![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 25, 22359-22367, June 22, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Laboratoire de Neurobiologie Cellulaire, CNRS FRE 2180, 5 rue Blaise Pascal, 67084 Strasbourg, France
Received for publication, January 26, 2001, and in revised form, April 4, 2001
When opened by depolarization,
L-type calcium channels are rapidly inactivated by
the elevation of Ca2+ concentration on the cytoplasmic
side. Recent studies have shown that the interaction of calmodulin with
the proximal part of the cytoplasmic C-terminal tail of the channel
plays a prominent role in this modulation. Two motifs interacting with
calmodulin in a Ca2+-dependent manner have been
described: the IQ sequence and more recently the neighboring CB
sequence. Here, using synthetic peptides and fusion proteins derived
from the Cav1.2 channel combined with biochemical
techniques, we show that these two peptides are the only motifs of the
cytoplasmic tail susceptible to interact with calmodulin. We determined
the Kd of the CB interaction with calmodulin to be
12 nM, i.e. below the Kd of
IQ-calmodulin, thereby precluding a competitive displacement of CB by
IQ in the presence of Ca2+. In place, we demonstrated that
a ternary complex is formed at high Ca2+ concentration,
provided that calmodulin and the peptides are initially allowed to
interact at a low Ca2+ concentration. These results provide
evidence that CB and IQ motifs interacting together with calmodulin
constitute a minimal molecular switch leading to
Ca2+-induced inactivation. In addition, we suggest that
they could also be the tethering site of calmodulin.
Numerous Ca2+-dependent cellular functions
are regulated by Ca2+ entries from the extracellular space.
Therefore, much interest has focused on the regulation of the
voltage-dependent Ca2+ channels. In the case of
the widely distributed L-type dihydropyridine-sensitive channels, opposing inhibitory and facilitatory effects are both Ca2+-dependent. Observations of invertebrate
cells (1) and identified L-type channels of mammalian
neurons (2) have demonstrated that Ca2+ channel
inactivation is promoted through Ca2+ entry itself, leading
to the paradigm that Ca2+ ions cause Ca2+
current inactivation by binding to a site inside the cell (3). Actually, intracellular photorelease of caged Ca2+ can
induce this blockade in less than 7 ms (4). From a functional point of
view, this type of blockade helps to maintain the internal Ca2+ concentration within physiological limits.
Facilitation in contrast is not systematically observed. A stimulatory
effect of Ca2+ ions is only observed as a result of
repetitive depolarizations (see Ref. 5, and references therein) or when
a steady, moderately elevated internal Ca2+concentration is
maintained before channel opening (6). In most cases, it is masked by
inhibition. Facilitation characteristically develops within 30-60 s,
suggesting a long multifactorial pathway. Therefore, these two opposing
regulatory processes were at first thought to be mechanistically unrelated.
Potential sites controlling the Ca2+-induced
inactivation/facilitation have been identified in the proximal third of
the C-terminal cytoplasmic domain of Cav1.2. An EF
hand-like motif located near the beginning of the 660-amino acid C
terminus was shown to be essential for preserving the
Ca2+-induced inactivation of the channel (7, 8), but not
operational in the direct binding of Ca2+ (8, 9). A region
of 80 residues located at a distance of 50 residues on the C-side of
the EF hand, potentially involved in alternate splicing substitutions,
was shown to be essential in preserving the Ca2+ -induced
inactivation of the commonly studied At present, these observations suggest that CB, but not IQ, should bind
to CaM at Ca2+ concentrations corresponding to the resting
state of the cell. However, both motifs would be able to bind at
Ca2+ levels corresponding to local concentrations reached
during the opening of the channel, although in a mutually exclusive
fashion. This raises the question of the function of one of these
motifs. If one considers the CaM interaction with the domain containing these two peptides as a Ca2+-triggered molecular switch, it
is obvious that structural or functional elements still need to be
assessed in order to provide a molecular description of its mechanism.
In the present report we show that CB and IQ are the only sequences of
the C-terminal tail of Cav1.2 capable of interacting with
CaM. We evaluated the affinity of CB for CaM and determined the
threshold Ca2+ concentration for CaM interaction with CB
and IQ alone and together. We demonstrate that CaM can form a ternary
complex with IQ and CB at Ca2+ concentrations reached
during the opening of the channel, provided the three partners have
been allowed to interact first at low Ca2+ concentrations
corresponding to the resting level of the cell. The present results
suggest that the interaction of CaM with the IQ and CB motifs is
sufficient for the formation of both a constitutive tethering and a
minimal molecular switch leading to the
Ca2+-dependent inactivation of
L-type Ca2+ channels.
Reagents--
Highly purified bovine brain calmodulin was either
purchased from Calbiochem (La Jolla, CA) or was a generous gift from
Dr. C. Lugnier (CNRS, Strasbourg, France). Streptavidin-coated
sensor chips were purchased from Biacore AB (Uppsala, Sweden).
N-terminally biotinylated CB and IQ peptides were synthesized and
purified in the institute facility.
Fusion Protein Constructs--
The pF2 fusion construct was
obtained in two steps. First, a sequence from a partial clone of rat
Cav1.2 (sequence identical to GenBankTM accession no.
M67515) was amplified by PCR with primers ACT.S
(GAGGATCCATGGACAACTTTGACTACC) and ACT.AS (GTGATTCGGTGTCCGCTTGG), subcloned into the EcoRV site of pBluescript SK Real Time Surface Plasmon Resonance Recording--
Real time
surface plasmon resonance (SPR) experiments were performed on a BIAcore
2000 biosensor system (Pharmacia Biosensor AB, Uppsala, Sweden). All
experiments were performed at 25 °C with a constant flow rate of 20 µl/min. Synthetic peptides were directly coupled to a
streptavidin-coated dextran matrix (SA sensor chip, Pharmacia
Biosensor). The density of immobilized peptides on the sensor chip
surface was 0.2 ng/mm2. Immobilization was monitored using
SPR spectroscopy. Calmodulin was diluted in a buffer containing 10 mM HEPES, pH 7.4, 150 mM NaCl, 1 mg/ml
CM-dextran, 0.005% surfactant P20 (running buffer), and 2 mM Ca2+ or 2 mM EGTA for binding
and complete desorption of calmodulin, respectively. All experiments
were run in triplicate and mean values ± S.D. are given.
Nonspecific binding was evaluated in the same experiment by measuring
binding to a surface saturated with biotin and subtracted
automatically. Absence of CaM binding on a third control peptide was
also monitored in parallel (data not shown).
Gel Shift Assays--
CaM (10 µM) was incubated
with different molar ratios of IQ and CB peptides in a buffer
containing 50 mM Tris-HCl (pH 7.4), 150 mM
NaCl, and 1 mM CaCl2 or 2 mM EGTA
for 30 min at room temperature. The bound complexes were then resolved
by nondenaturing polyacrylamide gel electrophoresis on a 12%
polyacrylamide gel in the presence of 2 mM
CaCl2 or 5 mM EGTA. Proteins were revealed by
Coomassie Blue staining.
Fluorescence--
Fluorescence studies were performed on a PTI
fluorescence system equipped with the FelixTM digital acquisition and
analysis software (Photon Technology International, Monmouth Junction, NJ). All measurements were performed at 25 °C in 3-ml, 1-ml, or 100-µl quartz cuvettes, taking care to use the same cuvette and instrumental for each set of experiments to be compared, in interaction buffer consisting of 50 mM MOPS, 130 mM NaCl, 1 mM EGTA, pH 7.4. The amount of CaCl2 added to
set the pCa was computed using the buffer program that
allows corrections for ionic strength, pH, and temperature (developed
in the laboratory by Dr. J.-L. Rodeau). Ca2+ and CB
titration were performed by successively adding small aliquots of
appropriate CaCl2 or CB stocks, keeping the total volume of
added solution to less than 3% of the initial volume. In this buffer,
the pH drift induced by Ca2+ titration of EGTA was checked
and shown to be less than 0.07 pH units over the buffering range of the
chelator (pCa 8.2-5.8). Usually entire spectra were
recorded in multiplicate (n = 3-4), buffer
contribution was subtracted, and spectra were averaged where indicated.
Numerical files from the recording were further analyzed and plotted
using the SIGMAPLOT 4.0 for Windows software.
Mapping of the Sequences from the C-terminal Domain of
Cav1.2 Interacting with Calmodulin--
Two short motifs
have been shown to be involved in the
CaM-Ca2+-dependent inactivation of
Cav1.2: CB (12, 18) and IQ (12, 14, 16) (see Fig.
1A), which display
Ca2+-dependent interactions with CaM (14, 16).
Using a biochemical approach to check if other domains of
Cav1.2 participate in the CaM binding, we constructed
His6-tagged fusion proteins covering the entire
intracellular C-terminal region and analyzed their interaction with CaM
in gel shift assays. From their charge distribution, all fusion
proteins except PF4 were expected to migrate toward the cathode in
their free form. When they are bound to CaM in a 1:1 ratio, the
complexes were expected to migrate toward the anode along with free CaM
but with different mobilities. As shown in Fig. 1B, when
mixed in equimolar ratios, PF2 and CaM formed a complex of low mobility
in the presence of 1 mM Ca2+. A concomitant
decrease of free CaM was observed. We were unable to saturate CaM by
raising the concentration of PF2, due to its limited solubility.
Neither PF3 nor PF4 seemed to bind to CaM; PF3 did not enter the gel,
and PF4 mobility was not affected. In agreement, the presence of these
fusion proteins did not diminish the amount of free CaM. We checked
that no motif of PF2 other than CB and IQ could interact with CaM by
using PF2
As reported previously (14, 16, 18), peptides CB and IQ bound to CaM
with 1:1 stoichiometry in the presence of saturating Ca2+
concentrations (Fig. 2A) and
no interaction was observed in 2 mM EGTA. When the ratio of
CB to CaM was 2 or higher a complex of still lower mobility appeared,
this could represent the binding of more than one peptide to CaM. Since
incubations and electrophoresis were performed at rather high
concentrations (at least 10 µM amounts of each partner),
we concluded that nonspecific interactions happened due to our
experimental set-up and did not characterize them further. Competition
of CB and IQ for CaM binding displayed a major band comigrating with
the complex CaM-IQ (Fig. 2B). A minor one of CB-CaM
was sometimes observed. Manipulations of relative peptide ratios,
provided they were both in excess to CaM, did not alter this pattern
significantly (data not shown). This result is consistent with studies
showing that a peptide containing the CB sequence, even in a 20-fold
molar excess, is entirely displaced by IQ (18).
We performed competition experiments for both of these peptides with
PF2 for Ca2+-dependent CaM binding at equimolar
ratios (Fig. 2C). Both peptides effectively competed with
PF2, as shown by the decrease in intensity of the PF2-CaM band. At this
level of resolution, neither of the peptide seemed to be more effective
than the other in displacing PF2. Moreover, the competitive effect of
the two peptides did not appear to be additive.
Surface Plasmon Resonance--
Interactions between CaM and
peptides CB and IQ were further studied by SPR spectroscopy. The
biotinylated peptides were immobilized on streptavidin-coated sensor
chips, and various CaM concentrations were run. Recorded SPR
sensorgrams show that, in the presence of 2 mM
Ca2+, CaM binds with fast kinetics to both peptides,
displaying typical saturation curves (Fig.
3). The interactions are
Ca2+-dependent since 2 mM EGTA
readily reversed the interaction (data not shown). Determinations of
the affinities yielded complex results. When analysis was performed
using the plateau values of binding, it yielded
Kd values of 349 ± 46 nM and
218 ± 22 nM for the interactions CaM-CB and CaM-IQ,
respectively. However, kinetics of their association and dissociation
indicated that these interactions are heterogeneous. The
kon value of CaM-CB is in the range of
107 M
In order to obtain information on the interactions of CaM with IQ and
CB and their Ca2+ dependence in solution without isolating
the complexes, we turned to fluorescence spectroscopy, taking advantage
of the distribution of tyrosine and tryptophan. CaM contains only two
Tyr located both in the C-terminal lobe, IQ contains two Tyr, and CB a
single tryptophan that has been shown to exhibit a blue-shift upon
binding to CaM (18).
Dependence of the Formation of Complexes IQ-CaM on Ca2+
Concentration--
Fluorescence spectra of CaM and IQ at 1 µM each were recorded with excitation at 270 nm, first in
1 mM EGTA and then the concentration of Ca2+
was gradually increased (Fig. 4). In the
absence of Ca2+, CaM alone displayed a faint fluorescence
peak, consistent with the frequent quenching of tyrosines in proteins
due to their interaction with nearby functional groups (22). When the
Ca2+ concentration was raised, a sharp rise in quantum
yield was observed in the region of pCa 6.4, indicative of
cooperative binding of the first two Ca2+ to the high
affinity C-terminal lobe bearing the two tyrosines. IQ alone displayed
a typical Tyr spectrum independent of the Ca2+
concentration. When mixed together in the absence of Ca2+,
CaM and IQ exhibited a peak at 304 nm, which was the sum of the spectra
of the two species. However, a rise of fluorescence was observed in the
region of pCa 6.4. This rise was 35% higher than what could
be expected from the CaM transition alone. This indicates that an
interaction between CaM and IQ indeed takes place at high
Ca2+ concentrations.
Ca2+ Dependence of the CB-CaM Interaction--
The
Ca2+-dependent interaction between CaM and CB,
was monitored by recording spectra from the single tryptophan of CB.
When excited at 295 nm, tyrosines do not absorb light and spectra of CaM and IQ were, as expected, virtually silent (Fig.
5, A and B). CB
alone displayed a typical Trp peak at 346-348 nm. The mixture of CaM
and CB in the absence of Ca2+ did not display any change in
the fluorescence spectrum. When the Ca2+ concentration was
increased, a sharp blue shift to 328 nm was observed with an increase
in peak fluorescence between pCa 7 and pCa 6, indicating that the Trp of CB is placed in a more hydrophobic environment upon binding to CaM. Sample spectra are shown in Fig. 5A and a contour plot of all spectra recorded at different
Ca2+ concentrations is shown in Fig. 5C. When
recorded in the presence of IQ, the interaction between CaM and CB
yielded less pronounced changes in the fluorescence spectra of Trp upon
Ca2+ titration. During the transition between
pCa 7 and pCa 6, a decrease in quantum yield and
a small blue shift to 336 nm were observed (Fig. 5, B and
D). Mixtures of CB and IQ in the absence of CaM did not
exhibit any spectral changes upon Ca2+ titration (data not
shown). Transitions of the CaM-CB interaction upon Ca2+
titration were compared in the presence and absence of IQ, using their
316/350 nm fluorescence ratio as an index of wavelength shift of the
peak. As shown in Fig. 5E, the pCa of transition was the same in the presence and absence of IQ.
Titration of CaM with CB--
CaM (1 µM) was
titrated with increasing amounts of CB at a concentration of
Ca2+ above the transition. In this experiment, excitation
was performed at 270 nm and fluorescence recorded at 320 nm, since we
observed that the fluorescence of the complex is more intense when
tyrosines are excited (data not shown). This is most probably due to
fluorescence energy transfer between one of the Tyr of CaM and the Trp
of CB. As shown in Fig. 6A,
this titration is biphasic; the fluorescence rises sharply below the
equimolar concentration. When CB is present in excess, this increase is
linear and parallels the fluorescence of CB alone. Regression analysis
showed that, above the equimolar point, CaM plus excess CB displays a
slope identical to that of CB alone. This indicates that CaM and CB
form a 1:1 complex with a Kd well below the
micromolar range. The titration was repeated at 0.1 µM
CaM, corresponding to the lowest limit for obtaining a reasonable
signal. We plotted the data by first subtracting to each point the
signal of CaM alone and the signal of equal amounts of CB alone and
then by normalizing the saturation, generating the binding profile
shown in Fig. 6B. This manipulation is legitimate if one
assumes that the total fluorescence signal is a linear combination of
the individual signals of the mixed species, complexes, and free
fluorophores. This condition is fulfilled when inner filter effects are
negligible, which is the case here, as indicated by the linearity of
the fluorescence increase even at concentrations well above the
measurement range. The data points were fitted with an equation
assuming a 1:1 binding (see legend to Fig. 6) and yielded a
Kd of 12.4 ± 2.8 nM
(r = 0.98), 1 order of magnitude lower than the value
obtained from the plateau values of Biacore experiments but in
agreement with the high affinity site characterized by kinetic-derived
values.
In the Presence of IQ, the Complex of CB with CaM at High
Ca2+ Concentrations Depends on Interactions at Low
Ca2+--
Unexpectedly, when we tried to record titrations
of CaM with CB in the presence of IQ at high Ca2+
concentrations, fluorescence spectra did not display any blue-shift of
the Trp peak. We also consistently observed an absence of blue shift
after mixing of CaM, CB, and IQ above pCa 6.5. As these results seemed to contradict the Ca2+ titration experiments
shown in Fig. 5, we suspected that the binding of CB to CaM in the
presence of IQ might require an initial interaction at low
Ca2+ concentration. In view of the emerging consensus that
CaM should be intrinsically bound in the neighborhood of the C-terminal
region of Cav1.2 (16), it seemed logical to assume that
during biosynthesis CaM associates with the channel at the resting
Ca2+ concentration of the cytoplasm, i.e. below
or around pCa 7. In order to check this hypothesis, we
applied a three-step protocol consisting in the mixture of equimolar
amounts of CaM, CB, and IQ in interaction buffer containing 1 mM EGTA. Spectra were recorded, and then pCa was
adjusted to 7.0 for fluorescence recording and finally set to 3.5, corresponding approximately to the Ca2+ level reached
during channel opening. As shown in Fig.
7, Trp displayed a marked blue shift in
fluorescence to 336 nm at high Ca2+ concentration. When the
peptides and CaM were directly diluted in buffer at pCa 3.5, this blue shift was not observed. Both protocols were repeated several
times (n = 7 for the three step protocol and
n = 3 for the direct dilution at pCa 3.5)
and yielded consistent results. It indicates that the initial
interaction, although not visible in fluorescence, must take place at
low Ca2+ in order to observe a binding of CB above
pCa 6.5. The observation of a decrease in fluorescence
intensity at pCa 7.0 favors this interpretation (Fig. 7).
However, when IQ was absent, a fluorescence blue shift of CB upon
interaction with CaM readily takes place at pCa 3.5, and did
not require a preliminary interaction at lower Ca2+
concentration (data not shown). Making a titration of CaM with CB in
the presence of IQ proved to be unfeasible, due to the complexity of
the protocol involved and the large interference of IQ fluorescence with the titration, generating poor signal/noise ratios. In order to
evaluate the proportion of CB involved in the interaction, we compared
the shape of the fluorescence spectrum of Trp at pCa 3.5 obtained using the three-step protocol with the spectrum observed in
the absence of Ca2+. This was done by normalizing both
spectra to their peak value and shifting them along the wavelength axis
in order to superimpose their peaks. If CB distributed between an
interacting pool and a free pool, one would expect to observe a
significant spreading of the spectrum at pCa 3.5. As shown
in the inset of Fig. 7, both peaks are superimposable,
indicating that the majority of CB interacts with CaM. The spectra of
the CB-CaM complexes in the absence and presence of IQ differed
significantly in terms of quantum yield and amplitude of the blue shift
(see Fig. 5), and the interaction of CB with CaM is quantitative both
in absence and presence of IQ. Thus, we can deduce that a ternary
complex CaM-CB-IQ is formed at high Ca2+ concentration, and
that this complex mimics the interaction of CaM with the C-terminal
region of Cav1.2 during Ca2+ inactivation of
the channel. When applying the three-step protocol to gel-shift
experiments, we did not find any other complexes except those shown in
Fig. 2B.
Recent work has provided new insights to our understanding of
Ca2+ inactivation of L-type Ca2+
channels, in particular characterization of their molecular
determinants. The Ca2+ effect has been shown to be
triggered by CaM, which binds to a 20 residues long IQ motif (14) of
the C-terminal tail of Cav1.2. CaM has also been shown to
bind to the CB motif in a Ca2+-dependent way
(18), at relatively low concentrations of this divalent ion (19).
Isolation of the complexes in gel-shift experiments indicated that the
association of CaM with CB does not occur if IQ is present. Therefore,
the role of CB remains enigmatic. More recently, a Ca2+
binding site has been described on the N-side of CB (19). Here we have
reexamined the interaction of CaM with the CB and IQ motifs of
Cav1.2, using three independent experimental approaches.
Gel-shift experiments allowed isolation of complexes, whereas SPR gave
access to kinetic parameters of these interactions, and fluorescence spectroscopy provided information on the complexes at equilibrium.
We first confirmed previous studies (14-16, 18, 19) in gel-shift
experiments showing that CaM binds with CB or IQ in the presence of
saturating concentration of Ca2+ and demonstrated that it
cannot bind to other motifs of the C-terminal tail of
Cav1.2. As noted previously (18), when CB and IQ were allowed to bind to CaM simultaneously, the CaM-IQ complex was the
predominant species, suggesting a competitive binding of the two
peptides. In the absence of Ca2+, no complexes of CaM with
either the peptides or the fusion protein PF2 were observed, although
Romanin et al. (19) showed that under certain circumstances,
presumably depending on folding or removal of bound Ca2+, a
fusion protein similar to PF2 binds to CaM in the absence of
Ca2+. Gel-shift experiments present several drawbacks in
analyzing these complexes that needed to be addressed. Firstly,
migrations in native gels depend on both net charge and Stoke's radius
of the species, and comigration of complexes of different compositions cannot be excluded when using a single condition of migration. However,
using gels of porosities varying from 7.5% to 20% acrylamide, we
obtained consistent results confirming the homogeneity of the observed
bands. A second point concerns the stability of the isolated complexes.
As the free peptides migrate in the opposite direction, a rapid
dissociation rate could prevent the observation of a complex existing
at equilibrium. Another inconvenience is due to the technical difficulties in controlling the Ca2+ concentration in a
medium of varying ionic strength, pH, and temperature during the
migration. To circumvent these last two points, other technical
approaches were necessary. We therefore turned to SPR in order to
precise the binary interactions between CaM and the peptides. Although
binding occurred in the presence of saturating Ca2+ levels,
measurement of binding affinities yielded complex results. Kinetics
analyses showed that on-rates are high and off-rates are heterogeneous,
suggesting that more than one class of binding site occurs when
peptides are immobilized. For the CaM-IQ interaction, the lower value
of Kd (40 nM) is consistent with
published results (50 nM; Ref. 17). A first approximation
of the CaM-CB interaction yielded a Kd below 24 nM, and a precise value of 12 nM was obtained
by fluorescence spectroscopy. It is worth noting that CB displays a
4-fold higher affinity for CaM than IQ at high Ca2+ and
that the interaction kinetics are rapid for both peptides. If their
binding to CaM were competitive, one would expect, in contradiction to
the gel-shift results, that the formation of CaM-CB would be favored
when the three partners are allowed to interact simultaneously. We
concluded that the ternary interaction is more complex than a simple
competitive binding to CaM and may involve conformational transitions
that are not evident in gel-shift analysis. Actually, the fluorescence
study at equilibrium showed that a ternary complex CaM-CB-IQ is formed
at high Ca2+ concentration.
We studied the Ca2+ dependence of the binary interaction
between CaM and the peptides and that of the ternary complex CaM-CB-IQ. All interactions displayed a marked cooperative transition in spectral
properties between pCa 7.0 and pCa 6.0 and these
transitions occurred at the same Ca2+ concentration as the
spectral change of CaM alone upon binding of two Ca2+ to
the C-terminal lobe. Two caveats apply to the interpretation of these
results. First, one must bear in mind that, if changes in fluorescence
signal arising from mixing of two or more components are a clue to an
interaction, an absence of signal modification does not necessarily
imply that the molecules do not interact with each other. It only means
that the local environment of the probing aromatic residue is
unaffected. Thus, rather than interpreting spectral changes as true
bindings of peptides to CaM, we prefer to express them as transitions
that could possibly be transconformations of preexisting
"invisible" complexes. A second restriction is related to well
known observations showing that the
Ca2+-dependent binding of peptides enhances
cooperatively the affinity of CaM for Ca2+ (23-27). If a
single lobe of CaM is preferentially involved in the binding of one or
the other of the peptides, its Ca2+ binding properties
could be affected and consequently the observed transition may not be
directly related to the CaM domain. The use of mutant CaMs, which are
unable to bind Ca2+ on one or the other of their lobes,
should resolve this issue.
Under physiological conditions, estimated Ca2+ basal levels
range between 40 and 70 nM Ca2+,
Ca2+-activated small conductance K+ channels
open in the range of 0.1-1 µM (28, 29) and transmitter release requires at least 10 µM Ca2+ (30).
The Ca2+ IC50 of Cav1.2 has been
estimated to be around 400 nM in smooth muscles (31) and 4 µM in cardiac cells (32). The large Ca2+
concentrations instantaneously attained upon photolysis of
Ca2+ caging DM-nitrophen lead to inactivation of
Cav1.2 (4), whereas the smaller Ca2+
concentration probably attained upon photolysis of Ca2+
caging nitr-5 gives rise to a facilitation (6), although precise measurements of Ca2+ concentration could not be achieved.
Thus, our observation of consistent fluorescence transitions around
pCa 6.5 are compatible with an activation process taking
place during Ca2+ channel opening.
Interestingly, the ternary complex can be formed only if the three
partners have been first allowed to interact at low Ca2+.
This implies that a complex should exist at Ca2+
concentrations below the transition, although we could not visualize it
experimentally, and that it is a prerequisite for the formation of the
ternary complex above this Ca2+ concentration. This view is
supported by the finding that a fusion protein containing the two
motifs can bind to CaM in the absence of Ca2+ and that
peptides analogue to CB bind to CaM at 50 nM
Ca2+ (19). Since mutated CaMs, which are unable to bind
Ca2+ on more than one of their binding sites, exerted a
dominant negative effect leading to a loss of Ca2+
inactivation, CaM is most likely constitutively associated with the
channel (14, 16, 17). Moreover, the Ca2+-induced
inactivation is a fast process requiring less than 7 ms (4), suggesting
that free CaM diffusing and binding could not easily account for these
kinetics. Since interactions of CaM with the IQ or the CB motifs at
first appeared strictly Ca2+-dependent, some
authors postulated that the constitutive site should be located in
other domains of the channel (16). The possible existence of a
CaM-peptide complex below the Ca2+-induced transition
level, as inferred from our results, suggests the possibility that
either CB or IQ motif, or a combination of both as a covalently
connected sequence, constitutes the attachment point of CaM to the
channel. In summary, our results show that a combination of CaM and the
two motifs CB and IQ displays the essential features of a minimal
Ca2+-induced molecular switch. When placed in the context
of the whole channel, the initial rearrangement of the CaM-CB-IQ
interaction is linked to features that need to be further evaluated. An
additional factor is certainly the recently described calcium sensor
domain lying on the N-side of CB (19), which has not been addressed here. This region directly binds Ca2+ without impairing CaM
binding and has been shown to partly contribute to the Ca2+
dependence of inactivation. The influence of the covalent connection of
these motifs in a single polypeptide also needs to be assessed. Subsequent domain movements acting in a relay system, which eventually obstructs the pore, are probably involved. A good candidate for a place
in this relay would be the EF-hand-like domain, which is essential for
inactivation but does not yet find a place in the switch process (9).
Other relaying candidates are suggested by recent observations,
demonstrating that the inactivation process involves the I-II
intracellular loop and associated We thank T. Tahouly for technical assistance
in preparing the plasmid constructs and fusion proteins, Dr. A. Janoshazi for providing easy access to the fluorescence spectroscopy
facility, Dr. C. Lugnier for providing purified calmodulin, and Dr. N. Grant-Takeda for help in the correction of the manuscript.
*
This work was supported by the CNRS and by a doctoral
fellowship from the Ministère de l'Education Nationale de la
Recherche et de la Technologie attributed to J. Mouton.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, April 9, 2001, DOI 10.1074/jbc.M100755200
The abbreviations used are:
CaM, calmodulin;
PCR, polymerase chain reaction;
SPR, surface plasmon resonance
spectroscopy;
MOPS, 3-(N-morpholino)propanesulfonic acid;
dansyl, 5-dimethylaminonaphthalene-1-sulfonyl.
Interactions of Calmodulin with Two Peptides Derived from the
C-terminal Cytoplasmic Domain of the Cav1.2
Ca2+ Channel Provide Evidence for a Molecular Switch
Involved in Ca2+-induced Inactivation*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1C77 splice variant of Cav1.2 (10, 11). In an extensive analysis involving
deletions and point mutations in this region, Zühlke et
al. described two short stretches operating in the
inactivation process (12): a dipeptide NE present 60 residues on the
C-side of the EF hand, and an octapeptide occurring 35 residues further
downstream that resembles an IQ consensus sequence for
Ca2+-independent calmodulin
(CaM)1 binding (13). This
sequence is now commonly referred as the IQ motif. Evidence that CaM
binds to the IQ segment has been provided recently (14-16). This
interaction is Ca2+-dependent with a 1:1
stoichiometry and occurs at Ca2+ concentrations above 100 nM. However, competition experiments with mutant CaMs
defective in Ca2+ binding suggest that it is constitutively
tethered to the channel (16). The actual domain of Cav1.2
responsible for constitutive binding of CaM is still unknown. Recently
the IQ motif and CaM were shown to be involved in both facilitation and
inactivation of the channel (17). An additional short sequence covering
the critical NE dipeptide also binds CaM in a strictly
Ca2+-dependent manner (18). The peptide, named
CB by the authors, binds with a 1:1 stoichiometry. At 200 µM Ca2+, IQ was shown to compete efficiently
with CB for CaM. Furthermore, these authors showed that injection of
the CB peptide into cardiac myocytes promotes facilitation of the
Ca2+ current, providing another clue to the CB involvement
in the Ca2+-dependent inactivation process.
More recently, Romanin et al. (19) showed that peptides
containing the CB motif can bind to CaM at Ca2+
concentrations as low as 50 nM and that a short stretch on
the N-side of CB directly binds Ca2+ with an affinity in
the range of 100 nM. Incidentally, the CB peptide was first
pointed out by Slavik et al. (20) for its ability to inhibit
both binding of [3H]ryanodine and activity of the
purified type-1 ryanodine receptor channel incorporated in planar lipid
bilayers, suggesting that its function is not restricted to the
Ca2+-dependent inactivation of
L-type channels.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
for
sequencing. Then, a BamHI/StuI fragment of 698 base pairs from this plasmid was subcloned in frame into
BamHI/SmaI-digested pQE30 (Quiagen). This
generated a 718-base pair product encoding a His6 fusion protein of the proximal C-terminal region of Cav1.2
(GenBankTM accession no. M67515, map position 4696-5370). The pF3
fusion construct was obtained by subcloning a
StuI/SacI fragment of 972 base pairs from a
partial clone of rat Cav1.2 (GenBankTM accession no.
M67515, map position: 5371-6342) into the
BamHI-blunted/SacI sites of pQE30. The pF4 fusion
construct was realized in two steps: first, subcloning of the
SacI/ApaI fragment from the C-terminal CaV1.2 partial clone in pBluescript SK
; and second,
cloning of the SacI/KpnI digestion product in
frame into pQE30 (GenBankTM accession no. M67515, map position
6343-6692). pF2
was prepared from pF2 by three PCR
amplifications with Pfx polymerase. First, two separate
amplifications were made using the following couple of primers,
C1/C2 (TGAGCGGATAACAATTTCACACAG)/(CTCTAGATCTGGCTTGCTCTAGGTTCCC)) and C3/C4 ((GAGGAGATCTGGTCGGCAAGCCCTC)/(TCCAGATGGAGTTCTGAGGTC)). The
C1/C2 and C3/C4 PCR products were digested by BglII, ligated with phosphorylated primers C5 (GATCCGACCAGGTGGTGCCCCCTGCAGGTGATGACGAG) and C6 (GATCGAACTTGCCCACTGTGACCTCGTCATCACCT), respectively, and then
repaired by Klenow polymerase. The two resulting fragments were mixed,
amplified with primers C1/C4, digested with BamHI and
HindIII, and cloned into the same sites of pQE30. Sequences of all constructs were checked, and fusion proteins were prepared in
denaturing conditions according to the standard protocols of the
QiaExpressionist kit (Qiagen). SDS-polyacrylamide gel electrophoresis and Coomassie Blue staining were used to check the apparent
electrophoretic mobility and purity of the fusion proteins.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

with both of these segments deleted. No interaction was
observed, confirming biochemically previous electrophysiological
studies showing that CB and IQ are the only determinants of the
C-terminal domain of Cav1.2 participating to a
Ca2+-dependent interaction with CaM (11, 19).
In the absence of Ca2+ (2 mM EGTA), none of the
fusion proteins bound to CaM (data not shown).

View larger version (28K):
[in a new window]
Fig. 1.
Interaction of fragments from the C-terminal
cytoplasmic region of Cav1.2 with CaM. A,
scheme depicting the structure of the C-terminal cytoplasmic region of
Cav1.2 on the C-side of the fourth transmembrane domain
(IV) and the positions of the EF-hand like structure
(EF), the CB and IQ peptides. All map positions are assigned
according to rat Cav1.2 sequence (GenBankTM accession no.
M67515). Sequences of CB and IQ peptides used in this study are shown
above (the CB sequence used here is the same as the CB-L-D peptide
described previously (18) but does not contain the 11 residues on the
N-side necessary for direct Ca2+ binding (19)).
His6-tagged fusion proteins shown below are mapped onto the
channel sequence. B, gel-shift experiments showing the
interaction between the fusion proteins and CaM. Fusion proteins and
CaM were incubated 30 min at a concentration of 10 µM for
each partner in buffer containing 1 mM CaCl2
and run on non-denaturing 15% acrylamide gels in the presence of the
same amount of Ca2+ in the running buffer and in the gel.
Proteins were revealed by Coomassie Blue staining.

View larger version (50K):
[in a new window]
Fig. 2.
Interaction of peptides CB and IQ with CaM in
the presence of 1 mM Ca2+. CaM (10 µM) was incubated with CB or IQ at the indicated peptide
(Pep.)/CaM molar ratios and run on 15% non-denaturing
polyacrylamide gels. A, stoichiometric interaction of CB and
IQ with CaM. Both peptides interact with a 1:1 stoichiometry. Note the
appearance of larger complexes of CB and CaM when CB is provided in
large excess. B, competition of CB and IQ for binding to
CaM. C, competition of CB or IQ with PF2 for binding to CaM.
CaM and PF2 were both at 10 µM.
1
s
1, and the limitations of the analysis
set-up did not allow to measure confidently on-rates higher than
106 M
1
s
1 (21). Moreover, dissociation rates could
only be fitted with a minimum of two exponentials, with
koff values of 0.024 and 0.33 s
1. Using a minimal
kon of 106
M
1 s
1,
upper limits of the Kd values were of 24 and 330 nM. For the CaM-IQ interaction, a
kon of 5.0 × 105
M
1 s
1
and two koff values of 0.02 and 0.4 s
1 were obtained, yielding
Kd of 40 and 400 nM, respectively. These
latter values can be compared with results previously obtained in
fluorescence studies for the dansyl-CaM- IQ interaction, yielding a
Kd of 50 nM (17). Plasmon resonance
spectroscopy indicated thus that two or more classes of binding sites,
possibly interconvertible, exist when these short peptides are
immobilized.

View larger version (28K):
[in a new window]
Fig. 3.
Quantitative analysis of CaM binding to CB
and IQ peptides using SPR spectroscopy. Left panels,
sensorgrams recorded with biotinylated synthetic peptides immobilized
on SA sensor chips and CaM (15.6, 31.2, 62.5, 125, 250, 500, 1000, and
2000 nM) in BIAcoreTM. The immobilization density was 0.2 ng peptide/mm2. During recording, running buffer contained
2 mM Ca2+ (open bars) and
CaM + 2 mM Ca2+ (filled
bars). Right panels, saturating curves plotting
response at plateau signal versus CaM concentration.
Curves are fitted by an hyperbolic function. A, binding of
CaM to IQ peptide, Kd = 218 ± 22 nM. B, binding of CaM to CB peptide,
Kd = 349 ± 46 nM.

View larger version (17K):
[in a new window]
Fig. 4.
Ca2+-dependent
interaction of IQ and CaM measured by fluorescence emission of the
tyrosines. IQ and CaM diluted to 1 µM in interaction
buffer. Excitation wavelength, 270 nm; input and output slit, 1 nm;
emission recorded between 286 and 400 nm by steps of 2 nm; integration
time, 0.2 s. Spectra are averages of three recordings, and buffer
contribution to the spectra was subtracted. A, spectra
recorded in 1 mM EGTA and at pCa 3.5. Dashed line, CaM alone; thin
line, IQ alone; thick line, CaM + IQ;
dotted line, summation of the individual spectra
from CaM and IQ alone. B, titration with Ca2+.
Each point is the mean ± S.D. of three measurements.
, CaM alone;
, IQ alone;
, CaM + IQ.

View larger version (35K):
[in a new window]
Fig. 5.
Ca2+-dependent
interactions of CB and CaM in the presence and absence of IQ measured
by fluorescence of the tryptophan. CB, CaM, and IQ were diluted in
interaction buffer to final concentrations of 1 µM.
Excitation wavelength 295 nm; input and output slit, 1 nm; emission
spectra recorded between 310 and 450 nm by steps of 2 nm; integration
time, 0.2 s. Spectra are averages of three recordings, buffer
contribution was subtracted. A, sample spectra of an
equimolar mix of CaM and CB at different Ca2+
concentrations: thin line, 1 mM EGTA;
dashed line, pCa 7; thick
line, pCa 3.5; open
circles, CaM alone in 1 mM EGTA;
dots, CB alone in 1 mM EGTA. B,
sample spectra of an equimolar mix of CaM, CB, and IQ at different
Ca2+ concentrations: thin line, 1 mM EGTA; dashed line, pCa
6.7; thick line, pCa 3.5;
open circles, CaM + IQ in the absence of CB in 1 mM EGTA. C, contour plot showing the evolution
of the spectra of CaM + CB with increasing Ca2+
concentrations. Contour lines are interpolations
of isoemissive points from the spectra expressed in photons/s × 10
4; arrows on the
right indicate the sampling of spectra used to construct the
plot. D, contour plot of the spectra of CaM + CB + IQ as a
function of Ca2+ concentration. E, measurement
of the Ca2+-induced blue-shift of interacting CB and CaM in
the presence and absence of IQ. In order to directly compare the
transitions observed in the presence and absence of IQ, the ratio of
fluorescence emission 316/350 nm was plotted versus
Ca2+ concentration. Each data point represents the
mean ± S.D. of three recordings.
, CaM + CB in the absence of
IQ;
, CaM + CB in the presence of IQ;
, CB alone. Curves were
obtained using either a non-linear four-parameter sigmoid fitting
program or a linear regression.

View larger version (15K):
[in a new window]
Fig. 6.
Binding of CB to CaM at pCa
3.5. CaM was diluted at the indicated concentration in interaction
buffer set to pCa 3.5, and increasing amounts of CB were
successively added in small aliquots. Excitation was at 270 nm, and
emission was recorded at 320 nm. Each point is the mean ± S.D. of
three recordings and buffer contribution has been subtracted.
A, CaM 1.0 µM, emission plotted
versus total CB concentration:
, CB in the presence of
1.0 µM CaM, linear regression below 1.2 µM
CB yielded a slope of 1.03 × 105 (r = 0.998) and above 1.2 µM, a slope = 6.04 × 104 (r = 0.997);
, CB alone; linear
regression: slope = 5.98 × 104
(r = 0.999). B, CaM 0.1 µM,
binding curve as a function of total CB concentration. The contribution
of CaM and the emission of free CB at the same concentration were
subtracted for each individual point. Values were normalized assuming
that saturation is complete above 1.2 µM CB.
Thick line, data points were fitted with the
equation relating bound CB (Lb) to the total
concentrations of CaM (C) and CB (L):
Lb = 1/2{(Kd + L + C)
[(Kd + L + C)2
4LC]0.5} and
yielded a Kd of 12.4 ± 2.8 nM.

View larger version (19K):
[in a new window]
Fig. 7.
Dependence of CaM-CB complex formation in the
presence of IQ when preincubated at low Ca2+
concentration. Samples were excited at 295 nm, and fluorescence
spectra were recorded between 310 and 450 nm. The three-step protocol
consisted of mixing CaM, CB, and IQ, each at 1 µM final
concentration, into interaction buffer in the absence of
Ca2+. Three spectra were recorded and averaged
(thick solid line), and then
pCa was adjusted to 7 and another set of spectra recorded
(dotted line); then pCa was adjusted
to 3.5 and spectra recorded (dashed line).
Usually, 5 min elapsed between the recordings, although longer
incubations did not change the fluorescence signal. The single-step
protocol consisted of mixing CaM, CB, and IQ directly in interaction
buffer adjusted to pCa 3.5 (thin solid
line). Inset, the spectra of the mixed peptides
at zero Ca2+ and at pCa 3.5 as obtained from the
three-step protocol were normalized and shifted in order to superimpose
their peak value: line, normalized spectrum obtained in the
absence of Ca2+; small circles,
normalized spectrum obtained at pCa 3.5 and shifted 10 nm
toward longer wavelength.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
subunit for both
Cav1.2 and Cav2.1 (33-35). These results
suggest that voltage-dependent and
Ca2+-dependent inactivations involve common
relays. In this frame, a chain of events involving several cytoplasmic
domains could contribute to Cav1.2 channel blockade (31).
Once the Ca2+-induced CaM-CB-IQ ternary interaction has
occurred, the C-terminal tail could act in synergy with the I-II loop.
Alternatively, the C-terminal switch domain may keep the channel
activatable in basal conditions by protecting the pore from the
blocking effect of the other cytoplasmic loops and upon
Ca2+ binding adopt a distinct conformation leading to a
more conventional voltage-dependent inactivation. In
support of this latter hypothesis are several observations showing that
deletions (12, 36) or mutations (10, 11, 14), which alter the CB-IQ
region of Cav1.2 and cause Ca2+ insensitivity,
enhance clearly the inactivation, when Ba2+ is used as the
permeant ion, rather than suppressing inactivation altogether. When
determined, the IBa inactivation kinetics of these variants
has been shown to be strongly voltage-dependent (10, 11),
leading to the emerging idea that Ca2+ channels subject to
Ca2+-dependent or voltage-dependent
inactivations are closed by a common mechanism.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence should be addressed. Tel.: 33-388-45-66-34;
Fax: 33-388-60-16-64; E-mail:
maulet@neurochem.u-strasbg.fr.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Eckert, R.,
and Chad, J. E.
(1984)
Prog. Biophys Mol. Biol.
44,
215-267
2.
Morad, M.,
Davies, N. W.,
Kaplan, J. H.,
and Lux, H. D.
(1988)
Science
241,
842-844
3.
Plant, T. D.,
Standen, N. B.,
and Ward, T. A.
(1983)
J. Physiol. (Lond.)
334,
189-212
4.
Hadley, R. W.,
and Lederer, W. J.
(1991)
J. Physiol. (Lond.)
444,
257-268
5.
Zygmunt, A. C.,
and Maylie, J.
(1990)
J. Physiol. (Lond.)
428,
653-671
6.
Gurney, A. M.,
Charnet, P.,
Pye, J. M.,
and Nargeot, J.
(1989)
Nature
341,
65-68
7.
De Leon, M.,
Wang, Y.,
Jones, L.,
Perez-Reyes, E.,
Wei, X.,
Soong, T. W.,
Snutch, T. P.,
and Yue, D. T.
(1995)
Science
270,
1502-1506
8.
Zhou, J.,
Olcese, R.,
Qin, N.,
Noceti, F.,
Birnbaumer, L.,
and Stefani, E.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2301-2305
9.
Peterson, B. Z.,
Lee, J. S.,
Mulle, J. G.,
Wang, L.,
de Leon, M.,
and Yue, D. T.
(2000)
Biophys. J.
78,
1906-1920
10.
Soldatov, N. M.,
Zühlke, R. D.,
Bouron, A.,
and Reuter, H.
(1997)
J. Biol. Chem.
272,
3560-3566
11.
Soldatov, N. K.,
Oz, M.,
O'Brien, K. A.,
Abernethy, D. R.,
and Morad, M.
(1998)
J. Biol. Chem.
273,
957-963
12.
Zühlke, R. D.,
and Reuter, H.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
3287-3294
13.
Rhoads, A. R.,
and Friedberg, F.
(1997)
FASEB J.
11,
331-340
14.
Zühlke, R. D.,
Pitt, G. S.,
Deisseroth, K.,
Tsien, R. W.,
and Reuter, H.
(1999)
Nature
399,
159-162
15.
Qin, N.,
Olcese, R.,
Bransby, M.,
Lin, T.,
and Birnbaumer, L.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
2435-2438
16.
Peterson, B. Z.,
DeMaria, C. D.,
Adelman, J. P.,
and Yue, D. T.
(1999)
Neuron
22,
549-558
17.
Zühlke, R. D.,
Pitt, G. S.,
Tsien, R. W.,
and Reuter, H.
(2000)
J. Biol. Chem.
275,
21121-21129
18.
Pate, P.,
Mochca-Morales, J.,
Wu, Y.,
Zhang, J. Z.,
Rodney, G.,
Serysheva, I.,
Williams, B. Y.,
Anderson, M. E.,
and Hamilton, S. L.
(2000)
J. Biol. Chem.
275,
39786-39792
19.
Romanin, C.,
Gamsjaeger, R.,
Kahr, H.,
Schaufler, D.,
Carlson, O,
Abernethy, D. R.,
and Soldatov, N. M.
(2000)
FEBS Lett.
487,
301-306
20.
Slavik, K. J.,
Wang, J. P.,
Aghdasi, B.,
Zhang, J. Z.,
Mandel, F.,
Malouf, N.,
and Hamilton, S. L.
(1997)
Am. J. Physiol.
272,
C1475-C1481
21.
Hall, D. R.,
Cann, J. R.,
and Winzor, D. J.
(1996)
Anal. Biochem.
235,
175-184
22.
Lakowicz, J. R.
(1983)
Principles of Fluorescence Spectroscopy
, pp. 341-379, Plenum Publishing Corporation, New York
23.
Maulet, Y.,
and Cox, J. A.
(1983)
Biochemistry
22,
5680-5686
24.
Olwin, B. B.,
and Storm, D. R.
(1985)
Biochemistry
24,
8081-8086
25.
Yazawa, M.,
Ikura, M.,
Hikichi, K.,
Ying, L.,
and Yagi, K.
(1987)
J. Biol. Chem.
262,
10951-10954
26.
Yazawa, M.,
Vorherr, T.,
James, P.,
Carafoli, E.,
and Yagi, K.
(1992)
Biochemistry
31,
3171-3176
27.
Martin, S. R.,
Bayley, P. M.,
Brown, S. E.,
Porumb, T.,
Zhang, M.,
and Ikura, M.
(1996)
Biochemistry
35,
3506-3517
28.
Lang, D. G.,
and Ritchie, A. K.
(1987)
Pflügers Arch.
410,
614-622
29.
Capiod, T.,
and Ogden, D. C.
(1989)
J. Physiol. (Lond.)
409,
285-295
30.
Schneggenburger, R.,
and Neher, E.
(2000)
Nature
406,
889-893
31.
Schuhmann, K.,
Romanin, C.,
Baumgartner, W.,
and Groschner, K.
(1997)
J. Gen. Physiol.
110,
503-513
32.
Hofer, G. F.,
Hohenthanner, K.,
Baumgartner, W.,
Groschner, K.,
Klugbauer, N.,
Hofmann, F.,
and Romanin, C.
(1997)
Biophys. J.
73,
1857-1865
33.
Cens, T.,
Restituito, S.,
Galas, S.,
and Charnet, P.
(1999)
J. Biol. Chem.
274,
5483-5490
34.
Cens, T.,
Restituito, S.,
and Charnet, P.
(1999)
FEBS Lett.
450,
17-22
35.
Restituito, S.,
Cens, T.,
Barrere, C.,
Geib, S.,
Galas, S.,
De Waard, M.,
and Charnet, P.
(2000)
J. Neurosci.
20,
9046-9052
36.
Klöckner, U.,
Mikala, G.,
Varadi, M.,
Varadi, G.,
and Schwartz, A.
(1995)
J. Biol. Chem.
270,
17306-17310
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
H. E. D. J. ter Keurs and P. A. Boyden Calcium and Arrhythmogenesis Physiol Rev, April 1, 2007; 87(2): 457 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Pitt Calmodulin and CaMKII as molecular switches for cardiac ion channels Cardiovasc Res, March 1, 2007; 73(4): 641 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tong, W. Zhang, K. Conrad, K. Mostoller, J. Y. Cheung, B. Z. Peterson, and B. A. Miller Regulation of the Transient Receptor Potential Channel TRPM2 by the Ca2+ Sensor Calmodulin J. Biol. Chem., April 7, 2006; 281(14): 9076 - 9085. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Halling, P. Aracena-Parks, and S. L. Hamilton Regulation of Voltage-Gated Ca2+ Channels by Calmodulin Sci. Signal., December 20, 2005; 2005(315): re15 - re15. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-J. Xu, L.-Y. Hao, A. Kameyama, and M. Kameyama Calmodulin reverses rundown of L-type Ca2+ channels in guinea pig ventricular myocytes Am J Physiol Cell Physiol, December 1, 2004; 287(6): C1717 - C1724. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Baumann, A. Gerstner, X. Zong, M. Biel, and C. Wahl-Schott Functional Characterization of the L-type Ca2+ Channel Cav1.4{alpha}1 from Mouse Retina Invest. Ophthalmol. Vis. Sci., February 1, 2004; 45(2): 708 - 713. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Putkey, Q. Kleerekoper, T. R. Gaertner, and M. N. Waxham A New Role for IQ Motif Proteins in Regulating Calmodulin Function J. Biol. Chem., December 12, 2003; 278(50): 49667 - 49670. [Abstract] [Full Text] |