mutant is co-expressed with hapoA-I in apoA-I-deficient mice (Fig. 2),
a system that more closely mimics the heterozygous state. ApoA-I
concentrations are 3-8-fold lower in apoA-I-deficient mice expressing
both proteins compared with mice expressing hapoA-I alone throughout
the time course of expression (Fig. 2A). Consequently, the
HDL-C (Fig. 2B) and plasma lipid (Table I) concentrations are greatly reduced and large HDL2 are absent (Fig.
3A, lanes 3 and 5) in these mice, similar to
findings reported previously (16) for heterozygous carriers of this mutation.
The dramatic reductions in apoA-I and HDL-C concentrations caused by
apoA-IFIN proteolysis should not come as a surprise. Numerous studies have demonstrated this can have a major impact on HDL
metabolism. ApoA-I degradation by elastase was shown to enhance the
binding and intracellular clearance of HDL by macrophages (45). Limited
proteolysis of apoA-I by matrix metalloproteinases has also been shown
to decrease cholesterol efflux from cholesterol-loaded macrophages
(46), and similarly, mild trypsinization of HDL effectively abolishes
apolipoprotein-mediated cholesterol efflux from cholesterol-loaded
fibroblasts (47). Therefore, even though the apoA-IFIN
mutation does not affect cholesterol efflux from cells in culture as we
(not shown) and Miettinen et al. (16) have found, it is
likely that proteolysis of apoA-IFIN in vivo interferes with HDL-mediated efflux in mice expressing this mutant. In
support of this, apoA-IFIN is selectively degraded on
smaller HDL and lipid-poor species (Fig. 4B), the most
important acceptors of cell-derived phospholipids and cholesterol
(reviewed in Ref. 48). Furthermore, another study has shown that
proteolysis leads to dissociation of apoA-I from HDL, especially on the
less buoyant HDL3, and produces an unstable HDL population
(49). We also find that apoA-IFIN is preferentially
degraded on HDL3 and lipid-poor species, and this is likely
to promote a more rapid clearance of native apoA-I and other HDL
apolipoproteins and in the process interfere with their maturation into
larger and more buoyant HDL. This hypothesis is consistent with our
findings that mice co-expressing apoA-IFIN and hapoA-I
(Fig. 2B, lanes 3 and 5) and wild-type mice expressing this mutant are devoid of HDL2. It also provides
an explanation as to why other HDL apolipoproteins, such as apoA-II, are also found at lower than normal concentrations in heterozygotes for
this mutation (15).
This is also the first demonstration that the apoA-IFIN
mutation decreases the rate of apoA-I secretion from primary
hepatocytes (Fig. 5). The effect is greatest under conditions that
mimic apoA-IFIN homozygosity (infection with the
apoA-IFIN adenovirus alone), but it is also observed in the
heterozygous state (co-infection with the two adenoviruses). This is
particularly true early on in the chase (t = 1 h)
before the plateaus in the secretion time course are reached. In fact,
hepatocytes expressing both apoA-IFIN and hapoA-I have
statistically significant decreases (p < 0.05) in
secreted 35S-apoA-I (Fig. 5A, ) as well as
cell-associated 35S-apoA-I (Fig. 5B, ) at the
1-h time point compared with hepatocytes expressing only hapoA-I (Fig.
5A, , and Fig. 5B, ). This suggests that
the apoA-IFIN mutation interferes with apoA-I secretion and causes apoA-I to be degraded intracellularly given that between 20 and
30% of the initial cell-associated apoA-I cannot be accounted for
throughout the chase. These data are consistent with hepatocytes expressing apoA-IFIN alone. The decreased secretion of
apoA-IFIN (Fig. 5A, ) into the medium is
apparently accounted for by the accumulation of this mutant within the
hepatocytes (Fig. 5B, ). However, some of the initial
cell-associated apoA-I is lost and cannot be accounted for in the
hepatocytes expressing this mutant. Therefore, these are the first data
to suggest that heterozygous carriers of the apoA-IFIN
mutation also have impaired apoA-I secretion in addition to enhanced
apoA-I clearance from the plasma. Some studies have suggested that
HDL-C levels are inversely correlated with the fractional catabolic
rate of apoA-I and not with the apoA-I secretion rate (50). However, a
more recent study utilizing endogenously labeled apoA-I has shown that
both the fractional catabolic rate and secretion rate contribute to
plasma HDL-C levels (51). Therefore, the reduced secretion rate of
apoA-I in hepatocytes expressing both apoA-IFIN and hapoA-I
most likely contributes to the low apoA-I and HDL-C concentrations in
heterozygous carriers of this mutation. We also propose that there is
an increased intracellular clearance of hapoA-I in the presence of
apoA-IFIN, since a proportion of apoA-I secreted from these
primary hepatocytes is in the form of lipid-associated apoA-I
dimers.2 Proteolysis of
apoA-IFIN inside the hepatocytes would prevent efficient
secretion of this nascent HDL population, similar to its effect on the
clearance of this lipid-poor HDL pool in the plasma.
There are at least 7 other mutations identified within the central
domain of apoA-I that are also associated with reduced plasma HDL-C and
apoA-I concentrations (52, 52-60). We have shown in this study that
apoA-IFIN has a greatly reduced ability to activate LCAT,
but this alone cannot account for the hypoalphalipoproteinemia in
heterozygous carriers of this mutation. In contrast, a recent in
vivo study suggests that deletion of aa 143-164 within apoA-I may
negatively affect LCAT activation by native apoA-I (40). It was
proposed that this might explain the dominant negative effect on HDL-C
concentrations seen in heterozygotes for the apoA-ISeattle mutation (deletion of aa 146-160), although it should be noted that
the two mutations are structurally different. In addition, no in
vitro LCAT studies have been reported to confirm this hypothesis. Conversely, it has been suggested that the low HDL-C concentrations in heterozygotes for apoA-I mutations such as
apoA-ISeattle, apoA-IFIN, and
apoA-IZavalla (Leu159 to Pro) result from
hypercatabolism of apoA-I that is only partially due to or independent
of a decrease in LCAT activation (55). This latter viewpoint is
consistent with the results obtained from this study in which we show
that proteolysis of apoA-IFIN and a reduced secretion rate
of this mutant from hepatocytes are more likely to account for the low
HDL-C and apoA-I concentrations than is dysfunctional LCAT activation.
In summary, this extensive metabolic study of a naturally occurring
apoA-I variant known as apoA-IFIN should also prove
valuable in the study of other apoA-I mutations contributing to
hypoalphalipoproteinemia and further our understanding of the roles of
apoA-I domains in the metabolism of HDL. We have shown that the
apoA-IFIN mutation does not affect the ability of apoA-I to
associate with lipids and form stable reconstituted lipoproteins.
However, apoA-IFIN has a significantly reduced ability to
activate LCAT (5-fold increase in appKm) compared
with hapoA-I, but in a heterogeneous lipoprotein preparation with
hapoA-I there is only a slight decrease in the affinity for the enzyme
(1.4-fold increase in appKm). Importantly, this
mutation impairs apoA-I secretion from primary hepatocytes and leads to
proteolysis of apoA-I in plasma. These effects appear to be primarily
responsible for the remodeling of and decrease in the HDL pool size in
both wild-type C57BL/6J mice expressing this mutant and in
apoA-I-deficient mice co-expressing apoA-IFIN and hapoA-I.
Therefore, we propose the combination of these defects account for the
4-5-fold reductions in HDL-C and apoA-I concentrations in heterozygous
carriers of the apoA-IFIN mutation.
 |
ACKNOWLEDGEMENTS |
We thank Tracey Neville and Susha Zachariah
for excellent technical assistance with the LCAT and primary hepatocyte
experiments, respectively, and to the Animal Care Staff at the
University of Ottawa Heart Institute for expert assistance. We also
thank Drs. Ruth McPherson and Ross Milne for their suggestions and
critical reading of this manuscript.
 |
FOOTNOTES |
*
This work was supported in part by a group grant from the
Medical Research Council of Canada.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a postgraduate scholarship from the Heart and Stroke
Foundation of Canada.
§
Both authors contributed equally to this work.
¶
Supported by a scholarship from the National Sciences and
Engineering Research Council of Canada and an Ontario Graduate Scholarship.
To whom correspondence should be addressed: Lipoprotein and
Atherosclerosis Research Group, University of Ottawa Heart Institute, Rm. H460, 40 Ruskin St., Ottawa, Ontario K1Y 4W7, Canada. Tel.: 613-761-5255; Fax: 613-761-5281; E-mail: ymarcel@ottawaheart.ca.
Published, JBC Papers in Press, April 5, 2001, DOI 10.1074/jbc.M100463200
2
D. C. McManus and Y. L. Marcel,
unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
HDL, high density
lipoproteins;
HDL-C, high density lipoprotein cholesterol;
apoA-I, apolipoprotein A-I;
CE, cholesteryl ester;
TRL, triglyceride-rich
lipoproteins;
FC, free cholesterol;
LCAT, lecithin:cholesterol
acyltransferase;
ABCA1, ATP-binding cassette transporter protein A1;
PLTP, phospholipid transfer protein;
FHA, familial
hypoalphalipoproteinemia;
apoA-IFIN, apoA-I Finland;
aa, amino acid;
hapoA-I, native human apoA-I;
Ad5, recombinant adenovirus(es);
apoA-IFIN.Ad5, Ad5 carrying the
apoA-IFIN cDNA;
hapoA-I.Ad5, Ad5 carrying the hapoA-I
cDNA;
PAGE, polyacrylamide gel electrophoresis;
luc.Ad5, Ad5
carrying the firefly luciferase cDNA;
pfu, plaque-forming units;
TC, total cholesterol;
PAGGE, polyacrylamide gradient gel
electrophoresis;
mapoA-I, murine apoA-I;
FBS, fetal bovine serum;
m.o.i., multiplicity of infection;
DMEM, Dulbecco's modified minimal
medium;
rec.hapoA-I, His-tagged purified recombinant hapoA-I;
rec.apoA-IFIN, His-tagged purified recombinant
apoA-IFIN;
Lp2A-I, reconstituted lipoproteins containing
two molecules of apoA-I;
POPC, 1-palmitoyl-2-oleoylphosphatidylcholine;
BSA, bovine serum albumin;
Lp2A-IWT, Lp2A-I with two
molecules of hapoA-I;
Lp2A-IFIN, Lp2A-I with two molecules
of apoA-IFIN;
Lp2A-IWT/FIN, Lp2A-I containing
two apoA-I prepared with an equimolar amount of hapoA-I and
apoA-IFIN;
pCPT-cAMP, cAMP analog
8-(4-chlorophenylthio)-cAMP;
apoA-II, apolipoprotein A-II.
 |
REFERENCES |
| 1.
|
Gordon, T.,
Castelli, W. P.,
Hjortland, M. C.,
Kannel, W. B.,
and Dawber, T. R.
(1977)
Am. J. Med.
62,
707-714
|
| 2.
|
Breslow, J. L.
(1995)
in
The Metabolic and Molecular Basis of Inherited Disease
(Scriver, C. R.
, Beaudet, A. L.
, Sly, W. S.
, and Valle, D., eds)
, pp. 2031-2052, McGraw-Hill Inc., New York
|
| 3.
|
Frank, P. G.,
and Marcel, Y. L.
(2000)
J. Lipid Res.
41,
853-872
|
| 4.
|
Segrest, J. P.,
Li, L.,
Anantharamaiah, G. M.,
Harvey, S. C.,
Liadaki, K. N.,
and Zannis, V.
(2000)
Curr. Opin. Lipidol.
11,
105-115
|
| 5.
|
Eisenberg, S.
(1984)
J. Lipid Res.
25,
1017-1058
|
| 6.
|
Jiang, X. C.,
Bruce, C.,
Mar, J.,
Lin, M.,
Ji, Y.,
Francone, O. L.,
and Tall, A. R.
(1999)
J. Clin. Invest.
103,
907-914
|
| 7.
|
Qin, S. C.,
Kawano, K.,
Bruce, C.,
Lin, M.,
Bisgaier, C.,
Tall, A. R.,
and Jiang, X. C.
(2000)
J. Lipid Res.
41,
269-276
|
| 8.
|
Brooks-Wilson, A.,
Marcil, M.,
Clee, S. M.,
Zhang, L. H.,
Roomp, K.,
Van Dam, M., Yu, L.,
Brewer, C.,
Collins, J. A.,
Molhuizen, H. O.,
Loubser, O.,
Ouelette, B. F.,
Fichter, K.,
Ashbourne-Excoffon, K. J.,
Sensen, C. W.,
Scherer, S.,
Mott, S.,
Denis, M.,
Martindale, D.,
Frohlich, J.,
Morgan, K.,
Koop, B.,
Pimstone, S.,
Kastelein, J. J.,
Genest, J., Jr.,
and Hayden, M. R.
(1999)
Nat. Genet.
22,
336-345
|
| 9.
|
Rust, S.,
Rosier, M.,
Funke, H.,
Real, J.,
Amoura, Z.,
Piette, J. C.,
Deleuze, J. F.,
Brewer, H. B.,
Duverger, N.,
Denefle, P.,
and Assmann, G.
(1999)
Nat. Genet.
22,
352-355
|
| 10.
|
Bodzioch, M.,
Orso, E.,
Klucken, J.,
Langmann, T.,
Bottcher, A.,
Diederich, W.,
Drobnik, W.,
Barlage, S.,
Buchler, C.,
Porsch-Ozcurumez, M.,
Kaminski, W. E.,
Hahmann, H. W.,
Oette, K.,
Rothe, G.,
Aslanidis, C.,
Lackner, K. J.,
and Schmitz, G.
(1999)
Nat. Genet.
22,
347-351
|
| 11.
|
Marcil, M.,
Brooks-Wilson, A.,
Clee, S. M.,
Roomp, K.,
Zhang, L. H., Yu, L.,
Collins, J. A.,
Van Dam, M.,
Molhuizen, H. O.,
Loubster, O.,
Ouellette, B. F.,
Sensen, C. W.,
Fichter, K.,
Mott, S.,
Denis, M.,
Boucher, B.,
Pimstone, S.,
Genest, J., Jr.,
Kastelein, J. J.,
and Hayden, M. R.
(1999)
Lancet
354,
1341-1346
|
| 12.
|
Clee, S. M.,
Kastelein, J. J.,
Van Dam, M.,
Marcil, M.,
Roomp, K.,
Zwarts, K. Y.,
Collins, J. A.,
Roelants, R.,
Tamasawa, N.,
Stulc, T.,
Suda, T.,
Ceska, R.,
Boucher, B.,
Rondeau, C.,
DeSouich, C.,
Brooks-Wilson, A.,
Molhuizen, H. O.,
Frohlich, J.,
Genest, J., Jr.,
and Hayden, M. R.
(2000)
J. Clin. Invest.
106,
1263-1270
|
| 13.
|
Yamakawa-Kobayashi, K.,
Yanagi, H.,
Fukayama, H.,
Hirano, C.,
Shimakura, Y.,
Yamamoto, N.,
Arinami, T.,
Tsuchiya, S.,
and Hamaguchi, H.
(1999)
Hum. Mol. Genet.
8,
331-336
|
| 14.
|
Calabresi, L.,
and Franceschini, G.
(1997)
Curr. Opin. Lipidol.
8,
219-224
|
| 15.
|
Miettinen, H. E.,
Gylling, H.,
Miettinen, T. A.,
Viikari, J.,
Paulin, L.,
and Kontula, K.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
83-90
|
| 16.
|
Miettinen, H. E.,
Jauhiainen, M.,
Gylling, H.,
Ehnholm, S.,
Palomaki, A.,
Miettinen, T. A.,
and Kontula, K.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
3021-3032
|
| 17.
|
Bergeron, J.,
Frank, P. G.,
Emmanuel, F.,
Latta, M.,
Zhao, Y. W.,
Sparks, D. L.,
Rassart, E.,
Denèfle, P.,
and Marcel, Y. L.
(1997)
Biochim. Biophys. Acta
1344,
139-152
|
| 18.
|
McManus, D. C.,
Scott, B. R.,
Frank, P. G.,
Franklin, V.,
Schultz, J. R.,
and Marcel, Y. L.
(2000)
J. Biol. Chem.
275,
5043-5051
|
| 19.
|
Bergeron, J.,
Frank, P. G.,
Scales, D.,
Meng, Q.-H.,
Castro, G.,
and Marcel, Y. L.
(1995)
J. Biol. Chem.
270,
27429-27483
|
| 20.
|
Calabresi, L.,
Meng, Q.-H.,
Castro, G. R.,
and Marcel, Y. L.
(1993)
Biochemistry
32,
6477-6484
|
| 21.
|
Subrahmanyan, L.,
and Kisilevsky, R.
(1988)
Scand. J. Immunol.
27,
251-260
|
| 22.
|
Thomas, S. S.,
Plenkiewicz, J.,
Ison, E. R.,
Bols, M.,
Zou, W.,
Szarek, W. A.,
and Kisilevsky, R.
(1995)
Biochim. Biophys. Acta
1272,
37-48
|
| 23.
|
McLeod, R. S.,
Wang, Y.,
Wang, S.,
Rusinol, A.,
Links, P.,
and Yao, Z.
(1996)
J. Biol. Chem.
271,
18445-18455
|
| 24.
|
Sparks, D. L.,
Lund-Katz, S.,
and Phillips, M. C.
(1992)
J. Biol. Chem.
267,
25839-25847
|
| 25.
|
Swaney, J. B.,
and O'Brien, K.
(1978)
J. Biol. Chem.
253,
7069-7077
|
| 26.
|
Markwell, M. A.,
Haas, S. M.,
Bieber, L. L.,
and Tolbert, N. E.
(1978)
Anal. Biochem.
87,
206-210
|
| 27.
|
Albers, J. J.,
Chen, C. H.,
and Lacko, A. G.
(1986)
Methods Enzymol.
129,
763-783
|
| 28.
|
Sparks, D. L.,
Anantharamaiah, G. M.,
Segrest, J. P.,
and Phillips, M. C.
(1995)
J. Biol. Chem.
270,
5151-5157
|
| 29.
|
Sakr, S. W.,
Williams, D. L.,
Stoudt, G. W.,
Phillips, M. C.,
and Rothblat, G. H.
(1999)
Biochim. Biophys. Acta
1438,
85-98
|
| 30.
|
Banka, C. L.,
Bonnet, D. J.,
Black, A. S.,
Smith, R. S.,
and Curtiss, L. K.
(1991)
J. Biol. Chem.
266,
23886-23892
|
| 31.
|
Meng, Q. H.,
Calabresi, L.,
Fruchart, J. C.,
and Marcel, Y. L.
(1993)
J. Biol. Chem.
268,
16966-16973
|
| 32.
|
Uboldi, P.,
Spoladore, M.,
Fantappiè, S.,
Marcovina, S.,
and Catapano, A. L.
(1996)
J. Lipid Res.
37,
2557-2568
|
| 33.
|
Dhoest, A.,
Zhao, Z. A.,
De Geest, B.,
Deridder, E.,
Sillen, A.,
Engelborghs, Y.,
Collen, D.,
and Holvoet, P.
(1997)
J. Biol. Chem.
272,
15967-15972
|
| 34.
|
Lindholm, E. M.,
Bielicki, J. K.,
Curtiss, L. K.,
Rubin, E. M.,
and Forte, T. M.
(1998)
Biochemistry
37,
4863-4868
|
| 35.
|
Frank, P. G.,
N'Guyen, D.,
Franklin, V.,
Neville, T.,
Desforges, M.,
Rassart, E.,
Sparks, D. L.,
and Marcel, Y. L.
(1998)
Biochemistry
37,
13902-13909
|
| 36.
|
Sorci-Thomas, M. G.,
Curtiss, L.,
Parks, J. S.,
Thomas, M. J.,
Kearns, M. W.,
and Landrum, M.
(1998)
J. Biol. Chem.
273,
11776-11782
|
| 37.
|
Sviridov, D.,
Hoang, A.,
Sawyer, W. H.,
and Fidge, N. H.
(2000)
J. Biol. Chem.
275,
19707-19712
|
| 38.
|
Roosbeek, S.,
Vanloo, B.,
Duverger, N.,
Caster, H.,
Breyne, J.,
De, B. I.,
Patel, H.,
Vandekerckhove, J.,
Shoulders, C.,
Rosseneu, M.,
and Peelman, F.
(2001)
J. Lipid Res.
42,
31-40
|
| 39.
|
Holvoet, P.,
De Geest, B.,
Van Linthout, S.,
Lox, M.,
Danloy, S.,
Raes, K.,
and Collen, D.
(2000)
Arterioscler. Thromb. Vasc. Biol.
20,
459-466
|
| 40.
|
Sorci-Thomas, M. G.,
Thomas, M.,
Curtiss, L.,
and Landrum, M.
(2000)
J. Biol. Chem.
275,
12156-12163
|
| 41.
|
Collet, X.,
Marcel, Y. L.,
Tremblay, N.,
Lazure, C.,
Milne, R. W.,
Perret, B.,
and Weech, P. K.
(1997)
J. Lipid Res.
38,
634-644
|
| 42.
|
Sparks, D. L.,
Frank, P. G.,
and Neville, T.
(1998)
Biochim. Biophys. Acta
1390,
160-172
|
| 43.
|
Seidah, N. G.,
and Chretien, M.
(1999)
Brain Res.
848,
45-62
|
| 44.
|
Rubin, E. M.,
Ishida, B. Y.,
Clift, S. M.,
and Krauss, R. M.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
434-438
|
| 45.
|
Pirillo, A.,
and Ghiselli, G.
(2000)
Biochem. Biophys. Res. Commun.
271,
386-391
|
| 46.
|
Lindstedt, L.,
Saarinen, J.,
Kalkkinen, N.,
Welgus, H.,
and Kovanen, P. T.
(1999)
J. Biol. Chem.
274,
22627-22634
|
| 47.
|
Mendez, A. J.,
and Oram, J. F.
(1997)
Biochim. Biophys. Acta
1346,
285-299
|
| 48.
|
Von Eckardstein, A.,
Nofer, J. R.,
and Assmann, G.
(2001)
Arterioscler. Thromb. Vasc. Biol.
21,
13-27
|
| 49.
|
Lee, M.,
Uboldi, P.,
Giudice, D.,
Catapano, A. L.,
and Kovanen, P. T.
(2000)
J. Lipid Res.
41,
975-984
|
| 50.
|
Brinton, E. A.,
Eisenberg, S.,
and Breslow, J. L.
(1989)
J. Clin. Invest.
84,
262-269
|
| 51.
|
Velez-Carrasco, W.,
Lichtenstein, A. H.,
Li, Z.,
Dolnikowski, G. G.,
Lamon-Fava, S.,
Welty, F. K.,
and Schaefer, E. J.
(2000)
Arterioscler. Thromb. Vasc. Biol.
20,
801-806
|
| 52.
|
Assmann, G.,
Von Eckardstein, A.,
and Funke, H.
(1993)
Circulation
87 Suppl. 3,
28-34
|
| 53.
|
Bruckert, E.,
Von Eckardstein, A.,
Funke, H.,
Beucler, I.,
Wiebusch, H.,
Turpin, G.,
and Assmann, G.
(1997)
Atherosclerosis
128,
121-128
|
| 54.
|
Deeb, S. S.,
Cheung, M. C.,
Peng, R.,
Wolf, A. C.,
Stern, R.,
Albers, J. J.,
and Knopp, R. H.
(1991)
J. Biol. Chem.
266,
13654-13660
|
| 55.
|
Miller, M.,
Aiello, D.,
Pritchard, H.,
Friel, G.,
and Zeller, K.
(1998)
Arterioscler. Thromb. Vasc. Biol.
18,
1242-1247
|
| 56.
|
Rosseneu, M.,
and Labeur, C.
(1995)
FASEB J.
9,
768-776
|
| 57.
|
Von Eckardstein, A.,
Funke, H.,
Henke, A.,
Altland, K.,
Benninghoven, A.,
and Assmann, G.
(1989)
J. Clin. Invest.
84,
1722-1730
|
| 58.
|
Daum, U.,
Leren, T. P.,
Langer, C.,
Chirazi, A.,
Cullen, P.,
Pritchard, P. H.,
Assmann, G.,
and Von Eckardstein, A.
(1999)
J. Lipid Res.
40,
486-494
|
| 59.
|
Daum, U.,
Langer, C.,
Duverger, N.,
Emmanuel, F.,
Benoit, P.,
Denèfle, P.,
Chirazi, A.,
Cullen, P.,
Pritchard, P. H.,
Bruckert, E.,
Assmann, G.,
and Von Eckardstein, A.
(1999)
J. Mol. Med.
77,
614-622
|
| 60.
|
Weisgraber, K. H.,
Bersot, T. P.,
Mahley, R. W.,
Franceschini, G.,
and Sirtori, C. R.
(1980)
J. Clin. Invest.
66,
901-907
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. S. Owen, M. S. Bharadwaj, M. J. Thomas, S. Bhat, M. P. Samuel, and M. G. Sorci-Thomas
Ratio determination of plasma wild-type and L159R apoA-I using mass spectrometry: tools for studying apoA-IFin
J. Lipid Res.,
January 1, 2007;
48(1):
226 - 234.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zheng, R. S. Kiss, V. Franklin, M.-D. Wang, B. Haidar, and Y. L. Marcel
ApoA-I Lipidation in Primary Mouse Hepatocytes: SEPARATE CONTROLS FOR PHOSPHOLIPID AND CHOLESTEROL TRANSFERS
J. Biol. Chem.,
June 3, 2005;
280(22):
21612 - 21621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Bhat, M. Zabalawi, M. C. Willingham, G. S. Shelness, M. J. Thomas, and M. G. Sorci-Thomas
Quality control in the apoA-I secretory pathway: deletion of apoA-I helix 6 leads to the formation of cytosolic phospholipid inclusions
J. Lipid Res.,
July 1, 2004;
45(7):
1207 - 1220.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Kiss, D. C. McManus, V. Franklin, W. L. Tan, A. McKenzie, G. Chimini, and Y. L. Marcel
The Lipidation by Hepatocytes of Human Apolipoprotein A-I Occurs by Both ABCA1-dependent and -independent Pathways
J. Biol. Chem.,
March 14, 2003;
278(12):
10119 - 10127.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Parolini, G. Chiesa, Y. Zhu, T. Forte, S. Caligari, E. Gianazza, M. G. Sacco, C. R. Sirtori, and E. M. Rubin
Targeted Replacement of Mouse Apolipoprotein A-I with Human ApoA-I or the Mutant ApoA-IMilano. EVIDENCE OF APOA-IM IMPAIRED HEPATIC SECRETION
J. Biol. Chem.,
February 7, 2003;
278(7):
4740 - 4746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Andreola, V. Bellotti, S. Giorgetti, P. Mangione, L. Obici, M. Stoppini, J. Torres, E. Monzani, G. Merlini, and M. Sunde
Conformational Switching and Fibrillogenesis in the Amyloidogenic Fragment of Apolipoprotein A-I
J. Biol. Chem.,
January 17, 2003;
278(4):
2444 - 2451.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. R. Scott, D. C. McManus, V. Franklin, A. G. McKenzie, T. Neville, D. L. Sparks, and Y. L. Marcel
The N-terminal Globular Domain and the First Class A Amphipathic Helix of Apolipoprotein A-I Are Important for Lecithin:Cholesterol Acyltransferase Activation and the Maturation of High Density Lipoprotein in Vivo
J. Biol. Chem.,
December 21, 2001;
276(52):
48716 - 48724.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|