Originally published In Press as doi:10.1074/jbc.M100072200 on April 6, 2001
J. Biol. Chem., Vol. 276, Issue 25, 22323-22331, June 22, 2001
The Absence of Oligonucleosomal DNA Fragmentation during
Apoptosis of IMR-5 Neuroblastoma Cells
DISAPPEARANCE OF THE CASPASE-ACTIVATED DNase*
Víctor J.
Yuste
,
José R.
Bayascas§,
Núria
Llecha,
Isabel
Sánchez-López,
Jacint
Boix, and
Joan X.
Comella¶
From the Grup de Neurobiologia Molecular, Departament de
Ciències Mèdiques Bàsiques, Universitat de Lleida,
25198 Lleida, Spain
Received for publication, January 4, 2001, and in revised form, March 9, 2001
 |
ABSTRACT |
Caspase-activated DNase is responsible for the
oligonucleosomal DNA degradation during apoptosis. DNA degradation is
thought to be important for multicellular organisms to prevent
oncogenic transformation or as a mechanism of viral defense. It has
been reported that certain cells, including some neuroblastoma cell lines such as IMR-5, enter apoptosis without digesting DNA in such a
way. We have analyzed the causes for the absence of DNA laddering in
staurosporine-treated IMR-5 cells, and we have found that most of the
molecular mechanisms controlling apoptosis are well preserved in this
cell line. These include degradation of substrates for caspases,
blockade of cell death by antiapoptotic genes such as Bcl-2 or
Bcl-XL, or normal levels and adequate activation of
caspase-3. Moreover, these cells display normal levels of
caspase-activated DNase and its inhibitory protein, inhibitor of
caspase-activated DNase, and their cDNA sequences are identical to
those reported previously. Nevertheless, IMR-5 cells lose
caspase-activated DNase during apoptosis and recover their ability to
degrade DNA when human recombinant caspase-activated DNase is
overexpressed. Our results lead to the conclusion that
caspase-activated DNase is processed during apoptosis of IMR-5 cells,
making these cells a good model to study the relevance of this
endonuclease in physiological or pathological conditions.
 |
INTRODUCTION |
Programmed cell death or apoptosis is characterized by a set of
morphological and biochemical events that are critical for embryonic
development and tissue homeostasis in metazoans (reviewed in Refs. 1
and 2). Apoptosis has also been involved as an important phenomenon in
many different human diseases (reviewed in Ref. 3). Shrinkage and
fragmentation of the nucleus as well as the cell body and extensive
degradation of chromosomal DNA are some of the most characteristic
features of apoptosis (4). DNA fragmentation is a two-step process in
which the DNA is first cleaved into 50-300-kilobase pair
fragments (high molecular weight DNA degradation), that are
subsequently degraded into smaller fragments of oligonucleosomal size
(DNA ladder) (reviewed in Ref. 5). It is considered that only the high
molecular weight DNA degradation is essential for cell death, because
there are several cell types that never produce DNA ladders with
treatments that induce the typical nuclear and cytoplasmatic changes of
apoptosis. These cell types include the breast carcinoma-derived cell
line MCF-7 (6), the human androgen-independent prostatic cancer cell
DU-145 (7), the human neuronal-like cell NT2 (8), and some human
neuroblastomas such as IMR-5 and IMR-32 (9).
Recently, an endonuclease that is activated specifically by caspase-3
during apoptosis has been described in human and mouse. The human gene
for this protein has been named caspase-activated nuclease (10) or
DFF40 (DNA fragmentation
factor, 40 kDa subunit) (11), whereas the mouse
homologue has been named caspase-activated DNase
(CAD)1 (12). CAD is
maintained inactive in the cytoplasm of normal cells because of its
association with a protein that acts as a chaperone and inhibitor. This
protein has been named the inhibitor of CAD (ICAD) in the mouse
(13) or DFF45 (DNA fragmentation factor, 45 kDa subunit) in humans (14). Here we
will refer to it as ICAD. It has been demonstrated that the enzymatic
activity of CAD is induced when caspase-3 cleaves ICAD at two specific aspartic residues (Asp117 and Asp224),
thus releasing CAD (12, 15). Activated CAD degrades the DNA at the
internucleosomal regions, and analysis of this DNA in agarose gels
shows a characteristic ladder pattern (14). Although, caspase-3 seem
necessary for the laddering degradation of DNA, it is considered that
apoptotic cell death can proceed without caspase-3 in some cell types.
For example, cells derived from caspase-3
/
mice or
cells defective in this caspase (MCF-7) die without displaying oligonucleosomal DNA degradation when treated with pro-apoptotic stimuli (6, 16). Moreover, several types of cells derived from the
ICAD-deficient mice lack internucleosomal DNA degradation, although
these mice do not show major defects in development (17).
Very little information exists about the cell death process without DNA
fragmentation, but it is assumed that the oligonucleosomal DNA
degradation confers some advantages to the organism. Thus, for example,
it has been proposed that DNA degradation may minimize the risk of
transferring oncogenes from a doomed cell to an adjacent healthy cell
or to a phagocyte (18). On the other hand, it has also been proposed
that the failure to digest chromatin could be the basis for the
pathogenesis of some autoimmune diseases in which antibodies against
the heterochromatin are generated (19).
We have reported previously that human neuroblastoma IMR-5 does not
show oligonucleosomal DNA fragmentation nor condensation of nuclear
chromatin into the rounded masses typical of apoptosis when cells were
treated with staurosporine (STP) (9). In the present report we have
analyzed several regulatory mechanisms that control apoptosis in the
IMR-5 cell line. We have not found major defects in caspase-3 protein
levels or its protease activity, and caspase inhibitors or
antiapoptotic genes such as Bcl-2 or Bcl-XL also block cell death.
Moreover, ICAD or CAD protein levels are comparable with other cell
lines that display oligonucleosomal degradation after induction of
apoptosis, and the primary sequences of these two proteins are the same
as that reported previously (GenBankTM accession numbers NM
004402 for CAD and NM 004401 for ICAD) (10, 11, 14, 20, 21). However,
IMR-5 cells rapidly lose CAD during STP-induced apoptosis. We also
observed that IMR-5 cells recover their ability to degrade DNA into
oligonucleosomal fragments when engineered to overexpress mouse or
human CAD, pointing out the importance of the relative levels of this
nuclease. In conclusion, we demonstrate that processing of CAD could be
a new regulatory step in the control of apoptosis and specifically
during oligonucleosomal DNA degradation. Moreover, because the
transgenic mouse with the deletion of the CAD gene is not currently
available, IMR-5 cells could serve as an alternative model to test the
relevance of oligonucleosomal degradation of DNA in normal cells or in
pathological process such as viral infection.
 |
EXPERIMENTAL PROCEDURES |
Cell Lines and Culture Procedures--
Human SH-SY5Y and IMR-5
cell lines employed in the present study were kindly provided by Dr.
Dionisio Martín-Zanca (Salamanca, Spain). The cells were
routinely grown in 75-cm2 culture flasks (Sarstedt, Newton,
NC) containing 10 ml of Dulbecco's modified Eagle's medium
supplemented with 2 mM L-glutamine,
antibiotics, and heat-inactivated fetal bovine serum (Life
Technologies, Inc.). IMR-5 cells were grown in the presence of 10%
(v/v) fetal bovine serum, whereas SH-SY5Y cells were grown in 15%
(v/v) fetal bovine serum. Medium was routinely changed every 3 days.
Cells were maintained at 37 °C in a saturating humidity atmosphere
containing 95% air and 5% CO2. For the different
experiments, cells were grown at the adequate cell densities in culture
dishes or multiwell plates (Corning, NY) using the same culture
conditions as described above.
MTT Reduction and Trypan Blue Exclusion Cell Viability Assays and
Chromatin Staining with Hoechst 33258--
MTT is a water-soluble
tetrazolium salt that is reduced by metabolically viable cells to a
colored, water-insoluble formazan salt. The procedure employed for this
assay was the same as that described by Boix et al. (9).
For trypan blue staining, cells were seeded in 24-multiwell plates at
5 × 104 cells/well. After 24 h of seeding, cells
were treated with STP at the adequate doses and times. Then cells were
gently dissociated with a blue tip in their own culture medium,
and a sample (100 µl) was taken and mixed with 20 µl of trypan blue
solution (0.4%) (Sigma). Ten µl of the resulting cell suspension
were counted with an hemocytometer. The results were expressed as
percentages of trypan blue-stained cells over the total number of cells.
Nuclear morphology was assessed by staining cells with the Hoechst
33258, which is also known as bisbenzimide
([2'-(4-hydroxyphenyl)-5-(4-methyl-1-piperazinyl)-2,5'-bi-1H-benzimidazole trihydrochloride]) as established in our laboratory (9). The normal or
apoptotic cell nuclei were visualized with an Olympus microscope
equipped with epifluorescence optics under UV illumination.
Electron Microscopy--
Control or STP-treated cells growing in
35-mm culture dishes (1 × 106 cells) were gently
pelleted by centrifugation and washed twice with phosphate-buffered
saline (PBS) (150 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, 1.5 mM
KH2PO4, pH 7.2). Fixation was performed with 100 mM phosphate buffer, pH 7.4, containing 2.5%
glutaraldehyde for 30 min at 4 °C. The pellets were rinsed twice
with cold PBS, postfixed in buffered OsO4, dehydrated in
graded acetone, and embedded in Durcupan ACM resin (Fluka, Buchs,
Switzerland). Ultrathin sections were obtained, mounted in copper
grids, and counterstained with uranyl acetate and lead citrate. The
specimens were observed with a Zeiss EM910 electron microscope.
DNA Degradation Analysis--
Cells grown in 35-mm culture
dishes (1 × 106 cells) were collected in their
culture medium, pelleted at 400 × g for 5 min, and
rinsed twice with PBS. The pellet was homogenized in 600 µl of lysis
buffer (0.5 M EDTA, 1% lauryl sarcosine, 10 mM
Tris-HCl, pH 9.5) by pipetting through a blue cone. Homogenates were
clarified by centrifuging at 13,000 × g for 15 min,
and supernatants were collected to a new tube in which they were
extracted with phenol:chloroform:isoamyl alcohol (25:24:1) (Iberlabo,
Madrid, Spain). DNA was precipitated with two volumes of cold ethanol
and 0.5 volumes of 7.5 M ammonium acetate. Precipitated DNA
was washed once in 70% ethanol and resuspended in 1 mM
EDTA, 10 mM Tris-HCl, pH 8.0 containing DNase-free RNase at
a final concentration of 20 µg/ml. DNA was analyzed in 1.5% agarose
gel in 1 mM EDTA, 40 mM Tris acetate, pH 7.6.
Protein Extractions and Western Blotting--
Approximately
2 × 106 cells/condition were detached from the 60-mm
culture dish, pelleted at 400 × g for 5 min, and
washed twice with PBS. Then cells were lysed with 100 µl of RIPA
buffer (10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 1% deoxycholate, 0.1% SDS, 1 mM PMSF) for nuclear protein extracts or with Nonidet P-40
buffer (10 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM NaCl, 5 mM dithiothreitol, 1 mM
PMSF, 0.05% Nonidet P-40) for cytosolic protein extracts. The pellets
were clarified by centrifuging at 13,000 × g for 10 min at 4 °C. The protein in the supernatants was quantitated using
the Bio-Rad DC protein assay, and 25-50 µg of protein were loaded in
SDS-polyacrylamide gels. The proteins were electrophoresed and
electrotransferred to polyvinylidene difluoride Immobilon filters
(Millipore, Bedford, MA) with a semidry apparatus following the
instructions of the supplier (Hoefer, Amersham Pharmacia Biotech). Then
filters were reacted with the appropriate specific primary antibodies
and incubated with the adequate secondary antibodies conjugated with
peroxidase (Sigma). Finally, immunoblots were developed with the
SuperSignal West Dura Extended Duration Substrate (Pierce) for the
detection of caspase-3 fragments and CAD and with the ECL system
(Amersham Pharmacia Biotech) for the rest.
DEVD-directed Caspase Activity--
We developed a new method to
quantify DEVD-directed caspase activity. The cells were grown onto
96-well multiplates at 4 × 104 cells/well. After
24 h, the cells were treated with STP and then lysed by adding 1 volume of Ac-DEVD-afc lysis buffer 2-fold concentrated containing the
fluorogenic substrate Ac-DEVD-afc (Enzyme Systems Products, Livermore,
CA). Ac-DEVD-afc 2 × lysis buffer buffer is 40 mM
Hepes/NaOH, pH 7.2, 300 mM NaCl, 20 mM
dithiothreitol, 10 mM EDTA, 0.2% CHAPS, 2% Nonidet P-40,
20% sucrose plus 50 µM of Ac-DEVD-afc. The plates were
incubated for 12 h at 37 °C and then read in a Bio-Tek FL 600 fluorimeter (Izasa, Spain) at 360 nm (40 nm bandwidth) of excitation
and 530 nm (25 nm bandwidth) of emission.
For quantitative DEVD-like activity in cell lysates, cells were seeded
onto 35-mm culture plates and, after treatment, were detached, washed
twice with PBS, and lysed with Ac-DEVD-afc lysis buffer without the
Ac-DEVD-afc. The supernatant was clarified by centrifuging at
13,000 × g in a microcentrifuge at 4 °C, and the protein was quantitated using the Bio-Rad protein assay
Bradford-based method. Twenty-five µg of protein were added to 100 µl of the same lysis buffer containing 20 µM of
Ac-DEVD-afc. The samples were incubated at 37 °C for 6 h and
read with the fluorimeter.
Preparation of SH-SY5Y and IMR-5 Nuclei--
Nuclei were
obtained as described previously (22, 23) with minor modifications.
Cells were grown in 75-cm2 culture flasks, and 1 × 108 cells were harvested by centrifugation at 200 × g for 5 min. After three washes with PBS and one with nuclei
isolation buffer (NIB; 10 mM Pipes, pH 7.4, 10 mM KCl, 2 mM MgCl2, 1 mM dithiothreitol, 10 µM cytochalasin B, 1 mM PMSF), cells were resuspended in 10 volumes of NIB and
transferred to a Dounce-type homogenizer. Cells were swelled for
30 min at 4 °C and gently lysed with 25 strokes of the pestle. Then
nuclei were layered over a 30% (w/v) sucrose cushion in NIB and
centrifuged at 800 × g for 10 min. Supernatant was
discarded, and the pellet was washed three times in NIB. Finally, nuclei were resuspended in nuclear storage buffer (10 mM
Pipes, pH 7.4, 80 mM KCl, 20 mM NaCl, 250 mM sucrose, 5 mM EGTA, 1 mM dithiothreitol 0.5 mM spermidine, 0.2 mM
spermine, 1 mM PMSF, 50% (v/v) glycerol) at 1 × 108 nuclei/ml and kept at
80 °C until used.
Preparation of Cytosolic Extracts and Reconstitution of the
Cell-free System--
Cytosolic extracts were obtained from cells
treated with 100 nM of STP for 24 h or from control
untreated cells. Cells were collected and centrifuged at 200 × g for 5 min, washed three times with PBS, resuspended in a
buffer containing 10 mM Hepes/KOH, pH 7.2, 2 mM
MgCl2, 5 mM EGTA, 50 mM NaCl, 5 mM dithiothreitol, 1 mM PMSF, 20% glycerol,
1% Nonidet P-40, and swelled at 4 °C for 15 min. The lysates were
centrifuged in a microcentrifuge at 4 °C, and the supernatants were
quantitated with Bio-Rad protein assay Bradford-based method.
To reconstitute the system, cytosolic extracts and purified nuclei from
the different conditions were adequately combined. Thus, 150 µg of
protein from cytosolic extracts and 5 × 105 of nuclei
were incubated at 37 °C for 2 h in a buffer containing an
ATP-regenerating system (2 mM ATP, 10 mM
phosphocreatine, 50 µg/ml creatine kinase) and 1 mg/ml of bovine
serum albumin. Reactions were stopped by adding 5 mM of
EDTA, and the DNA was extracted with phenol:chloroform:isoamyl alcohol
(25:24:1) and ethanol precipitation. DNA laddering was analyzed in a
1.8% agarose gel.
Sequencing of hICAD and hCAD--
One microgram of RNA from
either IMR-5 or SH-SY5Y was treated with 2 units of DNase RNase-free
(Amersham Pharmacia Biotech) and was reverse transcribed using 10 pmol
of the specific downstream primer (ICAD-R or CAD-R; see below) for
1 h at 42 °C. Approximately 10 ng of cDNA was amplified by
polymerase chain reaction in a PerkinElmer thermal cycler 2400 with 200 nM each primer. The polymerase chain reaction conditions
were 94 °C for 20 s, 65 °C for 20 s, and 72 °C for 1 min for 35 cycles in 50 mM Tris-HCl, pH 9.0, 2.5 mM MgCl2, 15 mM
(NH4)2SO4, 0.1% Triton X-100, and
1 unit of DyNAzime-EXT DNA polymerase (Finnzymes). Primers used
were CAD-F (TGCAATGCTCCAGAAGCCCAAGAGC) and CAD-R
(TCACTGGCGTTTCCGCACAGGCTG), which amplify a band of 1120 base pairs
corresponding to the whole open reading frame of CAD
(GenBankTM accession number NM 004402); and ICAD-F
(CGCTCCGGCCTCCCGCGACTTCTCG) and ICAD-R (GGCGTGAGCCACTGCGCCTGGCCAA),
which cover a 1353-base pair region containing the ICAD open reading
frame (GenBankTM accession number NM 004401). The
polymerase chain reaction products were automatically sequenced in both
direction in an ABI PRISM 310 automatic sequence analyzer (PerkinElmer).
Subcloning and Constitutive Transfection of Bcl-2,
Bcl-XL, hCAD, and hICAD--
MTbcl-2TKNeo (24) and
pSFFVNeobcl-XL (25) plasmids have been described
previously. DNA inserts were subcloned into the pcDNA3 mammalian
expression vector. (Invitrogen BV, Leek, The Netherlands). We also
cloned ICAD and CAD full-length open reading frame sequence into the
pcDNA3 vector. The constructs were named pcDNA3/bcl-2,
pcDNA3/bcl-XL, pcDNA3/hCAD, and
pcDNA3/hICADL. IMR-5 cells were transfected with
different constructs using LipofectAMINE Plus reagent (Life
Technologies, Inc.). Stably transfected cells were selected with 500 µg/ml G-418 (geneticin) (Life Technologies, Inc.) and were used as a pool.
 |
RESULTS |
STP-induced Apoptosis in IMR-5 Cells Proceeds without High Nuclear
Chromatin Condensation or Oligonucleosomal Degradation of DNA--
STP
is an unspecific protein kinase inhibitor that has been widely used as
a classic and potent inductor of apoptosis in many different cell types
(26-29). In a previous report, we characterized STP-induced cell death
in several human neuroblastoma cell lines (9) and found two of them,
IMR-5 and IMR-32, that underwent atypical apoptotic cell death. Here we
further characterize this cell death to determine precisely which can
be the alteration responsible of this phenotype. SH-SY5Y
neuroblastoma-derived cell line was used as a control. STP induces cell
death with a similar dose-dependent profile in both cell
lines as measured by MTT assay or trypan blue staining (Fig.
1, A and B,
respectively). Furthermore, for a given dose of STP (125 nM), the time course of cell death was comparable in both
SH-SY5Y and IMR-5 cells, and about half the cells initially plated died
after 12-18 h (Fig. 1C). However, nuclear morphology and
DNA laddering were two distinguishable features between these two cell
lines upon STP treatment (9). A ladder pattern of DNA fragmentation was
clearly visible in STP-treated SH-SY5Y cells, whereas it never appeared
in IMR-5 cells at any of the concentrations or times tested (Fig.
1D). When the nuclear chromatin was stained with Hoechst
33258, SH-SY5Y nuclei exhibited the typical apoptotic morphology,
whereas IMR-5 chromatin was found to be condensed in the marginal zones
of the nucleus (Fig. 2A). The
ultrastructural analysis of IMR-5 cells treated with STP revealed
important nuclear modifications; chromatin was condensed and formed
marginal and irregular masses of heterochromatin in a coarse pattern
(Fig. 2B) that has been previously defined as stage I
nuclear condensation (30). However, the characteristic high nuclear
chromatin condensation typical of apoptosis (defined previously as
stage II (30)) was never found in STP-treated IMR-5 cells, although it
was clearly apparent in SH-SY5Y (Fig. 2B).

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 1.
IMR-5 cells die upon STP treatment but do not
show oligonucleosomal DNA degradation. A and
B, SH-SY5Y and IMR-5 cells grown in 96-well dishes
(A) or in 24-well dishes (B) were treated with
STP in the range of 7.8-4 × 103 nM.
After 24 h, cell viability was measured with the MTT assay (Fig.
1A) or with trypan blue staining (Fig. 1B). Filled circles
(A) and bars (B) represent IMR-5
cells, whereas empty circles (A) and
bars (B) are SH-SY5Y cells. C, time
course analysis of cell death in SH-SY5Y and IMR-5 cells with 125 nM STP. The symbols are as in A. D,
SH-SY5Y (upper panel) and IMR-5 (lower panel)
cells were treated with increasing concentrations of STP (125, 250, 500, and 1000 nM) for the indicated times, and genomic DNA
was analyzed by conventional agarose gel electrophoresis. Note the
complete absence of DNA laddering in all the conditions of IMR-5 cells.
/H, DNA digested with HindIII marker (Promega).
|
|

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2.
Absence of high nuclear chromatin
condensation in IMR-5 cells treated with STP. SH-SY5Y cells
(left column) and IMR-5 cells (right column) were
treated with 100 nM STP for 24 h (all
panels in A and bottom panels in
B) or left untreated (top panels in
B). Then cells were stained with Hoechst 33258 (A) or included in Durcupan and processed for electron
microscopy (B). Note that treatment of IMR-5 cells with STP
induces an incomplete condensation of the nuclear chromatin. The
lower panels in A are high magnifications of the
cells framed in upper panels. The bars indicate
20 µm in the top panels in A and 2 µm for
all panels in B.
|
|
To rule out the possibility that the lack of oligonucleosomal DNA
fragmentation could be a specific feature of STP treatment, we tested a
set of apoptotic inducers at different doses and times. These included
DNA-damaging agents (camptothecin (100 µM), etoposide (100 µM), N-nitroso-N-methylurea (5 mM), and cisplatin (50 µM)), protein kinase
inhibitors (H-7 (100 µM) and roscovitine (50 µM)), cytoskeleton-disrupting agents (vinblastine (100 µM), nocodazole (50 µM), and colchicine (10 µg/ml)), and macromolecular synthesis inhibitors (cycloheximide (2 µg/ml) and actinomicin D (5 µg/ml)). (The highest doses tested are
indicated in parentheses.) None of these compounds was able to induce
ladder formation in IMR-5 cells at the doses and times that efficiently
promoted laddering in SH-SY5Y (data not shown). Moreover, all of these
drugs were capable of inducing cell death in both SH-SY5Y and IMR-5
cells as measured by trypan blue and MTT assays (data not shown). Thus, the inability of STP to induce an apoptotic phenotype in IMR-5 cells
seemed to be due to an intrinsic defect of these cells rather than to
an incapacity of STP to lead the nuclear apoptotic changes.
Pro-survival Members of Bcl-2 Family Prevent STP-induced Cell Death
in IMR-5 Cells--
Antiapoptotic members of the Bcl-2 family have
been shown to protect several cell models from STP-induced apoptosis
(31, 32). To gain further information on the cell death induced by STP
in our experimental system, we analyzed the ability of
Bcl-XL or Bcl-2 to prevent STP-induced IMR-5 cell death.
For this purpose, we obtained stable pools of transfected cells with
any of these two genes, and STP-induced cell death was measured using
the MTT assay (Fig. 3A). Both
Bcl-2 and Bcl-XL overexpression afforded a significant
protection against cell death at all the concentrations of STP tested.
At the highest doses, Bcl-2 was slightly more efficient than
Bcl-XL. However, neither of the two proteins was able to prevent cell death when the STP concentrations were higher than 5 µM. Western blot analysis of the transfected cells showed
increased levels of the corresponding protein (Fig. 3B).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 3.
Antiapoptotic members of the Bcl-2 family
block apoptotic cell death induced by STP in IMR-5 cells.
A, IMR-5 cells transfected with pcDNA3/bcl-2
(empty squares), pcDNA3/bcl-XL (empty
triangles), or empty pcDNA3 (filled circles) were
treated with increasing concentrations of STP for 24 h, and
viability was assessed with the MTT assay. B, cells
transfected with empty pcDNA3 vector (lane 1),
pcDNA3/bcl-2 (lanes 2), or pcDNA3/bcl-XL
(lanes 3) used in A were analyzed for levels of
Bcl-2 and Bcl-XL Note the increased levels of Bcl-2 or
Bcl-XL in the corresponding transfected cells.
|
|
STP-induced Cell Death Is a Caspase-dependent
Process--
It has been demonstrated that caspase-3-deficient mice or
MCF-7 cells enter apoptosis with an atypical morphology (similar to the
one described above for IMR-5 cells) and are unable to degrade DNA into
oligonucleosomal fragments (6, 16). Therefore, an alteration in the
caspase-3 function seemed a good explanation for the phenotype observed
in STP-treated IMR-5 cells. Consequently, we analyzed the state of
caspase activation in our system. When a broad spectrum caspase
inhibitor such as z-VAD-fmk was added to the culture medium of IMR-5
cells, the IC50 for STP-induced cell death shifted from 100 nM in untreated cells to 500 nM in cells
treated with 50 µM z-VAD-fmk, as measured with the MTT
assay (Fig. 4A). Comparable
results were obtained using the trypan blue staining (not shown). When
high doses of STP (>1 µM) were used, z-VAD-fmk was no
longer able to prevent a loss of mitochondrial reduction potential
(Fig. 4A).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 4.
Caspase inhibitors block apoptotic cell death
induced by STP in IMR-5 cells. A, IMR-5 cells were
treated with different concentration of STP with (open
circles) or without (filled circles) 50 µM z-VAD-fmk, and cell viability was measured after
24 h using the MTT assay. B, RIPA extracts from SH-SY5Y
and IMR-5 untreated cells (con) or cells treated for 6 h with 500 nM of STP alone (STP) or with 50 µM z-VAD-fmk (S+V) were analyzed by Western
blot with the indicated specific antibodies against poly(ADP-ribose)
polymerase (PARP), fodrin, or lamin B1 to analyze the
caspase-mediated degradation of these proteins. The apparent molecular
mass of the unfragmented protein or the specific fragments is indicated
on the right of the panel. C, analysis of DNA
degradation of the same samples used in B. Note the absence
of DNA laddering in all IMR-5 cell conditions and the complete
prevention of DNA laddering afforded by z-VAD-fmk in STP-treated
SH-SY5Y cells.
|
|
Several proteins were specifically cleaved during apoptosis as a
consequence of caspase activation. Thus, for example, nuclear lamins
are substrates for caspase-6 (33, 34), caspase-7 cuts poly(ADP-ribose)
polymerase (35), and fodrin is specifically cut by caspase-3 (36). The
detection of specific fragments of these proteins are normally
considered to be good markers of the involvement of these caspases in
the apoptotic process. We therefore analyzed whether the different
substrates appeared after STP treatment of IMR-5 cells. As shown in
Fig. 4B, poly(ADP-ribose) polymerase, lamin B1, and fodrin
were specifically cleaved in IMR-5 and SH-SY5Y STP-treated cells, with
no major differences between cell lines. Moreover, the addition of
z-VAD-fmk to the culture medium completely prevented the appearance of
these fragments, therefore suggesting a regulated and specific
cleavage. Finally, we assessed whether caspase activation was a
necessary step for the oligonucleosomal fragmentation of DNA. As could
be expected, STP induced DNA laddering in SH-SY5Y cells but not in
IMR-5 cells. Moreover, z-VAD-fmk completely prevented the typical
oligonucleosomal DNA degradation after STP treatment in SH-SY5Y cells
(Fig. 4C).
Finally, to analyze directly the state of caspase-3 activation in
STP-treated IMR-5 cells, we carried out two types of analysis. First,
Western blots were performed using extracts from STP-treated IMR-5
cells, and procaspase-3 and its active p17 subunit were immunodetected
in a Western blot using a specific antibody against recombinant human
caspase-3. Extracts from SH-SY5Y cells, which have been shown to
contain functional caspase-3 (37), were included as a positive control
(Fig. 5A). We detected a
specific fragment of 17 kDa in IMR-5 cells treated with 1 µM STP for 6 h. The appearance of this fragment was
completely prevented by treating IMR-5 cells simultaneously with STP
and 50 µM of z-VAD-fmk. We therefore conclude that IMR-5
cells are able to activate caspase-3 during the cell death process
induced by STP. On the other hand, we also analyzed the
activation of caspases with DEVD cleavage preference, such as
caspase-3, using the fluorogenic substrate Ac-DEVD-afc. STP was able to
induce an increase in DEVD-directed activity in both IMR-5 and SH-SY5Y
cells with a comparable activation profile (Fig. 5B).
Although IMR-5 cells degraded the DEVD substrate at lower concentrations of STP, the maximal activity was comparable in both cell
lines (Fig. 5, B and C). The increase in the
DEVD-directed caspase activity induced by STP in both cell lines was
completely prevented when cells were simultaneously treated with
z-VAD-fmk (Fig. 5C).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Caspase-3 is properly processed and activated
in STP-treated IMR-5 cells. A, SH-SY5Y and IMR-5 cells
were treated for 6 h with 5 µM (SH-SY5Y)
or 1 µM (IMR-5) of STP (STP),
treated with STP plus 50 µM z-VAD-fmk (S+V),
or left untreated (con). The caspase-3 cleavage was analyzed
in Nonidet P-40 cytoplasmic extracts by Western blot technique.
Procaspase-3 and its large active fragment (p17) were immunodetected
with a specific polyclonal antibody (Pharmingen). B, SH-SY5Y
(empty circles) and IMR-5 (filled circles) cells
grown in 96-well multiplates were treated with different concentrations
of STP, and after 24 h, DEVD-like activity was measured as
described under "Experimental Procedures." The results are
represented as percentages with respect to untreated control cells
(100%). C, SH-SY5Y and IMR-5 cells were treated for 12 h with 500 nM of STP (STP) or with STP plus
z-VAD-fmk (S+V). Control cultures included were untreated
cells (con) or simultaneously treated with Me2SO
plus STP (S+D). A quantitative DEVD-directed activity
assay was performed, and the results are shown as the number of
picomoles of 7-amino-4-trifluoromethyl coumarin/µg of protein/min
released from fluorogenic substrate.
|
|
In conclusion, these results demonstrate that IMR-5 cells have a fully
functional caspase system that includes caspase-3. Therefore, it seems
that the incapacity to degrade DNA in IMR-5 cells is due to a defect in
a step downstream from the caspase activation, most probably in the
endonuclease system.
Cell-free System Experiments--
One possibility to explain the
IMR-5 phenotype is that its chromatin is resistant to endonuclease
degradation. To further delimit whether the defect of IMR-5 cells is
localized in the cytoplasm or in the nucleus, we performed cell-free
apoptosis as described under "Experimental Procedures." SH-SY5Y and
IMR-5 cells were treated with 100 nM STP during 24 h,
and the cytosolic extracts were obtained. Likewise, nuclei from
untreated SH-SY5Y or IMR-5 cells were purified. Then nuclei and
cytoplasms from the different conditions were combined and incubated
for 2 h at 37 °C. After incubation, the nuclear DNA was
extracted and analyzed by conventional agarose electrophoresis. As
shown in Fig. 6A, when IMR-5
nuclei were incubated with cytosolic extracts from STP-treated SH-SY5Y
cells, a laddering of DNA degradation was found. Nonetheless, cytosolic
protein extracts from IMR-5 cells similarly pretreated were unable to
generate oligonucleosomal DNA fragmentation on purified IMR-5 (Fig.
6A) or SH-SY5Y nuclei (not shown). It could be argued
that DNA laddering in IMR-5 nuclei treated with apoptotic cytoplasms of
SH-SY5Y cells might result from DNA oligonucleosomal fragments present
in these extracts as a consequence of STP pretreatment. This seems not
to be the case because agarose gel electrophoresis of the apoptotic
cytosolic extracts from STP-pretreated SH-SY5Y cells did not show the
presence of detectable quantities of DNA either intact or degraded
(Fig. 6A). To exclude the possibility that the absence of
caspase-3-like activity could be responsible for the failure of
oligonucleosomal DNA degradation in the IMR-5 cell extracts, we
performed a DEVD-directed caspase activity assay. As shown in Fig.
6B, cytosolic extracts from STP-treated IMR-5 cells had an
activity similar to that found in extracts from similarly treated
SH-SY5Y cells. Therefore, it can be concluded that the absence of DNA
laddering in IMR-5 cells is due to a deficiency in the apoptotic
mechanisms localized in their cytosol rather than to an intrinsic
defect in their nuclear chromatin.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6.
Cell-free system studies demonstrate that
IMR-5 nuclei are able to degrade DNA into oligonucleosomal
fragments. A, cell lysates were obtained from SH-SY5Y
or IMR-5 cells treated (STP) or not (con) with
100 nM of STP for 24 h. Nuclei from untreated IMR-5
cells were incubated with 150 µg of protein from cytoplasmic
extracts. DNA was extracted and analyzed with conventional agarose gel
electrophoresis and ethidium bromide staining. Note the
oligonucleosomal DNA degradation in IMR-5 nuclei incubated with
apoptotic cytoplasms from SH-SY5Y cells. Note also that cytosolic
lysates from STP-treated SH-SY5Y cells do not contain significant
amounts of DNA (isolated lane on the right).
B, the same cell lysates used in A were subjected
to quantitative DEVDase assay. Fifty µg of cell lysates from SH-SY5Y
and IMR-5 cells treated with STP (STP) or left untreated
(con) were incubated with Ac-DEVD-afc for 30 min; the
luminometer values are expressed as arbitrary units.
|
|
Analysis of the ICAD/CAD System of IMR-5 Cells--
The
endonuclease system responsible for the DNA degradation in eukaryotic
cells requires only three elements: caspase-3, ICAD, and CAD (12, 14).
Because we have discarded a problem in the caspase-3 function and in
the chromatin of IMR-5 cells, we further analyzed the ICAD/CAD system.
Western blot analysis showed that IMR-5 and SH-SY5Y cells have
comparable CAD and ICAD protein levels (Fig.
7A). The cDNAs
corresponding to the open reading frame of both proteins from IMR-5 and
SH-SY5Y cells were obtained and were entirely sequenced in both
directions. The results show that the sequences were identical between
both cell lines and were actually the same as those reported previously
(Refs. 10, 11, 14, 20, and 21; see "Experimental Procedures").
Furthermore, we also analyzed the ICAD processing after STP-induced
cell death and found that it was correct because the p11 fragment
corresponding to the carboxyl-terminal part of the protein was detected
by Western blot. This fragment results from the specific cleavage of
caspase-3 at the residue Asp224 of ICAD (13, 14) (Fig.
7B, upper panel). Unexpectedly, when we monitored
the levels of CAD during STP treatment in the same cellular extracts,
we observed that CAD disappeared in IMR-5 cells but remained unchanged
in SH-SY5Y cells (Fig. 7B, lower panel). CAD
disappearance in IMR-5 cells was a time-dependent
phenomenon, and it was completed after 5-8 h of 500 nM STP
treatment (Fig. 8A), a time
course similar, although slightly delayed, to that observed for the
activation of caspase-3 as demonstrated by fodrin degradation (Fig.
8A). CAD loss was a specific event because proteins that are
known to be resistant to degradation during apoptosis, such as
extracellular-regulated kinases (ERKs) (38), did not decrease after STP
treatment of IMR-5 cells. Moreover, simultaneous treatment of cells
with STP and z-VAD-fmk completely prevented both CAD and fodrin
degradation (Fig. 8B). These data demonstrated that the
process is absolutely dependent on caspase activation.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 7.
ICAD and CAD levels in SH-SY5Y and IMR-5
cells. ICAD processing and complete CAD disappearance in
STP-treated IMR-5 cells. A, cell lysates from untreated
SH-SY5Y or IMR-5 cells were analyzed by Western blot using specific
antibodies against ICAD (Santa Cruz Biotechnology). Membrane was
stripped and reprobed with a CAD antibody (Chemicon International) and
subsequently with an specific monoclonal antibody against -actin
(Sigma) to control protein content. B, analysis of the
processing of ICAD was performed by Western blotting using an ICAD
carboxyl-terminal specific antiserum (Santa Cruz Biotechnology).
SH-SY5Y and IMR-5 cells were treated with 500 nM STP for
6 h or left untreated, and the processing of ICAD was examined.
Generation of the p11 ICAD subunit (arrow labeled
p11) resulting from the specific cleavage of caspase-3 at
the Asp224 is observed in both cell lines. Note that in the
same samples, CAD is completely degraded in STP-treated IMR-5 cells
(lower panel).
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 8.
Analysis of the CAD disappearance in
STP-treated IMR-5 cells and dependence on caspase activation.
A, protein extracts from SH-SY5Y and IMR-5 cells treated
with 500 nM STP for the indicated times were analyzed by
Western blotting using an anti-CAD antibody (top panel).
Note that CAD completely disappears after 8 h of STP treatment in
the IMR-5 cells. The membrane was stripped and reprobed with an
anti-fodrin monoclonal antibody (middle panel) to assess
caspase-3 activation and further stripped and reprobed with an
anti-pan-ERK antibody to control protein loading and nonspecific
proteolysis (bottom panel). B, cell lysates from
IMR-5 cells treated with 1 µM STP alone or with 1 µM STP plus 50 µM z-VAD-fmk for the
indicated times were submitted to Western blot using the same protocol
and antibodies as in A. Note that z-VAD-fmk completely
abolishes CAD and fodrin degradation at any of the times tested.
C, time course of CAD degradation in empty pcDNA3- or
pcDNA3/hCAD-transfected IMR-5 cells treated with 500 nM
STP. Stripping and reprobing of the membrane with anti-fodrin and
pan-ERK antibody was performed as in A. Note that
overexpression of hCAD prevents its disappearance at the times and STP
concentration analyzed.
|
|
Overexpression of hCAD into IMR-5 Rescues DNA Laddering and Stage
II Nuclear Morphology--
CAD disappearance could be a relevant
phenomenon to explain the absence of oligonucleosomal DNA degradation.
To further analyze this hypothesis, we generated clones of IMR-5 cells
stably transfected with human CAD. In cells overexpressing CAD, the
levels of this protein were significantly higher than in empty
pcDNA3-transfected clones (Fig. 8C). Moreover,
CAD-transfected IMR-5 cells showed remarkable levels of this protein
even after 9 h of STP treatment (Fig. 8C), even though
caspases are activated as demonstrated by fodrin cleavage (Fig.
8C). When we analyzed the nuclear morphology of
CAD-transfected IMR5 cells, the high nuclear chromatin condensation typical of the stage II of nuclear apoptosis could be observed (Fig.
9, A and B). When
we analyzed STP-induced apoptosis in CAD overexpressing cells, DNA
laddering could also be observed (Fig. 9C). We finally
analyzed which was the result of overexpressing ICADL in
IMR-5 cells, and as could be expected, this strategy did not result in
the appearance of DNA ladder degradation (Fig. 9C) or stage
II nuclear morphology (not shown) after STP treatment. However, double
transfection of IMR-5 cells with CAD and ICADL induced DNA
laddering after STP treatment (Fig. 9C). We further analyzed
which was the effect of CAD overexpression in cell viability after STP
treatment. No significant differences were observed between CAD
overexpressing cells and empty pcDNA3-transfected cells using
trypan blue counting or MTT assay (data not shown). Finally, we studied
the caspase activity dependence of the DNA laddering degradation during
apoptosis of cells overexpressing CAD. As shown in Fig. 9C,
inclusion of z-VAD-fmk in STP-treated cultures completely prevented
oligonucleosomal degradation. Similar results to those described above
were also found in IMR-5 cells stably transfected with mouse CAD (data
not shown).

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 9.
Overexpression of human CAD in IMR-5 cells
restores oligonucleosomal DNA degradation and apoptotic nuclear
morphology. A and B, IMR-5 cells transfected
with empty pcDNA3 (left panels) or with pcDNA3/hCAD
(right panels) were treated with 100 nM STP for
24 h (A and bottom panels in B)
or left untreated (top panels in B). Then cells
were stained with Hoechst 33258 (A) or included in Durcupan
and processed for electron microscopy (B). Note that STP
treatment of hCAD-transfected IMR-5 cells induces a higher chromatin
condensation when compared with empty pcDNA3-transfected cells. The
bars indicate 20 µm in A and 2 µm in
B. C, IMR-5 cells transfected with empty
pcDNA3, pcDNA3/hCAD, or pcDNA3/hICADL or double
transfected with pcDNA3/hCAD and pcDNA3/hICADL were
treated for 12 h with 500 nM STP (STP), 500 nM STP plus 50 µM z-VAD-fmk (STP + VAD), or left untreated (control). DNA was extracted
and analyzed by conventional agarose gel electrophoresis.
|
|
Taken together our results suggest that the major alteration of IMR-5
cells is an atypical loss of CAD that precludes the appearance of
nuclear changes associated with apoptosis, i.e. DNA
oligonucleosomal degradation and stage II nuclear morphology.
 |
DISCUSSION |
In this report we have analyzed the molecular mechanisms that
could be involved in the lack of some hallmarks of apoptosis when the
IMR-5 neuroblastoma cells are subjected to diverse apoptotic stimuli
including STP. These cells die without digesting their DNA into
oligonucleosomal fragments and do not exhibit the typical nuclear
apoptotic condensation. Instead, IMR-5 nuclei show a marginal chromatin
condensation that never gives rise to the nuclear apoptotic bodies.
IMR-5 cells activate caspases, and cell death can be prevented by the
addition of chemical inhibitors of these proteases or by the forced
overexpression of Bcl-2 or Bcl-XL antiapoptotic genes. These data suggest that these cells die by apoptosis after STP treatment but do not display some of the typical nuclear changes.
It is considered that caspase-3, ICAD, and CAD are the minimal elements
required to induce oligonucleosomal DNA degradation (12, 14). It has
been described that caspase-3-deficient cells undergo apoptosis without
DNA laddering (6, 16). However, this does not seem to be the case in
IMR-5 cells, because they have a functional caspase-3 that is able to
process fodrin and ICAD. Cell-free experiments also demonstrate that
IMR-5 chromatin is not resistant to endonuclease degradation. Moreover,
Western blot analysis shows that IMR-5 and SH-SY5Y cells contain
comparable levels of CAD protein, and cDNA sequencing revealed that
CAD from IMR-5 was not mutated. Surprisingly, analysis of the protein
content by Western blot showed that CAD from IMR-5 completely
disappeared after 5-8 h of STP treatment. Moreover, the DNA laddering
and the apoptotic nuclear phenotype of IMR-5 cells treated with STP can
be rescued when CAD is overexpressed in these cells. These results
suggest that in IMR-5 cells treated with STP, CAD could suffer a
caspase-dependent degradation prior to the oligonucleosomal DNA degradation. Increasing the levels of CAD by transfection allows
IMR-5 cells to produce enough endonuclease to digest DNA. Interestingly, when STP and z-VAD-fmk were simultaneously added to
culture medium of IMR-5, CAD disappearance was completely prevented. Loss of CAD is not a unspecific event because several proteins that are
degraded during apoptosis (such as fodrin, poly(ADP-ribose) polymerase,
or lamin B1) show behavior similar to that observed for CAD,
i.e. they are degraded upon apoptosis induction in a caspase-dependent manner. Moreover, ERK, a protein that is
not fragmented after apoptotic stimuli (38), remained intact in STP-treated IMR-5 cells. Although the disappearance of CAD from IMR-5
cells is dependent on caspase activation, analysis of the primary
structure of CAD protein does not suggest that CAD could be directly
cut by caspases (Ref. 14 and data not shown). The nuclear morphology
observed in IMR-5 cells treated with STP resembles that reported by
Susin and co-workers after microinjection of recombinant
apoptosis-inducing factor into mouse embryonic fibroblasts (30). These
authors classify this nuclear condensation apoptosis-inducing factor
microinjection as stage I, whereas the nuclear morphology corresponding
to the highly packaged chromatin is defined as stage II. The authors
demonstrate that stage II condensation is only achieved when
recombinant active CAD is microinjected. Moreover, nuclear stage II
phenotype is associated with the appearance of DNA oligonucleosomal
fragmentation. Because CAD primary sequence is normal in IMR-5 cells
and CAD disappears after STP treatment, it is reasonable to think that
the major defect of IMR-5 cells is a deregulation in the mechanisms
that govern CAD turnover or degradation. However, these mechanisms are
currently unknown, and further efforts should be devoted to
understanding them. In this regard, it should be noted that degradation
of CAD is not the sole mechanism that could explain its disappearance
upon IMR-5 apoptosis. Thus, for example it could be possible that
apoptotic stimuli could block CAD synthesis, and this could result in a progressive decrease in the cytosolic CAD levels. However, this does
not seem to be the case in our system, because blockade of the protein
synthesis with cycloheximide (doses of up to 2 µg/ml and times up to
24 h) did not significantly modify the CAD levels (data not shown).
The relevance of the oligonucleosomal degradation of the chromatin
during the apoptotic process remains an open question, but it seems
clear that it is not directly involved in the cell decision to die and
operates at the end of the apoptotic program. Thus, enucleated cells
can die by apoptosis, and pharmacological inhibitors of DNases cannot
prevent cell death (39). However, the adequate disintegration of the
DNA might be an important event because the insufficient digestion of
the chromatin could be involved in several pathologies (for review, see
Refs. 40 and 41). It has been proposed that nondegraded cellular or
viral DNA can lead to neoplastic transformations because it could be
transferred from doomed to normal cells (18). Moreover, intact
nucleosomes are potential immunogens and could be responsible for the
generation of the autoantibodies found in the sera of individuals with
autoimmune diseases such as systemic lupus erythematosus (19). Finally, it has also been proposed that the phagocytic activity of healthy cells
located close to an apoptotic cell can be facilitated if the chromatin
of apoptotic bodies is already fragmented (40).
The relevance of the ICAD/CAD system in the physiological degradation
of the apoptotic DNA remains controversial. Recently, several reports
have demonstrated that this system is not absolutely necessary and that
alternative ways exist to degrade apoptotic DNA. The group of Nagata
(42) generated and analyzed a transgenic mouse that expresses a mutated
form of ICAD-S that cannot be cleaved by caspases. This mutated ICAD-S
cannot dissociate from CAD, and therefore CAD cannot be activated.
Nonetheless, the thymocytes from these animals can be engulfed by
macrophages, and their DNA is digested into oligonucleosomal fragments
by the action of the lysosomal acid DNase(s) (e.g. DNase
II). Likewise, Horvitz and colleagues (43) have indicated that
Caenorhabditis elegans mutants for the endonuclease
nuc-1 do not completely degrade DNA unless the apoptotic
cell is engulfed. Because the knockout mouse for CAD is not still
available, IMR-5 neuroblastoma cells could be a good cellular model for
studying the relevance of the oligonucleosomal DNA degradation by the
ICAD/CAD system in physiological and pathological situations.
 |
ACKNOWLEDGEMENTS |
The neuroblastoma cell lines employed in this
work were generous gifts from D. Martín-Zanca (University of
Salamanca, Spain). We thank J. L. Fernández-Luna (Servicio
de Inmunologia, Hospital Universitario Marques de Valdecilla,
Santander, Spain) for providing the Bcl-XL plasmid. We
thank A. Manonelles (Hospital University Arnau de Vilanova, Lleida,
Spain) for help with the ABI PRISM 310 automatic sequence analyzer,
Imma Montoliu and Roser Pané for technical support, and the rest
of colleagues of the Molecular Neurobiology Group for helpful
discussions. We specially acknowledge J. Egea, M. Encinas R. M. Soler,
and M. Aldea for comments on manuscript.
 |
FOOTNOTES |
*
This work was supported by Proyectos FEDER Grant
1FD97-0514-002-01 and Plan Nacional Salud y Farmacia Grant SAF
2000-0164-002-01) from the Spanish Government and grants from
Telemarató de TV3 (Edició 1999) and Generalitat de
Catalunya.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Recipient of a postgraduate fellowship from the Telemarató
de TV3.
§
Postdoctoral researcher supported by Project 1FD97-0514-002-01.
¶
To whom correspondence should be addressed. Tel.:
34-973-702-414; Fax: 34-973-702-426; E-mail:
joan.comella@cmb.udl.es.
Published, JBC Papers in Press, April 6, 2001, DOI 10.1074/jbc.M100072200
 |
ABBREVIATIONS |
The abbreviations used are:
CAD, caspase-activated DNase;
Ac-DEVD-afc, acetyl-Asp[OMe]-Glu[OMe]-Val-Asp[OMe]-7-amino-4-trifluoromethyl
coumarin;
ERK, extracellular-regulated kinase;
hCAD, human CAD;
ICAD, inhibitor of the caspase-activated DNase;
hICAD, human ICAD;
MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide;
NIB, nuclei isolation buffer;
PBS, phosphate-buffered saline;
STP, staurosporine;
z-VAD-fmk, benzyloxycarbonyl-Val-Ala- Asp[OMe]-fluoromethylketone;
PMSF, phenylmethylsulfonyl fluoride;
CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid;
Pipes, 1,4-piperazinediethanesulfonic acid.
 |
REFERENCES |
| 1.
|
Steller, H.
(1995)
Science
267,
1445-1449
|
| 2.
|
Jacobson, M. D.,
Weil, M.,
and Raff, M. C.
(1997)
Cell
88,
347-354
|
| 3.
|
Fadeel, B.,
Orrenius, S.,
and Zhivotovsky, B.
(1999)
Biochem. Biophys. Res. Commun.
266,
699-717
|
| 4.
|
Wyllie, A. H.,
Kerr, J. F.,
and Currie, A. R.
(1980)
Int. Rev. Cytol.
68,
251-306
|
| 5.
|
Walker, P. R.,
and Sikorska, M.
(1997)
Biochem. Cell Biol.
75,
287-299
|
| 6.
|
Janicke, R. U.,
Sprengart, M. L.,
Wati, M. R.,
and Porter, A. G.
(1998)
J. Biol. Chem.
273,
9357-9360
|
| 7.
|
Oberhammer, F.,
Wilson, J. W.,
Dive, C.,
Morris, I. D.,
Hickman, J. A.,
Wakeling, A. E.,
Walker, P. R.,
and Sikorska, M.
(1993)
EMBO J.
12,
3679-3684
|
| 8.
|
Walker, P. R.,
Leblanc, J.,
Carson, C.,
Ribecco, M.,
and Sikorska, M.
(1999)
Ann. N. Y. Acad. Sci.
887,
48-59
|
| 9.
|
Boix, J.,
Llecha, N.,
Yuste, V. J.,
and Comella, J. X.
(1997)
Neuropharmacology
36,
811-821
|
| 10.
|
Halenbeck, R.,
MacDonald, H.,
Roulston, A.,
Chen, T. T.,
Conroy, L.,
and Williams, L. T.
(1998)
Curr. Biol.
8,
537-540
|
| 11.
|
Liu, X.,
Li, P.,
Widlak, P.,
Zou, H.,
Luo, X.,
Garrard, W. T.,
and Wang, X.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
8461-8466
|
| 12.
|
Enari, M.,
Sakahira, H.,
Yokoyama, H.,
Okawa, K.,
Iwamatsu, A.,
and Nagata, S.
(1998)
Nature
391,
43-50
|
| 13.
|
Sakahira, H.,
Enari, M.,
and Nagata, S.
(1998)
Nature
391,
96-99
|
| 14.
|
Liu, X.,
Zou, H.,
Slaughter, C.,
and Wang, X.
(1997)
Cell
89,
175-184
|
| 15.
|
McIlroy, D.,
Sakahira, H.,
Talanian, R. V.,
and Nagata, S.
(1999)
Oncogene
18,
4401-4408
|
| 16.
|
Woo, M.,
Hakem, R.,
Soengas, M. S.,
Duncan, G. S.,
Shahinian, A.,
Kagi, D.,
Hakem, A.,
McCurrach, M.,
Khoo, W.,
Kaufman, S. A.,
Senaldi, G.,
Howard, T.,
Lowe, S. W.,
and Mak, T. W.
(1998)
Genes Dev.
12,
806-819
|
| 17.
|
Zhang, J.,
Liu, X.,
Scherer, D. C.,
van Kaer, L.,
Wang, X.,
and Xu, M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
12480-12485
|
| 18.
|
de la Taille, A.,
Chen, M. W.,
Burchardt, M.,
Chopin, D. K.,
and Buttyan, R.
(1999)
Cancer Res.
59,
5461-5463
|
| 19.
|
Herrmann, M.,
Voll, R. E.,
Zoller, O. M.,
Hagenhofer, M.,
Ponner, B. B.,
and Kalden, J. R.
(1998)
Arthritis Rheum.
41,
1241-1250
|
| 20.
|
Mukae, N.,
Enari, M.,
Sakahira, H.,
Fukuda, Y.,
Inazawa, J.,
Toh, H.,
and Nagata, S.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
9123-9128
|
| 21.
|
Liu, X.,
Zou, H.,
Widlak, P.,
Garrard, W.,
and Wang, X.
(1999)
J. Biol. Chem.
274,
13836-13840
|
| 22.
|
Lazebnik, Y. A.,
Cole, S.,
Cooke, C. A.,
Nelson, W. G.,
and Earnshaw, W. C.
(1993)
J. Cell Biol.
123,
7-22
|
| 23.
|
Liu, X.,
Kim, C. N.,
Yang, J.,
Jemmerson, R.,
and Wang, X.
(1996)
Cell
86,
147-157
|
| 24.
|
Vaux, D. L.,
Cory, S.,
and Adams, J. M.
(1988)
Nature
335,
440-442
|
| 25.
|
Benito, A.,
Silva, M.,
Grillot, D.,
Nuñez, G.,
and Fernandez-Luna, J. L.
(1996)
Blood
87,
3837-3843
|
| 26.
|
Bertrand, R.,
Solary, E.,
O'Connor, P.,
Kohn, K. W.,
and Pommier, Y.
(1994)
Exp. Cell Res.
211,
314-321
|
| 27.
|
Koh, J. Y.,
Wie, M. B.,
Gwag, B. J.,
Sensi, S. L.,
Canzoniero, L. M.,
Demaro, J.,
Csernansky, C.,
and Choi, D. W.
(1995)
Exp. Neurol.
135,
153-159
|
| 28.
|
Prehn, J. H.,
Jordan, J.,
Ghadge, G. D.,
Preis, E.,
Galindo, M. F.,
Roos, R. P.,
Krieglstein, J.,
and Miller, R. J.
(1997)
J. Neurochem.
68,
1679-1685
|
| 29.
|
Deshmukh, M.,
and Johnson, E. M., Jr.
(2000)
Cell Death. Differ.
7,
250-261
|
| 30.
|
Susin, S. A.,
Daugas, E.,
Ravagnan, L.,
Samejima, K.,
Zamzami, N.,
Loeffler, M.,
Costantini, P.,
Ferri, K. F.,
Irinopoulou, T.,
Prevost, M. C.,
Brothers, G.,
Mak, T. W.,
Penninger, J.,
Earnshaw, W. C.,
and Kroemer, G.
(2000)
J. Exp. Med.
192,
571-580
|
| 31.
|
Boix, J.,
Fibla, J.,
Yuste, V. J.,
Piulats, J. M.,
Llecha, N.,
and Comella, J. X.
(1998)
Exp. Cell Res.
238,
422-429
|
| 32.
|
Gross, A.,
McDonnell, J. M.,
and Korsmeyer, S. J.
(1999)
Genes Dev.
13,
1899-1911
|
| 33.
|
Cuvillier, O.,
Rosenthal, D. S.,
Smulson, M. E.,
and Spiegel, S.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
8395-8400
|
| 34.
|
Orth, K.,
Chinnaiyan, A. M.,
Garg, M.,
Froelich, C. J.,
and Dixit, V. M.
(1996)
J. Biol. Chem.
271,
16443-16446
|
| 35.
|
Germain, M.,
Affar, E. B.,
D'Amours, D.,
Dixit, V. M.,
Salvesen, G. S.,
and Poirier, G. G.
(1999)
J. Biol. Chem.
274,
28379-28384
|
| 36.
|
Janicke, R. U.,
Ng, P.,
Sprengart, M. L.,
and Porter, A. G.
(1998)
J. Biol. Chem.
273,
15540-15545
|
| 37.
|
Posmantur, R.,
McGinnis, K.,
Nadimpalli, R.,
Gilbertsen, R. B.,
and Wang, K. K.
(1997)
J. Neurochem.
68,
2328-2337
|
| 38.
|
Widmann, C.,
Gibson, S.,
and Johnson, G. L.
(1998)
J. Biol. Chem.
273,
7141-7147
|
| 39.
|
Schulze-Osthoff, K.,
Walczak, H.,
Droge, W.,
and Krammer, P. H.
(1994)
J. Cell Biol.
127,
15-20
|
| 40.
|
Peitsch, M. C.,
Mannherz, H. G.,
and Tschopp, J.
(1994)
Trends Cell Biol.
4,
37-41
|
| 41.
|
Ferri, K. F.,
and Kroemer, G.
(2000)
Nat. Cell Biol.
2,
E63-E64
|
| 42.
|
McIlroy, D.,
Tanaka, M.,
Sakahira, H.,
Fukuyama, H.,
Suzuki, M.,
Yamamura, K.,
Ohsawa, Y.,
Uchiyama, Y.,
and Nagata, S.
(2000)
Genes Dev.
14,
549-558
|
| 43.
|
Wu, Y. C.,
Stanfield, G. M.,
and Horvitz, H. R.
(2000)
Genes Dev.
14,
536-548
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. F. Segura, C. Sole, M. Pascual, R. S. Moubarak, M. Jose Perez-Garcia, R. Gozzelino, V. Iglesias, N. Badiola, J. R. Bayascas, N. Llecha, et al.
The Long Form of Fas Apoptotic Inhibitory Molecule Is Expressed Specifically in Neurons and Protects Them against Death Receptor-Triggered Apoptosis
J. Neurosci.,
October 17, 2007;
27(42):
11228 - 11241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Schaecher, E. Touchette, J. Schriewer, R. M. Buller, and A. Pekosz
Severe Acute Respiratory Syndrome Coronavirus Gene 7 Products Contribute to Virus-Induced Apoptosis
J. Virol.,
October 15, 2007;
81(20):
11054 - 11068.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. J. Yuste, I. Sanchez-Lopez, C. Sole, R. S. Moubarak, J. R. Bayascas, X. Dolcet, M. Encinas, S. A. Susin, and J. X. Comella
The Contribution of Apoptosis-inducing Factor, Caspase-activated DNase, and Inhibitor of Caspase-activated DNase to the Nuclear Phenotype and DNA Degradation during Apoptosis
J. Biol. Chem.,
October 21, 2005;
280(42):
35670 - 35683.
[Abstract]
[Full Text]
[PDF]
|
 |
|