Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M100463200 on April 5, 2001

J. Biol. Chem., Vol. 276, Issue 24, 21292-21302, June 15, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/24/21292    most recent
M100463200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McManus, D. C.
Right arrow Articles by Marcel, Y. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McManus, D. C.
Right arrow Articles by Marcel, Y. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Proteolytic Degradation and Impaired Secretion of an Apolipoprotein A-I Mutant Associated with Dominantly Inherited Hypoalphalipoproteinemia*

Dan C. McManusDagger§, Brian R. Scott§, Vivian Franklin, Daniel L. Sparks, and Yves L. Marcel||

From the Lipoprotein and Atherosclerosis Research Group, Departments of Pathology and Laboratory Medicine and Biochemistry, Microbiology, and Immunology, University of Ottawa Heart Institute, Ottawa, Ontario K1Y 4W7, Canada

Received for publication, January 17, 2001, and in revised form, March 13, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have devised a combined in vivo, ex vivo, and in vitro approach to elucidate the mechanism(s) responsible for the hypoalphalipoproteinemia in heterozygous carriers of a naturally occurring apolipoprotein A-I (apoA-I) variant (Leu159 to Arg) known as apoA-I Finland (apoA-IFIN). Adenovirus-mediated expression of apoA-IFIN decreased apoA-I and high density lipoprotein cholesterol concentrations in both wild-type C57BL/6J mice and in apoA-I-deficient mice expressing native human apoA-I (hapoA-I). Interestingly, apoA-IFIN was degraded in the plasma, and the extent of proteolysis correlated with the most significant reductions in murine apoA-I concentrations. ApoA-IFIN had impaired activation of lecithin:cholesterol acyltransferase in vitro compared with hapoA-I, but in a mixed lipoprotein preparation consisting of both hapoA-I and apoA-IFIN there was only a moderate reduction in the activation of this enzyme. Importantly, secretion of apoA-I was also decreased from primary apoA-I-deficient hepatocytes when hapoA-I was co-expressed with apoA-IFIN following infection with recombinant adenoviruses, a condition that mimics secretion in heterozygotes. Thus, this is the first demonstration of an apoA-I point mutation that decreases LCAT activation, impairs hepatocyte secretion of apoA-I, and makes apoA-I susceptible to proteolysis leading to dominantly inherited hypoalphalipoproteinemia.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasma concentrations of high density lipoprotein (HDL)1 cholesterol (HDL-C) are inversely correlated with the risk of developing coronary heart disease (1). However, the complex and often poorly understood etiology for variations in HDL-C concentrations within the general population has made the therapeutic control of HDL levels an elusive target to date. This is attributed to the intricate nature of HDL metabolism that involves many components including the major HDL structural protein apolipoprotein A-I (apoA-I) and multiple factors required for cholesteryl ester (CE) formation, lipolysis, lipid transfer, cellular lipid efflux, and cell surface interactions (reviewed in Refs. 2-4).

Nascent HDLs that are derived from the liver and intestine are poorly lipidated (2, 5) and must acquire additional lipids for their maturation into the more stable alpha -migrating HDLs in plasma. Defective clearance of triglyceride-rich lipoproteins (TRL) is recognized as a major determinant of HDL-C concentrations. Recessive mutations in lipoprotein lipase and its major activator protein apolipoprotein C-II, which result in impaired hydrolysis of TRL, also contribute to low HDL-C concentrations. Also the efficient conversion of free cholesterol (FC) to CE on HDL by lecithin:cholesterol acyltransferase (LCAT) is necessary for HDL maturation and depends on apoA-I as its physiological activator (reviewed in Refs. 2-4). Recent work has also highlighted the importance of both the ATP-binding cassette transporter A1 (ABCA1) protein and phospholipid transfer protein (PLTP) in maintaining normal HDL-C concentrations. PLTP-deficient mice have HDL-C levels that are reduced by 60-70% (6) as a result of enhanced catabolism of HDL apparently due to defective transfer of lipids from TRL to nascent HDL (7). Mutations in the ABCA1 cause Tangier disease (8-10) in which affected individuals have less than 5% of the normal HDL-C concentrations due to impaired cellular lipid efflux to nascent HDL.

Isolated familial hypoalphalipoproteinemia (FHA) is more common than Tangier disease, and heterozygous mutations in ABCA1 can give rise to FHA (8, 11, 12). However, mutations in apoA-I also contribute significantly to FHA in the general population. A recent study has shown that in a group of 1264 Japanese school children, 6% of FHA cases defined as HDL-C concentrations below the 5th percentile matched for age and sex were related to apoA-I mutations (13). This would represent an incidence of 0.3% for apoA-I mutations in the general population, which is significant and warrants mechanistic studies on the relationships between these mutations and hypoalphalipoproteinemia. Many apoA-I mutations have been identified (reviewed in Refs. 3, 14), but particularly interesting among them are those associated with a dominant FHA phenotype, such as apoA-I Finland (apoA-IFIN). This mutation was originally identified in a Finnish kindred and results from a Leu to Arg substitution at amino acid (aa) 159 (15). These individuals are heterozygous carriers of this mutation and yet have HDL-C and apoA-I concentrations that are 20 and 25% of the normal plasma concentrations, respectively (15). The cause for this dominant negative effect on HDL-C concentrations remains largely unknown. ApoA-IFIN was shown to have reduced LCAT activation compared with native human apoA-I (hapoA-I) (16), but it has not been established whether this mutant can inhibit LCAT activation by hapoA-I and confer its dominant negative phenotype in this manner. We present the results of a combined in vivo, ex vivo, and in vitro study of the mechanisms responsible for the dominant negative effects on HDL-C brought about by apoA-IFIN, and we demonstrate that the mutation exerts its effects at multiple levels.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mutagenesis of ApoA-I cDNA-- The apoA-IFIN cDNA was generated by the QuikChangeTM mutagenesis protocol from Stratagene (La Jolla, CA) with sense 5'GTGGACGCGCGGCGCACGCATC3' and antisense 5'GATGCGTGCGCCGCG-CGT3' primers (Life Technologies, Inc.). The underlined sequence indicates the mutagenic bases required for the Leu to Arg conversion at aa 159 within apoA-I. To generate the purified recombinant His-tagged apoA-IFIN (see below), mutagenesis was carried out on plasmid pXL2116. This plasmid is a modified pET3a vector (Stratagene) that contains the apoA-I cDNA (minus the region coding for the prepro sequence) and an upstream region coding for an 11-aa N-terminal extension containing a His6 tag as described previously (17). For generation of the recombinant adenovirus (Ad5) carrying the apoA-IFIN cDNA (apoA-IFIN.Ad5, see below), the mutagenesis was carried out on plasmid pCA13 (Microbix Biosystems Inc., Toronto, Canada) harboring the hapoA-I cDNA. For both sets of mutagenesis reactions, positive clones were determined by the loss of the FspI restriction site that occurs as a result of a T to G substitution for this mutation as documented previously (15). The full-length apoA-IFIN cDNAs were sequenced prior to generation of the recombinant apoA-IFIN protein and the apoA-IFIN.Ad5.

Production and Screening of First Generation ApoA-I Recombinant Adenoviruses-- The apoA-IFIN.Ad5 was generated and purified in the same manner as the hapoA-I adenovirus (hapoA-I.Ad5) recently described by our laboratory (18). Prior to the studies with the primary hepatocytes and mice (see below), we confirmed that apoA-IFIN was produced and secreted from COS-7 cells following infection with the recombinant adenovirus. Medium was analyzed 2-3 days after infection by 12% SDS-polyacrylamide gel electrophoresis (PAGE) performed under reducing conditions, which was then subjected to Western blot analysis following transfer to nitrocellulose membrane. The membrane was probed with anti-apoA-I monoclonal antibodies 4H1 and 5F6, and the apoA-IFIN protein in the medium was detected by chemiluminescence (WestPico SuperSignal Substrate, Pierce) following treatment with horseradish peroxidase-conjugated anti-mouse IgG (Amersham Pharmacia Biotech).

Animals-- ApoA-I-deficient (ApoA1tm1Unc) and wild-type C57BL/6J mice were obtained from Jackson Laboratories (Bar Harbor, ME) and Charles River Laboratories (Wilmington, MA), respectively. Mice were maintained on a 12-h light/12-h dark schedule and were fed either a normal chow (Charles River rodent diet 5075, 18% protein and 4.5% fat) or high fat Western (Harlan Teklad TD 88137, 19.5% protein, 42% fat, 0.15% cholesterol) diet as indicated. All experiments were performed in accordance with protocols approved by the University of Ottawa Animal Care Committee. Mice used for these studies were 3-8-month-old females, except where indicated.

In Vivo Metabolism of HapoA-I and ApoA-IFIN-- Wild-type and apoA-I-deficient C57BL/6J mice were injected via the tail vein with either the hapoA-I.Ad5, the apoA-IFIN.Ad5, or the control luciferase adenovirus (luc.Ad5) at a dose of 2 × 109 plaque-forming units (pfu) (~3.7 × 1010 adenoviruses). ApoA-I-deficient mice were also co-injected with 1 × 109 pfu of each of the hapoA-I.Ad5 and the apoA-IFIN.Ad5. Blood was collected in K3-EDTA tubes at various times following the injections, and plasma samples isolated were immediately placed on ice and incubated with a protease inhibitor mixture consisting of aprotinin (0.15 µM), leupeptin (1 µM), and a protease inhibitor mixture (complete EDTA-free®) (Roche Molecular Biochemicals). The plasma and HDL total cholesterol (TC), FC, and phospholipid concentrations were measured with enzymatic kits as described (18), and human apoA-I concentrations (hapoA-I and apoA-IFIN) were measured by a solid-phase radioimmunoassay (19, 20). HDL fractions were isolated from the plasma by discontinuous gradient density ultracentrifugation (18). ApoA-I present in alpha - and pre-beta -migrating HDL was determined by agarose gel electrophoresis (Beckman Lipogel) and Western blot analysis. Western blots for apoA-I were also performed on plasma after it was subjected to 12% SDS-PAGE under reducing conditions or 4-20% polyacrylamide gradient gel electrophoresis (PAGGE) under native conditions. For anti-human apoA-I Western blots, monoclonal antibodies 4H1 and 5F6 were biotinylated with Sulfo-NHS-Biotin (Pierce), and chemiluminescence was performed following treatment with horseradish peroxidase-conjugated streptavidin (Amersham Pharmacia Biotech). Murine apoA-I (mapoA-I) was detected with an anti-mouse apoA-I antibody (BIODESIGN International, Kennebunk, ME), and chemiluminescence was carried out as above following treatment with anti-rabbit horseradish peroxidase-conjugated IgG (Amersham Pharmacia Biotech).

Secretion of HapoA-I and ApoA-IFIN from Primary Mouse Hepatocytes-- Primary hepatocytes were prepared from apoA-I-deficient mice according to an established protocol (21, 22). Briefly, the cells were seeded in fibronectin-coated (25 µg/well) 6-well plates at an initial density of 1-2 × 106 cells per well in William's medium containing penicillin (100 units/ml), streptomycin sulfate (100 units/ml), Fungizone® (250 ng/ml) (Life Technologies, Inc.), and 10% fetal bovine serum (FBS) (Sigma). Cells were infected the following day (24 h) with either the hapoA-I.Ad5 or the apoA-IFIN.Ad5 at a multiplicity of infection (m.o.i.) of 75:1 (pfu/cell) or with a mixture of hapoA-I.Ad5 and apoA-IFIN.Ad5 each at an m.o.i. of 37.5:1 (total m.o.i. = 75:1). 24 h after the initial infection, the William's medium was removed, and the hepatocytes were incubated in Dulbecco's minimal essential medium (DMEM) without methionine and cysteine containing 10% FBS (pre-labeling medium) for 1 h. Following this, the cells were pulse-labeled for 1 h with labeling medium (pre-labeling medium plus 150 µCi/well [35S]methionine). The labeling medium was then removed, and growth medium (DMEM plus 10% FBS) was added. Cells and medium were collected at the various time points up to 4 h after the initial pulse and harvested as described by McLeod et al. (23). ApoA-I was immunoprecipitated from the media and cell lysates with anti-human apoA-I antisera (Roche Molecular Biochemicals) and protein G-Sepharose (Amersham Pharmacia Biotech) and then subjected to 12% SDS-PAGE. The radioactivity associated with apoA-I at each time point was determined by PhosphorImager analysis (Personal Molecular Imager® FX, Bio-Rad) and is represented as a percentage of the initial cell apoA-I-associated radioactivity counts (t = 0). Statistical significance was determined by Student's t test. The data presented are the mean of triplicate measurements (± S.E.) and are representative of three independent experiments.

Purification of Recombinant His-tagged Proteins-- The recombinant His-tagged hapoA-I (rec.hapoA-I) and apoA-IFIN proteins (rec.apoA-IFIN) used for these studies were prepared as described previously (17) with some minor changes. Escherichia coli strain BL21(DE3) (Stratagene) was used instead of strain BL21(DE3)pLysS (Stratagene); LB broth and not M9 minimal medium was used for expression of the proteins, and rifampicin was omitted from the bacterial cultures. Following purification on nickel-nitrilotriacetic acid-agarose (Qiagen) columns, the proteins were dialyzed against sodium bicarbonate (5 mM, pH 8) containing EDTA (1 mM) and azide (0.02%), lyophilized, and stored at -20 °C. Prior to the in vitro studies, the lyophilized recombinant proteins were solubilized in 6 M guanidine hydrochloride and dialyzed extensively against phosphate-buffered saline or Tris-buffered saline as required.

Preparation of Reconstituted Lipoproteins (Lp2A-I)-- Discoidal reconstituted lipoproteins containing two apoA-I molecules per particle (Lp2A-I) were prepared by the cholate dispersion/Bio-Beads removal technique using a starting 1-palmitoyl-2-oleoyl-phosphatidylcholine (POPC)/FC/apoA-I ratio of 80:10:1 as published by Sparks et al. (24). The homogeneity and hydrodynamic diameters of the Lp2A-I were determined by non-denaturing PAGGE as described previously (17). The reconstituted lipoproteins were shown to contain two molecules of recombinant apoA-I by cross-linking with dimethyl suberimidate according to an established protocol (25). The Lp2A-I phospholipid compositions were determined with an enzymatic kit (Wako Chemicals, Neuss, Germany) as was FC (Roche Molecular Biochemicals). The apoA-I concentrations were measured by the Markwell Lowry method (26) using bovine serum albumin (BSA) as the standard.

Stability of Association on Lp2A-I-- The stability of association of rec.hapoA-I and rec.apoA-IFIN on the Lp2A-I was measured by CD spectroscopy using a Jasco J41A spectropolarimeter. The change in molar ellipticity at 222 nm in the presence of increasing amounts of guanidine hydrochloride was used to calculate the standard free energy of denaturation (Delta GD0) as described previously (24).

Lecithin:Cholesterol Acyltransferase Assay-- LCAT was purified according to Albers et al. (27) and the cholesterol esterification studies were performed as outlined previously (28). The Lp2A-I used in these studies (initial POPC/FC/apoA-I ratio of 80:10:1) were labeled with [1alpha ,2alpha -3H]cholesterol (PerkinElmer Life Sciences) and contain either rec.hapoA-I alone (Lp2A-IWT), rec.apoA-IFIN alone (Lp2A-IFIN), or an equimolar mixture of the two (Lp2A-IWT/FIN). The Lp2A-IWT/FIN are hybrid populations that were prepared to resemble most closely the nascent lipoproteins formed in heterozygous carriers of the apoA-IFIN mutation. Since rec.hapoA-I and apoA-IFIN have equal lipid binding capabilities and given that all proteins were incorporated into the particles, the Lp2A-IWT/FIN represent a heterogeneous lipoprotein population, similar to those that might form in vivo. Approximately 50% of the Lp2A-I contain one molecule of each, 25% two molecules of rec.hapoA-I, and 25% two molecules of rec.apoA-IFIN. Two different types of experiments were performed. The initial rate constants apparent Km (appKm) and Vmax were calculated by incubating the Lp2A-I at the concentrations indicated (given as µM of apoA-I) with the enzyme for 10 min at 37 °C and terminating the reaction with the addition of 2 ml of ethanol. Under these conditions, there is minimal substrate conversion as documented previously (28). In the second experiment, the time course of CE formed was followed over 5 h by incubating Lp2A-I particles at a final apoA-I concentration of 2.0 µM with 3.5 units of LCAT. For both sets of experiments, the values are the mean (± S.E.) of triplicate measurements and represent the average of two independent experiments. Statistical analysis was performed using the Student's t test. One unit of LCAT is defined as the amount required to convert 1 nmol of FC to CE per h using a standard Lp2A-I particle (prepared as described above) at a final apoA-I concentration of 2.0 µM.

Cholesterol Efflux Studies-- Efflux of cholesterol from mouse J774 macrophages (ATCC TIB-67) to rec.hapoA-I or rec.apoA-IFIN with or without stimulation by cAMP was performed as outlined previously (29). Briefly, J774 macrophages in 12-well plates were loaded with [1alpha ,2alpha -3H]cholesterol (10 µCi/well) using acetylated low density lipoproteins (75 µg/ml) in DMEM containing 10% FBS, penicillin (100 units/ml), and streptomycin sulfate (100 µg/ml). After 36 h, the loading medium was removed and replaced with serum-free DMEM containing 0.2% (w/v) BSA (DMEM/BSA) with or without the membrane-permeable cAMP analog 8-(4-chlorophenylthio)-cAMP (pCPT-cAMP) (0.15 mM final) (Sigma). Cholesterol was allowed to equilibrate with the cells for 10-12 h at which time the medium was removed and replaced with DMEM/BSA with or without pCPT-cAMP containing rec.hapoA-I or rec.apoA-IFIN as lipid-free proteins or as Lp2A-I (1.7 µM final apoA-I concentration). Efflux was measured over 3 h after subtracting the basal 3H-FC efflux to medium of cells without apoA-I (DMEM/BSA control) which was less than 10% of the apoA-I-specific efflux.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Since apoA-IFIN causes hypoalphalipoproteinemia in carriers of this mutation, we first sought to reproduce this phenotype in a mouse model by de novo expression of apoA-IFIN. This was accomplished by two different approaches. First, wild-type C57BL/6J mice were injected with either the apoA-IFIN.Ad5 or the hapoA-I.Ad5, and their effects on mapoA-I (Fig. 1) and HDL-C concentrations were compared. The concentrations of mapoA-I were decreased significantly by apoA-IFIN (Fig. 1B, lower right panel, lanes 1-4) but not by hapoA-I (Fig. 1A, lower right panel, lanes 1-4). Interestingly, evidence of apoA-IFIN proteolysis was seen in the plasma (Fig. 1B, upper right panel), and the greatest decreases in mapoA-I concentrations correlated with plasma samples that had the most significant amounts of apoA-IFIN degradation (Fig. 1B, lower right panel, lanes 3 and 4). Overall, low concentrations of circulating apoA-IFIN (50 ± 4.6 mg/dl) caused a statistically significant decrease (p < 0.03) in mapoA-I concentrations (to 32 ± 22% of pre-injected values) that was not found for higher and more physiological concentrations (141 ± 27 mg/dl) of hapoA-I (p = 0.14) (Fig. 1C). Furthermore, apoA-IFIN decreased the HDL-C concentrations and caused a remodeling of HDL in these mice converting the large HDL2 to smaller HDL3 (not shown). This is similar to what was observed when hapoA-I and apoA-IFIN were co-expressed in apoA-I-deficient mice (below).


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1.   Proteolysis of apoA-IFIN is correlated with reductions in murine apoA-I concentrations in C57BL/6J mice expressing sub-physiological concentrations of this human apoA-I mutant. Plasma (1.5 µl) was isolated from mice and subjected to 12% SDS-PAGE and then Western blot analysis following transfer to nitrocellulose. The blots were probed with either a mixture of biotinylated anti-human apoA-I monoclonal antibodies (alpha -human) (upper panels) or a polyclonal anti-mouse (alpha -mouse) apoA-I antibody (lower panels) as described under "Experimental Procedures." A, plasma was isolated from 4 mice prior to (left panels) or 4 days after injections of 2 × 109 pfu of the hapoA-I.Ad5 (right panels). B, plasma was isolated from 4 mice prior to (left panels) or 4 days after injections of 2 × 109 pfu of the apoA-IFIN.Ad5 (right panels). C, densitometric scanning of the mapoA-I bands before (white bars) or following injections of the hapoA-I.Ad5 (gray bar) or the apoA-IFIN.Ad5 (black bar). There is a statistically significant reduction (p < 0.03) in mapoA-I concentrations (33 ± 22% of normal values) following expression of apoA-IFIN (50 ± 4.6 mg/dl) but not with hapoA-I at higher and more physiological concentrations (141 ± 27 mg/dl). The greatest reductions in mapoA-I concentrations correlate with the most extensive proteolysis of apoA-IFIN.

To confirm these results and more closely mimic the human heterozygous state, apoA-I-deficient mice were co-injected with the hapoA-I.Ad5 and the apoA-IFIN.Ad5, and the circulating apoA-I and total cholesterol concentrations were compared with mice injected with either the hapoA-I.Ad5 or the apoA-IFIN.Ad5 alone (Fig. 2). Mice injected with the hapoA-I.Ad5 had high circulating concentrations of hapoA-I that reached physiological concentrations by 4 days and peaked at high levels between 7 and 9 days before returning to lower concentrations at 12 days (Fig. 2A, ). In contrast, co-expression of hapoA-I and apoA-IFIN (Fig. 2A, black-triangle) resulted in only moderate concentrations of circulating apoA-I (50-70 mg/dl) that were 3-8-fold lower in these mice throughout the time course of expression compared with hapoA-I. In fact, the apoA-I concentrations following co-expression of the two proteins were similar to mice expressing only apoA-IFIN (Fig. 2A, black-square), except that apoA-I levels were sustained longer in the plasma when both proteins were present. The increases in total cholesterol concentrations were confined to the HDL pool (rho  > 1.06 g/ml) and paralleled the expression of the human apoA-I proteins in these mice (Fig. 2B). Native hapoA-I increased the HDL-TC concentrations reaching a maximum between 7 and 9 days (Fig. 2B, ), whereas co-expression of hapoA-I and apoA-IFIN had only a moderate effect on the HDL-TC concentrations (2-3-fold increase) (Fig. 2B, black-triangle) throughout the time course (Table I). ApoA-IFIN (Fig. 2B, black-square) produced a similar effect, but the return to base-line plasma cholesterol concentrations occurred more rapidly (by 6-8 days) (Table I) and followed the more transient expression of this protein in apoA-I-deficient mice.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2.   ApoA-I-deficient mice co-expressing hapoA-I and apoA-IFIN or apoA-IFIN alone have greatly reduced apoA-I and HDL total cholesterol concentrations compared with mice expressing only hapoA-I over the time course of expression. ApoA-I-deficient mice were pre-bled and then injected with either 2 × 109 pfu of the hapoA-I.Ad5 alone (3 males), 1 × 109 pfu of each of the hapoA-I.Ad5 and the apoA-IFIN.Ad5 (2 males and 1 female), and for comparison 2 × 109 pfu of the apoA-IFIN.Ad5 alone (3 females) as described under "Experimental Procedures." A, the apoA-I concentrations in mouse plasma samples were measured with a standard radioimmunoassay as described previously (19, 20). In mice expressing hapoA-I alone (), the apoA-I concentrations reach physiological concentrations 4 days following injections of the adenoviruses and peaks between days 7 and 9 before returning to physiological concentrations once again by day 12. In contrast, mice co-expressing hapoA-I and apoA-IFIN (black-triangle) have a delayed appearance of apoA-I in the plasma, and the apoA-I concentrations attained are much lower. The apoA-I concentrations are more similar to mice expressing only apoA-IFIN (black-square), except the duration of expression is sustained longer in mice expressing both proteins. B, the plasma total cholesterol concentrations were determined as described under "Experimental Procedures," and the increases following apoA-I expression are confined to the HDL pool. Mice expressing hapoA-I alone () have large increases in HDL total cholesterol that parallel the apoA-I concentrations over the time course of expression. Mice co-expressing hapoA-I and apoA-IFIN (black-triangle) or apoA-IFIN alone (black-square) have only moderate increases in HDL total cholesterol concentrations, which demonstrate the dominant negative effect of this human mutation in these mice. The transient expression of apoA-IFIN is paralleled by a return to normal plasma cholesterol concentrations in these mice 6 days post-injection (black-square).

                              
View this table:
[in this window]
[in a new window]
 
Table I
The changes in apoA-I-deficient plasma lipid concentrations as a function of time of expression of either hapoA-I or apoA-IFIN alone or co-expression of hapoA-I and apoA-IFIN
The increases in plasma lipid concentrations were found in HDL fractions (rho  > 1.06 g/ml). Mice (n = 3 for each group) were injected with either 2 × 109 pfu of either the hapoA-I.Ad5 or the apoA-IFIN.Ad5 or co-injected with 1 × 109 pfu of each. Plasma was collected, and lipids were measured the same day as outlined under "Experimental Procedures." Plasma lipid concentrations are shown for day 2, day 4, and day 8 following injections of the apoA-I recombinant adenoviruses. The values are compared for statistical significance (Student's t test) as outlined below.

A more detailed analysis of the effects of the different adenovirus injections on plasma lipid concentrations in these mice is provided in Table I. Shown are the changes for 3 different days (2, 4, and 8 days) and are representative of early, intermediate, and late time points following injections of the adenoviruses. Statistically significant increases (p < 0.05) in all pre-injected plasma lipid concentrations occur following expression of hapoA-I by 4 days post-injection and are maintained at day 8 and beyond. Expression of apoA-IFIN or co-expression of hapoA-I and apoA-IFIN, on the other hand, did not produce these large changes in plasma lipid concentrations. Therefore, by 4 days post-injections there were significant differences in plasma lipid concentrations between mice expressing apoA-IFIN alone or co-expressing hapoA-I and apoA-IFIN and mice expressing hapoA-I (p < 0.05). Co-expressing hapoA-I and apoA-IFIN produced significant changes by 8 days post-injections compared with mice expressing apoA-IFIN alone (p < 0.05) due to the return to base-line plasma lipid concentrations in mice expressing only the mutant protein.

HDL size and charge were also monitored 4 days following injections of the different adenoviruses (Fig. 3). Interestingly, small HDL only were formed (8-9 nm) in apoA-I-deficient mice injected with the hapoA-I.Ad5 and the apoA-IFIN.Ad5 (Fig. 3A, lanes 3 and 5) similar in size although somewhat larger than in mice injected with the apoA-IFIN.Ad5 (lane 6). The absence of large HDL in mice expressing both proteins is consistent with that found in heterozygous carriers of the apoA-IFIN mutation (16). In contrast, hapoA-I formed mostly large HDL2 in these mice (Fig. 3A, lanes 2 and 4). Despite the decrease in HDL pool size and concentrations, both alpha - and pre-beta -migrating HDL were present in mice co-expressing apoA-IFIN and hapoA-I (Fig. 3B, lanes 4 and 5) as was found for mice expressing only hapoA-I (Fig. 3B, lanes 2 and 3). In contrast, apoA-IFIN was found predominantly as pre-beta -HDL with a minor population that migrated between the pre-beta - and alpha -migrating species. Negative staining electron microscopy also revealed that discoidal HDL were formed by apoA-IFIN (not shown) similar to what we observed previously for apoA-I central domain deletion mutants (18). Of note, the antibodies used (which were generated against lipid-free apoA-I) reacted much more strongly with pre-beta -HDL on transferred agarose gels, and no quantitative information on HDL charge distribution is implied or can be determined from this figure (Fig. 3B). As such, there appeared to be more pre-beta - than alpha -migrating HDL in mice expressing hapoA-I than was the case. Most of the hapoA-I was alpha -migrating as demonstrated by lipid and protein staining (not shown), large (Fig. 3A) and very buoyant (Fig. 4). The pre-beta -HDL containing the human apoA-I proteins in these mice were predominantly larger pre-beta 2-HDL that co-migrated with the alpha -HDL on native gels (Fig. 3A). There were also smaller amounts of lipid-poor pre-beta 1-HDL that appeared on the native gels (bottom of Fig. 3A) and when HDL were isolated by discontinuous gradient ultracentrifugation (Fig. 4).


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 3.   Differences in HDL size and charge are observed in apoA-I-deficient mice expressing either hapoA-I or apoA-IFIN alone or co-expressing hapoA-I and apoA-IFIN. Plasma was isolated from apoA-I-deficient mice 4 days following injections with the hapoA-I.Ad5, the apoA-IFIN.Ad5, or both as described for Fig. 2. A, plasma was subjected to 4-20% nondenaturing PAGGE and then to Western blot analysis following transfer to nitrocellulose. Lanes 1 and 7 contain biotinylated high molecular weight markers of known hydrodynamic diameters as indicated on the left; lanes 2 and 4, hapoA-I plasma (0.33 µl); lanes 3 and 5, hapoA-I/apoA-IFIN plasma (1 µl); and lane 6, apoA-IFIN plasma (1 µl). Large HDL2 are absent in mice that co-express apoA-IFIN and hapoA-I, which mimic the phenotype observed in individuals heterozygous for this mutation. Mice expressing hapoA-I alone form predominantly large HDL2 species, whereas mice expressing apoA-IFIN form smaller HDL (8-9 nm) similar in size to mice co-expressing hapoA-I and apoA-IFIN. B, the charge of the apoA-I lipoproteins was determined by Western blot analysis of an agarose gel electrophoresis. The antibodies react much more strongly with the pre-beta -HDL, and no quantitative information on HDL charge distribution is implied from this figure. However, apoA-I circulates as a mixture of alpha - and pre-beta -migrating HDL following expression of hapoA-I alone (1 µl, lanes 2 and 3) or following co-expression of hapoA-I and apoA-IFIN (5 µl, lanes 4 and 5). In contrast, apoA-IFIN (1 µl, lane 6) is found predominantly as pre-beta -HDL with minor population that migrates in between the alpha - and pre-beta -species. Lipid-free apoA-I (0.2 µg) prepared from human plasma (lane 1) is run as a standard.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 4.   Proteolysis of apoA-IFIN is confined to HDL3 and lipid-poor species in the plasma of apoA-I-deficient mice expressing this human apoA-I mutant. ApoA-I-deficient mice were maintained on the Teklad Western diet for 3 weeks prior to injection of either the hapoA-I and the apoA-IFIN recombinant adenoviruses (2 × 109 pfu). A, plasma isolated from apoA-I-deficient mice at the given days following injections with either the hapoA-I.Ad5 or the apoA-IFIN.Ad5 was subjected to 12% SDS-PAGE under reducing conditions followed by Western blot analysis. Proteolysis of apoA-IFIN is detected in the plasma, and the size of the major fragment (right-arrow) was found to be 18.5 kDa. This is the size predicted for an N-terminal fragment if cleavage occurs at or very close to the site of the apoA-IFIN mutation (antibodies used recognize N-terminal epitopes on apoA-I). B, selected HDL fractions were isolated from the plasma of fasted (9-11 h) apoA-I-deficient mice 4 days following injections of the recombinant adenoviruses and were subjected to 12% SDS-PAGE and Western blot analysis as described under "Experimental Procedures." Degradation products for apoA-IFIN are confined to the smaller HDL (HDL3) and lipid-poor species, and none are detected for hapoA-I.

Proteolysis of apoA-IFIN was also also evident following adenovirus-mediated expression in apoA-I-deficient mice (Fig. 4), similar to that observed in C57BL/6J mice (Fig. 1). For these experiments, female apoA-I-deficient mice between 4 and 6 months of age were maintained on a Western diet 3 weeks prior to injection of the recombinant adenoviruses. Under these dietary conditions, apoA-IFIN reached significantly higher levels (>100 mg/dl) allowing direct detection of the degradation products in the plasma by both Ponceau staining (not shown) and Western blot analysis (Fig. 4A). The monoclonal antibodies used for Western blot analysis recognize epitopes N-terminal to the Leu159 right-arrow Arg mutation (4H1 and 5F6 epitopes map to residues 1-8 and 118-148 of human apoA-I, respectively). Therefore, the major 18.5-kDa fragment represents an N-terminal degradation product and corresponds to the size expected if cleavage occurred at or near the site of the mutation. HDL fractions were isolated by centrifugation of pooled plasma collected from fasted (9-11 h) apoA-I-deficient mice on the Western diet 4 days after injection with either the hapoA-I or the apoA-IFIN recombinant adenoviruses (Fig. 4B). The apoA-IFIN degradation products were confined to the smaller HDL and lipid-poor fractions where the majority of this mutant was located (rho  > 1.13 g/ml). In contrast, no degradation products were found for hapoA-I which was found predominantly as buoyant HDL2 (rho  = 1.07 g/ml).

The delayed appearance of apoA-I in the plasma of apoA-I-deficient mice either co-expressing the two proteins or expressing apoA-IFIN alone (Fig. 2) suggested that the apoA-IFIN mutation might also impair hepatocyte secretion of apoA-I. To address this, apoA-I secretion was monitored in primary apoA-I-deficient murine hepatocytes infected with either the hapoA-I.Ad5 or apoA-IFIN.Ad5 (m.o.i. = 75:1 pfu/cell). As well, in order to simulate hepatic secretion of this mutant in heterozygous individuals, cells were co-infected with equal amounts of both recombinant adenoviruses at a half-dose (m.o.i. = 37.5 each) in which the combined titer was equivalent to that used to study secretion independently (Fig. 5). These results are representative of three separate experiments, and significant differences in the amounts of secreted and cell-associated 35S-apoA-I were detected under the different conditions during the initial chase period (t = 1 h) (p < 0.05). Less apoA-I was secreted in cells co-infected with the two adenoviruses (Fig. 5A, black-triangle) compared with hepatocytes infected with the hapoA-I.Ad5 alone (Fig. 5A, ). The apoA-I secreted was decreased further when apoA-IFIN was expressed alone (Fig. 5A, black-square). Interestingly, there was also less 35S-apoA-I associated with the hepatocytes expressing both apoA-I proteins (Fig. 5B, Delta ) at 1 h compared to hepatocytes expressing only hapoA-I (Fig. 5B, open circle ), and between 20 and 30% of the 35S-apoA-I is unaccounted for in these cells during the chase. Likewise, there was also less cell-associated 35S-apoA-I than expected in apoA-IFIN expressing hepatocytes throughout the chase even though this mutant accumulated in the hepatocytes (Fig. 5B, ) as anticipated from its poor secretion.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   The apoA-IFIN mutation impairs apoA-I secretion from hepatocytes and enhances its intracellular clearance. Primary hepatocytes from apoA-I-deficient mice were prepared as described previously (21, 22) and infected with the recombinant adenoviruses as described under "Experimental Procedures." 24 h after the initial infection, the cells were labeled with [35S]methionine for 1 h and chased for up to 4 h. A, the accumulation of 35S-apoA-I (given as the percentage of initial cell-associated apoA-I) in the medium is reported as a function of chase time following expression of hapoA-I (), apoA-IFIN (), or both (black-triangle). The initial rates of apoA-I secretion at the 1-h time point during the chase (before the plateaus are reached) show that hepatocytes co-expressing hapoA-I and apoA-IFIN (black-triangle) have impaired apoA-I secretion compared with hepatocytes expressing hapoA-I () (p < 0.05, Student's t test). ApoA-I secretion is reduced further in hepatocytes expressing apoA-IFIN (black-square) (p < 0.05 at 1 h). B, the amount of 35S-apoA-I remaining in the cells (as a percentage of initial cell associated apoA-I) is reported as a function of chase time following expression of hapoA-I (open circle ), apoA-IFIN (), or both (Delta ). Interestingly, at the 1-h time point less cell-associated apoA-I is found in hepatocytes co-expressing hapoA-I and apoA-IFIN (Delta ) compared with hepatocytes expressing hapoA-I (open circle ) (p < 0.05) despite the fact these cells also secrete less apoA-I into the medium. This suggests that the apoA-IFIN mutation not only interferes with hepatocyte secretion but makes apoA-I susceptible to intracellular clearance as well. This finding is supported by the observation that less than the expected amount of apoA-IFIN accumulates in the cells (). Statistically significant differences in medium and cell-associated apoA-I between hepatocytes co-expressing the two proteins or expressing apoA-IFIN alone and hepatocytes expressing hapoA-I are shown (*, p < 0.05, or **, p < 0.10).

The physicochemical properties of rec.hapoA-I and rec.apoA-IFIN purified from E. coli were also compared and found to be very similar. The two proteins have identical kinetics of association with dimyristoylphosphatidylcholine and behaved similarly to apoA-I purified from human plasma in this assay (not shown). When recombined with lipids in vitro, there were also no significant differences in the final molar compositions of Lp2A-IWT, Lp2A-IFIN, or Lp2A-IWT/FIN (Table II). All reconstituted lipoproteins contained two molecules of apoA-I as demonstrated by cross-linking with dimethyl suberimidate and were homogeneous in size (single band between 10.0 and 10.6 nm in diameter), and all proteins were incorporated into the lipoproteins as assessed by native 8-25% PAGGE (not shown). In addition, the stability of association (Delta GD0) of rec.apoA-IFIN with lipids was similar to rec.hapoA-I (Table II).

                              
View this table:
[in this window]
[in a new window]
 
Table II
Physical properties and LCAT kinetic data for reconstituted lipoproteins (Lp2A-I) prepared with recombinant hapoA-I, apoA-IFIN, or a 1:1 molar mixture of the two proteins

The effect of the apoA-IFIN mutation on LCAT activation was assessed (Fig. 6). As mentioned (see "Experimental Procedures"), the Lp2A-IWT/FIN were prepared to represent the nascent lipoprotein population that would most likely form in heterozygotes for the apoA-IFIN mutation. They consist of a heterogeneous mixture of reconstituted lipoproteins that contain one molecule of each recombinant protein (congruent 50% of total), two molecules of rec.hapoA-I (congruent 25% of total), or two molecules of rec.apoA-IFIN (congruent 25% of total). The Michaelis-Menten constants, appKm and Vmax (Table II), were determined for the three sets of Lp2A-I particles from the double-reciprocal Lineweaver-Burk plot (Fig. 6C). There was both a large increase in appKm and decrease in Vmax for Lp2A-IFIN (black-square) over Lp2A-IWT () (Fig. 6A and Table II). Interestingly, the Lp2A-IWT/FIN (triangle ) exhibited only a small increase in appKm over the Lp2A-IWT and no difference in Vmax (Fig. 6A and Table II). In addition, the Lp2A-IWT/FIN activated LCAT more efficiently than a 1:1 mixture of preformed Lp2A-IWT and Lp2A-IFIN (down-triangle), which had an expected activation of LCAT that was intermediate between that found for Lp2A-IWT () and Lp2A-IFIN (black-square) (Fig. 6B). There were also only small differences in the LCAT activation of Lp2A-IWT () and the Lp2A-IWT/FIN (Delta ) (measured as total CE formed) over an extended period at a set lipoprotein concentration (2.0 µM apoA-I) (Fig. 6D). However, the Lp2A-IFIN (black-square) had a greatly reduced LCAT activation, similar to what was found during the shorter incubation at varying substrate concentrations.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6.   ApoA-IFIN has impaired LCAT activation on its own but does not interfere with the activation of this enzyme by native human apoA-I. The three sets of reconstituted lipoproteins (Lp2A-I) were prepared as described under "Experimental Procedures." A, the esterification of [3H]cholesterol in three different reconstituted Lp2A-I particles by LCAT is shown. The Lp2A-I prepared with rec.hapoA-I alone (Lp2A-IWT) (), rec.apoA-IFIN alone (Lp2A-IFIN) (black-square), or a 1:1 molar ratio of two (Lp2A-IWT/FIN) (Delta ) were incubated with purified LCAT as described under "Experimental Procedures." Values are the mean (±S.E.) of duplicate experiments with triplicate measurements at each data point. B, as in A, except LCAT activation of a 1:1 molar mixture of pre-formed Lp2A-IWT and Lp2A-IFIN (down-triangle) instead of the hybrid particles is compared with Lp2A-IWT () and Lp2A-IFIN (). C, the double-reciprocal plot of cholesterol esterification for the 4 sets of Lp2A-I preparations is shown. The reciprocals of the initial velocities (VO) are plotted against the reciprocals of apoA-I concentration (µM) for each of the Lp2A-I preparations and are used to calculate the rate constants appKm and Vmax values for three sets of Lp2A-I (excluding the mixture of the two Lp2A-I) given in Table II. D, the nmol of CE formed over a 5-h period with 3.5 units of LCAT was determined for the Lp2A-IWT (), Lp2A-IFIN (), and Lp2A-IWT/FIN (Delta ) particles each at a final apoA-I concentration of 2.0 µM. Taken together, the results demonstrate that apoA-IFIN has impaired LCAT activation due to an apparent decrease in the affinity for the enzyme. However, apoA-IFIN does not inhibit LCAT activation of hapoA-I since the Lp2A-IWT/FIN (70-80% of which contain at least one molecule of apoA-IFIN) activates LCAT almost as efficiently as the Lp2A-IWT.

Finally, the effect of the apoA-IFIN mutation on the ability of apoA-I, both as lipid-free and as Lp2A-I, to promote efflux of cholesterol from macrophages was also determined. There were no differences between rec.apoA-IFIN and rec.hapoA-I in their abilities to promote cholesterol efflux from J774 macrophages as either lipid-free proteins or when reconstituted as Lp2A-I (not shown). Therefore, these data are consistent with the initial observations that the apoA-IFIN mutation does not negatively affect cholesterol efflux from cells in culture (16).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study offers new insights into the multiple and complex effects of apoA-IFIN on HDL metabolism. The cause for the dominant hypoalphalipoproteinemia induced by this mutation in heterozygous carriers has remained poorly understood since it was first identified by Miettinen et al. (15). The mutation was found to impair the ability of apoA-I to activate LCAT, but it was suggested that this could not account for the 4-5-fold reduction in HDL-C and apoA-I concentrations in these individuals (16). Therefore, we have expanded on these initial in vitro LCAT studies and designed informative in vivo experiments using recombinant adenoviruses to study the effect of the apoA-IFIN mutation on the metabolism of HDL. Our results show that while impaired LCAT activation may contribute to the dominant hypoalphalipoproteinemia in carriers of apoA-IFIN, it is clear that other mechanisms are also responsible for conferring this dominant negative phenotype. Furthermore, this study illustrates the advantages of using recombinant adenoviruses in expression of apoA-I variants in mice and primary hepatocytes when in vitro studies alone are not sufficiently informative for the study of HDL metabolism.

The apoA-IFIN mutation (Leu159 to Arg) occurs on the hydrophobic face of helix 6 (aa 143-165), a region of the protein that has been shown by both in vitro studies (30-38) and more recently by in vivo studies (18, 39, 40) to be important for LCAT activation. This helix is highly conserved among species (41), and therefore non-conserved amino acid substitutions in this region might be expected to interfere with LCAT activation by apoA-I. This was demonstrated for apoA-IFIN (16) and more recently in a study where three conserved Arg residues in this region were mutated (38). However, it remains unclear how lipoproteins containing both apoA-IFIN and hapoA-I activate LCAT compared with lipoproteins that contain only hapoA-I (see below). Also, the effect of apoA-IFIN on LCAT activity has not been analyzed in vivo in the homozygous state. In this study apoA-IFIN generates HDL with predominantly pre-beta migration in apoA-I-deficient mice (Fig. 3B, lane 6), and analysis of plasma lipoproteins from these mice by negative staining EM demonstrates that this mutant but not hapoA-I forms discoidal HDL (not shown). As well, even during peak expression of this mutant (2-3 days) the CE/TC ratio in the plasma samples averaged only 0.39 and is even lower than pre-injected values (derived from Table I). Therefore, these in vivo findings support previous and current (see below) in vitro data that apoA-IFIN has impaired LCAT activation in the absence of hapoA-I.

Detailed in vitro LCAT experiments were next performed to address the possibility that the apoA-IFIN mutation might inhibit LCAT activation in lipoproteins containing both apoA-IFIN and hapoA-I and contribute to its dominant negative effect on HDL-C and apoA-I concentrations in this manner (Fig. 6). Lp2A-I of similar size, lipid composition, and stability are formed with rec.hapoA-I (Lp2A-IWT), rec.apoA-IFIN (Lp2A-IFIN), or both (Lp2A-IWT/FIN) (Table II). This ensures that we are studying an effect of the mutation on LCAT activation and not secondary effects due to differences in lipid composition that can independently alter the activity of this enzyme (28, 42). The Lp2A-IWT/FIN are important because they most closely represent the nascent HDL that would form in apoA-IFIN heterozygotes. This heterogeneous lipoprotein population consists of Lp2A-I with either one molecule each of rec.hapoA-I and rec.apoA-IFIN or Lp2A-I containing two molecules of rec.hapoA-I or two molecules of rec.apoA-IFIN. As such, the majority (70-80%) of the Lp2A-I would contain at least one molecule of rec.hapoA-I and one molecule of rec.apoA-IFIN. Therefore, if apoA-IFIN is dominant over hapoA-I with respect to LCAT activation, the Lp2A-IWT/FIN should behave similarly to the Lp2A-IFIN in this assay. If not, the LCAT activation of the Lp2A-IWT/FIN should more closely resemble that of the Lp2A-IWT. The latter is observed here. We find that the Lp2A-IFIN (Fig. 6A, black-square, and Table II) does have a marked reduction in the affinity for the enzyme (large increase in appKm) which is consistent with our in vivo data (above), whereas the Lp2A-IWT/FIN (Fig. 6A, Delta ) have only slightly impaired LCAT activation compared with Lp2A-IWT. There is a small increase in the appKm and no difference in Vmax for the Lp2A-IWT/FIN compared with Lp2A-IWT (Table II). Furthermore, the Lp2A-IWT/FIN are more efficient at activating LCAT than is a 1:1 mixture of preformed Lp2A-IWT and Lp2A-IFIN (Fig. 6B, down-triangle). These data clearly demonstrate that the apoA-IFIN mutation does not negatively affect LCAT activation of hapoA-I, and hapoA-I even appears to overcome some of the inhibition of apoA-IFIN. Our in vivo data support these in vitro results. Both pre-beta - and mature alpha -migrating HDL are present in apoA-I-deficient mice expressing both proteins (Fig. 3B, lanes 4 and 5) but not in mice expressing only apoA-IFIN (Fig. 3B, lane 6). Taken together, these data indicate that LCAT activation is only moderately impaired in the heterozygous state and can not fully account for the hypoalphalipoproteinemia in carriers of apoA-IFIN.

Since many prohormones are cleaved at paired basic amino acids (43), it was suggested that the presence of two consecutive arginines within apoA-I produced by the Leu159 right-arrow Arg substitution may make the mutant protein susceptible to proteolytic cleavage (15). Of note, the pro-sequences of both human and mouse apolipoprotein A-II (apoA-II) are cleaved in the plasma at a paired basic sequences immediately downstream (-1,-2) of the first amino acid in the mature proteins. Nonetheless, proteolysis of apoA-IFIN was not detected by Western blot analysis of plasma samples isolated from heterozygotes in the initial studies of Miettinen et al. (15) and the possibility that apoA-IFIN was degraded was not explored further in these studies. However, it is clear in this study that even with precautions to reduce degradation artifacts that apoA-IFIN but not hapoA-I undergoes proteolysis in both wild-type (Fig. 1) and apoA-I-deficient mice (Fig. 4) following adenovirus-mediated expression. The higher concentrations of apoA-IFIN obtained following injections of the recombinant adenoviruses have made possible the detection of these proteolytic cleavage products of apoA-IFIN, which under normal circumstances are likely cleared rapidly from the circulation and escape detection. This proteolysis appears to play an important role in reducing HDL-C and apoA-I concentrations. In our in vivo system, we show that there is a direct correlation between the extent of apoA-IFIN proteolysis and the decrease in mapoA-I concentrations (Fig. 1). In fact, mapoA-I is barely detectable in the plasma sample where there is greatest amount of detectable apoA-IFIN proteolysis (Fig. 1B, lane 4, lower right panel). This reduction in mapoA-I levels occurs with only low to moderate concentrations of apoA-IFIN (50 ± 4.6 mg/dl) and is specific for the mutant protein. Higher and more physiological concentrations of hapoA-I (147 ± 26 mg/dl) do not have this statistically significant effect (Fig. 1). This finding appears different from that reported previously with human apoA-I transgenic mice, in which high expression of hapoA-I was shown to reduce mapoA-I concentrations (44). However, the two systems are not directly comparable. Two major differences between this study and the previous one is that in the prior study the human apoA-I transgenic mice were fasted overnight and had higher circulating concentrations of human apoA-I. In the present study, the C57BL/6J mice were not fasted and hapoA-I is found only to slightly reduce mapoA-I plasma concentrations without reaching statistical significance (p = 0.14). In contrast, sub-physiological concentrations of apoA-IFIN significantly reduce mapoA-I levels (p < 0.03) (Fig. 1C). Furthermore, we observe a similar and dominant effect of apoA-IFIN on apoA-I and HDL-C concentrations when this mutant is co-expressed with hapoA-I in apoA-I-deficient mice (Fig. 2), a system that more closely mimics the heterozygous state. ApoA-I concentrations are 3-8-fold lower in apoA-I-deficient mice expressing both proteins compared with mice expressing hapoA-I alone throughout the time course of expression (Fig. 2A). Consequently, the HDL-C (Fig. 2B) and plasma lipid (Table I) concentrations are greatly reduced and large HDL2 are absent (Fig. 3A, lanes 3 and 5) in these mice, similar to findings reported previously (16) for heterozygous carriers of this mutation.

The dramatic reductions in apoA-I and HDL-C concentrations caused by apoA-IFIN proteolysis should not come as a surprise. Numerous studies have demonstrated this can have a major impact on HDL metabolism. ApoA-I degradation by elastase was shown to enhance the binding and intracellular clearance of HDL by macrophages (45). Limited proteolysis of apoA-I by matrix metalloproteinases has also been shown to decrease cholesterol efflux from cholesterol-loaded macrophages (46), and similarly, mild trypsinization of HDL effectively abolishes apolipoprotein-mediated cholesterol efflux from cholesterol-loaded fibroblasts (47). Therefore, even though the apoA-IFIN mutation does not affect cholesterol efflux from cells in culture as we (not shown) and Miettinen et al. (16) have found, it is likely that proteolysis of apoA-IFIN in vivo interferes with HDL-mediated efflux in mice expressing this mutant. In support of this, apoA-IFIN is selectively degraded on smaller HDL and lipid-poor species (Fig. 4B), the most important acceptors of cell-derived phospholipids and cholesterol (reviewed in Ref. 48). Furthermore, another study has shown that proteolysis leads to dissociation of apoA-I from HDL, especially on the less buoyant HDL3, and produces an unstable HDL population (49). We also find that apoA-IFIN is preferentially degraded on HDL3 and lipid-poor species, and this is likely to promote a more rapid clearance of native apoA-I and other HDL apolipoproteins and in the process interfere with their maturation into larger and more buoyant HDL. This hypothesis is consistent with our findings that mice co-expressing apoA-IFIN and hapoA-I (Fig. 2B, lanes 3 and 5) and wild-type mice expressing this mutant are devoid of HDL2. It also provides an explanation as to why other HDL apolipoproteins, such as apoA-II, are also found at lower than normal concentrations in heterozygotes for this mutation (15).

This is also the first demonstration that the apoA-IFIN mutation decreases the rate of apoA-I secretion from primary hepatocytes (Fig. 5). The effect is greatest under conditions that mimic apoA-IFIN homozygosity (infection with the apoA-IFIN adenovirus alone), but it is also observed in the heterozygous state (co-infection with the two adenoviruses). This is particularly true early on in the chase (t = 1 h) before the plateaus in the secretion time course are reached. In fact, hepatocytes expressing both apoA-IFIN and hapoA-I have statistically significant decreases (p < 0.05) in secreted 35S-apoA-I (Fig. 5A, black-triangle) as well as cell-associated 35S-apoA-I (Fig. 5B, Delta ) at the 1-h time point compared with hepatocytes expressing only hapoA-I (Fig. 5A, , and Fig. 5B, open circle ). This suggests that the apoA-IFIN mutation interferes with apoA-I secretion and causes apoA-I to be degraded intracellularly given that between 20 and 30% of the initial cell-associated apoA-I cannot be accounted for throughout the chase. These data are consistent with hepatocytes expressing apoA-IFIN alone. The decreased secretion of apoA-IFIN (Fig. 5A, black-square) into the medium is apparently accounted for by the accumulation of this mutant within the hepatocytes (Fig. 5B, ). However, some of the initial cell-associated apoA-I is lost and cannot be accounted for in the hepatocytes expressing this mutant. Therefore, these are the first data to suggest that heterozygous carriers of the apoA-IFIN mutation also have impaired apoA-I secretion in addition to enhanced apoA-I clearance from the plasma. Some studies have suggested that HDL-C levels are inversely correlated with the fractional catabolic rate of apoA-I and not with the apoA-I secretion rate (50). However, a more recent study utilizing endogenously labeled apoA-I has shown that both the fractional catabolic rate and secretion rate contribute to plasma HDL-C levels (51). Therefore, the reduced secretion rate of apoA-I in hepatocytes expressing both apoA-IFIN and hapoA-I most likely contributes to the low apoA-I and HDL-C concentrations in heterozygous carriers of this mutation. We also propose that there is an increased intracellular clearance of hapoA-I in the presence of apoA-IFIN, since a proportion of apoA-I secreted from these primary hepatocytes is in the form of lipid-associated apoA-I dimers.2 Proteolysis of apoA-IFIN inside the hepatocytes would prevent efficient secretion of this nascent HDL population, similar to its effect on the clearance of this lipid-poor HDL pool in the plasma.

There are at least 7 other mutations identified within the central domain of apoA-I that are also associated with reduced plasma HDL-C and apoA-I concentrations (52, 52-60). We have shown in this study that apoA-IFIN has a greatly reduced ability to activate LCAT, but this alone cannot account for the hypoalphalipoproteinemia in heterozygous carriers of this mutation. In contrast, a recent in vivo study suggests that deletion of aa 143-164 within apoA-I may negatively affect LCAT activation by native apoA-I (40). It was proposed that this might explain the dominant negative effect on HDL-C concentrations seen in heterozygotes for the apoA-ISeattle mutation (deletion of aa 146-160), although it should be noted that the two mutations are structurally different. In addition, no in vitro LCAT studies have been reported to confirm this hypothesis. Conversely, it has been suggested that the low HDL-C concentrations in heterozygotes for apoA-I mutations such as apoA-ISeattle, apoA-IFIN, and apoA-IZavalla (Leu159 to Pro) result from hypercatabolism of apoA-I that is only partially due to or independent of a decrease in LCAT activation (55). This latter viewpoint is consistent with the results obtained from this study in which we show that proteolysis of apoA-IFIN and a reduced secretion rate of this mutant from hepatocytes are more likely to account for the low HDL-C and apoA-I concentrations than is dysfunctional LCAT activation.

In summary, this extensive metabolic study of a naturally occurring apoA-I variant known as apoA-IFIN should also prove valuable in the study of other apoA-I mutations contributing to hypoalphalipoproteinemia and further our understanding of the roles of apoA-I domains in the metabolism of HDL. We have shown that the apoA-IFIN mutation does not affect the ability of apoA-I to associate with lipids and form stable reconstituted lipoproteins. However, apoA-IFIN has a significantly reduced ability to activate LCAT (5-fold increase in appKm) compared with hapoA-I, but in a heterogeneous lipoprotein preparation with hapoA-I there is only a slight decrease in the affinity for the enzyme (1.4-fold increase in appKm). Importantly, this mutation impairs apoA-I secretion from primary hepatocytes and leads to proteolysis of apoA-I in plasma. These effects appear to be primarily responsible for the remodeling of and decrease in the HDL pool size in both wild-type C57BL/6J mice expressing this mutant and in apoA-I-deficient mice co-expressing apoA-IFIN and hapoA-I. Therefore, we propose the combination of these defects account for the 4-5-fold reductions in HDL-C and apoA-I concentrations in heterozygous carriers of the apoA-IFIN mutation.

    ACKNOWLEDGEMENTS

We thank Tracey Neville and Susha Zachariah for excellent technical assistance with the LCAT and primary hepatocyte experiments, respectively, and to the Animal Care Staff at the University of Ottawa Heart Institute for expert assistance. We also thank Drs. Ruth McPherson and Ross Milne for their suggestions and critical reading of this manuscript.

    FOOTNOTES

* This work was supported in part by a group grant from the Medical Research Council of Canada.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Supported by a postgraduate scholarship from the Heart and Stroke Foundation of Canada.

§ Both authors contributed equally to this work.

Supported by a scholarship from the National Sciences and Engineering Research Council of Canada and an Ontario Graduate Scholarship.

|| To whom correspondence should be addressed: Lipoprotein and Atherosclerosis Research Group, University of Ottawa Heart Institute, Rm. H460, 40 Ruskin St., Ottawa, Ontario K1Y 4W7, Canada. Tel.: 613-761-5255; Fax: 613-761-5281; E-mail: ymarcel@ottawaheart.ca.

Published, JBC Papers in Press, April 5, 2001, DOI 10.1074/jbc.M100463200

2 D. C. McManus and Y. L. Marcel, unpublished results.

    ABBREVIATIONS

The abbreviations used are: HDL, high density lipoproteins; HDL-C, high density lipoprotein cholesterol; apoA-I, apolipoprotein A-I; CE, cholesteryl ester; TRL, triglyceride-rich lipoproteins; FC, free cholesterol; LCAT, lecithin:cholesterol acyltransferase; ABCA1, ATP-binding cassette transporter protein A1; PLTP, phospholipid transfer protein; FHA, familial hypoalphalipoproteinemia; apoA-IFIN, apoA-I Finland; aa, amino acid; hapoA-I, native human apoA-I; Ad5, recombinant adenovirus(es); apoA-IFIN.Ad5, Ad5 carrying the apoA-IFIN cDNA; hapoA-I.Ad5, Ad5 carrying the hapoA-I cDNA; PAGE, polyacrylamide gel electrophoresis; luc.Ad5, Ad5 carrying the firefly luciferase cDNA; pfu, plaque-forming units; TC, total cholesterol; PAGGE, polyacrylamide gradient gel electrophoresis; mapoA-I, murine apoA-I; FBS, fetal bovine serum; m.o.i., multiplicity of infection; DMEM, Dulbecco's modified minimal medium; rec.hapoA-I, His-tagged purified recombinant hapoA-I; rec.apoA-IFIN, His-tagged purified recombinant apoA-IFIN; Lp2A-I, reconstituted lipoproteins containing two molecules of apoA-I; POPC, 1-palmitoyl-2-oleoylphosphatidylcholine; BSA, bovine serum albumin; Lp2A-IWT, Lp2A-I with two molecules of hapoA-I; Lp2A-IFIN, Lp2A-I with two molecules of apoA-IFIN; Lp2A-IWT/FIN, Lp2A-I containing two apoA-I prepared with an equimolar amount of hapoA-I and apoA-IFIN; pCPT-cAMP, cAMP analog 8-(4-chlorophenylthio)-cAMP; apoA-II, apolipoprotein A-II.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Gordon, T., Castelli, W. P., Hjortland, M. C., Kannel, W. B., and Dawber, T. R. (1977) Am. J. Med. 62, 707-714
2. Breslow, J. L. (1995) in The Metabolic and Molecular Basis of Inherited Disease (Scriver, C. R. , Beaudet, A. L. , Sly, W. S. , and Valle, D., eds) , pp. 2031-2052, McGraw-Hill Inc., New York
3. Frank, P. G., and Marcel, Y. L. (2000) J. Lipid Res. 41, 853-872
4. Segrest, J. P., Li, L., Anantharamaiah, G. M., Harvey, S. C., Liadaki, K. N., and Zannis, V. (2000) Curr. Opin. Lipidol. 11, 105-115
5. Eisenberg, S. (1984) J. Lipid Res. 25, 1017-1058
6. Jiang, X. C., Bruce, C., Mar, J., Lin, M., Ji, Y., Francone, O. L., and Tall, A. R. (1999) J. Clin. Invest. 103, 907-914
7. Qin, S. C., Kawano, K., Bruce, C., Lin, M., Bisgaier, C., Tall, A. R., and Jiang, X. C. (2000) J. Lipid Res. 41, 269-276
8. Brooks-Wilson, A., Marcil, M., Clee, S. M., Zhang, L. H., Roomp, K., Van Dam, M., Yu, L., Brewer, C., Collins, J. A., Molhuizen, H. O., Loubser, O., Ouelette, B. F., Fichter, K., Ashbourne-Excoffon, K. J., Sensen, C. W., Scherer, S., Mott, S., Denis, M., Martindale, D., Frohlich, J., Morgan, K., Koop, B., Pimstone, S., Kastelein, J. J., Genest, J., Jr., and Hayden, M. R. (1999) Nat. Genet. 22, 336-345
9. Rust, S., Rosier, M., Funke, H., Real, J., Amoura, Z., Piette, J. C., Deleuze, J. F., Brewer, H. B., Duverger, N., Denefle, P., and Assmann, G. (1999) Nat. Genet. 22, 352-355
10. Bodzioch, M., Orso, E., Klucken, J., Langmann, T., Bottcher, A., Diederich, W., Drobnik, W., Barlage, S., Buchler, C., Porsch-Ozcurumez, M., Kaminski, W. E., Hahmann, H. W., Oette, K., Rothe, G., Aslanidis, C., Lackner, K. J., and Schmitz, G. (1999) Nat. Genet. 22, 347-351
11. Marcil, M., Brooks-Wilson, A., Clee, S. M., Roomp, K., Zhang, L. H., Yu, L., Collins, J. A., Van Dam, M., Molhuizen, H. O., Loubster, O., Ouellette, B. F., Sensen, C. W., Fichter, K., Mott, S., Denis, M., Boucher, B., Pimstone, S., Genest, J., Jr., Kastelein, J. J., and Hayden, M. R. (1999) Lancet 354, 1341-1346
12. Clee, S. M., Kastelein, J. J., Van Dam, M., Marcil, M., Roomp, K., Zwarts, K. Y., Collins, J. A., Roelants, R., Tamasawa, N., Stulc, T., Suda, T., Ceska, R., Boucher, B., Rondeau, C., DeSouich, C., Brooks-Wilson, A., Molhuizen, H. O., Frohlich, J., Genest, J., Jr., and Hayden, M. R. (2000) J. Clin. Invest. 106, 1263-1270
13. Yamakawa-Kobayashi, K., Yanagi, H., Fukayama, H., Hirano, C., Shimakura, Y., Yamamoto, N., Arinami, T., Tsuchiya, S., and Hamaguchi, H. (1999) Hum. Mol. Genet. 8, 331-336
14. Calabresi, L., and Franceschini, G. (1997) Curr. Opin. Lipidol. 8, 219-224
15. Miettinen, H. E., Gylling, H., Miettinen, T. A., Viikari, J., Paulin, L., and Kontula, K. (1997) Arterioscler. Thromb. Vasc. Biol. 17, 83-90
16. Miettinen, H. E., Jauhiainen, M., Gylling, H., Ehnholm, S., Palomaki, A., Miettinen, T. A., and Kontula, K. (1997) Arterioscler. Thromb. Vasc. Biol. 17, 3021-3032
17. Bergeron, J., Frank, P. G., Emmanuel, F., Latta, M., Zhao, Y. W., Sparks, D. L., Rassart, E., Denèfle, P., and Marcel, Y. L. (1997) Biochim. Biophys. Acta 1344, 139-152
18. McManus, D. C., Scott, B. R., Frank, P. G., Franklin, V., Schultz, J. R., and Marcel, Y. L. (2000) J. Biol. Chem. 275, 5043-5051
19. Bergeron, J., Frank, P. G., Scales, D., Meng, Q.-H., Castro, G., and Marcel, Y. L. (1995) J. Biol. Chem. 270, 27429-27483
20. Calabresi, L., Meng, Q.-H., Castro, G. R., and Marcel, Y. L. (1993) Biochemistry 32, 6477-6484
21. Subrahmanyan, L., and Kisilevsky, R. (1988) Scand. J. Immunol. 27, 251-260
22. Thomas, S. S., Plenkiewicz, J., Ison, E. R., Bols, M., Zou, W., Szarek, W. A., and Kisilevsky, R. (1995) Biochim. Biophys. Acta 1272, 37-48
23. McLeod, R. S., Wang, Y., Wang, S., Rusinol, A., Links, P., and Yao, Z. (1996) J. Biol. Chem. 271, 18445-18455
24. Sparks, D. L., Lund-Katz, S., and Phillips, M. C. (1992) J. Biol. Chem. 267, 25839-25847
25. Swaney, J. B., and O'Brien, K. (1978) J. Biol. Chem. 253, 7069-7077
26. Markwell, M. A., Haas, S. M., Bieber, L. L., and Tolbert, N. E. (1978) Anal. Biochem. 87, 206-210
27. Albers, J. J., Chen, C. H., and Lacko, A. G. (1986) Methods Enzymol. 129, 763-783
28. Sparks, D. L., Anantharamaiah, G. M., Segrest, J. P., and Phillips, M. C. (1995) J. Biol. Chem. 270, 5151-5157
29. Sakr, S. W., Williams, D. L., Stoudt, G. W., Phillips, M. C., and Rothblat, G. H. (1999) Biochim. Biophys. Acta 1438, 85-98
30. Banka, C. L., Bonnet, D. J., Black, A. S., Smith, R. S., and Curtiss, L. K. (1991) J. Biol. Chem. 266, 23886-23892
31. Meng, Q. H., Calabresi, L., Fruchart, J. C., and Marcel, Y. L. (1993) J. Biol. Chem. 268, 16966-16973
32. Uboldi, P., Spoladore, M., Fantappiè, S., Marcovina, S., and Catapano, A. L. (1996) J. Lipid Res. 37, 2557-2568
33. Dhoest, A., Zhao, Z. A., De Geest, B., Deridder, E., Sillen, A., Engelborghs, Y., Collen, D., and Holvoet, P. (1997) J. Biol. Chem. 272, 15967-15972
34. Lindholm, E. M., Bielicki, J. K., Curtiss, L. K., Rubin, E. M., and Forte, T. M. (1998) Biochemistry 37, 4863-4868
35. Frank, P. G., N'Guyen, D., Franklin, V., Neville, T., Desforges, M., Rassart, E., Sparks, D. L., and Marcel, Y. L. (1998) Biochemistry 37, 13902-13909
36. Sorci-Thomas, M. G., Curtiss, L., Parks, J. S., Thomas, M. J., Kearns, M. W., and Landrum, M. (1998) J. Biol. Chem. 273, 11776-11782
37. Sviridov, D., Hoang, A., Sawyer, W. H., and Fidge, N. H. (2000) J. Biol. Chem. 275, 19707-19712
38. Roosbeek, S., Vanloo, B., Duverger, N., Caster, H., Breyne, J., De, B. I., Patel, H., Vandekerckhove, J., Shoulders, C., Rosseneu, M., and Peelman, F. (2001) J. Lipid Res. 42, 31-40
39. Holvoet, P., De Geest, B., Van Linthout, S., Lox, M., Danloy, S., Raes, K., and Collen, D. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 459-466
40. Sorci-Thomas, M. G., Thomas, M., Curtiss, L., and Landrum, M. (2000) J. Biol. Chem. 275, 12156-12163
41. Collet, X., Marcel, Y. L., Tremblay, N., Lazure, C., Milne, R. W., Perret, B., and Weech, P. K. (1997) J. Lipid Res. 38, 634-644
42. Sparks, D. L., Frank, P. G., and Neville, T. (1998) Biochim. Biophys. Acta 1390, 160-172
43. Seidah, N. G., and Chretien, M. (1999) Brain Res. 848, 45-62
44. Rubin, E. M., Ishida, B. Y., Clift, S. M., and Krauss, R. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 434-438
45. Pirillo, A., and Ghiselli, G. (2000) Biochem. Biophys. Res. Commun. 271, 386-391
46. Lindstedt, L., Saarinen, J., Kalkkinen, N., Welgus, H., and Kovanen, P. T. (1999) J. Biol. Chem. 274, 22627-22634
47. Mendez, A. J., and Oram, J. F. (1997) Biochim. Biophys. Acta 1346, 285-299
48. Von Eckardstein, A., Nofer, J. R., and Assmann, G. (2001) Arterioscler. Thromb. Vasc. Biol. 21, 13-27
49. Lee, M., Uboldi, P., Giudice, D., Catapano, A. L., and Kovanen, P. T. (2000) J. Lipid Res. 41, 975-984
50. Brinton, E. A., Eisenberg, S., and Breslow, J. L. (1989) J. Clin. Invest. 84, 262-269
51. Velez-Carrasco, W., Lichtenstein, A. H., Li, Z., Dolnikowski, G. G., Lamon-Fava, S., Welty, F. K., and Schaefer, E. J. (2000) Arterioscler. Thromb. Vasc. Biol. 20, 801-806
52. Assmann, G., Von Eckardstein, A., and Funke, H. (1993) Circulation 87 Suppl. 3, 28-34
53. Bruckert, E., Von Eckardstein, A., Funke, H., Beucler, I., Wiebusch, H., Turpin, G., and Assmann, G. (1997) Atherosclerosis 128, 121-128
54. Deeb, S. S., Cheung, M. C., Peng, R., Wolf, A. C., Stern, R., Albers, J. J., and Knopp, R. H. (1991) J. Biol. Chem. 266, 13654-13660
55. Miller, M., Aiello, D., Pritchard, H., Friel, G., and Zeller, K. (1998) Arterioscler. Thromb. Vasc. Biol. 18, 1242-1247
56. Rosseneu, M., and Labeur, C. (1995) FASEB J. 9, 768-776
57. Von Eckardstein, A., Funke, H., Henke, A., Altland, K., Benninghoven, A., and Assmann, G. (1989) J. Clin. Invest. 84, 1722-1730
58. Daum, U., Leren, T. P., Langer, C., Chirazi, A., Cullen, P., Pritchard, P. H., Assmann, G., and Von Eckardstein, A. (1999) J. Lipid Res. 40, 486-494
59. Daum, U., Langer, C., Duverger, N., Emmanuel, F., Benoit, P., Denèfle, P., Chirazi, A., Cullen, P., Pritchard, P. H., Bruckert, E., Assmann, G., and Von Eckardstein, A. (1999) J. Mol. Med. 77, 614-622
60. Weisgraber, K. H., Bersot, T. P., Mahley, R. W., Franceschini, G., and Sirtori, C. R. (1980) J. Clin. Invest. 66, 901-907


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Lipid Res.Home page
J. S. Owen, M. S. Bharadwaj, M. J. Thomas, S. Bhat, M. P. Samuel, and M. G. Sorci-Thomas
Ratio determination of plasma wild-type and L159R apoA-I using mass spectrometry: tools for studying apoA-IFin
J. Lipid Res., January 1, 2007; 48(1): 226 - 234.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Zheng, R. S. Kiss, V. Franklin, M.-D. Wang, B. Haidar, and Y. L. Marcel
ApoA-I Lipidation in Primary Mouse Hepatocytes: SEPARATE CONTROLS FOR PHOSPHOLIPID AND CHOLESTEROL TRANSFERS
J. Biol. Chem., June 3, 2005; 280(22): 21612 - 21621.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
S. Bhat, M. Zabalawi, M. C. Willingham, G. S. Shelness, M. J. Thomas, and M. G. Sorci-Thomas
Quality control in the apoA-I secretory pathway: deletion of apoA-I helix 6 leads to the formation of cytosolic phospholipid inclusions
J. Lipid Res., July 1, 2004; 45(7): 1207 - 1220.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Kiss, D. C. McManus, V. Franklin, W. L. Tan, A. McKenzie, G. Chimini, and Y. L. Marcel
The Lipidation by Hepatocytes of Human Apolipoprotein A-I Occurs by Both ABCA1-dependent and -independent Pathways
J. Biol. Chem., March 14, 2003; 278(12): 10119 - 10127.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Parolini, G. Chiesa, Y. Zhu, T. Forte, S. Caligari, E. Gianazza, M. G. Sacco, C. R. Sirtori, and E. M. Rubin
Targeted Replacement of Mouse Apolipoprotein A-I with Human ApoA-I or the Mutant ApoA-IMilano. EVIDENCE OF APOA-IM IMPAIRED HEPATIC SECRETION
J. Biol. Chem., February 7, 2003; 278(7): 4740 - 4746.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Andreola, V. Bellotti, S. Giorgetti, P. Mangione, L. Obici, M. Stoppini, J. Torres, E. Monzani, G. Merlini, and M. Sunde
Conformational Switching and Fibrillogenesis in the Amyloidogenic Fragment of Apolipoprotein A-I
J. Biol. Chem., January 17, 2003; 278(4): 2444 - 2451.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. R. Scott, D. C. McManus, V. Franklin, A. G. McKenzie, T. Neville, D. L. Sparks, and Y. L. Marcel
The N-terminal Globular Domain and the First Class A Amphipathic Helix of Apolipoprotein A-I Are Important for Lecithin:Cholesterol Acyltransferase Activation and the Maturation of High Density Lipoprotein in Vivo
J. Biol. Chem., December 21, 2001; 276(52): 48716 - 48724.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/24/21292    most recent
M100463200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McManus, D. C.
Right arrow Articles by Marcel, Y. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McManus, D. C.
Right arrow Articles by Marcel, Y. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement