JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M100072200 on April 6, 2001

J. Biol. Chem., Vol. 276, Issue 25, 22323-22331, June 22, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/22323    most recent
M100072200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuste, V. J.
Right arrow Articles by Comella, J. X.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuste, V. J.
Right arrow Articles by Comella, J. X.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Absence of Oligonucleosomal DNA Fragmentation during Apoptosis of IMR-5 Neuroblastoma Cells

DISAPPEARANCE OF THE CASPASE-ACTIVATED DNase*

Víctor J. YusteDagger, José R. Bayascas§, Núria Llecha, Isabel Sánchez-López, Jacint Boix, and Joan X. Comella

From the Grup de Neurobiologia Molecular, Departament de Ciències Mèdiques Bàsiques, Universitat de Lleida, 25198 Lleida, Spain

Received for publication, January 4, 2001, and in revised form, March 9, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Caspase-activated DNase is responsible for the oligonucleosomal DNA degradation during apoptosis. DNA degradation is thought to be important for multicellular organisms to prevent oncogenic transformation or as a mechanism of viral defense. It has been reported that certain cells, including some neuroblastoma cell lines such as IMR-5, enter apoptosis without digesting DNA in such a way. We have analyzed the causes for the absence of DNA laddering in staurosporine-treated IMR-5 cells, and we have found that most of the molecular mechanisms controlling apoptosis are well preserved in this cell line. These include degradation of substrates for caspases, blockade of cell death by antiapoptotic genes such as Bcl-2 or Bcl-XL, or normal levels and adequate activation of caspase-3. Moreover, these cells display normal levels of caspase-activated DNase and its inhibitory protein, inhibitor of caspase-activated DNase, and their cDNA sequences are identical to those reported previously. Nevertheless, IMR-5 cells lose caspase-activated DNase during apoptosis and recover their ability to degrade DNA when human recombinant caspase-activated DNase is overexpressed. Our results lead to the conclusion that caspase-activated DNase is processed during apoptosis of IMR-5 cells, making these cells a good model to study the relevance of this endonuclease in physiological or pathological conditions.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Programmed cell death or apoptosis is characterized by a set of morphological and biochemical events that are critical for embryonic development and tissue homeostasis in metazoans (reviewed in Refs. 1 and 2). Apoptosis has also been involved as an important phenomenon in many different human diseases (reviewed in Ref. 3). Shrinkage and fragmentation of the nucleus as well as the cell body and extensive degradation of chromosomal DNA are some of the most characteristic features of apoptosis (4). DNA fragmentation is a two-step process in which the DNA is first cleaved into 50-300-kilobase pair fragments (high molecular weight DNA degradation), that are subsequently degraded into smaller fragments of oligonucleosomal size (DNA ladder) (reviewed in Ref. 5). It is considered that only the high molecular weight DNA degradation is essential for cell death, because there are several cell types that never produce DNA ladders with treatments that induce the typical nuclear and cytoplasmatic changes of apoptosis. These cell types include the breast carcinoma-derived cell line MCF-7 (6), the human androgen-independent prostatic cancer cell DU-145 (7), the human neuronal-like cell NT2 (8), and some human neuroblastomas such as IMR-5 and IMR-32 (9).

Recently, an endonuclease that is activated specifically by caspase-3 during apoptosis has been described in human and mouse. The human gene for this protein has been named caspase-activated nuclease (10) or DFF40 (DNA fragmentation factor, 40 kDa subunit) (11), whereas the mouse homologue has been named caspase-activated DNase (CAD)1 (12). CAD is maintained inactive in the cytoplasm of normal cells because of its association with a protein that acts as a chaperone and inhibitor. This protein has been named the inhibitor of CAD (ICAD) in the mouse (13) or DFF45 (DNA fragmentation factor, 45 kDa subunit) in humans (14). Here we will refer to it as ICAD. It has been demonstrated that the enzymatic activity of CAD is induced when caspase-3 cleaves ICAD at two specific aspartic residues (Asp117 and Asp224), thus releasing CAD (12, 15). Activated CAD degrades the DNA at the internucleosomal regions, and analysis of this DNA in agarose gels shows a characteristic ladder pattern (14). Although, caspase-3 seem necessary for the laddering degradation of DNA, it is considered that apoptotic cell death can proceed without caspase-3 in some cell types. For example, cells derived from caspase-3 -/- mice or cells defective in this caspase (MCF-7) die without displaying oligonucleosomal DNA degradation when treated with pro-apoptotic stimuli (6, 16). Moreover, several types of cells derived from the ICAD-deficient mice lack internucleosomal DNA degradation, although these mice do not show major defects in development (17).

Very little information exists about the cell death process without DNA fragmentation, but it is assumed that the oligonucleosomal DNA degradation confers some advantages to the organism. Thus, for example, it has been proposed that DNA degradation may minimize the risk of transferring oncogenes from a doomed cell to an adjacent healthy cell or to a phagocyte (18). On the other hand, it has also been proposed that the failure to digest chromatin could be the basis for the pathogenesis of some autoimmune diseases in which antibodies against the heterochromatin are generated (19).

We have reported previously that human neuroblastoma IMR-5 does not show oligonucleosomal DNA fragmentation nor condensation of nuclear chromatin into the rounded masses typical of apoptosis when cells were treated with staurosporine (STP) (9). In the present report we have analyzed several regulatory mechanisms that control apoptosis in the IMR-5 cell line. We have not found major defects in caspase-3 protein levels or its protease activity, and caspase inhibitors or antiapoptotic genes such as Bcl-2 or Bcl-XL also block cell death. Moreover, ICAD or CAD protein levels are comparable with other cell lines that display oligonucleosomal degradation after induction of apoptosis, and the primary sequences of these two proteins are the same as that reported previously (GenBankTM accession numbers NM 004402 for CAD and NM 004401 for ICAD) (10, 11, 14, 20, 21). However, IMR-5 cells rapidly lose CAD during STP-induced apoptosis. We also observed that IMR-5 cells recover their ability to degrade DNA into oligonucleosomal fragments when engineered to overexpress mouse or human CAD, pointing out the importance of the relative levels of this nuclease. In conclusion, we demonstrate that processing of CAD could be a new regulatory step in the control of apoptosis and specifically during oligonucleosomal DNA degradation. Moreover, because the transgenic mouse with the deletion of the CAD gene is not currently available, IMR-5 cells could serve as an alternative model to test the relevance of oligonucleosomal degradation of DNA in normal cells or in pathological process such as viral infection.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Lines and Culture Procedures-- Human SH-SY5Y and IMR-5 cell lines employed in the present study were kindly provided by Dr. Dionisio Martín-Zanca (Salamanca, Spain). The cells were routinely grown in 75-cm2 culture flasks (Sarstedt, Newton, NC) containing 10 ml of Dulbecco's modified Eagle's medium supplemented with 2 mM L-glutamine, antibiotics, and heat-inactivated fetal bovine serum (Life Technologies, Inc.). IMR-5 cells were grown in the presence of 10% (v/v) fetal bovine serum, whereas SH-SY5Y cells were grown in 15% (v/v) fetal bovine serum. Medium was routinely changed every 3 days. Cells were maintained at 37 °C in a saturating humidity atmosphere containing 95% air and 5% CO2. For the different experiments, cells were grown at the adequate cell densities in culture dishes or multiwell plates (Corning, NY) using the same culture conditions as described above.

MTT Reduction and Trypan Blue Exclusion Cell Viability Assays and Chromatin Staining with Hoechst 33258-- MTT is a water-soluble tetrazolium salt that is reduced by metabolically viable cells to a colored, water-insoluble formazan salt. The procedure employed for this assay was the same as that described by Boix et al. (9).

For trypan blue staining, cells were seeded in 24-multiwell plates at 5 × 104 cells/well. After 24 h of seeding, cells were treated with STP at the adequate doses and times. Then cells were gently dissociated with a blue tip in their own culture medium, and a sample (100 µl) was taken and mixed with 20 µl of trypan blue solution (0.4%) (Sigma). Ten µl of the resulting cell suspension were counted with an hemocytometer. The results were expressed as percentages of trypan blue-stained cells over the total number of cells.

Nuclear morphology was assessed by staining cells with the Hoechst 33258, which is also known as bisbenzimide ([2'-(4-hydroxyphenyl)-5-(4-methyl-1-piperazinyl)-2,5'-bi-1H-benzimidazole trihydrochloride]) as established in our laboratory (9). The normal or apoptotic cell nuclei were visualized with an Olympus microscope equipped with epifluorescence optics under UV illumination.

Electron Microscopy-- Control or STP-treated cells growing in 35-mm culture dishes (1 × 106 cells) were gently pelleted by centrifugation and washed twice with phosphate-buffered saline (PBS) (150 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.2). Fixation was performed with 100 mM phosphate buffer, pH 7.4, containing 2.5% glutaraldehyde for 30 min at 4 °C. The pellets were rinsed twice with cold PBS, postfixed in buffered OsO4, dehydrated in graded acetone, and embedded in Durcupan ACM resin (Fluka, Buchs, Switzerland). Ultrathin sections were obtained, mounted in copper grids, and counterstained with uranyl acetate and lead citrate. The specimens were observed with a Zeiss EM910 electron microscope.

DNA Degradation Analysis-- Cells grown in 35-mm culture dishes (1 × 106 cells) were collected in their culture medium, pelleted at 400 × g for 5 min, and rinsed twice with PBS. The pellet was homogenized in 600 µl of lysis buffer (0.5 M EDTA, 1% lauryl sarcosine, 10 mM Tris-HCl, pH 9.5) by pipetting through a blue cone. Homogenates were clarified by centrifuging at 13,000 × g for 15 min, and supernatants were collected to a new tube in which they were extracted with phenol:chloroform:isoamyl alcohol (25:24:1) (Iberlabo, Madrid, Spain). DNA was precipitated with two volumes of cold ethanol and 0.5 volumes of 7.5 M ammonium acetate. Precipitated DNA was washed once in 70% ethanol and resuspended in 1 mM EDTA, 10 mM Tris-HCl, pH 8.0 containing DNase-free RNase at a final concentration of 20 µg/ml. DNA was analyzed in 1.5% agarose gel in 1 mM EDTA, 40 mM Tris acetate, pH 7.6.

Protein Extractions and Western Blotting-- Approximately 2 × 106 cells/condition were detached from the 60-mm culture dish, pelleted at 400 × g for 5 min, and washed twice with PBS. Then cells were lysed with 100 µl of RIPA buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 1% deoxycholate, 0.1% SDS, 1 mM PMSF) for nuclear protein extracts or with Nonidet P-40 buffer (10 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM NaCl, 5 mM dithiothreitol, 1 mM PMSF, 0.05% Nonidet P-40) for cytosolic protein extracts. The pellets were clarified by centrifuging at 13,000 × g for 10 min at 4 °C. The protein in the supernatants was quantitated using the Bio-Rad DC protein assay, and 25-50 µg of protein were loaded in SDS-polyacrylamide gels. The proteins were electrophoresed and electrotransferred to polyvinylidene difluoride Immobilon filters (Millipore, Bedford, MA) with a semidry apparatus following the instructions of the supplier (Hoefer, Amersham Pharmacia Biotech). Then filters were reacted with the appropriate specific primary antibodies and incubated with the adequate secondary antibodies conjugated with peroxidase (Sigma). Finally, immunoblots were developed with the SuperSignal West Dura Extended Duration Substrate (Pierce) for the detection of caspase-3 fragments and CAD and with the ECL system (Amersham Pharmacia Biotech) for the rest.

DEVD-directed Caspase Activity-- We developed a new method to quantify DEVD-directed caspase activity. The cells were grown onto 96-well multiplates at 4 × 104 cells/well. After 24 h, the cells were treated with STP and then lysed by adding 1 volume of Ac-DEVD-afc lysis buffer 2-fold concentrated containing the fluorogenic substrate Ac-DEVD-afc (Enzyme Systems Products, Livermore, CA). Ac-DEVD-afc 2 × lysis buffer buffer is 40 mM Hepes/NaOH, pH 7.2, 300 mM NaCl, 20 mM dithiothreitol, 10 mM EDTA, 0.2% CHAPS, 2% Nonidet P-40, 20% sucrose plus 50 µM of Ac-DEVD-afc. The plates were incubated for 12 h at 37 °C and then read in a Bio-Tek FL 600 fluorimeter (Izasa, Spain) at 360 nm (40 nm bandwidth) of excitation and 530 nm (25 nm bandwidth) of emission.

For quantitative DEVD-like activity in cell lysates, cells were seeded onto 35-mm culture plates and, after treatment, were detached, washed twice with PBS, and lysed with Ac-DEVD-afc lysis buffer without the Ac-DEVD-afc. The supernatant was clarified by centrifuging at 13,000 × g in a microcentrifuge at 4 °C, and the protein was quantitated using the Bio-Rad protein assay Bradford-based method. Twenty-five µg of protein were added to 100 µl of the same lysis buffer containing 20 µM of Ac-DEVD-afc. The samples were incubated at 37 °C for 6 h and read with the fluorimeter.

Preparation of SH-SY5Y and IMR-5 Nuclei-- Nuclei were obtained as described previously (22, 23) with minor modifications. Cells were grown in 75-cm2 culture flasks, and 1 × 108 cells were harvested by centrifugation at 200 × g for 5 min. After three washes with PBS and one with nuclei isolation buffer (NIB; 10 mM Pipes, pH 7.4, 10 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, 10 µM cytochalasin B, 1 mM PMSF), cells were resuspended in 10 volumes of NIB and transferred to a Dounce-type homogenizer. Cells were swelled for 30 min at 4 °C and gently lysed with 25 strokes of the pestle. Then nuclei were layered over a 30% (w/v) sucrose cushion in NIB and centrifuged at 800 × g for 10 min. Supernatant was discarded, and the pellet was washed three times in NIB. Finally, nuclei were resuspended in nuclear storage buffer (10 mM Pipes, pH 7.4, 80 mM KCl, 20 mM NaCl, 250 mM sucrose, 5 mM EGTA, 1 mM dithiothreitol 0.5 mM spermidine, 0.2 mM spermine, 1 mM PMSF, 50% (v/v) glycerol) at 1 × 108 nuclei/ml and kept at -80 °C until used.

Preparation of Cytosolic Extracts and Reconstitution of the Cell-free System-- Cytosolic extracts were obtained from cells treated with 100 nM of STP for 24 h or from control untreated cells. Cells were collected and centrifuged at 200 × g for 5 min, washed three times with PBS, resuspended in a buffer containing 10 mM Hepes/KOH, pH 7.2, 2 mM MgCl2, 5 mM EGTA, 50 mM NaCl, 5 mM dithiothreitol, 1 mM PMSF, 20% glycerol, 1% Nonidet P-40, and swelled at 4 °C for 15 min. The lysates were centrifuged in a microcentrifuge at 4 °C, and the supernatants were quantitated with Bio-Rad protein assay Bradford-based method.

To reconstitute the system, cytosolic extracts and purified nuclei from the different conditions were adequately combined. Thus, 150 µg of protein from cytosolic extracts and 5 × 105 of nuclei were incubated at 37 °C for 2 h in a buffer containing an ATP-regenerating system (2 mM ATP, 10 mM phosphocreatine, 50 µg/ml creatine kinase) and 1 mg/ml of bovine serum albumin. Reactions were stopped by adding 5 mM of EDTA, and the DNA was extracted with phenol:chloroform:isoamyl alcohol (25:24:1) and ethanol precipitation. DNA laddering was analyzed in a 1.8% agarose gel.

Sequencing of hICAD and hCAD-- One microgram of RNA from either IMR-5 or SH-SY5Y was treated with 2 units of DNase RNase-free (Amersham Pharmacia Biotech) and was reverse transcribed using 10 pmol of the specific downstream primer (ICAD-R or CAD-R; see below) for 1 h at 42 °C. Approximately 10 ng of cDNA was amplified by polymerase chain reaction in a PerkinElmer thermal cycler 2400 with 200 nM each primer. The polymerase chain reaction conditions were 94 °C for 20 s, 65 °C for 20 s, and 72 °C for 1 min for 35 cycles in 50 mM Tris-HCl, pH 9.0, 2.5 mM MgCl2, 15 mM (NH4)2SO4, 0.1% Triton X-100, and 1 unit of DyNAzime-EXT DNA polymerase (Finnzymes). Primers used were CAD-F (TGCAATGCTCCAGAAGCCCAAGAGC) and CAD-R (TCACTGGCGTTTCCGCACAGGCTG), which amplify a band of 1120 base pairs corresponding to the whole open reading frame of CAD (GenBankTM accession number NM 004402); and ICAD-F (CGCTCCGGCCTCCCGCGACTTCTCG) and ICAD-R (GGCGTGAGCCACTGCGCCTGGCCAA), which cover a 1353-base pair region containing the ICAD open reading frame (GenBankTM accession number NM 004401). The polymerase chain reaction products were automatically sequenced in both direction in an ABI PRISM 310 automatic sequence analyzer (PerkinElmer).

Subcloning and Constitutive Transfection of Bcl-2, Bcl-XL, hCAD, and hICAD-- MTbcl-2TKNeo (24) and pSFFVNeobcl-XL (25) plasmids have been described previously. DNA inserts were subcloned into the pcDNA3 mammalian expression vector. (Invitrogen BV, Leek, The Netherlands). We also cloned ICAD and CAD full-length open reading frame sequence into the pcDNA3 vector. The constructs were named pcDNA3/bcl-2, pcDNA3/bcl-XL, pcDNA3/hCAD, and pcDNA3/hICADL. IMR-5 cells were transfected with different constructs using LipofectAMINE Plus reagent (Life Technologies, Inc.). Stably transfected cells were selected with 500 µg/ml G-418 (geneticin) (Life Technologies, Inc.) and were used as a pool.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

STP-induced Apoptosis in IMR-5 Cells Proceeds without High Nuclear Chromatin Condensation or Oligonucleosomal Degradation of DNA-- STP is an unspecific protein kinase inhibitor that has been widely used as a classic and potent inductor of apoptosis in many different cell types (26-29). In a previous report, we characterized STP-induced cell death in several human neuroblastoma cell lines (9) and found two of them, IMR-5 and IMR-32, that underwent atypical apoptotic cell death. Here we further characterize this cell death to determine precisely which can be the alteration responsible of this phenotype. SH-SY5Y neuroblastoma-derived cell line was used as a control. STP induces cell death with a similar dose-dependent profile in both cell lines as measured by MTT assay or trypan blue staining (Fig. 1, A and B, respectively). Furthermore, for a given dose of STP (125 nM), the time course of cell death was comparable in both SH-SY5Y and IMR-5 cells, and about half the cells initially plated died after 12-18 h (Fig. 1C). However, nuclear morphology and DNA laddering were two distinguishable features between these two cell lines upon STP treatment (9). A ladder pattern of DNA fragmentation was clearly visible in STP-treated SH-SY5Y cells, whereas it never appeared in IMR-5 cells at any of the concentrations or times tested (Fig. 1D). When the nuclear chromatin was stained with Hoechst 33258, SH-SY5Y nuclei exhibited the typical apoptotic morphology, whereas IMR-5 chromatin was found to be condensed in the marginal zones of the nucleus (Fig. 2A). The ultrastructural analysis of IMR-5 cells treated with STP revealed important nuclear modifications; chromatin was condensed and formed marginal and irregular masses of heterochromatin in a coarse pattern (Fig. 2B) that has been previously defined as stage I nuclear condensation (30). However, the characteristic high nuclear chromatin condensation typical of apoptosis (defined previously as stage II (30)) was never found in STP-treated IMR-5 cells, although it was clearly apparent in SH-SY5Y (Fig. 2B).


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1.   IMR-5 cells die upon STP treatment but do not show oligonucleosomal DNA degradation. A and B, SH-SY5Y and IMR-5 cells grown in 96-well dishes (A) or in 24-well dishes (B) were treated with STP in the range of 7.8-4 × 103 nM. After 24 h, cell viability was measured with the MTT assay (Fig. 1A) or with trypan blue staining (Fig. 1B). Filled circles (A) and bars (B) represent IMR-5 cells, whereas empty circles (A) and bars (B) are SH-SY5Y cells. C, time course analysis of cell death in SH-SY5Y and IMR-5 cells with 125 nM STP. The symbols are as in A. D, SH-SY5Y (upper panel) and IMR-5 (lower panel) cells were treated with increasing concentrations of STP (125, 250, 500, and 1000 nM) for the indicated times, and genomic DNA was analyzed by conventional agarose gel electrophoresis. Note the complete absence of DNA laddering in all the conditions of IMR-5 cells. lambda /H, lambda  DNA digested with HindIII marker (Promega).


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 2.   Absence of high nuclear chromatin condensation in IMR-5 cells treated with STP. SH-SY5Y cells (left column) and IMR-5 cells (right column) were treated with 100 nM STP for 24 h (all panels in A and bottom panels in B) or left untreated (top panels in B). Then cells were stained with Hoechst 33258 (A) or included in Durcupan and processed for electron microscopy (B). Note that treatment of IMR-5 cells with STP induces an incomplete condensation of the nuclear chromatin. The lower panels in A are high magnifications of the cells framed in upper panels. The bars indicate 20 µm in the top panels in A and 2 µm for all panels in B.

To rule out the possibility that the lack of oligonucleosomal DNA fragmentation could be a specific feature of STP treatment, we tested a set of apoptotic inducers at different doses and times. These included DNA-damaging agents (camptothecin (100 µM), etoposide (100 µM), N-nitroso-N-methylurea (5 mM), and cisplatin (50 µM)), protein kinase inhibitors (H-7 (100 µM) and roscovitine (50 µM)), cytoskeleton-disrupting agents (vinblastine (100 µM), nocodazole (50 µM), and colchicine (10 µg/ml)), and macromolecular synthesis inhibitors (cycloheximide (2 µg/ml) and actinomicin D (5 µg/ml)). (The highest doses tested are indicated in parentheses.) None of these compounds was able to induce ladder formation in IMR-5 cells at the doses and times that efficiently promoted laddering in SH-SY5Y (data not shown). Moreover, all of these drugs were capable of inducing cell death in both SH-SY5Y and IMR-5 cells as measured by trypan blue and MTT assays (data not shown). Thus, the inability of STP to induce an apoptotic phenotype in IMR-5 cells seemed to be due to an intrinsic defect of these cells rather than to an incapacity of STP to lead the nuclear apoptotic changes.

Pro-survival Members of Bcl-2 Family Prevent STP-induced Cell Death in IMR-5 Cells-- Antiapoptotic members of the Bcl-2 family have been shown to protect several cell models from STP-induced apoptosis (31, 32). To gain further information on the cell death induced by STP in our experimental system, we analyzed the ability of Bcl-XL or Bcl-2 to prevent STP-induced IMR-5 cell death. For this purpose, we obtained stable pools of transfected cells with any of these two genes, and STP-induced cell death was measured using the MTT assay (Fig. 3A). Both Bcl-2 and Bcl-XL overexpression afforded a significant protection against cell death at all the concentrations of STP tested. At the highest doses, Bcl-2 was slightly more efficient than Bcl-XL. However, neither of the two proteins was able to prevent cell death when the STP concentrations were higher than 5 µM. Western blot analysis of the transfected cells showed increased levels of the corresponding protein (Fig. 3B).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.   Antiapoptotic members of the Bcl-2 family block apoptotic cell death induced by STP in IMR-5 cells. A, IMR-5 cells transfected with pcDNA3/bcl-2 (empty squares), pcDNA3/bcl-XL (empty triangles), or empty pcDNA3 (filled circles) were treated with increasing concentrations of STP for 24 h, and viability was assessed with the MTT assay. B, cells transfected with empty pcDNA3 vector (lane 1), pcDNA3/bcl-2 (lanes 2), or pcDNA3/bcl-XL (lanes 3) used in A were analyzed for levels of Bcl-2 and Bcl-XL Note the increased levels of Bcl-2 or Bcl-XL in the corresponding transfected cells.

STP-induced Cell Death Is a Caspase-dependent Process-- It has been demonstrated that caspase-3-deficient mice or MCF-7 cells enter apoptosis with an atypical morphology (similar to the one described above for IMR-5 cells) and are unable to degrade DNA into oligonucleosomal fragments (6, 16). Therefore, an alteration in the caspase-3 function seemed a good explanation for the phenotype observed in STP-treated IMR-5 cells. Consequently, we analyzed the state of caspase activation in our system. When a broad spectrum caspase inhibitor such as z-VAD-fmk was added to the culture medium of IMR-5 cells, the IC50 for STP-induced cell death shifted from 100 nM in untreated cells to 500 nM in cells treated with 50 µM z-VAD-fmk, as measured with the MTT assay (Fig. 4A). Comparable results were obtained using the trypan blue staining (not shown). When high doses of STP (>1 µM) were used, z-VAD-fmk was no longer able to prevent a loss of mitochondrial reduction potential (Fig. 4A).


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4.   Caspase inhibitors block apoptotic cell death induced by STP in IMR-5 cells. A, IMR-5 cells were treated with different concentration of STP with (open circles) or without (filled circles) 50 µM z-VAD-fmk, and cell viability was measured after 24 h using the MTT assay. B, RIPA extracts from SH-SY5Y and IMR-5 untreated cells (con) or cells treated for 6 h with 500 nM of STP alone (STP) or with 50 µM z-VAD-fmk (S+V) were analyzed by Western blot with the indicated specific antibodies against poly(ADP-ribose) polymerase (PARP), fodrin, or lamin B1 to analyze the caspase-mediated degradation of these proteins. The apparent molecular mass of the unfragmented protein or the specific fragments is indicated on the right of the panel. C, analysis of DNA degradation of the same samples used in B. Note the absence of DNA laddering in all IMR-5 cell conditions and the complete prevention of DNA laddering afforded by z-VAD-fmk in STP-treated SH-SY5Y cells.

Several proteins were specifically cleaved during apoptosis as a consequence of caspase activation. Thus, for example, nuclear lamins are substrates for caspase-6 (33, 34), caspase-7 cuts poly(ADP-ribose) polymerase (35), and fodrin is specifically cut by caspase-3 (36). The detection of specific fragments of these proteins are normally considered to be good markers of the involvement of these caspases in the apoptotic process. We therefore analyzed whether the different substrates appeared after STP treatment of IMR-5 cells. As shown in Fig. 4B, poly(ADP-ribose) polymerase, lamin B1, and fodrin were specifically cleaved in IMR-5 and SH-SY5Y STP-treated cells, with no major differences between cell lines. Moreover, the addition of z-VAD-fmk to the culture medium completely prevented the appearance of these fragments, therefore suggesting a regulated and specific cleavage. Finally, we assessed whether caspase activation was a necessary step for the oligonucleosomal fragmentation of DNA. As could be expected, STP induced DNA laddering in SH-SY5Y cells but not in IMR-5 cells. Moreover, z-VAD-fmk completely prevented the typical oligonucleosomal DNA degradation after STP treatment in SH-SY5Y cells (Fig. 4C).

Finally, to analyze directly the state of caspase-3 activation in STP-treated IMR-5 cells, we carried out two types of analysis. First, Western blots were performed using extracts from STP-treated IMR-5 cells, and procaspase-3 and its active p17 subunit were immunodetected in a Western blot using a specific antibody against recombinant human caspase-3. Extracts from SH-SY5Y cells, which have been shown to contain functional caspase-3 (37), were included as a positive control (Fig. 5A). We detected a specific fragment of 17 kDa in IMR-5 cells treated with 1 µM STP for 6 h. The appearance of this fragment was completely prevented by treating IMR-5 cells simultaneously with STP and 50 µM of z-VAD-fmk. We therefore conclude that IMR-5 cells are able to activate caspase-3 during the cell death process induced by STP. On the other hand, we also analyzed the activation of caspases with DEVD cleavage preference, such as caspase-3, using the fluorogenic substrate Ac-DEVD-afc. STP was able to induce an increase in DEVD-directed activity in both IMR-5 and SH-SY5Y cells with a comparable activation profile (Fig. 5B). Although IMR-5 cells degraded the DEVD substrate at lower concentrations of STP, the maximal activity was comparable in both cell lines (Fig. 5, B and C). The increase in the DEVD-directed caspase activity induced by STP in both cell lines was completely prevented when cells were simultaneously treated with z-VAD-fmk (Fig. 5C).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Caspase-3 is properly processed and activated in STP-treated IMR-5 cells. A, SH-SY5Y and IMR-5 cells were treated for 6 h with 5 µM (SH-SY5Y) or 1 µM (IMR-5) of STP (STP), treated with STP plus 50 µM z-VAD-fmk (S+V), or left untreated (con). The caspase-3 cleavage was analyzed in Nonidet P-40 cytoplasmic extracts by Western blot technique. Procaspase-3 and its large active fragment (p17) were immunodetected with a specific polyclonal antibody (Pharmingen). B, SH-SY5Y (empty circles) and IMR-5 (filled circles) cells grown in 96-well multiplates were treated with different concentrations of STP, and after 24 h, DEVD-like activity was measured as described under "Experimental Procedures." The results are represented as percentages with respect to untreated control cells (100%). C, SH-SY5Y and IMR-5 cells were treated for 12 h with 500 nM of STP (STP) or with STP plus z-VAD-fmk (S+V). Control cultures included were untreated cells (con) or simultaneously treated with Me2SO plus STP (S+D). A quantitative DEVD-directed activity assay was performed, and the results are shown as the number of picomoles of 7-amino-4-trifluoromethyl coumarin/µg of protein/min released from fluorogenic substrate.

In conclusion, these results demonstrate that IMR-5 cells have a fully functional caspase system that includes caspase-3. Therefore, it seems that the incapacity to degrade DNA in IMR-5 cells is due to a defect in a step downstream from the caspase activation, most probably in the endonuclease system.

Cell-free System Experiments-- One possibility to explain the IMR-5 phenotype is that its chromatin is resistant to endonuclease degradation. To further delimit whether the defect of IMR-5 cells is localized in the cytoplasm or in the nucleus, we performed cell-free apoptosis as described under "Experimental Procedures." SH-SY5Y and IMR-5 cells were treated with 100 nM STP during 24 h, and the cytosolic extracts were obtained. Likewise, nuclei from untreated SH-SY5Y or IMR-5 cells were purified. Then nuclei and cytoplasms from the different conditions were combined and incubated for 2 h at 37 °C. After incubation, the nuclear DNA was extracted and analyzed by conventional agarose electrophoresis. As shown in Fig. 6A, when IMR-5 nuclei were incubated with cytosolic extracts from STP-treated SH-SY5Y cells, a laddering of DNA degradation was found. Nonetheless, cytosolic protein extracts from IMR-5 cells similarly pretreated were unable to generate oligonucleosomal DNA fragmentation on purified IMR-5 (Fig. 6A) or SH-SY5Y nuclei (not shown). It could be argued that DNA laddering in IMR-5 nuclei treated with apoptotic cytoplasms of SH-SY5Y cells might result from DNA oligonucleosomal fragments present in these extracts as a consequence of STP pretreatment. This seems not to be the case because agarose gel electrophoresis of the apoptotic cytosolic extracts from STP-pretreated SH-SY5Y cells did not show the presence of detectable quantities of DNA either intact or degraded (Fig. 6A). To exclude the possibility that the absence of caspase-3-like activity could be responsible for the failure of oligonucleosomal DNA degradation in the IMR-5 cell extracts, we performed a DEVD-directed caspase activity assay. As shown in Fig. 6B, cytosolic extracts from STP-treated IMR-5 cells had an activity similar to that found in extracts from similarly treated SH-SY5Y cells. Therefore, it can be concluded that the absence of DNA laddering in IMR-5 cells is due to a deficiency in the apoptotic mechanisms localized in their cytosol rather than to an intrinsic defect in their nuclear chromatin.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 6.   Cell-free system studies demonstrate that IMR-5 nuclei are able to degrade DNA into oligonucleosomal fragments. A, cell lysates were obtained from SH-SY5Y or IMR-5 cells treated (STP) or not (con) with 100 nM of STP for 24 h. Nuclei from untreated IMR-5 cells were incubated with 150 µg of protein from cytoplasmic extracts. DNA was extracted and analyzed with conventional agarose gel electrophoresis and ethidium bromide staining. Note the oligonucleosomal DNA degradation in IMR-5 nuclei incubated with apoptotic cytoplasms from SH-SY5Y cells. Note also that cytosolic lysates from STP-treated SH-SY5Y cells do not contain significant amounts of DNA (isolated lane on the right). B, the same cell lysates used in A were subjected to quantitative DEVDase assay. Fifty µg of cell lysates from SH-SY5Y and IMR-5 cells treated with STP (STP) or left untreated (con) were incubated with Ac-DEVD-afc for 30 min; the luminometer values are expressed as arbitrary units.

Analysis of the ICAD/CAD System of IMR-5 Cells-- The endonuclease system responsible for the DNA degradation in eukaryotic cells requires only three elements: caspase-3, ICAD, and CAD (12, 14). Because we have discarded a problem in the caspase-3 function and in the chromatin of IMR-5 cells, we further analyzed the ICAD/CAD system. Western blot analysis showed that IMR-5 and SH-SY5Y cells have comparable CAD and ICAD protein levels (Fig. 7A). The cDNAs corresponding to the open reading frame of both proteins from IMR-5 and SH-SY5Y cells were obtained and were entirely sequenced in both directions. The results show that the sequences were identical between both cell lines and were actually the same as those reported previously (Refs. 10, 11, 14, 20, and 21; see "Experimental Procedures"). Furthermore, we also analyzed the ICAD processing after STP-induced cell death and found that it was correct because the p11 fragment corresponding to the carboxyl-terminal part of the protein was detected by Western blot. This fragment results from the specific cleavage of caspase-3 at the residue Asp224 of ICAD (13, 14) (Fig. 7B, upper panel). Unexpectedly, when we monitored the levels of CAD during STP treatment in the same cellular extracts, we observed that CAD disappeared in IMR-5 cells but remained unchanged in SH-SY5Y cells (Fig. 7B, lower panel). CAD disappearance in IMR-5 cells was a time-dependent phenomenon, and it was completed after 5-8 h of 500 nM STP treatment (Fig. 8A), a time course similar, although slightly delayed, to that observed for the activation of caspase-3 as demonstrated by fodrin degradation (Fig. 8A). CAD loss was a specific event because proteins that are known to be resistant to degradation during apoptosis, such as extracellular-regulated kinases (ERKs) (38), did not decrease after STP treatment of IMR-5 cells. Moreover, simultaneous treatment of cells with STP and z-VAD-fmk completely prevented both CAD and fodrin degradation (Fig. 8B). These data demonstrated that the process is absolutely dependent on caspase activation.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 7.   ICAD and CAD levels in SH-SY5Y and IMR-5 cells. ICAD processing and complete CAD disappearance in STP-treated IMR-5 cells. A, cell lysates from untreated SH-SY5Y or IMR-5 cells were analyzed by Western blot using specific antibodies against ICAD (Santa Cruz Biotechnology). Membrane was stripped and reprobed with a CAD antibody (Chemicon International) and subsequently with an specific monoclonal antibody against beta -actin (Sigma) to control protein content. B, analysis of the processing of ICAD was performed by Western blotting using an ICAD carboxyl-terminal specific antiserum (Santa Cruz Biotechnology). SH-SY5Y and IMR-5 cells were treated with 500 nM STP for 6 h or left untreated, and the processing of ICAD was examined. Generation of the p11 ICAD subunit (arrow labeled p11) resulting from the specific cleavage of caspase-3 at the Asp224 is observed in both cell lines. Note that in the same samples, CAD is completely degraded in STP-treated IMR-5 cells (lower panel).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8.   Analysis of the CAD disappearance in STP-treated IMR-5 cells and dependence on caspase activation. A, protein extracts from SH-SY5Y and IMR-5 cells treated with 500 nM STP for the indicated times were analyzed by Western blotting using an anti-CAD antibody (top panel). Note that CAD completely disappears after 8 h of STP treatment in the IMR-5 cells. The membrane was stripped and reprobed with an anti-fodrin monoclonal antibody (middle panel) to assess caspase-3 activation and further stripped and reprobed with an anti-pan-ERK antibody to control protein loading and nonspecific proteolysis (bottom panel). B, cell lysates from IMR-5 cells treated with 1 µM STP alone or with 1 µM STP plus 50 µM z-VAD-fmk for the indicated times were submitted to Western blot using the same protocol and antibodies as in A. Note that z-VAD-fmk completely abolishes CAD and fodrin degradation at any of the times tested. C, time course of CAD degradation in empty pcDNA3- or pcDNA3/hCAD-transfected IMR-5 cells treated with 500 nM STP. Stripping and reprobing of the membrane with anti-fodrin and pan-ERK antibody was performed as in A. Note that overexpression of hCAD prevents its disappearance at the times and STP concentration analyzed.

Overexpression of hCAD into IMR-5 Rescues DNA Laddering and Stage II Nuclear Morphology-- CAD disappearance could be a relevant phenomenon to explain the absence of oligonucleosomal DNA degradation. To further analyze this hypothesis, we generated clones of IMR-5 cells stably transfected with human CAD. In cells overexpressing CAD, the levels of this protein were significantly higher than in empty pcDNA3-transfected clones (Fig. 8C). Moreover, CAD-transfected IMR-5 cells showed remarkable levels of this protein even after 9 h of STP treatment (Fig. 8C), even though caspases are activated as demonstrated by fodrin cleavage (Fig. 8C). When we analyzed the nuclear morphology of CAD-transfected IMR5 cells, the high nuclear chromatin condensation typical of the stage II of nuclear apoptosis could be observed (Fig. 9, A and B). When we analyzed STP-induced apoptosis in CAD overexpressing cells, DNA laddering could also be observed (Fig. 9C). We finally analyzed which was the result of overexpressing ICADL in IMR-5 cells, and as could be expected, this strategy did not result in the appearance of DNA ladder degradation (Fig. 9C) or stage II nuclear morphology (not shown) after STP treatment. However, double transfection of IMR-5 cells with CAD and ICADL induced DNA laddering after STP treatment (Fig. 9C). We further analyzed which was the effect of CAD overexpression in cell viability after STP treatment. No significant differences were observed between CAD overexpressing cells and empty pcDNA3-transfected cells using trypan blue counting or MTT assay (data not shown). Finally, we studied the caspase activity dependence of the DNA laddering degradation during apoptosis of cells overexpressing CAD. As shown in Fig. 9C, inclusion of z-VAD-fmk in STP-treated cultures completely prevented oligonucleosomal degradation. Similar results to those described above were also found in IMR-5 cells stably transfected with mouse CAD (data not shown).


View larger version (72K):
[in this window]
[in a new window]
 
Fig. 9.   Overexpression of human CAD in IMR-5 cells restores oligonucleosomal DNA degradation and apoptotic nuclear morphology. A and B, IMR-5 cells transfected with empty pcDNA3 (left panels) or with pcDNA3/hCAD (right panels) were treated with 100 nM STP for 24 h (A and bottom panels in B) or left untreated (top panels in B). Then cells were stained with Hoechst 33258 (A) or included in Durcupan and processed for electron microscopy (B). Note that STP treatment of hCAD-transfected IMR-5 cells induces a higher chromatin condensation when compared with empty pcDNA3-transfected cells. The bars indicate 20 µm in A and 2 µm in B. C, IMR-5 cells transfected with empty pcDNA3, pcDNA3/hCAD, or pcDNA3/hICADL or double transfected with pcDNA3/hCAD and pcDNA3/hICADL were treated for 12 h with 500 nM STP (STP), 500 nM STP plus 50 µM z-VAD-fmk (STP + VAD), or left untreated (control). DNA was extracted and analyzed by conventional agarose gel electrophoresis.

Taken together our results suggest that the major alteration of IMR-5 cells is an atypical loss of CAD that precludes the appearance of nuclear changes associated with apoptosis, i.e. DNA oligonucleosomal degradation and stage II nuclear morphology.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this report we have analyzed the molecular mechanisms that could be involved in the lack of some hallmarks of apoptosis when the IMR-5 neuroblastoma cells are subjected to diverse apoptotic stimuli including STP. These cells die without digesting their DNA into oligonucleosomal fragments and do not exhibit the typical nuclear apoptotic condensation. Instead, IMR-5 nuclei show a marginal chromatin condensation that never gives rise to the nuclear apoptotic bodies. IMR-5 cells activate caspases, and cell death can be prevented by the addition of chemical inhibitors of these proteases or by the forced overexpression of Bcl-2 or Bcl-XL antiapoptotic genes. These data suggest that these cells die by apoptosis after STP treatment but do not display some of the typical nuclear changes.

It is considered that caspase-3, ICAD, and CAD are the minimal elements required to induce oligonucleosomal DNA degradation (12, 14). It has been described that caspase-3-deficient cells undergo apoptosis without DNA laddering (6, 16). However, this does not seem to be the case in IMR-5 cells, because they have a functional caspase-3 that is able to process fodrin and ICAD. Cell-free experiments also demonstrate that IMR-5 chromatin is not resistant to endonuclease degradation. Moreover, Western blot analysis shows that IMR-5 and SH-SY5Y cells contain comparable levels of CAD protein, and cDNA sequencing revealed that CAD from IMR-5 was not mutated. Surprisingly, analysis of the protein content by Western blot showed that CAD from IMR-5 completely disappeared after 5-8 h of STP treatment. Moreover, the DNA laddering and the apoptotic nuclear phenotype of IMR-5 cells treated with STP can be rescued when CAD is overexpressed in these cells. These results suggest that in IMR-5 cells treated with STP, CAD could suffer a caspase-dependent degradation prior to the oligonucleosomal DNA degradation. Increasing the levels of CAD by transfection allows IMR-5 cells to produce enough endonuclease to digest DNA. Interestingly, when STP and z-VAD-fmk were simultaneously added to culture medium of IMR-5, CAD disappearance was completely prevented. Loss of CAD is not a unspecific event because several proteins that are degraded during apoptosis (such as fodrin, poly(ADP-ribose) polymerase, or lamin B1) show behavior similar to that observed for CAD, i.e. they are degraded upon apoptosis induction in a caspase-dependent manner. Moreover, ERK, a protein that is not fragmented after apoptotic stimuli (38), remained intact in STP-treated IMR-5 cells. Although the disappearance of CAD from IMR-5 cells is dependent on caspase activation, analysis of the primary structure of CAD protein does not suggest that CAD could be directly cut by caspases (Ref. 14 and data not shown). The nuclear morphology observed in IMR-5 cells treated with STP resembles that reported by Susin and co-workers after microinjection of recombinant apoptosis-inducing factor into mouse embryonic fibroblasts (30). These authors classify this nuclear condensation apoptosis-inducing factor microinjection as stage I, whereas the nuclear morphology corresponding to the highly packaged chromatin is defined as stage II. The authors demonstrate that stage II condensation is only achieved when recombinant active CAD is microinjected. Moreover, nuclear stage II phenotype is associated with the appearance of DNA oligonucleosomal fragmentation. Because CAD primary sequence is normal in IMR-5 cells and CAD disappears after STP treatment, it is reasonable to think that the major defect of IMR-5 cells is a deregulation in the mechanisms that govern CAD turnover or degradation. However, these mechanisms are currently unknown, and further efforts should be devoted to understanding them. In this regard, it should be noted that degradation of CAD is not the sole mechanism that could explain its disappearance upon IMR-5 apoptosis. Thus, for example it could be possible that apoptotic stimuli could block CAD synthesis, and this could result in a progressive decrease in the cytosolic CAD levels. However, this does not seem to be the case in our system, because blockade of the protein synthesis with cycloheximide (doses of up to 2 µg/ml and times up to 24 h) did not significantly modify the CAD levels (data not shown).

The relevance of the oligonucleosomal degradation of the chromatin during the apoptotic process remains an open question, but it seems clear that it is not directly involved in the cell decision to die and operates at the end of the apoptotic program. Thus, enucleated cells can die by apoptosis, and pharmacological inhibitors of DNases cannot prevent cell death (39). However, the adequate disintegration of the DNA might be an important event because the insufficient digestion of the chromatin could be involved in several pathologies (for review, see Refs. 40 and 41). It has been proposed that nondegraded cellular or viral DNA can lead to neoplastic transformations because it could be transferred from doomed to normal cells (18). Moreover, intact nucleosomes are potential immunogens and could be responsible for the generation of the autoantibodies found in the sera of individuals with autoimmune diseases such as systemic lupus erythematosus (19). Finally, it has also been proposed that the phagocytic activity of healthy cells located close to an apoptotic cell can be facilitated if the chromatin of apoptotic bodies is already fragmented (40).

The relevance of the ICAD/CAD system in the physiological degradation of the apoptotic DNA remains controversial. Recently, several reports have demonstrated that this system is not absolutely necessary and that alternative ways exist to degrade apoptotic DNA. The group of Nagata (42) generated and analyzed a transgenic mouse that expresses a mutated form of ICAD-S that cannot be cleaved by caspases. This mutated ICAD-S cannot dissociate from CAD, and therefore CAD cannot be activated. Nonetheless, the thymocytes from these animals can be engulfed by macrophages, and their DNA is digested into oligonucleosomal fragments by the action of the lysosomal acid DNase(s) (e.g. DNase II). Likewise, Horvitz and colleagues (43) have indicated that Caenorhabditis elegans mutants for the endonuclease nuc-1 do not completely degrade DNA unless the apoptotic cell is engulfed. Because the knockout mouse for CAD is not still available, IMR-5 neuroblastoma cells could be a good cellular model for studying the relevance of the oligonucleosomal DNA degradation by the ICAD/CAD system in physiological and pathological situations.

    ACKNOWLEDGEMENTS

The neuroblastoma cell lines employed in this work were generous gifts from D. Martín-Zanca (University of Salamanca, Spain). We thank J. L. Fernández-Luna (Servicio de Inmunologia, Hospital Universitario Marques de Valdecilla, Santander, Spain) for providing the Bcl-XL plasmid. We thank A. Manonelles (Hospital University Arnau de Vilanova, Lleida, Spain) for help with the ABI PRISM 310 automatic sequence analyzer, Imma Montoliu and Roser Pané for technical support, and the rest of colleagues of the Molecular Neurobiology Group for helpful discussions. We specially acknowledge J. Egea, M. Encinas R. M. Soler, and M. Aldea for comments on manuscript.

    FOOTNOTES

* This work was supported by Proyectos FEDER Grant 1FD97-0514-002-01 and Plan Nacional Salud y Farmacia Grant SAF 2000-0164-002-01) from the Spanish Government and grants from Telemarató de TV3 (Edició 1999) and Generalitat de Catalunya.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Recipient of a postgraduate fellowship from the Telemarató de TV3.

§ Postdoctoral researcher supported by Project 1FD97-0514-002-01.

To whom correspondence should be addressed. Tel.: 34-973-702-414; Fax: 34-973-702-426; E-mail: joan.comella@cmb.udl.es.

Published, JBC Papers in Press, April 6, 2001, DOI 10.1074/jbc.M100072200

    ABBREVIATIONS

The abbreviations used are: CAD, caspase-activated DNase; Ac-DEVD-afc, acetyl-Asp[OMe]-Glu[OMe]-Val-Asp[OMe]-7-amino-4-trifluoromethyl coumarin; ERK, extracellular-regulated kinase; hCAD, human CAD; ICAD, inhibitor of the caspase-activated DNase; hICAD, human ICAD; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; NIB, nuclei isolation buffer; PBS, phosphate-buffered saline; STP, staurosporine; z-VAD-fmk, benzyloxycarbonyl-Val-Ala- Asp[OMe]-fluoromethylketone; PMSF, phenylmethylsulfonyl fluoride; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; Pipes, 1,4-piperazinediethanesulfonic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Steller, H. (1995) Science 267, 1445-1449
2. Jacobson, M. D., Weil, M., and Raff, M. C. (1997) Cell 88, 347-354
3. Fadeel, B., Orrenius, S., and Zhivotovsky, B. (1999) Biochem. Biophys. Res. Commun. 266, 699-717
4. Wyllie, A. H., Kerr, J. F., and Currie, A. R. (1980) Int. Rev. Cytol. 68, 251-306
5. Walker, P. R., and Sikorska, M. (1997) Biochem. Cell Biol. 75, 287-299
6. Janicke, R. U., Sprengart, M. L., Wati, M. R., and Porter, A. G. (1998) J. Biol. Chem. 273, 9357-9360
7. Oberhammer, F., Wilson, J. W., Dive, C., Morris, I. D., Hickman, J. A., Wakeling, A. E., Walker, P. R., and Sikorska, M. (1993) EMBO J. 12, 3679-3684
8. Walker, P. R., Leblanc, J., Carson, C., Ribecco, M., and Sikorska, M. (1999) Ann. N. Y. Acad. Sci. 887, 48-59
9. Boix, J., Llecha, N., Yuste, V. J., and Comella, J. X. (1997) Neuropharmacology 36, 811-821
10. Halenbeck, R., MacDonald, H., Roulston, A., Chen, T. T., Conroy, L., and Williams, L. T. (1998) Curr. Biol. 8, 537-540
11. Liu, X., Li, P., Widlak, P., Zou, H., Luo, X., Garrard, W. T., and Wang, X. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 8461-8466
12. Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., and Nagata, S. (1998) Nature 391, 43-50
13. Sakahira, H., Enari, M., and Nagata, S. (1998) Nature 391, 96-99
14. Liu, X., Zou, H., Slaughter, C., and Wang, X. (1997) Cell 89, 175-184
15. McIlroy, D., Sakahira, H., Talanian, R. V., and Nagata, S. (1999) Oncogene 18, 4401-4408
16. Woo, M., Hakem, R., Soengas, M. S., Duncan, G. S., Shahinian, A., Kagi, D., Hakem, A., McCurrach, M., Khoo, W., Kaufman, S. A., Senaldi, G., Howard, T., Lowe, S. W., and Mak, T. W. (1998) Genes Dev. 12, 806-819
17. Zhang, J., Liu, X., Scherer, D. C., van Kaer, L., Wang, X., and Xu, M. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 12480-12485
18. de la Taille, A., Chen, M. W., Burchardt, M., Chopin, D. K., and Buttyan, R. (1999) Cancer Res. 59, 5461-5463
19. Herrmann, M., Voll, R. E., Zoller, O. M., Hagenhofer, M., Ponner, B. B., and Kalden, J. R. (1998) Arthritis Rheum. 41, 1241-1250
20. Mukae, N., Enari, M., Sakahira, H., Fukuda, Y., Inazawa, J., Toh, H., and Nagata, S. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9123-9128
21. Liu, X., Zou, H., Widlak, P., Garrard, W., and Wang, X. (1999) J. Biol. Chem. 274, 13836-13840
22. Lazebnik, Y. A., Cole, S., Cooke, C. A., Nelson, W. G., and Earnshaw, W. C. (1993) J. Cell Biol. 123, 7-22
23. Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, X. (1996) Cell 86, 147-157
24. Vaux, D. L., Cory, S., and Adams, J. M. (1988) Nature 335, 440-442
25. Benito, A., Silva, M., Grillot, D., Nuñez, G., and Fernandez-Luna, J. L. (1996) Blood 87, 3837-3843
26. Bertrand, R., Solary, E., O'Connor, P., Kohn, K. W., and Pommier, Y. (1994) Exp. Cell Res. 211, 314-321
27. Koh, J. Y., Wie, M. B., Gwag, B. J., Sensi, S. L., Canzoniero, L. M., Demaro, J., Csernansky, C., and Choi, D. W. (1995) Exp. Neurol. 135, 153-159
28. Prehn, J. H., Jordan, J., Ghadge, G. D., Preis, E., Galindo, M. F., Roos, R. P., Krieglstein, J., and Miller, R. J. (1997) J. Neurochem. 68, 1679-1685
29. Deshmukh, M., and Johnson, E. M., Jr. (2000) Cell Death. Differ. 7, 250-261
30. Susin, S. A., Daugas, E., Ravagnan, L., Samejima, K., Zamzami, N., Loeffler, M., Costantini, P., Ferri, K. F., Irinopoulou, T., Prevost, M. C., Brothers, G., Mak, T. W., Penninger, J., Earnshaw, W. C., and Kroemer, G. (2000) J. Exp. Med. 192, 571-580
31. Boix, J., Fibla, J., Yuste, V. J., Piulats, J. M., Llecha, N., and Comella, J. X. (1998) Exp. Cell Res. 238, 422-429
32. Gross, A., McDonnell, J. M., and Korsmeyer, S. J. (1999) Genes Dev. 13, 1899-1911
33. Cuvillier, O., Rosenthal, D. S., Smulson, M. E., and Spiegel, S. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8395-8400
34. Orth, K., Chinnaiyan, A. M., Garg, M., Froelich, C. J., and Dixit, V. M. (1996) J. Biol. Chem. 271, 16443-16446
35. Germain, M., Affar, E. B., D'Amours, D., Dixit, V. M., Salvesen, G. S., and Poirier, G. G. (1999) J. Biol. Chem. 274, 28379-28384
36. Janicke, R. U., Ng, P., Sprengart, M. L., and Porter, A. G. (1998) J. Biol. Chem. 273, 15540-15545
37. Posmantur, R., McGinnis, K., Nadimpalli, R., Gilbertsen, R. B., and Wang, K. K. (1997) J. Neurochem. 68, 2328-2337
38. Widmann, C., Gibson, S., and Johnson, G. L. (1998) J. Biol. Chem. 273, 7141-7147
39. Schulze-Osthoff, K., Walczak, H., Droge, W., and Krammer, P. H. (1994) J. Cell Biol. 127, 15-20
40. Peitsch, M. C., Mannherz, H. G., and Tschopp, J. (1994) Trends Cell Biol. 4, 37-41
41. Ferri, K. F., and Kroemer, G. (2000) Nat. Cell Biol. 2, E63-E64
42. McIlroy, D., Tanaka, M., Sakahira, H., Fukuyama, H., Suzuki, M., Yamamura, K., Ohsawa, Y., Uchiyama, Y., and Nagata, S. (2000) Genes Dev. 14, 549-558
43. Wu, Y. C., Stanfield, G. M., and Horvitz, H. R. (2000) Genes Dev. 14, 536-548


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Neurosci.Home page
M. F. Segura, C. Sole, M. Pascual, R. S. Moubarak, M. Jose Perez-Garcia, R. Gozzelino, V. Iglesias, N. Badiola, J. R. Bayascas, N. Llecha, et al.
The Long Form of Fas Apoptotic Inhibitory Molecule Is Expressed Specifically in Neurons and Protects Them against Death Receptor-Triggered Apoptosis
J. Neurosci., October 17, 2007; 27(42): 11228 - 11241.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. R. Schaecher, E. Touchette, J. Schriewer, R. M. Buller, and A. Pekosz
Severe Acute Respiratory Syndrome Coronavirus Gene 7 Products Contribute to Virus-Induced Apoptosis
J. Virol., October 15, 2007; 81(20): 11054 - 11068.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. J. Yuste, I. Sanchez-Lopez, C. Sole, R. S. Moubarak, J. R. Bayascas, X. Dolcet, M. Encinas, S. A. Susin, and J. X. Comella
The Contribution of Apoptosis-inducing Factor, Caspase-activated DNase, and Inhibitor of Caspase-activated DNase to the Nuclear Phenotype and DNA Degradation during Apoptosis
J. Biol. Chem., October 21, 2005; 280(42): 35670 - 35683.
[Abstract] [Full Text] [PDF]