Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M102076200 on April 9, 2001

J. Biol. Chem., Vol. 276, Issue 25, 22278-22286, June 22, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/22278    most recent
M102076200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chetyrkin, S. V.
Right arrow Articles by Kedishvili, N. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chetyrkin, S. V.
Right arrow Articles by Kedishvili, N. Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Characterization of a Novel Type of Human Microsomal 3alpha -Hydroxysteroid Dehydrogenase

UNIQUE TISSUE DISTRIBUTION AND CATALYTIC PROPERTIES*

Sergei V. Chetyrkin, Olga V. Belyaeva, Wendy H. GoughDagger, and Natalia Y. Kedishvili§

From the Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, Missouri 64110

Received for publication, March 8, 2001, and in revised form, April 6, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We report characterization of a novel member of the short chain dehydrogenase/reductase superfamily. The 1513-base pair cDNA encodes a 319-amino acid protein. The corresponding gene spans over 26 kilobase pairs on chromosome 2 and contains five exons. The recombinant protein produced using the baculovirus system is localized in the microsomal fraction of Sf9 cells and is an integral membrane protein with cytosolic orientation of its catalytic domain. The enzyme exhibits an oxidoreductase activity toward hydroxysteroids with NAD+ and NADH as the preferred cofactors. The enzyme is most efficient as a 3alpha -hydroxysteroid dehydrogenase, converting 3alpha -tetrahydroprogesterone (allopregnanolone) to dihydroprogesterone and 3alpha -androstanediol to dihydrotestosterone with similar catalytic efficiency (Vmax values of 13-14 nmol/min/mg microsomal protein and Km values of 5-7 µM). Despite ~44-47% sequence identity with retinol/3alpha -hydroxysterol dehydrogenases, the enzyme is not active toward retinols. The corresponding message is abundant in human trachea and is present at lower levels in the spinal cord, bone marrow, brain, heart, colon, testis, placenta, lung, and lymph node. Thus, the new short chain dehydrogenase represents a novel type of microsomal NAD+-dependent 3alpha -hydroxysteroid dehydrogenase with unique catalytic properties and tissue distribution.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Oxidation and reduction of hydroxyl and ketone groups in position 3 on naturally occurring steroids play an important role in regulation of intracellular levels of biologically active steroid hormones. For example, in gonads, 3alpha -hydroxysteroid oxidoreductase activity is responsible for maintaining the balance between a potent androgen, 5alpha -dihydrotestosterone, with a ketone group in position 3 and a weak androgen, 3alpha -androstanediol, which has a hydroxyl group in the same position (Fig. 1; reviewed in Ref. 1). In the central nervous system, 3alpha -hydroxysteroid oxidoreductase activity controls the amount of a potent neurosteroid, 3alpha -tetrahydroprogesterone (also called allopregnanolone), which serves as an allosteric regulator of all gamma -aminobutyric acid type A receptors and potentiates gamma -aminobutyric acid mediated chloride conductance (1). 3alpha -Hydroxysteroid oxidoreductase activity has been described in the cytosolic and microsomal fractions of a number of human and animal tissues (2-11). In addition to the different subcellular localization, cytosolic and microsomal enzymes appear to have a distinctively different cofactor preference. Cytosolic 3alpha -hydroxysteroid oxidoreductases exhibit a preference for the phosphorylated nucleotides as cofactors (NADP+/NADPH), whereas microsomal enzymes prefer NAD+/NADH (2-11). Because the predominant forms of nucleotide cofactors in the cells are NAD+ and NADPH, it is generally believed that the NAD+-dependent dehydrogenases function mainly in the oxidative direction, whereas the NADPH-dependent enzymes function as reductases (12). Thus, the balance between the oxidative and reductive activities will determine the local concentrations of bioactive compounds in specific tissues. To date, at least four types of cytosolic 3alpha -hydroxysteroid dehydrogenases (HSDs)1 have been identified in humans (1, 13, 14). All four cytosolic enzymes, named AKR1C1-AKR1C4, are members of the aldo-ketoreductase gene superfamily and prefer NADPH as cofactor (13). Liver is the only tissue that contains all four isoforms at similar levels (13). Extrahepatic tissues such as lung, prostate, uterus, mammary gland, brain, small intestine, and testis vary significantly in their composition and relative amounts of individual isoforms (13).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Metabolic pathways of steroids used to characterize substrate specificity of 3alpha -HSD. 3alpha -Adiol, 3alpha -androstanediol; ADT, androsterone; DHT, dihydrotestosterone; Dione, androstanedione; Allo-P, allopregnanolone; DHP, dihydroprogesterone; Iso-P, isopregnanolone.

The identity of the enzymes responsible for the NAD+-dependent 3alpha -hydroxysteroid oxidoreductase activity found in microsomes has remained elusive until recently, when several newly discovered members of the short chain dehydrogenase/reductase superfamily were shown to stereospecifically oxidize the 3alpha -hydroxyl group on 3alpha -androstanediol (15-20) and allopregnanolone (21, 22). In contrast to cytosolic 3alpha -HSDs, these membrane-bound short chain dehydrogenases exhibit a strong preference for NAD+ as cofactor. Previously, we characterized the properties of two human microsomal short chain dehydrogenases that are capable of oxidizing 3alpha -androstanediol to 5alpha -dihydrotestosterone and allopregnanolone to 5alpha -dihydroprogesterone (20, 21). The range of potential physiological substrates for these enzymes (RoDH-4 and RoDH-like 3alpha -HSD) is not limited to 3alpha -hydroxysteroids because they can also oxidize all-trans-retinol and might contribute to the biosynthesis of a potent morphogen, all-trans-retinoic acid (20, 21).

Besides RoDH-4 and RoDH-like 3alpha -HSD, human cis-retinol dehydrogenase Rdh5 was also shown to oxidize 3alpha -hydroxysteroids, although with lower catalytic efficiency than cis-retinols (16). Rdh5 was found to localize on the lumenal side of the endoplasmic reticulum (23) and was implicated in the biosynthesis of 11-cis-retinal (24), the cofactor for vision, and 9-cis-retinoic acid, the activating ligand for retinoid X receptors (25). The three human retinol/sterol dehydrogenases share ~50% amino acid sequence identity, similar genomic structure, and chromosomal localization on chromosome 12 (26-28). Individual enzymes exhibit distinctively different tissue distribution patterns. RoDH-4 is primarily expressed in human liver and skin (20, 29). RoDH-like 3alpha -HSD is present in liver, lung, prostate, testis, spleen (15), spinal cord (21), and various areas of human brain (21). Rdh5 appears to be ubiquitously expressed in a wide variety of tissues: liver, mammary gland, colon, thymus, small intestine, kidney, and others. (16, 25). Remarkably, liver contains the highest levels of mRNAs for all three enzymes. Here, we report molecular cloning and characterization of a novel human 3alpha -hydroxysteroid dehydrogenase. We show that, in contrast to the previously identified enzymes, this human 3alpha -hydroxysteroid dehydrogenase is not active toward retinoids and exhibits different membrane topology as well as different tissue distribution.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning of the Full-length cDNA-- cDNA clone W17165 was identified in the expressed sequence tag data base of GenBankTM based on its similarity to human RoDH-4 cDNA. Sequencing of the clone obtained from American Type Culture Collection revealed that it lacked the 5'-end (started at nucleotide 346 in Fig. 2). The missing part was obtained by rapid amplification of cDNA ends (RACE) using 5'-RACE-ready human liver cDNA (CLONTECH) as template. The internal gene-specific primers (TGACATTCTCTGGGTCGGTCA and TCTTCACCCACTGGGCAGTC; both antisense; indicated by arrows in Fig. 2) were designed based on the 5'-end sequence of clone W17165. The gene-specific primers were paired with the anchor primer (CLONTECH), and the cDNA was amplified in two sequential reactions using Taq polymerase (PerkinElmer Life Sciences). The amplifications were performed for 30 cycles as follows: denaturing at 94 °C for 1 min, annealing at 60 °C for 1 min, and extension at 72 °C for 5 min. The ~400-base pair cDNA product was subcloned into M13mp18 and sequenced. This cDNA fragment encoded amino acids 1-90 and contained 153 base pairs of the 5'-untranslated region (Fig. 2). The complete nucleotide sequence was submitted to GenBankTM with accession number AF343729.


View larger version (74K):
[in this window]
[in a new window]
 
Fig. 2.   cDNA sequence and deduced protein sequence of human microsomal 3alpha -HSD. Numbers on the right correspond to nucleotide sequence (italic) and amino acid sequence. The termination codon is indicated by an asterisk. The sequences of primers used to obtain the 5'-RACE PCR product are underlined by arrows.

To obtain the full-length cDNA, human liver and heart mRNAs were amplified by PCR using Pfu polymerase (Stratagene Cloning Systems, La Jolla, CA) and primers GGGGGATCCATGCTCTTTTGGGTGCTAGG (sense primer; the BamHI site is underlined) and TTAGAATTCTCACACTGCCTTGGGATTAG (antisense primer; the EcoRI site is underlined). Thirty cycles of amplification were performed as follows: denaturing at 94 °C for 45 s, annealing at 55 °C for 45 s, and extension at 72 °C for 6 min. The amplified cDNAs were subcloned into BamHI/EcoRI restriction sites of pVL1393 transfer vector (PharMingen, San Diego, CA). The transfer vectors were sequenced to verify the cDNA sequence of the gene of interest. The sequences of the cDNAs obtained from liver and heart were identical. The structure of the corresponding gene was determined by searching Human Genome GenBankTM data base using the full-length cDNA sequence and the BLAST 2.0 homology search tool.

Northern Blot Analysis-- The following multiple tissue mRNA blots (MTNs) were used for Northern blot analysis: Human 12-lane MTN Blot, Human 12-lane MTN Blot II, and Human Endocrine System MTN Blot from CLONTECH, which contained a minimum of 1 µg of polyadenylated RNA per lane. The blots were hybridized with ~1.0-kilobase pair 32P-labeled cDNA probe in ExpressHyb hybridization solution (CLONTECH) according to the manufacturer's instructions. Briefly, the blots were prehybridized in ExpressHyb solution for 30 min at 68 °C and transferred to a fresh solution containing 2 × 106 cpm/ml denatured radiolabeled cDNA. The hybridization was performed at 68 °C for 1 h. The blots were rinsed in 2× SSC, 0.05% SDS several times at room temperature and washed in 0.1× SSC, 0.1% SDS for 10 min at 50 °C. The mRNA bands were visualized by exposure to x-ray film at -70 °C with two intensifying screens for 1-10 days.

Expression in Sf9 Cells-- Expression of the cDNA in Sf9 cells was performed essentially as described previously (20). To produce recombinant protein, Sf9 cells were infected at a virus/cell ratio of 10:1. Cells were collected after 3 days of incubation at 27 °C, resuspended in 0.01 M potassium phosphate, pH 7.4, 0.25 M sucrose, 0.1 mM EDTA, 1 mM dithiothreitol, and protease inhibitors (1.5 µg/ml aprotinin, 1.5 µg/ml leupeptins, and 1.0 µg/ml pepstatin A), and homogenized using a French pressure cell. The unbroken cells, cellular debris, and nuclei were removed by centrifugation at 1000 × g for 10 min, and then mitochondria were removed by centrifugation at 10,000 × g for 30 min. Microsomes were pelleted by centrifugation at 105,000 × g for 1 h through a 0.6 M sucrose cushion and resuspended in 90 mM potassium phosphate, pH 7.4, 40 mM KCl, 0.1 mM EDTA, 1 mM dithiothreitol, and 20% glycerol. Protein concentration was determined by the method of Lowry et al. (30) using bovine serum albumin as a standard.

Alkaline Extraction and Western Blot Analysis-- Five-µl aliquots of microsomes (1.8 µg/µl) containing the recombinant protein were incubated with 100 µl of 100 mM sodium carbonate and 25 mM potassium acetate (extraction buffer) or with phosphate-buffered saline (PBS), pH 7.4, or with 1-10% Triton X-100 in PBS for 30 min on ice. After incubation, samples were loaded onto 100-µl cushions of 0.5 M sucrose prepared in extraction buffer, PBS, or Triton/PBS and centrifuged for 1 h at 200,000 × g. Pellets were dissolved in 20 µl of SDS-polyacrylamide gel electrophoresis sample buffer. Supernatants were precipitated with an equal volume of ice-cold 50% trichloroacetic acid for 30 min on ice and centrifuged for 3 min at 12,000 × g. The resulting pellets were washed twice with ethyl ether, dried, and dissolved in 20 µl of SDS-polyacrylamide gel electrophoresis sample buffer. After separation in a 15% denaturing polyacrylamide gel, samples were transferred to Hybond-P membrane (Amersham Pharmacia Biotech). Protein was detected using the ECL Western blotting analysis system (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Rabbit antibodies raised against the N-terminal fragment of RoDH-like 3alpha -HSD were used as primary antibodies at a 1:3000 dilution in 3% bovine serum albumin, 20 mM Tris, pH 7.6, 137 mM NaCl, and 0.1% Tween 20. Visualization was performed using horseradish peroxidase-conjugated anti-rabbit antibodies (at a 1:10,000 dilution) and ECL Western blotting detection reagents (Amersham Pharmacia Biotech).

Identification of Reaction Products and Determination of Kinetic Constants-- All reactions were performed in 90 mM potassium phosphate, pH 7.4, and 40 mM KCl at 37 °C (reaction buffer) in siliconized glass tubes as described previously (20). Commercially available radiolabeled steroids (PerkinElmer Life Sciences; ~40-60 Ci/mmol each) were diluted with cold steroids (Steraloids Inc. (Newport, RI) and Sigma) dissolved in dimethyl sulfoxide (Me2SO). The 500-µl reactions (final concentration of Me2SO < 1%) were started with the addition of enzyme. After 15-60 min at 37 °C, steroids were extracted and separated by development in toluene:acetone (4:1) on silica gel TLC plates (Sigma). TLC plates containing 3H-labeled steroids were exposed to a PhosphorImager (Molecular Dynamics) tritium screen overnight and/or cut into 1-cm-wide sections, which were then counted in scintillation liquid (Bio-Safe II). Products of each reaction were identified by comparison with reference steroids. For determination of apparent Km values, six concentrations between 0.1 and 17.5 µM were used for allopregnanolone and dihydrotestosterone; and concentrations between 0.5 and 25 µM were used for androstanediol, androsterone, and dehydroepiandrosterone. The amount of product formed was less than 10% of the amount of substrate within the 15-min reaction time and was linearly proportional to the amount of microsomes added. A control without added cofactor was included with each experiment and subtracted from each experimental data point. The apparent Km values for oxidation of hydroxysteroids were determined at a fixed NAD+ concentration (1 mM), and the apparent Km value for reduction of dihydrotestosterone was determined at a fixed NADH concentration (1 mM). Each Km determination was repeated at least three times. The apparent Km values for cofactors were determined at a fixed saturating concentration of substrate with six concentrations of each cofactor (1-400 µM for NAD+ and 1-200 µM for NADH).

The activity with all-trans-retinol and 13-cis-retinol was determined in the same reaction buffer used for steroid assays. The reaction was allowed to proceed for 30 min at 37 °C, and the reaction products were extracted and analyzed by HPLC as described previously (21).

Coupled in Vitro Transcription/Translation and Protease Protection Assay-- The coding region of the cDNA was cloned into BamHI/EcoRI restriction sites of expression vector pT7/T3-19 (Ambion Inc., Austin, TX) under the control of T7 promoter. The cDNA for 11beta -HSD1 (31) was amplified from 5'-RACE-ready human liver cDNA using Pfu polymerase and primers GCTGGATCCGCCATGGCTTTTATGAAAAAATATCTC (sense primer) and AGGTCTAGACTACTTGTTTATGAATCTGTCC (antisense primer), which contained BamHI and XbaI restriction sites (underlined), respectively. The PCR product of expected size was cloned into pT7/T3-18 vector cleaved with BamHI and XbaI restriction endonucleases and sequenced to verify the fidelity of PCR amplification. The expression constructs were subjected to in vitro transcription by T7 RNA polymerase and translation in reticulocyte lysate in the presence or absence of dog pancreas microsomes (TNT Quick system; Promega) according to the manufacturer's instructions. In a typical assay, 0.5-1 µg of plasmid DNA, 20 µCi of [35S]methionine (Amersham Pharmacia Biotech), and 0.5-1 µl of canine pancreatic microsomal membranes (Promega) were incubated for 60-90 min at 30 °C in a final volume of 12.5 µl. Translocation of polypeptides to the lumenal side of the microsomes was assayed by proteinase K treatment. Equal aliquots of the in vitro transcription/translation product were incubated for 60 min on ice with or without 200 µg/ml proteinase K (Roche Molecular Biochemicals) in a final volume of 5 µl. Proteinase K was inactivated by the addition of 4 mM phenylmethylsulfonyl fluoride. Proteins were subjected to 12% SDS-polyacrylamide gel electrophoresis and analyzed by autoradiography.

Thirty µg of 3alpha -HSD-containing microsomes from Sf9 cells were incubated with or without proteinase K in the presence or absence of 1% CHAPS. Reactions were incubated at 37 °C for 15 min with various amounts of protease relative to microsomal protein (µg:µg) in a final reaction volume of 36 µl. The reaction was stopped by the addition of protease inhibitor phenylmethylsulfonyl fluoride to the final concentration of 2 mM. Samples of the reaction mixture were analyzed by Western blotting and by activity measurements using 5 µM androsterone as substrate.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Characterization of the Primary Structure and Genomic Organization-- The 1513-base pair cDNA shown in Fig. 2 was constructed from the overlapping sequences of the original clone W17165 (nucleotides 346-1513) and the 5'-RACE PCR product (nucleotides 1-449) obtained in this study (see "Experimental Procedures"). The open reading frame starts at nucleotide 154 and ends in a stop codon at nucleotide 1,113, resulting in a 319-amino acid-long polypeptide (Fig. 2). A search of the GenBankTM data base for homologous sequences revealed that three unpublished sequences exhibit similarity to the cDNA reported here: (a) human retinol dehydrogenase homolog gene (AF067174), (b) Homo sapiens retinol dehydrogenase homolog isoform-1 mRNA (AF240698), and (c) H. sapiens retinol dehydrogenase homolog isoform-2 mRNA (AF240697). The first cDNA is identical to segments 147-603 and 667-1513 in the cDNA shown in Fig. 2 but is missing a segment coding for 21 amino acids between Pro-150 and Val-172. Instead, in this position, it contains nucleotides 1-45 of the 5'-untranslated sequence joined with an unidentified 31-base pair fragment. Retinol dehydrogenase homolog isoform-1 lacks 120 base pairs coding for 40 amino acids between Glu-204 and Ser-246, whereas isoform-2 has an insertion of 113 nucleotides between positions 94 and 95 in the 5'-untranslated region (Fig. 2) as well as four mismatched nucleotides and one missing nucleotide, which causes a frameshift.

To obtain the full-length cDNA and further confirm the cDNA and deduced protein sequence, we performed PCR amplification of mRNA isolated from two human tissues, liver and heart, using gene-specific primers flanking the coding region. Sequencing of the PCR products showed that they were identical with the sequence in Fig. 2. Furthermore, a BLAST 2.0 search of the Human Genome data base revealed that the cDNA sequence determined in this study (AF343729) is 100% identical to five consecutive segments in the NCBI-assembled contig NT  005343 assigned to chromosome 2q31.1 (Fig. 3A). The corresponding gene spans over 26 kilobase pairs and does not appear to have pseudogenes. The proposed exon-intron boundaries follow the canonical GT/AG rule and are summarized in Table I.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3.   Genomic organization of 3alpha -HSD on chromosome 2 (A) and alignment of its amino acid sequence with related short chain dehydrogenases (B). The identical residues are indicated by asterisks. The cofactor binding site and the active site consensus sequences are boxed. The exon-intron junctions are highlighted in bold and are indicated by the breaks in the sequence.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Exon-intron junctions of human microsomal 3alpha -HSD gene

The deduced protein sequence of the novel protein contains the signature cofactor binding motif G(X)3GXG at Gly-36 and the active site consensus sequence Y(X)3K at Tyr-176 characteristic of the short chain dehydrogenases/reductases. The amino acid sequence is most closely related to retinol/sterol dehydrogenases of the short chain dehydrogenase/reductase superfamily: (a) RoDH-4, 47% identity; (b) RoDH-like 3alpha -HSD, 43% identity; and (c) Rdh5, 44% identity. Furthermore, the positions of exon-intron junctions in the translated region of the novel gene and the sizes of exons 3 and 4 are identical to those in the genes for RoDH-4, RoDH-like 3alpha -HSD, and Rdh5 (Fig. 3B). However, the new gene is present on chromosome 2q31.1, whereas retinol/sterol dehydrogenases are clustered on chromosome 12q13 (28).

Tissue Distribution-- Tissue distribution of the corresponding message was examined by Northern blot analysis. Hybridization of pre-made Northern blots with radiolabeled cDNA revealed that the message for the putative short chain dehydrogenase is present in a number of human tissues (Fig. 4). The most intense signal was observed in trachea. Relatively strong signals were detected in spinal cord, bone marrow, heart, and colon. Weaker bands were also present in lymph node, brain, lung, placenta, testis, prostate, and mammary gland. A total of three different-size mRNA species were detected, which exhibited tissue-specific expression. The longest mRNA species were detected in trachea, testis, and lung. An intermediate size mRNA was present in trachea, colon, placenta, lung, bone marrow, and lymph node, with trace amounts seen in mammary gland, prostate, and stomach. The shortest mRNA was detected in spinal cord, lymph node, brain, bone marrow, and heart.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 4.   Northern blot analysis of 3alpha -HSD distribution in human tissues. Human multiple tissue Northern blots (CLONTECH) containing a minimum of 1 µg polyadenylated RNA/lane were hybridized with human radiolabeled 3alpha -HSD cDNA at high stringency conditions. The blots were exposed to x-ray film for 1 day (the panel with uterus and trachea on the far left) and then re-exposed for 10 days (all other panels). The hybridized blots were stripped of residual radioactivity, reprobed with beta -actin cDNA, and exposed for 3 h (bottom panel). Positions of the size standards are indicated on the left.

Expression and Characterization of the Recombinant Enzyme-- To establish whether the novel cDNA codes for a functional enzyme, we expressed the corresponding protein using the baculovirus expression system. Similar to human retinol/sterol dehydrogenases, the recombinant protein was present in the microsomal fraction of Sf9 cells as indicated by Western blot analysis using antibodies against the conserved N-terminal cofactor-binding domain of retinol/sterol dehydrogenases. Under the same conditions, no protein bands were detected in microsomes isolated from Sf9 cells infected with wild-type virus, which did not express the recombinant protein (data not shown). To determine whether the new short chain dehydrogenase is an integral membrane protein, microsomal fraction from Sf9 cells that expressed the recombinant protein was subjected to alkaline and detergent extractions. Equal amounts of microsomes were incubated with either sodium carbonate buffer, pH 11.5 (alkaline extraction), Triton X-100/PBS (detergent extraction), or PBS, pH 7.4 (control) (Fig. 5). Extracted proteins were separated from membrane-bound proteins by ultracentrifugation and analyzed by Western blotting. As shown in Fig. 5, the recombinant protein remained membrane-bound after alkaline extraction but was partially solubilized by increasing concentration of a detergent, consistent with the behavior of an integral membrane protein.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5.   Alkaline extraction and Western blot analysis of recombinant 3alpha -HSD. Microsomal membranes containing 3alpha -HSD were extracted with 10% Triton X-100 in PBS (10% Tx-100), 1% Triton X-100 in PBS (1% Tx-100), sodium carbonate buffer, pH 11.5 (alkaline extraction), or PBS, pH 7.4 (PBS). Solubilized proteins (S) were separated from integral membrane proteins (P) by ultracentrifugation. Distribution of 3alpha -HSD between the soluble and the membrane-bound fractions was analyzed by Western blotting as described under "Experimental Procedures."

Next, we tested whether the putative short chain dehydrogenase is enzymatically active. Because its amino acid sequence showed the closest similarity to retinol/sterol dehydrogenases, we examined whether it possessed a hydroxysteroid dehydrogenase activity using reaction conditions established previously for RoDH-4 (20) and RoDH-like 3alpha -HSD (21). Microsomes were incubated with a number of tritiated steroid compounds for 1 h at 37 °C in the presence of 1 mM NAD+ or NADH. The reaction products were extracted, separated by TLC, and visualized using a PhosphorImager. At a 5 µM concentration of each substrate, the highest percentage of conversion in the oxidative direction in the presence of NAD+ was observed with 3alpha -hydroxysteroids, 3alpha -androstanediol and allopregnanolone (Fig. 6A). 3alpha -Androstanediol contains two hydroxyl groups in positions 3alpha and 17beta (Fig. 1). The enzyme possessed both 3alpha -HSD and 17beta -HSD activity, as evidenced by the appearance of androstanedione with ketone groups in positions 3 and 17 (Fig. 6A). To estimate the relative efficiency of the two activities, we used substrates that have only one hydroxyl group: 3alpha -hydroxyl (androsterone) or 17beta -hydroxyl (dihydrotestosterone) (Fig. 1). The 3alpha -hydroxyl group was oxidized much more efficiently (androsterone to androstanedione) than the 17beta -hydroxyl group (dihydrotestosterone to androstanedione). To evaluate the 3beta -HSD activity of the enzyme, we used dehydroepiandrosterone as substrate. As seen in Fig. 6A, no oxidation products of dehydroepiandrosterone were detected by autoradiography, indicating that the rate of conversion was not sufficient to detect the respective oxidation product.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6.   Analysis of the reaction products produced by 3alpha -HSD in the presence of NAD+ (A) or NADH (B). Control reactions performed in the absence of cofactor (-NAD+/-NADH) are shown next to the sample with the same substrate in the presence of cofactor. All reactions were allowed to proceed for 1 h at 37 °C. Substrates were used at a concentration of 5 µM. The microsomes were used at concentration of 25 µg/ml in the reaction volume. C, analysis of the endogenous activity of Sf9 microsomes isolated from cells infected with wild-type baculovirus toward dihydrotestosterone in the presence of NAD+ (+ NAD+) (17beta -dehydrogenase activity) or NADH (+ NADH) (3 keto-reductase activity). ADT, androsterone; DHT, dihydrotestosterone; ADIOL, 3alpha -androstanediol; DHEA, dehydroepiandrosterone; ALLO-P, allopregnanolone; ISO-P, isopregnanolone; DHP, dihydroprogesterone; DIONE, androstanedione.

One of the best substrates for the novel 3alpha -HSD in the oxidative direction was allopregnanolone (3alpha -tetrahydroprogesterone) (Fig. 6A). Interestingly, besides a significant amount of dihydroprogesterone with ketone group in position 3, an additional product, isopregnanolone (3beta -tetrahydroprogesterone), appeared in this reaction. This implied that the ketone group on carbon 3 of dihydroprogesterone could be reduced to either a 3alpha or 3beta -hydroxyl group. This type of activity was observed previously during prolonged incubations of RoDH-like 3alpha -HSD with allopregnanolone and NAD+ (22).

Analysis of the reaction products in the reductive direction in the presence of NADH showed that ketone group on carbon 3 was reduced to hydroxyl group with the highest catalytic efficiency (dihydrotestosterone to 3alpha /3beta -androstanediol) (Fig. 6B). The 17-ketone group on androsterone was also reduced, albeit at a much slower rate. To ensure that the observed 3beta - and 17beta -hydroxysteroid dehydrogenase activity was not due to endogenous activity of insect cell microsomes, we determined the activity of microsomes isolated from Sf9 cells that were infected with wild-type virus and did not express 3alpha -HSD. At a 5 µM substrate concentration, 0.2 pmol of androstanedione and 0.08 pmol of androstendione were formed by 3 µg of control microsomes from dihydrotestosterone and dehydroepiandrosterone, respectively, in the presence of NAD+. In contrast, the same amount of microsomes that contained 3alpha -HSD produced 199 pmol of androstanedione and 28 pmol of androstendione. The endogenous hydroxysteroid activity of Sf9 microsomes from the cells infected with wild-type virus was also tested using [14C]dihydrotestosterone in the presence of NAD+ (17beta -hydroxysteroid dehydrogenase activity) or NADH (3-keto reductase activity). As shown in Fig. 6C, no products were detected in the oxidative or the reductive direction. Based on this analysis, we concluded that all of the observed steroid conversions were catalyzed by the novel 3alpha -HSD.

Before measuring kinetic constants for oxidation and reduction of steroids, we determined whether NAD+ and NADH were, in fact, the preferred cofactors. In the oxidative direction, using 5 µM allopregnanolone as substrate, the reaction rate was 44-fold higher in the presence of 1 mM NAD+ than in the presence of 1 mM NADP+. In the reductive direction, using 10 µM dihydrotestosterone as substrate, the rate was 9-fold higher with 1 mM NADH than it was with 1 mM NADPH. Thus, NAD+ and NADH were the preferred cofactors. The apparent Km value for NAD+ determined with 20 µM allopregnanolone was 72.0 ± 5.0 µM. The apparent Km value for NADH determined with 25 µM dihydrotestosterone was 9.0 ± 0.5 µM.

Considering that multiple products are formed by the enzyme over long periods of incubation (or with high enzyme concentrations), we established conditions under which only one reaction product was formed. These conditions were used to determine kinetic constants for steroid substrates. Specifically, the apparent Km and Vmax values for allopregnanolone and 3alpha -androstanediol were measured when there was no detectable formation of secondary products (isopregnanolone and androstanedione, respectively). Consistent with autoradiography analysis of the reaction products, allopregnanolone and androstanediol were the best substrates in the oxidative direction with the apparent Km values of 5-7 µM (Table II). The apparent Km value for androsterone was ~5-fold higher (Table II). Kinetic analysis also showed that the enzyme was capable of binding 3beta -hydroxysteroid dehydroepiandrosterone; however, the rate of conversion was about 20-fold lower compared with that of allopregnanolone (Table II), which explains why the corresponding product could not be visualized using a PhosphorImager (Fig. 6A). Dihydrotestosterone (3-ketone group) was reduced to androstanediol with a catalytic efficiency similar to that for the oxidation of 3alpha -hydroxyl group (Table II).

                              
View this table:
[in this window]
[in a new window]
 
Table II
Kinetic constants for steroid substrates
Kinetic constants were measured in 90 mM potassium phosphate, pH 7.4, and 40 mM KCl at 37 °C. The Km value for dihydrotestosterone was determined with saturating 1 mM NADH, and the Km values for all other substrates were determined with saturating 1 mM NAD+.

To determine whether the new enzyme was active toward retinoids, we incubated 30-300 µg of microsomal membranes containing the recombinant protein with 10-50 µM all-trans-retinol or 13-cis-retinol in the presence of 1 mM NAD+. After a 30-min incubation at 37 °C, the reaction products were extracted and analyzed by HPLC as described previously (21). The amount of retinaldehyde formed was calculated from the calibration curve of the amount of pure retinal injected onto the column. Based on these measurements, 71 pmol were produced by 30 µg of microsomal protein over the 30-min incubation time from 10 µM retinol. For comparison, 9600 pmol of dihydroprogesterone would have been produced from 10 µM allopregnanolone by the same amount of protein under the identical conditions. Considering that the rate of retinol oxidation is at least 100 times lower than that of allopregnanolone, the new enzyme is not efficient as retinol dehydrogenase.

Transmembrane Topology of 3alpha -HSD-- Because we have established that the novel 3alpha -HSD is an integral membrane protein, we were interested in determining its transmembrane orientation. Analysis of its protein sequence for signature sites and motifs indicated that there is a potential N-terminal transmembrane segment (amino acids 2-17) as well as three potential N-glycosylation sites at Asn-161, Asn-187, and Asn-253. Because N-glycosylation is carried out exclusively on the luminal side of the endoplasmic reticulum, the appearance of protein species with higher subunit molecular weight in the presence of microsomes would indicate that they become glycosylated and were therefore exposed to the lumen.

To investigate the transmembrane topology of 3alpha -HSD, we used a coupled in vitro transcription/translation system and canine pancreatic microsomal membranes. 11beta -HSD1, a protein with known lumenal orientation and three glycosylation sites (32), served as a positive control for glycosylation. 3alpha -HSD was synthesized in vitro in the presence or absence of canine microsomes. Analysis of the reaction products showed that the size of 3alpha -HSD produced in the absence of microsomes was identical to that produced in the presence of microsomes, indicating that the three glycosylation sites in 3alpha -HSD were not glycosylated (Fig. 7A). At the same time, all three sites were glycosylated in the positive control, 11beta -HSD1 (Fig. 7A). Then, the reaction products were treated with proteinase K to determine whether the protein was translocated across the membrane and protected against the protease (see "Experimental Procedures"). In agreement with the lack of glycosylation, 3alpha -HSD produced in the presence of microsomes was not protected from proteinase K, whereas the glycosylated 11beta -HSD1 was fully protected. This outcome is consistent with the cytosolic orientation of 3alpha -HSD, in contrast to the lumenal orientation established for 11beta -HSD1 (32).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7.   Protease protection assay of 3alpha -HSD produced in vitro using coupled transcription/translation system (A) and of recombinant 3alpha -HSD in Sf9 cell-derived microsomes (B). A, proteins (3alpha -HSD and 11beta -HSD1) were produced in the presence (+) or absence (-) of canine pancreatic microsomes (Ms) and incubated with (+) or without (-) 200 µg/ml proteinase K (PK). Proteins were separated by 12% SDS-polyacrylamide gel electrophoresis, and dried gels were subjected to autoradiography. B, microsomal membranes isolated from Sf9 cells that express 3alpha -HSD (Prot) were incubated with proteinase K (PK) at various protein:protein ratios in the presence (+) or absence (-) of 1% CHAPS (CHAPS). Samples of the reactions were analyzed by Western blotting and activity assays (C). C, the residual 3alpha -HSD activity was determined using 5 µM androsterone as substrate. 100% activity corresponds to the activity of 3alpha -HSD incubated under the same conditions in the absence of proteinase K.

To obtain additional evidence for the cytosolic orientation of the new 3alpha -HSD, we incubated enzyme-containing microsomes from Sf9 cells with different concentrations of proteinase K in the presence or absence of 1% CHAPS and analyzed the residual activity and the amount of protein left after protease treatment. 3alpha -HSD was readily proteolysed by proteinase K in both the presence and absence of CHAPS, suggesting that the disruption of membrane integrity was not essential for proteolysis to occur (Fig. 7B). The activity of the enzyme incubated with proteinase K decreased from 1.87 nmol/min/mg microsomal protein (100%) to 0.86 nmol/min/mg microsomal protein (46%) at a 1:250 protease:microsomes ratio (µg:µg) (Fig. 7C). No change in either 3alpha -HSD activity or protein was observed in the absence of proteinase K. Based on the above experimental data, we conclude that the new short chain dehydrogenase is an integral membrane protein, which faces the cytosolic side of the microsomal membrane.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The novel 3alpha -HSD characterized in the present study exhibits less than 50% amino acid sequence identity to any known protein. It is most closely related to retinol/sterol dehydrogenases of the short chain dehydrogenase/reductase superfamily. Furthermore, the gene for 3alpha -HSD shares similar structural organization with the genes for retinol/sterol dehydrogenases (28). Some variation is observed in the length of exon 5, which is 1 amino acid longer that the corresponding exon in the Rdh5 gene and 2 amino acids longer than that in the RoDH-4 and RoDH-like 3alpha -HSD genes. Interestingly, 3alpha -HSD gene is found on a different chromosome and does not appear to have satellite pseudogenes like RoDH-4 and RoDH-like 3alpha -HSD genes (28), which might indicate that it appeared later in evolution.

Analysis of the sequences deposited in the GenBankTM expressed sequence tag data base showed that cDNA fragments identical to different segments of 3alpha -HSD cDNA were isolated from multiple sources: lymph node (nine reports), testis (three reports), normal colon and colon adenocarcinoma (three reports), cervical tumor (one report), breast (one report), uterus and endometrial adenocarcinoma (four reports), fetal lung (one report), pancreas adenocarcinoma (two reports), and lymphoma (one report). Thus, 3alpha -HSD appears to exhibit wide tissue distribution. Indeed, Northern blot analysis of human tissues revealed that 3alpha -HSD mRNA is present in the central nervous system and in a number of peripheral endocrine tissues. Interestingly, the size of the predominant mRNA species varied depending on the tissue source, suggesting that there might be a tissue-specific splicing of 3alpha -HSD mRNA. In fact, we found that the 113-nucleotide segment inserted in the 5'-untranslated sequence of a nearly identical clone submitted under the name of retinol dehydrogenase homolog isoform-2 (AF240697) is located within the 11,805-base pair sequence of putative intron 1. This observation suggests that alternatively spliced products may exist.

The most striking difference in the distribution pattern of the novel 3alpha -HSD compared with that of retinol/sterol dehydrogenases is that the 3alpha -HSD message is practically absent in liver. The lack of hybridization with the liver mRNA serves as a confirmation that the cDNA probe does not cross-hybridize with either RoDH-4 or RoDH-like 3alpha -HSD mRNA, both of which are very abundant in the liver.

The presence of 3alpha -HSD in the brain is consistent with its activity toward allopregnanolone, which serves as a potent allosteric regulator of gamma -aminobutyric acid type A receptors. Allopregnanolone is likely to be produced in the brain by cytosolic 3alpha -HSDs, AKR1C1 and AKR1C2, which catalyze the reduction of the 3-ketone group on dihydroprogesterone (13). The back-oxidation of allopregnanolone to dihydroprogesterone is thought to be catalyzed by an unidentified membrane-bound NAD+-dependent 3alpha -HSD (4, 5). Previously, we have reported that RoDH-like 3alpha -HSD is capable of oxidizing allopregnanolone and is expressed in various regions of the human brain and in the spinal cord (21), suggesting that it may function as allopregnanolone dehydrogenase in the central nervous system. This study shows that, in addition to RoDH-like 3alpha -HSD, the central nervous system contains a second isoform of microsomal oxidative 3alpha -HSD active toward allopregnanolone. Interestingly, similar to RoDH-like 3alpha -HSD (21, 22), the newly characterized enzyme exhibits "epimerase" activity toward allopregnanolone, slowly converting it to 3beta -hydroxysteroid isopregnanolone in the presence of NAD+. We have previously proposed that NADH, which is produced during oxidation of allopregnanolone, might be retained in the active site and trigger the nonstereospecific reduction of the 3-ketone group on dihydroprogesterone to both a 3alpha -hydroxyl and a 3beta -hydroxyl group. Consistent with this hypothesis, the new 3alpha -HSD exhibits a higher affinity for NADH than for NAD+ (the apparent Km value is 9 versus 72 µM), similar to RoDH-like 3alpha -HSD (0.18 versus 1.9 µM) (21). At the same time, RoDH-4, which has almost identical Km values for NAD+ (0.13 µM) and NADH (0.1 µM), does not seem to possess the epimerase activity.2 It should also be noted that, in addition to allopregnanolone, RoDH-like 3alpha -HSD epimerized androsterone into epiandrosterone. However, we did not observe epimerization of androsterone with the new 3alpha -HSD, possibly due to the 5-fold higher apparent Km value of the enzyme for androsterone compared with allopregnanolone.

Besides utilizing allopregnanolone as substrate, the new 3alpha -HSD is equally efficient at converting 3alpha -androstanediol into a potent androgen, dihydrotestosterone. This is consistent with the expression of the enzyme in testis and prostate. Previously, Biswas and Russell (15) proposed that RoDH-like 3alpha -HSD, which is expressed in prostate and testis, contributes to the back-oxidation of 3alpha -androstanediol to dihydrotestosterone in these tissues. This study shows that, in addition to RoDH-like 3alpha -HSD, dihydrotestosterone can be produced in testis and prostate by the novel isoform of 3alpha -HSD.

Similar to retinol/sterol dehydrogenases, 3alpha -HSD is an integral membrane protein. Therefore, depending on its transmembrane topology, the active site of the enzyme may be exposed either to the cytosol or to the lumen of the endoplasmic reticulum. This, in turn, may affect its access to the substrates and cofactors. Previous analysis of the transmembrane topology of Rdh5, which was proposed to catalyze the biosynthesis of 11-cis-retinaldehyde in retinal pigment epithelium, showed that Rdh5 is anchored to the membranes of smooth endoplasmic reticulum by two hydrophobic peptide segments (23). The catalytic domain of this enzyme is confined to the lumenal compartment, suggesting that generation of 11-cis-retinaldehyde occurs in the lumen of the endoplasmic reticulum (23). In contrast to Rdh5, 3alpha -HSD appears to be facing the cytosolic side of the membrane, indicating that it will utilize the cytosolic pool of steroids and nucleotides. In the liver cytosol, and presumably in other tissues, the NAD+:NADH ratio is about 1000, whereas the NADP+:NADPH ratio is about 0.01 (33). This suggests that the NAD+-preferring oxidoreductases, which face the cytosol like the new 3alpha -HSD, will function in the oxidative direction. The available substrate and cofactor pool for the lumenally oriented Rdh5, which also prefers NAD+ over NADP+ as cofactor (34), is less clear.

The existence of enzymes that share similar substrates but exhibit different transmembrane orientation is not unusual. For example, two other members of the short chain dehydrogenase/reductase superfamily, 11beta -HSD type 1 and type 2, which catalyze the interconversion between a potent glucocorticoid cortisol and a weak glucocorticoid cortisone, exhibit opposite transmembrane orientation: 11beta -HSD type 1 is a lumenally oriented glycoprotein, whereas 11beta -HSD type 2 faces the cytosol (32). Interestingly, these two enzymes exhibit a different cofactor preference: 11beta -HSD type 1 catalyzes oxidation and reduction using NADP(H) as cofactor, whereas 11beta -HSD type 2 is NAD+-specific and catalyzes only 11beta -dehydrogenation. This is in contrast to Rdh5 and 3alpha -HSD, which both appear to exhibit a cofactor preference for NAD+.

Besides the difference in the transmembrane topology and tissue distribution, 3alpha -HSD exhibits different substrate specificity compared with Rdh5 and the all-trans-retinol-oxidizing microsomal dehydrogenases, RoDH-4 and RoDH-like 3alpha -HSD. Rdh5 has similar affinity for retinoids (K0.5 of 6.3-6.6 µM for 9-cis and 11-cis-retinol) and 3alpha -androstanediol (K0.5 of 6.4 µM) (16) and is about two times more efficient as retinol dehydrogenase than as a steroid dehydrogenase. RoDH-4 and RoDH-like 3alpha -HSD occupy an intermediate position and are more efficient as 3alpha -hydroxysteroid dehydrogenases with apparent Km values of ~0.2 µM for 3alpha -hydroxysteroids (20, 21) while retaining the retinol-oxidizing capacity (Km value of 3.2 µM) (21). The new 3alpha -HSD is practically inactive with retinoid compounds and is most efficient as allopregnanolone and 3alpha -androstanediol dehydrogenase, representing the opposite end of the spectrum. Thus, experimental data obtained in this study suggest that the new member of the short chain dehydrogenase/reductase superfamily is a novel type of microsomal NAD+-dependent 3alpha -HSD with unique tissue distribution, transmembrane topology, and catalytic properties.

    ACKNOWLEDGEMENT

We thank Dr. Kirill Popov (Division of Molecular Biology and Biochemistry, University of Missouri-Kansas City, Kansas City, MO) for helpful discussions and critical reading of the manuscript.

    FOOTNOTES

* This work was supported by the National Institute on Alcohol Abuse and Alcoholism Grants AA00221 and AA12153 (to N. Y. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF343729.

Dagger Present address: Eli Lilly and Co., Lilly Corporate Center, Indianapolis, IN 46285.

§ To whom correspondence should be addressed: Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, 5007 Rockhill Rd., 103 BSB, Kansas City, MO 64110. Tel.: 816-235-2658; Fax: 816-235-5595; E-mail kedishvilin@umkc.edu.

Published, JBC Papers in Press, April 9, 2001, DOI 10.1074/jbc.M102076200

2 S. V. Chetyrkin, and N. Y. Kedishvili, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: HSD, hydroxysteroid dehydrogenase; CHAPS, (3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonate; HPLC, high performance liquid chromatography; RACE, rapid amplification of cDNA ends; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; RODH, retinol dehydrogenase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Penning, T. M., Pawlowski, J. E., Schlegel, B. P., Jez, J. M., Lin, H. K., Hoog, S. S., Bennett, M. J., and Lewis, M. (1996) Steroids 61, 508-523
2. Verhoeven, G., Heyns, W., and De Moor, P. (1977) J. Steroid Biochem. 8, 731-733
3. Verhoeven, G., Heyns, W., and De Moor, P. (1976) Eur. J. Biochem. 65, 565-576
4. Krause, J. E., and Karavolas, H. J. (1980) J. Biol. Chem. 255, 11807-11814
5. Krause, J. E., and Karavolas, H. J. (1981) J. Steroid Biochem. 14, 63-69
6. Pirog, E. C., and Collins, D. C. (1994) Steroids 59, 259-264
7. Span, P. N., Sweep, C. G. J., Benraad, Th. J., and Smals, A. G. H. (1996) J. Steroid Biochem. Mol. Biol. 58, 319-324
8. Li, X., Bertics, P. J., and Karavolas, H. J. (1997) J. Steroid Biochem. Mol. Biol. 60, 311-318
9. Dombroski, R. A., Casey, M. L., and MacDonald, P. C. (1997) J. Steroid Biochem. Mol. Biol. 63, 155-163
10. Pirog, E. C., and Collins, D. C. (1999) J. Clin. Endocrinol. Metab. 84, 3217-3221
11. Ge, R. S., Hardy, D. O., Catterall, J. F., and Hardy, M. P. (1999) Biol. Reprod. 60, 855-860
12. Labrie, F., Luu-The, V., Lin, S.-X., Labrie, C., Simard, J., Breton, R., and Belanger, A. (1997) Steroids 62, 148-158
13. Penning, T. M., Burczynski, M. E., Jez, J. M., Hung, C. F., Lin, H. K., Ma, H., Moore, M., Palackal, N., and Ratnam, K. (2000) Biochem. J. 351, 67-77
14. Khanna, M., Qin, K. N., Wang, R. W., and Cheng, K. C. (1995) J. Biol. Chem. 270, 20162-20168
15. Biswas, M. G., and Russell, D. W. (1997) J. Biol. Chem. 272, 15959-15966
16. Wang, J., Chai, X., Eriksson, U., and Napoli, J. L. (1999) Biochem. J. 338, 23-27
17. Chai, X., Zhai, Y., and Napoli, J. L. (1997) J. Biol. Chem. 272, 33125-33131
18. Su, J., Chai, X., Kahn, B., and Napoli, J. L. (1998) J. Biol. Chem. 273, 17910-17916
19. Su, J., Lin, M., and Napoli, J. L. (1999) Endocrinology 140, 5275-5284
20. Gough, W. H., Van Ooteghem, S., Sint, T., and Kedishvili, N. Y. (1998) J. Biol. Chem. 273, 19778-19785
21. Chetyrkin, S. V., Hu, J., Gough, W. H., Dumaual, N., and Kedishvili, N. Y. (2001) Arch. Biochem. Biophys. 386, 1-10
22. Huang, X. F., and Luu-The, V. (2000) J. Biol. Chem. 275, 29452-29457
23. Simon, A., Romert, A., Gustafson, A. L., McCaffery, J. M., and Eriksson, U. (1999) J. Cell Sci. 112, 549-558
24. Yamamoto, H., Simon, A., Eriksson, U., Harris, E., Berson, E. L., and Dryja, T. P. (1999) Nat. Genet. 22, 188-191
25. Mertz, J. R., Shang, E., Piantedosi, R., Wei, S., Wolgemuth, D. J., and Blaner, W. S. (1997) J. Biol. Chem. 272, 11744-11749
26. Simon, A., Lagercrantz, J., Bajalica-Lagercrantz, S., and Eriksson, U. (1996) Genomics 36, 424-430
27. Gamble, M. V., Shang, E., Zott, R. P., Mertz, J. R., Wolgemuth, D. J., and Blaner, W. S. (1999) J. Lipid Res. 40, 2279-2292
28. Kedishvili, N. Y., Belyaeva, O. V., and Gough, W. H. (2000) Chem. Biol. Interact. 130, 457-467
29. Jurukovski, V., Markova, N. G., Karaman-Jurukovska, N., Randolph, R. K., Su, J., Napoli, J. L., and Simon, M. (1999) Mol. Genet. Metab. 67, 62-73
30. Lowry, O. H., Rosebrough, N. H., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275
31. Tannin, G. M., Agarwal, A. K., Monder, C., New, M. I., and White, P. C. (1991) J. Biol. Chem. 266, 16653-16658
32. Odermatt, A., Arnold, P., Stauffer, A., Frey, B. M., and Frey, F. J. (1999) J. Biol. Chem. 274, 28762-28770
33. Veech, R. L., Eggleston, L. V., and Krebs, H. A. (1969) Biochem. J. 115, 609-619
34. Simon, A., Hellman, U., Wernstedt, C., and Eriksson, U. (1995) J. Biol. Chem. 270, 1107-1112


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
M. Zhang, P. Hu, C. R. Krois, M. A. Kane, and J. L. Napoli
Altered vitamin A homeostasis and increased size and adiposity in the rdh1-null mouse
FASEB J, September 1, 2007; 21(11): 2886 - 2896.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
O. V. Belyaeva, S. V. Chetyrkin, A. L. Clark, N. V. Kostereva, K. S. SantaCruz, B. M. Chronwall, and N. Y. Kedishvili
Role of Microsomal Retinol/Sterol Dehydrogenase-Like Short-Chain Dehydrogenases/Reductases in the Oxidation and Epimerization of 3{alpha}-Hydroxysteroids in Human Tissues
Endocrinology, May 1, 2007; 148(5): 2148 - 2156.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Jones, S. Dickerson, P. M. Bhende, H.-J. Delecluse, and S. C. Kenney
Epstein-Barr Virus Lytic Infection Induces Retinoic Acid-responsive Genes through Induction of a Retinol-metabolizing Enzyme, DHRS9
J. Biol. Chem., March 16, 2007; 282(11): 8317 - 8324.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. True, I. Coleman, S. Hawley, C.-Y. Huang, D. Gifford, R. Coleman, T. M. Beer, E. Gelmann, M. Datta, E. Mostaghel, et al.
A molecular correlate to the Gleason grading system for prostate adenocarcinoma
PNAS, July 18, 2006; 103(29): 10991 - 10996.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. R. Bauman, S. Steckelbroeck, M. V. Williams, D. M. Peehl, and T. M. Penning
Identification of the Major Oxidative 3{alpha}-Hydroxysteroid Dehydrogenase in Human Prostate That Converts 5{alpha}-Androstane-3{alpha},17{beta}-diol to 5{alpha}-Dihydrotestosterone: A Potential Therapeutic Target for Androgen-Dependent Disease
Mol. Endocrinol., February 1, 2006; 20(2): 444 - 458.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. D. Nadauld, D. N. Shelton, S. Chidester, H. J. Yost, and D. A. Jones
The Zebrafish Retinol Dehydrogenase, rdh1l, Is Essential for Intestinal Development and Is Regulated by the Tumor Suppressor Adenomatous Polyposis Coli
J. Biol. Chem., August 26, 2005; 280(34): 30490 - 30495.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. D. Nadauld, I. T. Sandoval, S. Chidester, H. J. Yost, and D. A. Jones
Adenomatous Polyposis Coli Control of Retinoic Acid Biosynthesis Is Critical for Zebrafish Intestinal Development and Differentiation
J. Biol. Chem., December 3, 2004; 279(49): 51581 - 51589.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Jette, P. W. Peterson, I. T. Sandoval, E. J. Manos, E. Hadley, C. M. Ireland, and D. A. Jones
The Tumor Suppressor Adenomatous Polyposis Coli and Caudal Related Homeodomain Protein Regulate Expression of Retinol Dehydrogenase L
J. Biol. Chem., August 13, 2004; 279(33): 34397 - 34405.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Steckelbroeck, Y. Jin, S. Gopishetty, B. Oyesanmi, and T. M. Penning
Human Cytosolic 3{alpha}-Hydroxysteroid Dehydrogenases of the Aldo-keto Reductase Superfamily Display Significant 3{beta}-Hydroxysteroid Dehydrogenase Activity: IMPLICATIONS FOR STEROID HORMONE METABOLISM AND ACTION
J. Biol. Chem., March 12, 2004; 279(11): 10784 - 10795.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Wood, V. L. Nelson, C. Ho, E. Jansen, C. Y. Wang, M. Urbanek, J. M. McAllister, S. Mosselman, and J. F. Strauss III
The Molecular Phenotype of Polycystic Ovary Syndrome (PCOS) Theca Cells and New Candidate PCOS Genes Defined by Microarray Analysis
J. Biol. Chem., July 11, 2003; 278(29): 26380 - 26390.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
B. N. Rexer and D. E. Ong
A Novel Short-Chain Alcohol Dehydrogenase from Rats with Retinol Dehydrogenase Activity, Cyclically Expressed in Uterine Epithelium
Biol Reprod, November 1, 2002; 67(5): 1555 - 1564.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Y. Kedishvili, O. V. Chumakova, S. V. Chetyrkin, O. V. Belyaeva, E. A. Lapshina, D. W. Lin, M. Matsumura, and P. S. Nelson
Evidence That the Human Gene for Prostate Short-chain Dehydrogenase/Reductase (PSDR1) Encodes a Novel Retinal Reductase (RalR1)
J. Biol. Chem., August 2, 2002; 277(32): 28909 - 28915.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/22278    most recent
M102076200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chetyrkin, S. V.
Right arrow Articles by Kedishvili, N. Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chetyrkin, S. V.
Right arrow Articles by Kedishvili, N. Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement