|
Originally published In Press as doi:10.1074/jbc.M102076200 on April 9, 2001
J. Biol. Chem., Vol. 276, Issue 25, 22278-22286, June 22, 2001
Characterization of a Novel Type of Human Microsomal
3 -Hydroxysteroid Dehydrogenase
UNIQUE TISSUE DISTRIBUTION AND CATALYTIC PROPERTIES*
Sergei V.
Chetyrkin,
Olga V.
Belyaeva,
Wendy H.
Gough , and
Natalia Y.
Kedishvili§
From the Division of Molecular Biology and Biochemistry, School of
Biological Sciences, University of Missouri-Kansas City, Kansas City,
Missouri 64110
Received for publication, March 8, 2001, and in revised form, April 6, 2001
 |
ABSTRACT |
We report characterization of a novel
member of the short chain dehydrogenase/reductase superfamily. The
1513-base pair cDNA encodes a 319-amino acid protein. The
corresponding gene spans over 26 kilobase pairs on chromosome 2 and
contains five exons. The recombinant protein produced using the
baculovirus system is localized in the microsomal fraction of
Sf9 cells and is an integral membrane protein with cytosolic
orientation of its catalytic domain. The enzyme exhibits an
oxidoreductase activity toward hydroxysteroids with
NAD+ and NADH as the preferred cofactors. The enzyme
is most efficient as a 3 -hydroxysteroid dehydrogenase, converting
3 -tetrahydroprogesterone (allopregnanolone) to dihydroprogesterone
and 3 -androstanediol to dihydrotestosterone with similar catalytic
efficiency (Vmax values of 13-14 nmol/min/mg
microsomal protein and Km values of 5-7
µM). Despite ~44-47% sequence identity with
retinol/3 -hydroxysterol dehydrogenases, the enzyme is not active
toward retinols. The corresponding message is abundant in human trachea
and is present at lower levels in the spinal cord, bone marrow, brain,
heart, colon, testis, placenta, lung, and lymph node. Thus, the new
short chain dehydrogenase represents a novel type of microsomal
NAD+-dependent 3 -hydroxysteroid
dehydrogenase with unique catalytic properties and tissue distribution.
 |
INTRODUCTION |
Oxidation and reduction of hydroxyl and ketone groups in position
3 on naturally occurring steroids play an important role in regulation
of intracellular levels of biologically active steroid hormones. For
example, in gonads, 3 -hydroxysteroid oxidoreductase activity is
responsible for maintaining the balance between a potent androgen,
5 -dihydrotestosterone, with a ketone group in position 3 and a weak
androgen, 3 -androstanediol, which has a hydroxyl group in the same
position (Fig. 1; reviewed in Ref. 1). In
the central nervous system, 3 -hydroxysteroid oxidoreductase activity
controls the amount of a potent neurosteroid,
3 -tetrahydroprogesterone (also called allopregnanolone), which
serves as an allosteric regulator of all -aminobutyric acid type A
receptors and potentiates -aminobutyric acid mediated chloride
conductance (1). 3 -Hydroxysteroid oxidoreductase activity has been
described in the cytosolic and microsomal fractions of a number of
human and animal tissues (2-11). In addition to the different
subcellular localization, cytosolic and microsomal enzymes appear to
have a distinctively different cofactor preference. Cytosolic
3 -hydroxysteroid oxidoreductases exhibit a preference for the
phosphorylated nucleotides as cofactors (NADP+/NADPH),
whereas microsomal enzymes prefer NAD+/NADH (2-11).
Because the predominant forms of nucleotide cofactors in the cells are
NAD+ and NADPH, it is generally believed that the
NAD+-dependent dehydrogenases function mainly
in the oxidative direction, whereas the NADPH-dependent
enzymes function as reductases (12). Thus, the balance between the
oxidative and reductive activities will determine the local
concentrations of bioactive compounds in specific tissues. To date, at
least four types of cytosolic 3 -hydroxysteroid dehydrogenases
(HSDs)1 have been identified
in humans (1, 13, 14). All four cytosolic enzymes, named AKR1C1-AKR1C4,
are members of the aldo-ketoreductase gene superfamily and prefer NADPH
as cofactor (13). Liver is the only tissue that contains all four
isoforms at similar levels (13). Extrahepatic tissues such as lung,
prostate, uterus, mammary gland, brain, small intestine, and testis
vary significantly in their composition and relative amounts of
individual isoforms (13).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
Metabolic pathways of steroids
used to characterize substrate specificity of
3 -HSD. 3 -Adiol,
3 -androstanediol; ADT, androsterone; DHT,
dihydrotestosterone; Dione, androstanedione;
Allo-P, allopregnanolone; DHP,
dihydroprogesterone; Iso-P, isopregnanolone.
|
|
The identity of the enzymes responsible for the
NAD+-dependent 3 -hydroxysteroid
oxidoreductase activity found in microsomes has remained elusive until
recently, when several newly discovered members of the short chain
dehydrogenase/reductase superfamily were shown to stereospecifically
oxidize the 3 -hydroxyl group on 3 -androstanediol (15-20) and
allopregnanolone (21, 22). In contrast to cytosolic 3 -HSDs, these
membrane-bound short chain dehydrogenases exhibit a strong preference
for NAD+ as cofactor. Previously, we characterized the
properties of two human microsomal short chain dehydrogenases that are
capable of oxidizing 3 -androstanediol to 5 -dihydrotestosterone
and allopregnanolone to 5 -dihydroprogesterone (20, 21). The range of
potential physiological substrates for these enzymes (RoDH-4 and
RoDH-like 3 -HSD) is not limited to 3 -hydroxysteroids because they
can also oxidize all-trans-retinol and might contribute to
the biosynthesis of a potent morphogen, all-trans-retinoic
acid (20, 21).
Besides RoDH-4 and RoDH-like 3 -HSD, human cis-retinol
dehydrogenase Rdh5 was also shown to oxidize 3 -hydroxysteroids,
although with lower catalytic efficiency than cis-retinols
(16). Rdh5 was found to localize on the lumenal side of the endoplasmic
reticulum (23) and was implicated in the biosynthesis of
11-cis-retinal (24), the cofactor for vision, and
9-cis-retinoic acid, the activating ligand for retinoid X
receptors (25). The three human retinol/sterol dehydrogenases share
~50% amino acid sequence identity, similar genomic structure, and
chromosomal localization on chromosome 12 (26-28). Individual enzymes
exhibit distinctively different tissue distribution patterns. RoDH-4 is
primarily expressed in human liver and skin (20, 29). RoDH-like
3 -HSD is present in liver, lung, prostate, testis, spleen (15),
spinal cord (21), and various areas of human brain (21). Rdh5 appears
to be ubiquitously expressed in a wide variety of tissues: liver,
mammary gland, colon, thymus, small intestine, kidney, and others. (16,
25). Remarkably, liver contains the highest levels of mRNAs for all three enzymes. Here, we report molecular cloning and characterization of a novel human 3 -hydroxysteroid dehydrogenase. We show that, in
contrast to the previously identified enzymes, this human
3 -hydroxysteroid dehydrogenase is not active toward retinoids and
exhibits different membrane topology as well as different tissue distribution.
 |
EXPERIMENTAL PROCEDURES |
Cloning of the Full-length cDNA--
cDNA clone W17165
was identified in the expressed sequence tag data base of
GenBankTM based on its similarity to human RoDH-4 cDNA.
Sequencing of the clone obtained from American Type Culture Collection
revealed that it lacked the 5'-end (started at nucleotide 346 in Fig.
2). The missing part was obtained by
rapid amplification of cDNA ends (RACE) using 5'-RACE-ready human
liver cDNA (CLONTECH) as template. The internal
gene-specific primers (TGACATTCTCTGGGTCGGTCA and TCTTCACCCACTGGGCAGTC;
both antisense; indicated by arrows in Fig. 2) were designed
based on the 5'-end sequence of clone W17165. The gene-specific primers
were paired with the anchor primer (CLONTECH), and
the cDNA was amplified in two sequential reactions using
Taq polymerase (PerkinElmer Life Sciences). The
amplifications were performed for 30 cycles as follows: denaturing at
94 °C for 1 min, annealing at 60 °C for 1 min, and extension at
72 °C for 5 min. The ~400-base pair cDNA product was subcloned
into M13mp18 and sequenced. This cDNA fragment encoded amino acids
1-90 and contained 153 base pairs of the 5'-untranslated region (Fig.
2). The complete nucleotide sequence was submitted to
GenBankTM with accession number AF343729.

View larger version (74K):
[in this window]
[in a new window]
|
Fig. 2.
cDNA sequence and deduced protein
sequence of human microsomal 3 -HSD.
Numbers on the right correspond to nucleotide
sequence (italic) and amino acid sequence. The termination
codon is indicated by an asterisk. The sequences of primers
used to obtain the 5'-RACE PCR product are underlined by
arrows.
|
|
To obtain the full-length cDNA, human liver and heart mRNAs
were amplified by PCR using Pfu polymerase (Stratagene
Cloning Systems, La Jolla, CA) and primers
GGGGGATCCATGCTCTTTTGGGTGCTAGG (sense primer; the
BamHI site is underlined) and
TTAGAATTCTCACACTGCCTTGGGATTAG (antisense primer; the
EcoRI site is underlined). Thirty cycles of
amplification were performed as follows: denaturing at 94 °C for
45 s, annealing at 55 °C for 45 s, and extension at
72 °C for 6 min. The amplified cDNAs were subcloned into
BamHI/EcoRI restriction sites of pVL1393 transfer
vector (PharMingen, San Diego, CA). The transfer vectors were sequenced
to verify the cDNA sequence of the gene of interest. The sequences
of the cDNAs obtained from liver and heart were identical. The
structure of the corresponding gene was determined by searching Human
Genome GenBankTM data base using the full-length cDNA
sequence and the BLAST 2.0 homology search tool.
Northern Blot Analysis--
The following multiple tissue
mRNA blots (MTNs) were used for Northern blot analysis: Human
12-lane MTN Blot, Human 12-lane MTN Blot II, and Human Endocrine System
MTN Blot from CLONTECH, which contained a minimum
of 1 µg of polyadenylated RNA per lane. The blots were hybridized
with ~1.0-kilobase pair 32P-labeled cDNA probe
in ExpressHyb hybridization solution (CLONTECH) according to the manufacturer's instructions. Briefly, the blots were
prehybridized in ExpressHyb solution for 30 min at 68 °C and
transferred to a fresh solution containing 2 × 106
cpm/ml denatured radiolabeled cDNA. The hybridization was performed at 68 °C for 1 h. The blots were rinsed in 2× SSC, 0.05% SDS
several times at room temperature and washed in 0.1× SSC, 0.1% SDS
for 10 min at 50 °C. The mRNA bands were visualized by exposure
to x-ray film at 70 °C with two intensifying screens for 1-10 days.
Expression in Sf9 Cells--
Expression of the cDNA
in Sf9 cells was performed essentially as described previously
(20). To produce recombinant protein, Sf9 cells were infected at
a virus/cell ratio of 10:1. Cells were collected after 3 days of
incubation at 27 °C, resuspended in 0.01 M potassium
phosphate, pH 7.4, 0.25 M sucrose, 0.1 mM EDTA, 1 mM dithiothreitol, and protease inhibitors (1.5 µg/ml
aprotinin, 1.5 µg/ml leupeptins, and 1.0 µg/ml pepstatin A), and
homogenized using a French pressure cell. The unbroken cells, cellular
debris, and nuclei were removed by centrifugation at 1000 × g for 10 min, and then mitochondria were removed by
centrifugation at 10,000 × g for 30 min. Microsomes
were pelleted by centrifugation at 105,000 × g for
1 h through a 0.6 M sucrose cushion and resuspended in
90 mM potassium phosphate, pH 7.4, 40 mM KCl,
0.1 mM EDTA, 1 mM dithiothreitol, and 20%
glycerol. Protein concentration was determined by the method of Lowry
et al. (30) using bovine serum albumin as a standard.
Alkaline Extraction and Western Blot Analysis--
Five-µl
aliquots of microsomes (1.8 µg/µl) containing the recombinant
protein were incubated with 100 µl of 100 mM sodium carbonate and 25 mM potassium acetate (extraction buffer)
or with phosphate-buffered saline (PBS), pH 7.4, or with 1-10% Triton X-100 in PBS for 30 min on ice. After incubation, samples were loaded
onto 100-µl cushions of 0.5 M sucrose prepared in
extraction buffer, PBS, or Triton/PBS and centrifuged for 1 h at
200,000 × g. Pellets were dissolved in 20 µl of
SDS-polyacrylamide gel electrophoresis sample buffer. Supernatants were
precipitated with an equal volume of ice-cold 50% trichloroacetic acid
for 30 min on ice and centrifuged for 3 min at 12,000 × g. The resulting pellets were washed twice with ethyl ether,
dried, and dissolved in 20 µl of SDS-polyacrylamide gel
electrophoresis sample buffer. After separation in a 15% denaturing
polyacrylamide gel, samples were transferred to Hybond-P membrane
(Amersham Pharmacia Biotech). Protein was detected using the ECL
Western blotting analysis system (Amersham Pharmacia Biotech) according
to the manufacturer's instructions. Rabbit antibodies raised against
the N-terminal fragment of RoDH-like 3 -HSD were used as primary
antibodies at a 1:3000 dilution in 3% bovine serum albumin, 20 mM Tris, pH 7.6, 137 mM NaCl, and 0.1% Tween
20. Visualization was performed using horseradish peroxidase-conjugated anti-rabbit antibodies (at a 1:10,000 dilution) and ECL Western blotting detection reagents (Amersham Pharmacia Biotech).
Identification of Reaction Products and Determination of Kinetic
Constants--
All reactions were performed in 90 mM
potassium phosphate, pH 7.4, and 40 mM KCl at 37 °C
(reaction buffer) in siliconized glass tubes as described previously
(20). Commercially available radiolabeled steroids (PerkinElmer Life
Sciences; ~40-60 Ci/mmol each) were diluted with cold steroids
(Steraloids Inc. (Newport, RI) and Sigma) dissolved in dimethyl
sulfoxide (Me2SO). The 500-µl reactions (final
concentration of Me2SO < 1%) were started with the
addition of enzyme. After 15-60 min at 37 °C, steroids were extracted and separated by development in toluene:acetone (4:1) on
silica gel TLC plates (Sigma). TLC plates containing
3H-labeled steroids were exposed to a PhosphorImager
(Molecular Dynamics) tritium screen overnight and/or cut into 1-cm-wide
sections, which were then counted in scintillation liquid (Bio-Safe
II). Products of each reaction were identified by comparison with
reference steroids. For determination of apparent Km
values, six concentrations between 0.1 and 17.5 µM were
used for allopregnanolone and dihydrotestosterone; and concentrations
between 0.5 and 25 µM were used for androstanediol,
androsterone, and dehydroepiandrosterone. The amount of product formed
was less than 10% of the amount of substrate within the 15-min
reaction time and was linearly proportional to the amount of microsomes
added. A control without added cofactor was included with each
experiment and subtracted from each experimental data point. The
apparent Km values for oxidation of
hydroxysteroids were determined at a fixed NAD+
concentration (1 mM), and the apparent
Km value for reduction of dihydrotestosterone was
determined at a fixed NADH concentration (1 mM). Each
Km determination was repeated at least three times.
The apparent Km values for cofactors were determined
at a fixed saturating concentration of substrate with six
concentrations of each cofactor (1-400 µM for
NAD+ and 1-200 µM for NADH).
The activity with all-trans-retinol and
13-cis-retinol was determined in the same reaction buffer
used for steroid assays. The reaction was allowed to proceed for 30 min
at 37 °C, and the reaction products were extracted and analyzed by
HPLC as described previously (21).
Coupled in Vitro Transcription/Translation and Protease
Protection Assay--
The coding region of the cDNA was cloned
into BamHI/EcoRI restriction sites of expression
vector pT7/T3-19 (Ambion Inc., Austin, TX) under the control of
T7 promoter. The cDNA for 11 -HSD1 (31) was amplified from
5'-RACE-ready human liver cDNA using Pfu polymerase and
primers GCTGGATCCGCCATGGCTTTTATGAAAAAATATCTC (sense primer) and AGGTCTAGACTACTTGTTTATGAATCTGTCC (antisense primer),
which contained BamHI and XbaI restriction
sites (underlined), respectively. The PCR product of
expected size was cloned into pT7/T3-18 vector cleaved with
BamHI and XbaI restriction endonucleases and
sequenced to verify the fidelity of PCR amplification. The expression
constructs were subjected to in vitro transcription by T7
RNA polymerase and translation in reticulocyte lysate in the presence
or absence of dog pancreas microsomes (TNT Quick system; Promega)
according to the manufacturer's instructions. In a typical assay,
0.5-1 µg of plasmid DNA, 20 µCi of [35S]methionine
(Amersham Pharmacia Biotech), and 0.5-1 µl of canine pancreatic
microsomal membranes (Promega) were incubated for 60-90 min at
30 °C in a final volume of 12.5 µl. Translocation of polypeptides to the lumenal side of the microsomes was assayed by proteinase K
treatment. Equal aliquots of the in vitro
transcription/translation product were incubated for 60 min on ice with
or without 200 µg/ml proteinase K (Roche Molecular Biochemicals) in a
final volume of 5 µl. Proteinase K was inactivated by the addition of
4 mM phenylmethylsulfonyl fluoride. Proteins were subjected
to 12% SDS-polyacrylamide gel electrophoresis and analyzed by autoradiography.
Thirty µg of 3 -HSD-containing microsomes from Sf9 cells
were incubated with or without proteinase K in the presence or absence of 1% CHAPS. Reactions were incubated at 37 °C for 15 min with various amounts of protease relative to microsomal protein (µg:µg) in a final reaction volume of 36 µl. The reaction was stopped by the
addition of protease inhibitor phenylmethylsulfonyl fluoride to the
final concentration of 2 mM. Samples of the reaction
mixture were analyzed by Western blotting and by activity measurements using 5 µM androsterone as substrate.
 |
RESULTS |
Characterization of the Primary Structure and Genomic
Organization--
The 1513-base pair cDNA shown in Fig. 2 was
constructed from the overlapping sequences of the original clone W17165
(nucleotides 346-1513) and the 5'-RACE PCR product (nucleotides
1-449) obtained in this study (see "Experimental Procedures"). The
open reading frame starts at nucleotide 154 and ends in a stop codon at
nucleotide 1,113, resulting in a 319-amino acid-long polypeptide (Fig.
2). A search of the GenBankTM data base for homologous
sequences revealed that three unpublished sequences exhibit similarity
to the cDNA reported here: (a) human retinol
dehydrogenase homolog gene (AF067174), (b) Homo
sapiens retinol dehydrogenase homolog isoform-1 mRNA
(AF240698), and (c) H. sapiens retinol
dehydrogenase homolog isoform-2 mRNA (AF240697). The first cDNA
is identical to segments 147-603 and 667-1513 in the cDNA shown
in Fig. 2 but is missing a segment coding for 21 amino acids between
Pro-150 and Val-172. Instead, in this position, it contains nucleotides
1-45 of the 5'-untranslated sequence joined with an unidentified
31-base pair fragment. Retinol dehydrogenase homolog isoform-1 lacks
120 base pairs coding for 40 amino acids between Glu-204 and Ser-246,
whereas isoform-2 has an insertion of 113 nucleotides between positions
94 and 95 in the 5'-untranslated region (Fig. 2) as well as four
mismatched nucleotides and one missing nucleotide, which causes
a frameshift.
To obtain the full-length cDNA and further confirm the cDNA and
deduced protein sequence, we performed PCR amplification of mRNA
isolated from two human tissues, liver and heart, using gene-specific primers flanking the coding region. Sequencing of the PCR products showed that they were identical with the sequence in Fig. 2.
Furthermore, a BLAST 2.0 search of the Human Genome data base revealed
that the cDNA sequence determined in this study (AF343729) is 100% identical to five consecutive segments in the NCBI-assembled contig NT 005343 assigned to chromosome 2q31.1 (Fig.
3A). The corresponding gene
spans over 26 kilobase pairs and does not appear to have pseudogenes.
The proposed exon-intron boundaries follow the canonical GT/AG rule and
are summarized in Table I.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 3.
Genomic organization of 3 -HSD on chromosome 2 (A) and alignment of its amino acid sequence with related
short chain dehydrogenases (B). The identical residues are
indicated by asterisks. The cofactor binding site and the
active site consensus sequences are boxed. The exon-intron
junctions are highlighted in bold and are indicated by the
breaks in the sequence.
|
|
The deduced protein sequence of the novel protein contains the
signature cofactor binding motif
G(X)3GXG at Gly-36 and the active site consensus sequence Y(X)3K at Tyr-176
characteristic of the short chain dehydrogenases/reductases. The amino
acid sequence is most closely related to retinol/sterol dehydrogenases
of the short chain dehydrogenase/reductase superfamily: (a)
RoDH-4, 47% identity; (b) RoDH-like 3 -HSD, 43%
identity; and (c) Rdh5, 44% identity. Furthermore, the
positions of exon-intron junctions in the translated region of the
novel gene and the sizes of exons 3 and 4 are identical to those in the
genes for RoDH-4, RoDH-like 3 -HSD, and Rdh5 (Fig. 3B).
However, the new gene is present on chromosome 2q31.1, whereas
retinol/sterol dehydrogenases are clustered on chromosome 12q13
(28).
Tissue Distribution--
Tissue distribution of the corresponding
message was examined by Northern blot analysis. Hybridization of
pre-made Northern blots with radiolabeled cDNA revealed that the
message for the putative short chain dehydrogenase is present in a
number of human tissues (Fig. 4). The
most intense signal was observed in trachea. Relatively strong signals
were detected in spinal cord, bone marrow, heart, and colon. Weaker
bands were also present in lymph node, brain, lung, placenta, testis,
prostate, and mammary gland. A total of three different-size mRNA
species were detected, which exhibited tissue-specific expression. The
longest mRNA species were detected in trachea, testis, and lung. An
intermediate size mRNA was present in trachea, colon, placenta,
lung, bone marrow, and lymph node, with trace amounts seen in mammary
gland, prostate, and stomach. The shortest mRNA was detected in
spinal cord, lymph node, brain, bone marrow, and heart.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 4.
Northern blot analysis of
3 -HSD distribution in human tissues.
Human multiple tissue Northern blots (CLONTECH)
containing a minimum of 1 µg polyadenylated RNA/lane were hybridized
with human radiolabeled 3 -HSD cDNA at high stringency
conditions. The blots were exposed to x-ray film for 1 day (the panel
with uterus and trachea on the far left) and then re-exposed
for 10 days (all other panels). The hybridized blots were
stripped of residual radioactivity, reprobed with -actin cDNA,
and exposed for 3 h (bottom panel). Positions of the
size standards are indicated on the left.
|
|
Expression and Characterization of the Recombinant Enzyme--
To
establish whether the novel cDNA codes for a functional enzyme, we
expressed the corresponding protein using the baculovirus expression
system. Similar to human retinol/sterol dehydrogenases, the recombinant
protein was present in the microsomal fraction of Sf9 cells as
indicated by Western blot analysis using antibodies against the
conserved N-terminal cofactor-binding domain of retinol/sterol dehydrogenases. Under the same conditions, no protein bands were detected in microsomes isolated from Sf9 cells infected with
wild-type virus, which did not express the recombinant protein (data
not shown). To determine whether the new short chain dehydrogenase is
an integral membrane protein, microsomal fraction from Sf9 cells
that expressed the recombinant protein was subjected to alkaline and
detergent extractions. Equal amounts of microsomes were incubated with
either sodium carbonate buffer, pH 11.5 (alkaline extraction), Triton
X-100/PBS (detergent extraction), or PBS, pH 7.4 (control) (Fig.
5). Extracted proteins were separated
from membrane-bound proteins by ultracentrifugation and analyzed by Western blotting. As shown in Fig. 5, the recombinant protein remained
membrane-bound after alkaline extraction but was partially solubilized
by increasing concentration of a detergent, consistent with the
behavior of an integral membrane protein.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
Alkaline extraction and Western blot analysis
of recombinant 3 -HSD. Microsomal
membranes containing 3 -HSD were extracted with 10% Triton X-100 in
PBS (10% Tx-100), 1% Triton X-100 in PBS (1%
Tx-100), sodium carbonate buffer, pH 11.5 (alkaline
extraction), or PBS, pH 7.4 (PBS). Solubilized proteins
(S) were separated from integral membrane proteins
(P) by ultracentrifugation. Distribution of 3 -HSD between
the soluble and the membrane-bound fractions was analyzed by Western
blotting as described under "Experimental Procedures."
|
|
Next, we tested whether the putative short chain dehydrogenase is
enzymatically active. Because its amino acid sequence showed the
closest similarity to retinol/sterol dehydrogenases, we examined whether it possessed a hydroxysteroid dehydrogenase activity using reaction conditions established previously for RoDH-4 (20) and RoDH-like 3 -HSD (21). Microsomes were incubated with a number of
tritiated steroid compounds for 1 h at 37 °C in the presence of
1 mM NAD+ or NADH. The reaction products were
extracted, separated by TLC, and visualized using a PhosphorImager. At
a 5 µM concentration of each substrate, the highest
percentage of conversion in the oxidative direction in the presence of
NAD+ was observed with 3 -hydroxysteroids,
3 -androstanediol and allopregnanolone (Fig.
6A). 3 -Androstanediol
contains two hydroxyl groups in positions 3 and 17 (Fig. 1). The
enzyme possessed both 3 -HSD and 17 -HSD activity, as evidenced by
the appearance of androstanedione with ketone groups in positions 3 and
17 (Fig. 6A). To estimate the relative efficiency of the two
activities, we used substrates that have only one hydroxyl group:
3 -hydroxyl (androsterone) or 17 -hydroxyl (dihydrotestosterone)
(Fig. 1). The 3 -hydroxyl group was oxidized much more efficiently
(androsterone to androstanedione) than the 17 -hydroxyl group
(dihydrotestosterone to androstanedione). To evaluate the 3 -HSD
activity of the enzyme, we used dehydroepiandrosterone as substrate. As
seen in Fig. 6A, no oxidation products of
dehydroepiandrosterone were detected by autoradiography, indicating
that the rate of conversion was not sufficient to detect the respective
oxidation product.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 6.
Analysis of the reaction products produced
by 3 -HSD in the presence of NAD+ (A) or NADH
(B). Control reactions performed in the absence of cofactor
( NAD+/ NADH) are shown next to the sample with the same
substrate in the presence of cofactor. All reactions were allowed to
proceed for 1 h at 37 °C. Substrates were used at a
concentration of 5 µM. The microsomes were used at
concentration of 25 µg/ml in the reaction volume. C,
analysis of the endogenous activity of Sf9 microsomes isolated
from cells infected with wild-type baculovirus toward
dihydrotestosterone in the presence of NAD+ (+ NAD+) (17 -dehydrogenase activity) or NADH (+ NADH) (3 keto-reductase activity). ADT,
androsterone; DHT, dihydrotestosterone; ADIOL,
3 -androstanediol; DHEA, dehydroepiandrosterone;
ALLO-P, allopregnanolone; ISO-P,
isopregnanolone; DHP, dihydroprogesterone; DIONE,
androstanedione.
|
|
One of the best substrates for the novel 3 -HSD in the oxidative
direction was allopregnanolone (3 -tetrahydroprogesterone) (Fig.
6A). Interestingly, besides a significant amount of
dihydroprogesterone with ketone group in position 3, an additional
product, isopregnanolone (3 -tetrahydroprogesterone), appeared in
this reaction. This implied that the ketone group on carbon 3 of
dihydroprogesterone could be reduced to either a 3 or 3 -hydroxyl
group. This type of activity was observed previously during prolonged
incubations of RoDH-like 3 -HSD with allopregnanolone and
NAD+ (22).
Analysis of the reaction products in the reductive direction in the
presence of NADH showed that ketone group on carbon 3 was reduced to
hydroxyl group with the highest catalytic efficiency (dihydrotestosterone to 3 /3 -androstanediol) (Fig. 6B).
The 17-ketone group on androsterone was also reduced, albeit at a much
slower rate. To ensure that the observed 3 - and 17 -hydroxysteroid
dehydrogenase activity was not due to endogenous activity of insect
cell microsomes, we determined the activity of microsomes isolated from
Sf9 cells that were infected with wild-type virus and did not
express 3 -HSD. At a 5 µM substrate concentration, 0.2 pmol of androstanedione and 0.08 pmol of androstendione were formed by
3 µg of control microsomes from dihydrotestosterone and
dehydroepiandrosterone, respectively, in the presence of
NAD+. In contrast, the same amount of microsomes that
contained 3 -HSD produced 199 pmol of androstanedione and 28 pmol of
androstendione. The endogenous hydroxysteroid activity of Sf9
microsomes from the cells infected with wild-type virus was also tested
using [14C]dihydrotestosterone in the presence of
NAD+ (17 -hydroxysteroid dehydrogenase activity) or
NADH (3-keto reductase activity). As shown in Fig. 6C, no
products were detected in the oxidative or the reductive direction.
Based on this analysis, we concluded that all of the observed steroid
conversions were catalyzed by the novel 3 -HSD.
Before measuring kinetic constants for oxidation and reduction of
steroids, we determined whether NAD+ and NADH were, in
fact, the preferred cofactors. In the oxidative direction, using 5 µM allopregnanolone as substrate, the reaction rate was
44-fold higher in the presence of 1 mM NAD+
than in the presence of 1 mM NADP+. In the
reductive direction, using 10 µM dihydrotestosterone as
substrate, the rate was 9-fold higher with 1 mM NADH than
it was with 1 mM NADPH. Thus, NAD+ and NADH
were the preferred cofactors. The apparent Km value
for NAD+ determined with 20 µM
allopregnanolone was 72.0 ± 5.0 µM. The apparent
Km value for NADH determined with 25 µM dihydrotestosterone was 9.0 ± 0.5 µM.
Considering that multiple products are formed by the enzyme over long
periods of incubation (or with high enzyme concentrations), we
established conditions under which only one reaction product was
formed. These conditions were used to determine kinetic constants for
steroid substrates. Specifically, the apparent Km and Vmax values for allopregnanolone and
3 -androstanediol were measured when there was no detectable
formation of secondary products (isopregnanolone and androstanedione,
respectively). Consistent with autoradiography analysis of the reaction
products, allopregnanolone and androstanediol were the best substrates
in the oxidative direction with the apparent Km
values of 5-7 µM (Table
II). The apparent Km
value for androsterone was ~5-fold higher (Table II). Kinetic
analysis also showed that the enzyme was capable of binding
3 -hydroxysteroid dehydroepiandrosterone; however, the rate of
conversion was about 20-fold lower compared with that of
allopregnanolone (Table II), which explains why the
corresponding product could not be visualized using a
PhosphorImager (Fig. 6A). Dihydrotestosterone (3-ketone
group) was reduced to androstanediol with a catalytic efficiency
similar to that for the oxidation of 3 -hydroxyl group (Table
II).
View this table:
[in this window]
[in a new window]
|
Table II
Kinetic constants for steroid substrates
Kinetic constants were measured in 90 mM potassium
phosphate, pH 7.4, and 40 mM KCl at 37 °C. The
Km value for dihydrotestosterone was determined with
saturating 1 mM NADH, and the Km values
for all other substrates were determined with saturating 1 mM NAD+.
|
|
To determine whether the new enzyme was active toward retinoids, we
incubated 30-300 µg of microsomal membranes containing the
recombinant protein with 10-50 µM
all-trans-retinol or 13-cis-retinol in the
presence of 1 mM NAD+. After a 30-min
incubation at 37 °C, the reaction products were extracted and
analyzed by HPLC as described previously (21). The amount of
retinaldehyde formed was calculated from the calibration curve of the
amount of pure retinal injected onto the column. Based on these
measurements, 71 pmol were produced by 30 µg of microsomal protein
over the 30-min incubation time from 10 µM retinol. For
comparison, 9600 pmol of dihydroprogesterone would have been produced
from 10 µM allopregnanolone by the same amount of protein
under the identical conditions. Considering that the rate of retinol
oxidation is at least 100 times lower than that of allopregnanolone,
the new enzyme is not efficient as retinol dehydrogenase.
Transmembrane Topology of 3 -HSD--
Because we have
established that the novel 3 -HSD is an integral membrane protein, we
were interested in determining its transmembrane orientation. Analysis
of its protein sequence for signature sites and motifs indicated that
there is a potential N-terminal transmembrane segment (amino acids
2-17) as well as three potential N-glycosylation sites at
Asn-161, Asn-187, and Asn-253. Because N-glycosylation is
carried out exclusively on the luminal side of the endoplasmic reticulum, the appearance of protein species with higher subunit molecular weight in the presence of microsomes would indicate that they
become glycosylated and were therefore exposed to the lumen.
To investigate the transmembrane topology of 3 -HSD, we used a
coupled in vitro transcription/translation system and canine pancreatic microsomal membranes. 11 -HSD1, a protein with known lumenal orientation and three glycosylation sites (32), served as a
positive control for glycosylation. 3 -HSD was synthesized in
vitro in the presence or absence of canine microsomes. Analysis of
the reaction products showed that the size of 3 -HSD produced in the
absence of microsomes was identical to that produced in the presence of
microsomes, indicating that the three glycosylation sites in 3 -HSD
were not glycosylated (Fig.
7A). At the same time, all
three sites were glycosylated in the positive control, 11 -HSD1 (Fig.
7A). Then, the reaction products were treated with
proteinase K to determine whether the protein was translocated across
the membrane and protected against the protease (see "Experimental Procedures"). In agreement with the lack of glycosylation, 3 -HSD produced in the presence of microsomes was not protected from proteinase K, whereas the glycosylated 11 -HSD1 was fully protected. This outcome is consistent with the cytosolic orientation of 3 -HSD, in contrast to the lumenal orientation established for 11 -HSD1 (32).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7.
Protease protection assay of 3 -HSD produced
in vitro using coupled transcription/translation system
(A) and of recombinant 3 -HSD in Sf9 cell-derived
microsomes (B). A, proteins (3 -HSD and
11 -HSD1) were produced in the presence (+) or absence ( ) of canine
pancreatic microsomes (Ms) and incubated with (+) or without
( ) 200 µg/ml proteinase K (PK). Proteins were separated
by 12% SDS-polyacrylamide gel electrophoresis, and dried gels were
subjected to autoradiography. B, microsomal membranes
isolated from Sf9 cells that express 3 -HSD (Prot)
were incubated with proteinase K (PK) at various
protein:protein ratios in the presence (+) or absence ( ) of 1% CHAPS
(CHAPS). Samples of the reactions were analyzed by Western
blotting and activity assays (C). C, the residual
3 -HSD activity was determined using 5 µM androsterone
as substrate. 100% activity corresponds to the activity of 3 -HSD
incubated under the same conditions in the absence of proteinase
K.
|
|
To obtain additional evidence for the cytosolic orientation of the new
3 -HSD, we incubated enzyme-containing microsomes from Sf9
cells with different concentrations of proteinase K in the presence or
absence of 1% CHAPS and analyzed the residual activity and the amount
of protein left after protease treatment. 3 -HSD was readily
proteolysed by proteinase K in both the presence and absence of CHAPS,
suggesting that the disruption of membrane integrity was not essential
for proteolysis to occur (Fig. 7B). The activity of the
enzyme incubated with proteinase K decreased from 1.87 nmol/min/mg
microsomal protein (100%) to 0.86 nmol/min/mg microsomal protein
(46%) at a 1:250 protease:microsomes ratio (µg:µg) (Fig. 7C). No change in either 3 -HSD activity or protein was
observed in the absence of proteinase K. Based on the above
experimental data, we conclude that the new short chain dehydrogenase
is an integral membrane protein, which faces the cytosolic side of the microsomal membrane.
 |
DISCUSSION |
The novel 3 -HSD characterized in the present study exhibits
less than 50% amino acid sequence identity to any known protein. It is
most closely related to retinol/sterol dehydrogenases of the short
chain dehydrogenase/reductase superfamily. Furthermore, the gene for
3 -HSD shares similar structural organization with the genes for
retinol/sterol dehydrogenases (28). Some variation is observed in the
length of exon 5, which is 1 amino acid longer that the corresponding
exon in the Rdh5 gene and 2 amino acids longer than that in the RoDH-4
and RoDH-like 3 -HSD genes. Interestingly, 3 -HSD gene is found on
a different chromosome and does not appear to have satellite
pseudogenes like RoDH-4 and RoDH-like 3 -HSD genes (28), which might
indicate that it appeared later in evolution.
Analysis of the sequences deposited in the GenBankTM
expressed sequence tag data base showed that cDNA fragments
identical to different segments of 3 -HSD cDNA were isolated from
multiple sources: lymph node (nine reports), testis (three
reports), normal colon and colon adenocarcinoma (three reports),
cervical tumor (one report), breast (one report), uterus and
endometrial adenocarcinoma (four reports), fetal lung (one report),
pancreas adenocarcinoma (two reports), and lymphoma (one report). Thus,
3 -HSD appears to exhibit wide tissue distribution. Indeed, Northern
blot analysis of human tissues revealed that 3 -HSD mRNA is
present in the central nervous system and in a number of peripheral
endocrine tissues. Interestingly, the size of the predominant mRNA
species varied depending on the tissue source, suggesting that there
might be a tissue-specific splicing of 3 -HSD mRNA. In fact, we
found that the 113-nucleotide segment inserted in the 5'-untranslated
sequence of a nearly identical clone submitted under the name of
retinol dehydrogenase homolog isoform-2 (AF240697) is located within the 11,805-base pair sequence of putative intron 1. This observation suggests that alternatively spliced products may exist.
The most striking difference in the distribution pattern of the novel
3 -HSD compared with that of retinol/sterol dehydrogenases is that
the 3 -HSD message is practically absent in liver. The lack of
hybridization with the liver mRNA serves as a confirmation that the
cDNA probe does not cross-hybridize with either RoDH-4 or RoDH-like
3 -HSD mRNA, both of which are very abundant in the liver.
The presence of 3 -HSD in the brain is consistent with its activity
toward allopregnanolone, which serves as a potent allosteric regulator
of -aminobutyric acid type A receptors. Allopregnanolone is likely
to be produced in the brain by cytosolic 3 -HSDs, AKR1C1 and AKR1C2,
which catalyze the reduction of the 3-ketone group on
dihydroprogesterone (13). The back-oxidation of allopregnanolone to
dihydroprogesterone is thought to be catalyzed by an unidentified membrane-bound NAD+-dependent 3 -HSD (4, 5).
Previously, we have reported that RoDH-like 3 -HSD is capable of
oxidizing allopregnanolone and is expressed in various regions of the
human brain and in the spinal cord (21), suggesting that it may
function as allopregnanolone dehydrogenase in the central nervous
system. This study shows that, in addition to RoDH-like 3 -HSD, the
central nervous system contains a second isoform of microsomal
oxidative 3 -HSD active toward allopregnanolone. Interestingly,
similar to RoDH-like 3 -HSD (21, 22), the newly characterized enzyme
exhibits "epimerase" activity toward allopregnanolone, slowly
converting it to 3 -hydroxysteroid isopregnanolone in the presence of
NAD+. We have previously proposed that NADH, which is
produced during oxidation of allopregnanolone, might be retained in the
active site and trigger the nonstereospecific reduction of the 3-ketone group on dihydroprogesterone to both a 3 -hydroxyl and a
3 -hydroxyl group. Consistent with this hypothesis, the new 3 -HSD
exhibits a higher affinity for NADH than for NAD+ (the
apparent Km value is 9 versus 72 µM), similar to RoDH-like 3 -HSD (0.18 versus 1.9 µM) (21). At the same time, RoDH-4,
which has almost identical Km values for
NAD+ (0.13 µM) and NADH (0.1 µM), does not seem to possess the epimerase activity.2 It should also be
noted that, in addition to allopregnanolone, RoDH-like 3 -HSD
epimerized androsterone into epiandrosterone. However, we did not
observe epimerization of androsterone with the new 3 -HSD, possibly
due to the 5-fold higher apparent Km value of the
enzyme for androsterone compared with allopregnanolone.
Besides utilizing allopregnanolone as substrate, the new 3 -HSD is
equally efficient at converting 3 -androstanediol into a potent
androgen, dihydrotestosterone. This is consistent with the expression
of the enzyme in testis and prostate. Previously, Biswas and Russell
(15) proposed that RoDH-like 3 -HSD, which is expressed in prostate
and testis, contributes to the back-oxidation of 3 -androstanediol to
dihydrotestosterone in these tissues. This study shows that, in
addition to RoDH-like 3 -HSD, dihydrotestosterone can be produced in
testis and prostate by the novel isoform of 3 -HSD.
Similar to retinol/sterol dehydrogenases, 3 -HSD is an integral
membrane protein. Therefore, depending on its transmembrane topology,
the active site of the enzyme may be exposed either to the cytosol or
to the lumen of the endoplasmic reticulum. This, in turn, may affect
its access to the substrates and cofactors. Previous analysis of the
transmembrane topology of Rdh5, which was proposed to catalyze the
biosynthesis of 11-cis-retinaldehyde in retinal pigment
epithelium, showed that Rdh5 is anchored to the membranes of smooth
endoplasmic reticulum by two hydrophobic peptide segments (23). The
catalytic domain of this enzyme is confined to the lumenal compartment,
suggesting that generation of 11-cis-retinaldehyde occurs in
the lumen of the endoplasmic reticulum (23). In contrast to Rdh5,
3 -HSD appears to be facing the cytosolic side of the membrane,
indicating that it will utilize the cytosolic pool of steroids and
nucleotides. In the liver cytosol, and presumably in other tissues, the
NAD+:NADH ratio is about 1000, whereas the
NADP+:NADPH ratio is about 0.01 (33). This suggests that
the NAD+-preferring oxidoreductases, which face the cytosol
like the new 3 -HSD, will function in the oxidative direction. The
available substrate and cofactor pool for the lumenally oriented Rdh5,
which also prefers NAD+ over NADP+ as cofactor
(34), is less clear.
The existence of enzymes that share similar substrates but exhibit
different transmembrane orientation is not unusual. For example, two
other members of the short chain dehydrogenase/reductase superfamily,
11 -HSD type 1 and type 2, which catalyze the interconversion between
a potent glucocorticoid cortisol and a weak glucocorticoid cortisone,
exhibit opposite transmembrane orientation: 11 -HSD type 1 is a
lumenally oriented glycoprotein, whereas 11 -HSD type 2 faces the
cytosol (32). Interestingly, these two enzymes exhibit a different
cofactor preference: 11 -HSD type 1 catalyzes oxidation and reduction
using NADP(H) as cofactor, whereas 11 -HSD type 2 is
NAD+-specific and catalyzes only 11 -dehydrogenation.
This is in contrast to Rdh5 and 3 -HSD, which both appear to exhibit
a cofactor preference for NAD+.
Besides the difference in the transmembrane topology and tissue
distribution, 3 -HSD exhibits different substrate specificity compared with Rdh5 and the all-trans-retinol-oxidizing
microsomal dehydrogenases, RoDH-4 and RoDH-like 3 -HSD. Rdh5 has
similar affinity for retinoids (K0.5 of
6.3-6.6 µM for 9-cis and
11-cis-retinol) and 3 -androstanediol
(K0.5 of 6.4 µM) (16) and is about
two times more efficient as retinol dehydrogenase than as a steroid dehydrogenase. RoDH-4 and RoDH-like 3 -HSD occupy an intermediate position and are more efficient as 3 -hydroxysteroid dehydrogenases with apparent Km values of ~0.2 µM
for 3 -hydroxysteroids (20, 21) while retaining the retinol-oxidizing
capacity (Km value of 3.2 µM) (21).
The new 3 -HSD is practically inactive with retinoid compounds and is
most efficient as allopregnanolone and 3 -androstanediol
dehydrogenase, representing the opposite end of the spectrum. Thus,
experimental data obtained in this study suggest that the new member of
the short chain dehydrogenase/reductase superfamily is a novel type of
microsomal NAD+-dependent 3 -HSD with unique
tissue distribution, transmembrane topology, and catalytic properties.
 |
ACKNOWLEDGEMENT |
We thank Dr. Kirill Popov (Division of
Molecular Biology and Biochemistry, University of Missouri-Kansas City,
Kansas City, MO) for helpful discussions and critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported by the National Institute on Alcohol
Abuse and Alcoholism Grants AA00221 and AA12153 (to N. Y. K.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF343729.
Present address: Eli Lilly and Co., Lilly Corporate Center,
Indianapolis, IN 46285.
§
To whom correspondence should be addressed: Division of
Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, 5007 Rockhill Rd., 103 BSB, Kansas
City, MO 64110. Tel.: 816-235-2658; Fax: 816-235-5595; E-mail
kedishvilin@umkc.edu.
Published, JBC Papers in Press, April 9, 2001, DOI 10.1074/jbc.M102076200
2
S. V. Chetyrkin, and N. Y. Kedishvili, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
HSD, hydroxysteroid
dehydrogenase;
CHAPS, (3-[(3-cholamidopropyl)dimethylammonio]-1-propane-sulfonate;
HPLC, high performance liquid chromatography;
RACE, rapid amplification of
cDNA ends;
PCR, polymerase chain reaction;
PBS, phosphate-buffered
saline;
RODH, retinol dehydrogenase.
 |
REFERENCES |
| 1.
|
Penning, T. M.,
Pawlowski, J. E.,
Schlegel, B. P.,
Jez, J. M.,
Lin, H. K.,
Hoog, S. S.,
Bennett, M. J.,
and Lewis, M.
(1996)
Steroids
61,
508-523
|
| 2.
|
Verhoeven, G.,
Heyns, W.,
and De Moor, P.
(1977)
J. Steroid Biochem.
8,
731-733
|
| 3.
|
Verhoeven, G.,
Heyns, W.,
and De Moor, P.
(1976)
Eur. J. Biochem.
65,
565-576
|
| 4.
|
Krause, J. E.,
and Karavolas, H. J.
(1980)
J. Biol. Chem.
255,
11807-11814
|
| 5.
|
Krause, J. E.,
and Karavolas, H. J.
(1981)
J. Steroid Biochem.
14,
63-69
|
| 6.
|
Pirog, E. C.,
and Collins, D. C.
(1994)
Steroids
59,
259-264
|
| 7.
|
Span, P. N.,
Sweep, C. G. J.,
Benraad, Th. J.,
and Smals, A. G. H.
(1996)
J. Steroid Biochem. Mol. Biol.
58,
319-324
|
| 8.
|
Li, X.,
Bertics, P. J.,
and Karavolas, H. J.
(1997)
J. Steroid Biochem. Mol. Biol.
60,
311-318
|
| 9.
|
Dombroski, R. A.,
Casey, M. L.,
and MacDonald, P. C.
(1997)
J. Steroid Biochem. Mol. Biol.
63,
155-163
|
| 10.
|
Pirog, E. C.,
and Collins, D. C.
(1999)
J. Clin. Endocrinol. Metab.
84,
3217-3221
|
| 11.
|
Ge, R. S.,
Hardy, D. O.,
Catterall, J. F.,
and Hardy, M. P.
(1999)
Biol. Reprod.
60,
855-860
|
| 12.
|
Labrie, F.,
Luu-The, V.,
Lin, S.-X.,
Labrie, C.,
Simard, J.,
Breton, R.,
and Belanger, A.
(1997)
Steroids
62,
148-158
|
| 13.
|
Penning, T. M.,
Burczynski, M. E.,
Jez, J. M.,
Hung, C. F.,
Lin, H. K.,
Ma, H.,
Moore, M.,
Palackal, N.,
and Ratnam, K.
(2000)
Biochem. J.
351,
67-77
|
| 14.
|
Khanna, M.,
Qin, K. N.,
Wang, R. W.,
and Cheng, K. C.
(1995)
J. Biol. Chem.
270,
20162-20168
|
| 15.
|
Biswas, M. G.,
and Russell, D. W.
(1997)
J. Biol. Chem.
272,
15959-15966
|
| 16.
|
Wang, J.,
Chai, X.,
Eriksson, U.,
and Napoli, J. L.
(1999)
Biochem. J.
338,
23-27
|
| 17.
|
Chai, X.,
Zhai, Y.,
and Napoli, J. L.
(1997)
J. Biol. Chem.
272,
33125-33131
|
| 18.
|
Su, J.,
Chai, X.,
Kahn, B.,
and Napoli, J. L.
(1998)
J. Biol. Chem.
273,
17910-17916
|
| 19.
|
Su, J.,
Lin, M.,
and Napoli, J. L.
(1999)
Endocrinology
140,
5275-5284
|
| 20.
|
Gough, W. H.,
Van Ooteghem, S.,
Sint, T.,
and Kedishvili, N. Y.
(1998)
J. Biol. Chem.
273,
19778-19785
|
| 21.
|
Chetyrkin, S. V.,
Hu, J.,
Gough, W. H.,
Dumaual, N.,
and Kedishvili, N. Y.
(2001)
Arch. Biochem. Biophys.
386,
1-10
|
| 22.
|
Huang, X. F.,
and Luu-The, V.
(2000)
J. Biol. Chem.
275,
29452-29457
|
| 23.
|
Simon, A.,
Romert, A.,
Gustafson, A. L.,
McCaffery, J. M.,
and Eriksson, U.
(1999)
J. Cell Sci.
112,
549-558
|
| 24.
|
Yamamoto, H.,
Simon, A.,
Eriksson, U.,
Harris, E.,
Berson, E. L.,
and Dryja, T. P.
(1999)
Nat. Genet.
22,
188-191
|
| 25.
|
Mertz, J. R.,
Shang, E.,
Piantedosi, R.,
Wei, S.,
Wolgemuth, D. J.,
and Blaner, W. S.
(1997)
J. Biol. Chem.
272,
11744-11749
|
| 26.
|
Simon, A.,
Lagercrantz, J.,
Bajalica-Lagercrantz, S.,
and Eriksson, U.
(1996)
Genomics
36,
424-430
|
| 27.
|
Gamble, M. V.,
Shang, E.,
Zott, R. P.,
Mertz, J. R.,
Wolgemuth, D. J.,
and Blaner, W. S.
(1999)
J. Lipid Res.
40,
2279-2292
|
| 28.
|
Kedishvili, N. Y.,
Belyaeva, O. V.,
and Gough, W. H.
(2000)
Chem. Biol. Interact.
130,
457-467
|
| 29.
|
Jurukovski, V.,
Markova, N. G.,
Karaman-Jurukovska, N.,
Randolph, R. K.,
Su, J.,
Napoli, J. L.,
and Simon, M.
(1999)
Mol. Genet. Metab.
67,
62-73
|
| 30.
|
Lowry, O. H.,
Rosebrough, N. H.,
Farr, A. L.,
and Randall, R. J.
(1951)
J. Biol. Chem.
193,
265-275
|
| 31.
|
Tannin, G. M.,
Agarwal, A. K.,
Monder, C.,
New, M. I.,
and White, P. C.
(1991)
J. Biol. Chem.
266,
16653-16658
|
| 32.
|
Odermatt, A.,
Arnold, P.,
Stauffer, A.,
Frey, B. M.,
and Frey, F. J.
(1999)
J. Biol. Chem.
274,
28762-28770
|
| 33.
|
Veech, R. L.,
Eggleston, L. V.,
and Krebs, H. A.
(1969)
Biochem. J.
115,
609-619
|
| 34.
|
Simon, A.,
Hellman, U.,
Wernstedt, C.,
and Eriksson, U.
(1995)
J. Biol. Chem.
270,
1107-1112
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Zhang, P. Hu, C. R. Krois, M. A. Kane, and J. L. Napoli
Altered vitamin A homeostasis and increased size and adiposity in the rdh1-null mouse
FASEB J,
September 1, 2007;
21(11):
2886 - 2896.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. V. Belyaeva, S. V. Chetyrkin, A. L. Clark, N. V. Kostereva, K. S. SantaCruz, B. M. Chronwall, and N. Y. Kedishvili
Role of Microsomal Retinol/Sterol Dehydrogenase-Like Short-Chain Dehydrogenases/Reductases in the Oxidation and Epimerization of 3{alpha}-Hydroxysteroids in Human Tissues
Endocrinology,
May 1, 2007;
148(5):
2148 - 2156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Jones, S. Dickerson, P. M. Bhende, H.-J. Delecluse, and S. C. Kenney
Epstein-Barr Virus Lytic Infection Induces Retinoic Acid-responsive Genes through Induction of a Retinol-metabolizing Enzyme, DHRS9
J. Biol. Chem.,
March 16, 2007;
282(11):
8317 - 8324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. True, I. Coleman, S. Hawley, C.-Y. Huang, D. Gifford, R. Coleman, T. M. Beer, E. Gelmann, M. Datta, E. Mostaghel, et al.
A molecular correlate to the Gleason grading system for prostate adenocarcinoma
PNAS,
July 18, 2006;
103(29):
10991 - 10996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. R. Bauman, S. Steckelbroeck, M. V. Williams, D. M. Peehl, and T. M. Penning
Identification of the Major Oxidative 3{alpha}-Hydroxysteroid Dehydrogenase in Human Prostate That Converts 5{alpha}-Androstane-3{alpha},17{beta}-diol to 5{alpha}-Dihydrotestosterone: A Potential Therapeutic Target for Androgen-Dependent Disease
Mol. Endocrinol.,
February 1, 2006;
20(2):
444 - 458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. D. Nadauld, D. N. Shelton, S. Chidester, H. J. Yost, and D. A. Jones
The Zebrafish Retinol Dehydrogenase, rdh1l, Is Essential for Intestinal Development and Is Regulated by the Tumor Suppressor Adenomatous Polyposis Coli
J. Biol. Chem.,
August 26, 2005;
280(34):
30490 - 30495.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. D. Nadauld, I. T. Sandoval, S. Chidester, H. J. Yost, and D. A. Jones
Adenomatous Polyposis Coli Control of Retinoic Acid Biosynthesis Is Critical for Zebrafish Intestinal Development and Differentiation
J. Biol. Chem.,
December 3, 2004;
279(49):
51581 - 51589.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Jette, P. W. Peterson, I. T. Sandoval, E. J. Manos, E. Hadley, C. M. Ireland, and D. A. Jones
The Tumor Suppressor Adenomatous Polyposis Coli and Caudal Related Homeodomain Protein Regulate Expression of Retinol Dehydrogenase L
J. Biol. Chem.,
August 13, 2004;
279(33):
34397 - 34405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Steckelbroeck, Y. Jin, S. Gopishetty, B. Oyesanmi, and T. M. Penning
Human Cytosolic 3{alpha}-Hydroxysteroid Dehydrogenases of the Aldo-keto Reductase Superfamily Display Significant 3{beta}-Hydroxysteroid Dehydrogenase Activity: IMPLICATIONS FOR STEROID HORMONE METABOLISM AND ACTION
J. Biol. Chem.,
March 12, 2004;
279(11):
10784 - 10795.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Wood, V. L. Nelson, C. Ho, E. Jansen, C. Y. Wang, M. Urbanek, J. M. McAllister, S. Mosselman, and J. F. Strauss III
The Molecular Phenotype of Polycystic Ovary Syndrome (PCOS) Theca Cells and New Candidate PCOS Genes Defined by Microarray Analysis
J. Biol. Chem.,
July 11, 2003;
278(29):
26380 - 26390.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. N. Rexer and D. E. Ong
A Novel Short-Chain Alcohol Dehydrogenase from Rats with Retinol Dehydrogenase Activity, Cyclically Expressed in Uterine Epithelium
Biol Reprod,
November 1, 2002;
67(5):
1555 - 1564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Y. Kedishvili, O. V. Chumakova, S. V. Chetyrkin, O. V. Belyaeva, E. A. Lapshina, D. W. Lin, M. Matsumura, and P. S. Nelson
Evidence That the Human Gene for Prostate Short-chain Dehydrogenase/Reductase (PSDR1) Encodes a Novel Retinal Reductase (RalR1)
J. Biol. Chem.,
August 2, 2002;
277(32):
28909 - 28915.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|