JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M101907200 on April 18, 2001

J. Biol. Chem., Vol. 276, Issue 25, 22565-22572, June 22, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/22565    most recent
M101907200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miranda, K. C.
Right arrow Articles by Teasdale, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miranda, K. C.
Right arrow Articles by Teasdale, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Dileucine Motif Targets E-cadherin to the Basolateral Cell Surface in Madin-Darby Canine Kidney and LLC-PK1 Epithelial Cells*

Kevin C. MirandaDagger §, Tatiana KhromykhDagger , Perpetina ChristyDagger , Tam Luan LeDagger §, Cara J. Gottardi, Alpha S. YapDagger ||**, Jennifer L. StowDagger §, and Rohan D. TeasdaleDagger DaggerDagger

From the Dagger  Institute for Molecular Bioscience, the § Department of Biochemistry, and the || Department of Physiology & Pharmacology, University of Queensland, Brisbane, Queensland 4072, Australia and the  Memorial Sloan-Kettering Cancer Center, New York, New York 10021

Received for publication, March 2, 2001, and in revised form, April 11, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

E-cadherin is a major adherens junction protein of epithelial cells, with a central role in cell-cell adhesion and cell polarity. Newly synthesized E-cadherin is targeted to the basolateral cell surface. We analyzed targeting information in the cytoplasmic tail of E-cadherin by utilizing chimeras of E-cadherin fused to the ectodomain of the interleukin-2alpha (IL-2alpha ) receptor expressed in Madin-Darby canine kidney and LLC-PK1 epithelial cells. Chimeras containing the full-length or membrane-proximal half of the E-cadherin cytoplasmic tail were correctly targeted to the basolateral domain. Sequence analysis of the membrane-proximal tail region revealed the presence of a highly conserved dileucine motif, which was analyzed as a putative targeting signal by mutagenesis. Elimination of this motif resulted in the loss of Tac/E-cadherin basolateral localization, pinpointing this dileucine signal as being both necessary and sufficient for basolateral targeting of E-cadherin. Truncation mutants unable to bind beta -catenin were correctly targeted, showing, contrary to current understanding, that beta -catenin is not required for basolateral trafficking. Our results also provide evidence that dileucine-mediated targeting is maintained in LLC-PK1 cells despite the altered polarity of basolateral proteins with tyrosine-based signals in this cell line. These results provide the first direct insights into how E-cadherin is targeted to the basolateral membrane.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

E-cadherin is expressed on the lateral membranes of epithelial cells where it accumulates as a major component of the adherens junction. The cadherins in adherens junctions have central roles in establishing and maintaining cell-cell adhesion and cell polarity in epithelia and participate in morphogenesis during development (1-4). The continual expression and function of E-cadherin is important in its role as a tumor suppressor and the loss of E-cadherin function contributes to tumor invasion and progression in carcinomas (5).

Mature, human E-cadherin is a 728-amino acid, single pass transmembrane protein (6). The E-cadherin ectodomain is involved in Ca2+-dependent homotypic binding to E-cadherins on adjacent cell membranes, and its cytoplasmic tail is involved in a series of protein interactions providing a link to the actin cytoskeleton. The cytoplasmic tail of E-cadherin is bound directly to beta -catenin or plakoglobin, and thereby to alpha -catenin and actin (reviewed in Ref. 2). The binding site for beta -catenin has been mapped by deletion mutagenesis to the distal 76 amino acids of the carboxyl terminus of E-cadherin (7), with critical residues found in the last 30 amino acid domain (8). Aside from its participation as a member of the cadherin-bound adherens junction complex, beta -catenin is involved in the Wnt signaling pathway through its interactions with a cytoplasmic adenomatous polyposis coli complex and with the Lef/Tcf transcription factors in the nucleus (reviewed in Ref. 9).

Epithelial cells are morphologically and functionally polarized with distinct complements of cell surface proteins and lipids at the apical or basolateral poles. Maintenance of this polarity requires that newly synthesized proteins are sorted and targeted to specific membrane domains (10-12). Sorting of proteins to the apical domain of polarized cells occurs via lipid raft interactions or through oligosaccharides (13-15), whereas specific amino acids motifs act as sorting signals to target membrane proteins to the basolateral cell surface (reviewed in Ref. 16). For example, tyrosine-based motifs target the low density lipoprotein receptor to the basolateral domain of polarized cells (17), whereas a dileucine motif is utilized by other proteins, like the Fc receptor (18). Both types of signals can also be used to direct endocytosis from the plasma membrane, although the structural requirements for each pathway may differ (19-22). Yet other amino acid motifs can be used by selected proteins for basolateral targeting (23-25). Previous studies on adhesion molecules have defined a dileucine signal that functions in the basolateral targeting of the Lutheran glycoprotein (26) and a similar dihydrophobic signal in CD44 (27). The basolateral targeting of neural cell adhesion molecule (N-CAM) has been attributed to a cytoplasmic tail sequence without classic motif homology (23). Detailed information and further insights are needed into how other classes of adhesion proteins, including cadherins, are sorted and trafficked in polarized cells.

Recently, the polarized epithelial cells of the pig kidney LLC-PK1 line have been distinguished as having aspects of inverted polarity. Roush et al. (28) noted that some typically basolateral proteins, such as the H,K-ATPase beta  subunit, are delivered to the apical pole of LLC-PK1 cells. Mis-sorting of basolateral proteins in LLC-PK1 cells led to subsequent analysis of their AP-1 adaptor complexes. Most polarized epithelial cells express a special µ1B subunit, which directs polarized sorting to the basolateral surface (29). It has now been shown that LLC-PK1 cells express a µ1A subunit but not the µ1B subunit and that this results in aberrant sorting of proteins with tyrosine-based signals, a defect that can be overcome by expression of recombinant µ1B protein (30). Cadherin staining in LLC-PK1 cells appears to be basolateral (31), although the trafficking of these proteins in this cell line has not been studied in detail.

The correct placement of E-cadherin on the plasma membrane is required from an early stage to help establish and maintain cell polarity (32). The mechanisms that mediate the sorting and polarized delivery of E-cadherin to the surface have not been elucidated. Previous studies have shown that beta -catenin binds to E-cadherin early in the biosynthetic pathway, implying that the two proteins, and perhaps others, are transported to the cell surface together as a complex (33). More recently, it was suggested that beta -catenin plays an essential role in the trafficking of E-cadherin, based on observations that mutagenized proteins, with reduced binding to beta -catenin, were not efficiently delivered to the surface (34). It has also been previously noted that the cytoplasmic tail of E-cadherin does contain motifs with homology to known targeting signals (34, 35), which could potentially function to guide its trafficking. In this study we set out to test putative signals in the cytoplasmic tail of E-cadherin for possible basolateral targeting information. Our experiments also addressed the role of beta -catenin in this targeting. We utilized a series of chimeras to express the E-cadherin cytoplasmic tail, or mutagenized versions thereof, using Tac (the alpha  subunit of the IL-2 receptor) as an ectodomain marker. Tac is a 273-amino acid protein that has previously been used as a reporter protein for trafficking studies (36, 37). These constructs were expressed in MDCK1 cells, in which the basolateral surface expression of E-cadherin is well established, and in another epithelial cell line LLC-PK1 cells. Using these model systems we have identified a positive targeting signal in E-cadherin that is responsible for basolateral delivery. Our results provide new insights into the trafficking of E-cadherin and its accessory proteins (catenins), and the findings are also significant to our understanding of cell polarity and sorting pathways in epithelia.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture-- Madin-Darby canine kidney (MDCK) and pig kidney (LLC-PK1) cell lines were grown and passaged as described previously (38) in Dulbecco's modified Eagle's medium (Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal calf serum and 2 mM glutamine in 5% CO2 and 95% air.

Antibodies-- Mouse monoclonal antibodies (Transduction Laboratories, Lexington, KY) raised against a conserved region of the cytoplasmic domain of human E-cadherin and against beta -catenin were used; Tac was recognized using a mouse monoclonal antibody (B-B10, BIOSOURCE International, Camarillo, CA) and a rabbit polyclonal antibody directed against the green fluorescence protein (GFP) (Molecular Probes Inc., Eugene, OR) was also used for staining. Secondary antibodies included Cy3-conjugated sheep anti-mouse and goat anti-rabbit IgGs (Jackson ImmunoResearch Labs, West Grove, PA) and a horseradish peroxidase-conjugated sheep anti-mouse IgG (AMRAD, Victoria, Australia).

cDNA Construction and Expression-- Chimeric fusions between human E-cadherin cDNAs and the cDNA encoding for Tac were generated in the pCDNA3 expression vector. Molecular cloning techniques were performed according to Sambrook et al. (39), using reagents from New England BioLabs (Beverly, MA). All constructs were confirmed by DNA sequencing. cDNAs encoding the transmembrane plus cytoplasmic domains (residues 554-728), the cytoplasmic tail (residues 578-728), or the amino-terminal half of the cytoplasmic tail (578) of human E-cadherin were amplified using PCR with specific oligonucleotide primers. E-cadherin residue numbers correspond to the mature protein as defined previously (6). The oligonucleotide primers contained restriction endonuclease sites allowing generation of in-frame fusions with the Tac cDNA. Cloning the respective PCR products into pCMV-IL2R (40) using the HindIII and XbaI sites generated the pCMV-Tac/Ecad-(578-728) and pCMV-Tac/Ecad-(578-653) plasmids. The entire Tac/E-cadherin cDNA constructs were then subcloned into the pCDNA3 expression vector (Invitrogen, Carlsbad, CA) that also encodes for the neomycin selection marker. The resulting constructs were termed Tac/Ecad-(578-728) and Tac/Ecad-(578-653). To generate the Tac/Ecad-(554-728) plasmid, an EcoRV restriction endonuclease site was introduced using PCR at the end of the extracellular domain of the Tac cDNA within pCDNA3. This modification altered residue 239 of the Tac cDNA from an Asp to a Gln. The final plasmid was generated by cloning the E-cadherin PCR product into the EcoRV and XbaI sites.

E-cadherin-GFP encodes the full-length E-cadherin sequence with the green fluorescence protein (GFP) fused to the carboxyl terminus of the cytoplasmic domain. Initially, a SacII restriction endonuclease site was introduced at the carboxyl terminus of the full-length cDNA of E-cadherin. This was achieved by the PCR amplification of the entire E-cadherin cDNA using specific oligonucleotide primers using pCDNA3-hECad (41) as a template. The 3'-primer included the SacII site and a XbaI site. The resulting PCR product was digested with SgrA1 and XbaI and subcloned into pCDNA3-hECad using the same sites. The open reading frame of GFP was amplified by PCR using specific oligonucleotide primers and pEGFP-N1 (CLONTECH, Palo Alto, CA) as a template. The 5'-primer contained a SacII site that allowed the resulting PCR product to be cloned into the SacII site introduced into in the carboxyl terminus of E-cadherin.

Mutagenesis of the two leucine residues at positions 587 and 588 of human E-cadherin to alanines was performed using oligonucleotide cloning. The construct pCMV-Tac/Ecad-(578-728) was digested with HindIII and XbaI to remove a 55-bp fragment that included the codons for the dileucine residues. The digested plasmid was then ligated with the annealed, phosphorylated, synthetic oligonucleotides 5'-AGCTTCGTCGACGCGCGGTGGTCAAAGAGCCCGCAGCACCCCCAGAGGATGACAC3-' and 5'-CCGGGTGTCATCCTCTGGGGGTGCTGCGGGCTCTTTGACCACCGCGCGTCGACGA3'. These complementary oligonucleotides contain a 5'-HindIII end and a 3'-XbaI end, as well as codons encoding for LRRRAVVKEPAAPPEDD (altered residues are underlined). The resulting construct was termed Tac/Ecad-(578-728)Delta S1.

For transfection and expression of cDNAs, sub-confluent LLC-PK1 or MDCK cells were transfected with plasmid DNA (2 µg) in complex with LipofectAMINE Plus reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturer's guidelines. For stably expressing lines, transfected cells were passaged and maintained in media containing G418 (Geneticin, Life Technologies, Inc.); cells were kept under selection for 7-10 days and then plated at low density for ring cloning of surviving cells. Clonal cell lines were generated and then assessed by indirect immunofluorescence and immunoblotting to select lines with different levels of recombinant protein expression.

Indirect Immunofluorescence-- Confluent monolayers of cells grown on glass coverslips or on Transwell polycarbonate filters (Corning Costar, Cambridge, MA) were generally fixed in 4% paraformaldehyde in PBS for 90 min and then permeabilized in PBS containing 0.1% Triton X-100 for 5 min. In one experiment LLC-PK1 cells were fixed in ice-cold methanol for 10 min. Cells were then incubated sequentially with primary antibody (1 h) and then secondary antibodies (30 min) using PBS containing bovine serum albumin (Sigma Chemical Co., St. Louis, MO) as a blocking buffer. Cells were mounted on slides in PBS/glycerol (50/50) containing 1% n-propyl-galate. For some experiments, cells were treated with 10 µM cycloheximide (Sigma), which was added to the medium for various times up to 4 h prior to fixation. Cells on coverslips were examined by epifluorescence using an Olympus Provis AX-70 microscope, and images were collected with a CCD300ET-RCX camera (DageMTI, Michigan City, IN) using National Institutes of Health IMAGE software. Cells growing on Transwell filters were examined using a Bio-Rad MRC-600 confocal laser-scanning microscope mounted on a Zeiss Axioskop, and XY and XZ sections were generated using Bio-Rad MRC-600 CoMOS software.

Immunoprecipitation and Immunoblotting-- Confluent monolayers of transfected MDCK and LLC-PK1 cells were solubilized in cold RIPA buffer (1% Triton X-100, 1% deoxycholate, 0.1% SDS, 0.15 NaCl, 5 mM EDTA, 25 mM Tris-HCl, pH 7.4) containing protease inhibitors (Roche Molecular Biochemicals, Germany) on ice. Post-nuclear supernatants were incubated with the Tac antibody for 2 h and then with washed protein G beads (Sigma) for a further 2 h. Precipitates were recovered by centrifugation then washed through several rounds of RIPA buffer and 20 mM Tris-HCl (pH 7.4) prior to solubilization in concentrated SDS-PAGE sample buffer. Proteins in cell extracts and immunoprecipitates were separated on 8% SDS-PAGE reducing gels and then transferred to polyvinylidene difluoride Immunobilon-P membranes (Millipore, Bedford, MA) and stained with 0.1% Coomassie Brilliant Blue to ensure even protein transfer and protein loading. Membranes were immunoblotted by sequential incubations in primary antibody, horseradish peroxidase-conjugated secondary antibody followed by chemiluminescence detection with Supersignal West Pico (Pierce Chemical Co., Rockford, IL). Different luminescence exposures were collected and exposures in the linear range were used.

Surface Biotinylation-- Confluent monolayers of LLC-PK1 cells stably expressing Tac/Ecad-(578-728) or Tac/Ecad-(578-653) grown on filters were incubated in media containing 1.5 mg/ml Sulfo-NHS-SS-biotin (Pierce), applied to either the apical or basal side of the filter, for 60 min on ice. Filters were then washed several times in cold PBS before cells were scraped off and lysed in cold RIPA buffer. Soluble cell fractions were incubated with streptavidin beads (Sigma) in RIPA buffer, pH 7.4, for 2 h with rotation. Beads were then washed in several rounds of RIPA buffer and 20 mM Tris-HCl (pH 7.4). Biotinylated proteins bound to the streptavidin beads and unlabeled proteins in the supernatants were analyzed by SDS-PAGE, immunoblotting, and densitometry to quantitate the relative amounts of biotinylated Tac/Ecad proteins.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Basolateral Targeting of E-cadherin-- E-cadherin is delivered to the basolateral surface of polarized MDCK cells, where it gives a typical and widely documented staining pattern using specific antibodies (Fig. 1a). The same antibody did not stain E-cadherin in paraformaldehyde-fixed LLC-PK1 cells (Fig. 1c), but it did produce cell surface staining of E-cadherin in methanol-fixed LLC-PK1 cells (31 and Fig. 1b). Hence E-cadherin is expressed endogenously in both cell lines and is found in a polarized distribution. A tagged construct of human GFP-E-cadherin was expressed in MDCK cells, generating a clear basolateral surface staining pattern with GFP antibodies, showing that GFP-E-cadherin is targeted in a manner analogous to the endogenous protein (Fig. 1d). GFP-E-cadherin was also expressed in epithelial LLC-PK1 cells, where it was also targeted in a polarized fashion to the basolateral membrane (Fig. 1e).


View larger version (153K):
[in this window]
[in a new window]
 
Fig. 1.   Localization of E-cadherin. MDCK and LLC-PK1 cells were generally fixed with paraformaldehyde and labeled with a mouse monoclonal antibody to localize endogenous E-cadherin by immunofluorescence. a, E-cadherin staining in MDCK cells on cell boundaries is at the basolateral domain; b, in LLC-PK1 cells fixed in methanol, there is typical basolateral surface staining; c, in LLC-PK1 cells fixed in paraformaldehyde the E-cadherin antibody gave no staining. GFP-E-cadherin is localized by the GFP antibody on the basolateral membrane of transfected MDCK cells (d) and LLC-PK1 cells (e). There is also some intracellular, perinuclear staining of newly synthesized GFP-E-cadherin in LLC-PK1 cells (arrows). Bar, 2.5 µm.

Targeting of Tac/E-cadherin Chimeras-- For targeting studies we utilized chimeras consisting of the ectodomain of Tac fused to the cytoplasmic tail of E-cadherin (Fig. 2A). Chimeric cDNAs expressed in epithelial cells all produced proteins of the expected molecular masses (Fig. 2B). Tac typically localizes to the apical membrane in polarized cells (Ref. 36 and Fig. 3, a and b), therefore, any basolateral signal in the E-cadherin cytoplasmic domain is predicted to redirect Tac from apical to basolateral membranes. cDNAs for Tac alone or chimeric proteins were transfected into MDCK and LLC-PK1 cells, and clonal, stably transfected cell lines were selected. Antibodies against Tac were used to detect the chimeric proteins and determine their localization by indirect immunofluorescence and confocal microscopy.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2.   A, diagrammatic representation of chimeras. Chimeras were made by fusing amino-terminal regions of Tac, encompassing the extracellular domain and transmembrane domain to the full-length carboxyl-terminal cytoplasmic tail of E-cadherin (shaded) (Tac/Ecad-(578-728)). In some constructs the transmembrane domain of Tac was replaced with that of E-cadherin (Tac/Ecad-(554-728)). In Tac/Ecad-(578-653) the E-cadherin tail was truncated leaving only the membrane-proximal region. B, extracts of MDCK (lane 1) and LLC-PK1 cells (lanes 2-5) were probed by immunoblotting with the E-cadherin antibody to detect Tac/Ecad chimeras. Proteins of the expected molecular weight were detected for each of the Tac/Ecad chimeras (Tac/Ecad-(578-728), 72 kDa; Tac/Ecad-(554-728), 72 kDa; Tac/Ecad-(578-653), 62 kDa; Tac/Ecad-(578-728)Delta S1, 72 kDa (see also Fig. 5)).


View larger version (167K):
[in this window]
[in a new window]
 
Fig. 3.   Localization of Tac/E-cadherin chimeras. Immunofluorescence staining of Tac or Tac/E-cadherin chimeras in stably transfected cell lines using the Tac antibody. Upper views show cross sections of monolayers; lower views in each panel represent XZ sections of filter-grown cells. MDCK (a) and LLC-PK1 (b) cells overexpressing full-length Tac on their apical domains; c, Tac/Ecad-(554-728) expressed in LLC-PK1 cells is localized on the basolateral membrane. The Tac/Ecad-(578-728) construct is also on the basolateral domains of transfected LLC-PK1 cells (d) and MDCK cells (e). Bars, 2.5 µm.

Chimeras containing the full cytoplasmic tail of E-cadherin were expressed and found to redirect Tac to the basolateral domain in both MDCK and LLC-PK1 cells. Both Tac/Ecad-(578-728) and Tac/Ecad-(554-728), which additionally encodes the transmembrane domain of E-cadherin, were localized by epifluorescence and by confocal imaging to the basolateral membranes of MDCK and LLC-PK1 cells (Fig. 3). Thus the presence or absence of the E-cadherin transmembrane domain had no effect on targeting. These results indicate that the Tac/E-cadherin chimeras are efficiently synthesized and transported to the cell surface and that the cytoplasmic tail of E-cadherin contains positive sorting information, capable of rerouting Tac to a basolateral trafficking pathway. MDCK cells expressing Tac/Ecad-(578-728) showed no concomitant loss of endogenous E-cadherin staining on the basolateral surface (not shown), suggesting that the sorting and targeting machinery in these cells has not been saturated or subverted by the overexpressed protein.

Basolateral Targeting Mediated by the Membrane-proximal E-cadherin Tail-- As the first step in a more detailed analysis of the cytoplasmic tail of E-cadherin, a truncation mutant was created to effectively bisect the cytoplasmic tail, leaving only the membrane-proximal portion of the tail fused to Tac. The resulting Tac/Ecad-(578-653) construct was expressed in MDCK and LLC-PK1 cells (Fig. 4). Immunofluorescence staining and confocal analysis showed that it was distributed in a polarized fashion. There was no staining of apical membranes when antibody was applied to either unpermeabilized cells (not shown) or permeabilized cells, however, there was staining of the basolateral membranes in LLC-PK1 and MDCK cells expressing Tac/Ecad-(578-653) (Fig. 4, a and c). Thus, chimeras containing either the full-length tails or only the membrane-proximal tails are trafficked similarly and have the same polarized surface distribution.


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 4.   Immunofluorescence localization of the membrane-proximal chimera. LLC-PK1 (a, b) and MDCK (c) cells overexpressing Tac/Ecad-(578-653) were stained with the Tac antibody. The truncated chimera encoding only the membrane-proximal tail localized to the basolateral domains of confluent cells. There was also some intracellular, perinuclear staining in untreated cells (a) that disappeared after 2 h of treatment with cycloheximide (b). Bars, 2.5 µm.

We noted that, in cells from several different clones stably expressing Tac/Ecad-(578-653), there was intracellular staining of Tac/Ecad-(578-653) in a perinuclear, Golgi-like pattern in addition to basolateral surface staining (Fig. 4a). This pattern was not regularly seen in cell lines expressing chimeras with full-length tails (Tac/Ecad-(554-728) or Tac/Ecad-(578-728)). LLC-PK1 cells expressing Tac/Ecad-(578-653) were treated with cycloheximide to stop protein synthesis and fixed and stained at various times after addition of the drug. There was a sequential loss of intracellular staining followed at longer times by a diminution of cell surface staining. Fig. 4 shows that after 2 h of treatment, all of the intracellular staining had disappeared, leaving only staining of Tac/Ecad-(578-653) at the basolateral surface. From this it was concluded that intracellular staining in these cells represents a transient accumulation of newly synthesized Tac/Ecad-(578-653) in the biosynthetic pathway and that the membrane-proximal chimera is transported to the basolateral membrane at a slower rate than Tac/Ecad-(578-728).

The targeting of Tac/Ecad-(578-653) was finally tested using a surface biotinylation assay to measure and quantify its appearance on the plasma membrane domains of confluent, polarized cells. Cell surface biotinylation was performed on cell lines stably expressing Tac/Ecad-(578-728) and Tac/Ecad-(578-653). Addition of biotin reagents to the basal sides of the monolayers labeled most of the Tac/Ecad-(578-728) and Tac/Ecad-(578-653) proteins, whereas from the apical side almost no labeling occurred in either case (see Table I). Together these results show that a chimeric protein, containing only the membrane-proximal half of the E-cadherin cytoplasmic tail, has sufficient information to direct efficient sorting and targeting to the basolateral cell surface, albeit perhaps at a slower rate than constructs with the full-length cytoplasmic tail.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Cell surface subjected to biotinylation
Surface expression of Tac/Ecad constructs. Cells stably overexpressing Tac/Ecad-(578-728) and Tac/Ecad-(578-653) were incubated with Sulfo-NHS-SS-biotin added to apical or basal side. Biotinylated proteins were isolated and analyzed by immunoblotting and densitometry to calculate the proportion of each construct accessed from each side of the cell layer.

A Dileucine Motif Is Responsible for Basolateral Targeting of E-cadherin-- Sequence analysis of the membrane-proximal E-cadherin tail encoded by the region in Tac/Ecad-(578-653) revealed the presence of two putative targeting motifs. Sequence alignment of members of the type I cadherins, of which E-cadherin is the prototype, and type II cadherins (42), revealed that a dileucine motif at position 587 is highly conserved across species and preserved in almost all members of the family (Fig. 5A). To test this dileucine motif for targeting information, the leucines at positions 587 and 588 were changed to alanines in the chimeras encoding the full-length tail and membrane-proximal tail, using oligonucleotide cloning. The resulting mutated chimeras, termed Tac/Ecad-(578-728)Delta S1 and Tac/Ecad-(578-653)Delta S1, were transfected into LLC-PK1 and MDCK cells and then localized by immunofluorescence (Fig. 5B). Tac/Ecad-(578-728)Delta S1 and Tac/Ecad-(578-653)Delta S1 were localized at the apical surfaces of transfected LLC-PK1 and MDCK cells, in patterns similar to the apical Tac (Fig. 3, a and 3b) and distinct from the basolateral non-mutated chimeras. Thus removal of the dileucine motif at 587 from the E-cadherin cytoplasmic domain resulted in a loss of basolateral targeting information. We conclude that this motif is a positive sorting signal for the basolateral membrane localization of E-cadherin and that it is necessary to direct sorting. The high level of conservation of this dileucine motif throughout the cadherins family further suggests that it has a key functional role. A second potential targeting signal of the type NPXY is present in the sequence of Tac/Ecad-(578-653). This tyrosine-based signal at position 600 was not tested here and is not considered a likely candidate for targeting, based on experimental data from another study (34) and our observation that the motif is not conserved in cadherins across different species.


View larger version (129K):
[in this window]
[in a new window]
 
Fig. 5.   A, sequence alignment of cadherins with conserved cytoplasmic tails (type I and II families as defined by Nollet et al. (42)). Sequence alignment of the membrane-proximal tail regions of cadherin family members, including E-cadherin (cadherin 1), N-cadherin (cadherin 2), and VE-cadherin (cadherin 5). A dileucine motif at position 587 (shaded) in E-cadherin (cadherin 1) is highly conserved across members of the family and is relatively close to the transmembrane domain (underlined) in the membrane-proximal region of the tail. B, targeting of dileucine deletion mutants. MDCK and LLC-PK1 cells expressing Tac/Ecad-(578-728)Delta S1 or Tac/Ecad-(578-653)Delta S1 were stained with the Tac antibody. Both constructs with deleted dileucine motifs, now show apical targeting. Prominent apical staining only, is now seen in both cell lines expressing Tac/Ecad-(578-728)Delta S1 or Tac/Ecad-(578-653)Delta S1. Bars, 2.5 µm.

Binding of beta -Catenin-- beta -Catenin is known to bind to the cytoplasmic tail of E-cadherin early in the biosynthetic pathway and has previously been implicated in trafficking to the cell surface (34). Therefore, Tac/E-cadherin chimeras were tested for their ability to bind to beta -catenin. The interaction of endogenous E-cadherin in MDCK cells with beta -catenin was demonstrated by co-immunoprecipitation of the two proteins using an E-cadherin antibody (Fig. 6A). Tac/Ecad-(578-728) was immunoprecipitated with the Tac antibody from extracts of transfected MDCK and LLC-PK1 cells, and beta -catenin co-precipitating in the complex was detected by immunoblotting. In extracts of both MDCK and LLC-PK1 cells, beta -catenin was bound to Tac/Ecad-(578-728) (Fig. 6B). This finding suggests that the full-length cytoplasmic tail in Tac/Ecad-(578-728) is correctly folded and processed in a manner conducive to effective trafficking and surface delivery.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.   Co-immunoprecipitation of beta -catenin. A, proteins immunoprecipitated from untransfected MDCK cells with a monoclonal antibody to E-cadherin were probed by immunoblotting with the E-cadherin antibody (top) or with a beta -catenin antibody (bottom). Proteins at 120 and 92 kDa, respectively, were detected. B, the Tac antibody was used to immunoprecipitate chimeras from transfected LLC-PK1 cells. The beta -catenin antibody was then used for immunoblotting supernatants (SN lanes 1, 3, and 5) and immunoprecipitates (IP lanes 2, 4, and 6). beta -Catenin was co-precipitated with Tac/Ecad-(578-728) (lane 2) but not with the truncated Tac/Ecad-(578-653) chimera (lane 4). Deletion of the dileucine targeting motif (Tac/Ecad-(578-728)Delta S1) did not affect co-precipitation of beta -catenin (lane 6).

The membrane-proximal Tac/Ecad-(578-653) construct is missing the carboxyl-terminal beta -catenin binding domain, and co-immunoprecipitation experiments confirm that, as expected, beta -catenin was not co-precipitated with this truncated chimeric protein (Fig. 6B). Endogenous E-cadherin and chimeras with full-length E-cadherin tails were able to efficiently bind and co-immunoprecipitate beta -catenin (Fig. 6, A and B). Deletion of the 587 dileucine targeting signal had no effect on binding of beta -catenin, which was efficiently co-precipitated with Tac/Ecad-(578-728)Delta S1 (Fig. 6B). The correct basolateral targeting of Tac/Ecad-(578-653) in the absence of bound beta -catenin now demonstrates that beta -catenin is not essential for basolateral sorting and targeting in either MDCK or LLC-PK1 cells. The complexing of beta -catenin with newly synthesized E-cadherin may be required for other roles in biosynthetic processing or trafficking, for instance, the loss of beta -catenin binding may account for the increased intracellular accumulation and apparently slower trafficking of the Tac/Ecad-(578-653) mutants.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

E-cadherin is one of the proto-typical polarized membrane proteins in epithelia. It is delivered to the basolateral membrane and is concentrated in adherens junctions where it participates in cell-cell adhesion. To address how E-cadherin is trafficked and targeted in polarized cells, we made use of Tac/E-cadherin chimeras expressed in two epithelial cell lines. Our findings show that chimeras containing full-length or truncated cytoplasmic tails of E-cadherin were effectively sorted and trafficked to the basolateral surface domain in MDCK and LLC-PK1 cells. Furthermore, this polarized targeting was lost after deletion of a single, dominant targeting motif in the proximal region of the tail. Three main conclusions emerged from these experiments; (i) that a single dileucine motif at 587 is able to convey basolateral targeting information in Tac/E-cadherin chimeras and that this signal is necessary for basolateral sorting; (ii) that LLC-PK1 cells are able to correctly sort and traffic E-cadherin using a dileucine-based mechanism, in contrast to proteins sorted by tyrosine-based signals that are mis-trafficked in these cells, and (iii) that beta -catenin is not required for basolateral targeting and surface delivery of E-cadherin.

Chimeras containing the full cytoplasmic tail of E-cadherin, Tac/Ecad-(578-728) and Tac/Ecad-(554-728), were efficiently targeted and trafficked to the basolateral domain of MDCK and LLC-PK1 cells in a similar manner to that of endogenous E-cadherin or GFP-E-cadherin in either cell line. The Tac ectodomain did not interfere with the intracellular trafficking or processing in the full-length tail constructs, because there was no evidence of less efficient membrane delivery or retention within the secretory pathway. The transmembrane domain has been implicated in mediating lateral association and adhesive strength of cadherins in the plasma membrane, without affecting surface delivery (43). Amino acid sequences within transmembrane segments can, however, be involved in targeting as exemplified by the apical targeting signal in one of the transmembrane segments of the alpha -subunit of the gastric parietal H,K-ATPase (44). Our experiments directly tested the E-cadherin transmembrane domain, with the finding that this region of the protein has no role in basolateral targeting nor in sorting or membrane delivery of Tac/E-cadherin chimeras. Overall the results obtained with the Tac/E-cadherin chimeras point to the cytoplasmic tail of E-cadherin as having positive basolateral sorting information, in keeping with many other type I membrane proteins.

The correct basolateral targeting of the Tac/Ecad-(578-653) construct first indicated that the membrane-proximal tail region alone is sufficient for membrane targeting and that distal regions of the tail are not required for targeting or surface delivery. In our hands, mutants with the truncated tail of E-cadherin, Tac/Ecad-(578-653), were processed, targeted, and delivered to the basolateral cell surface, albeit at a slower rate than constructs with the full cytoplasmic tail. Transient accumulation of Tac/Ecad-(578-653) in the biosynthetic pathway, seen as intracellular staining in LLC-PK1 cells, indicated that it was trafficked less efficiently than the full-length tail. Partial accumulation of Tac/Ecad-(578-653) was similarly noted in MDCK cells, although the truncated tail mutants did eventually reach the cell surface. Our findings are in contrast to those of a previous study in which a series of chimeras representing truncation mutants of the E-cadherin tail fused to a GP-2 ectodomain, were found to be very poorly trafficked (34). Only about 10% of the truncated GP-2 chimeric proteins in that study reached the surface of MDCK cells and were randomly sorted, whereas the majority of the proteins were blocked or degraded early in the secretory pathway (34). On the basis of the correct targeting and delivery of Tac/Ecad-(578-653), which contains similar tail regions to some of the mutants in the previous study, we hypothesize that the poor processing and trafficking of those chimeras may have been due to the influence of the GP-2 ectodomain rather than being a function of E-cadherin trafficking or accessory proteins (see below).

The membrane-proximal tail region of E-cadherin has been implicated in a number of functions. Cadherin clustering and adhesive strength were shown to be affected by mutations in the membrane-proximal region of the C-cadherin tail (45). Binding of the p120ctn protein has also been shown to occur in this region (45, 46), and some of the amino acid sequences mapped by two-hybrid analysis, as being specifically involved in the binding of p120ctn (47), overlap with the dileucine targeting signal identified in this study. It is therefore likely that this membrane-proximal region of the tail is involved in multiple, temporally regulated protein interactions that are important, initially for E-cadherin transport, and then for adhesive function at the cell surface. Positive sorting mediated by the Tac/Ecad-(578-653) membrane-proximal tail allowed us to focus on putative sorting signals in this region. The dileucine motif at 587 was chosen here as a candidate targeting signal. Despite being in the non-conserved region of the tail, sequence alignments revealed that the dileucine consensus motif is highly conserved throughout cadherins of type I or II cadherin families (42). We therefore predict that this dileucine will function to target all similar transmembrane cadherins to basolateral domains of polarized epithelial cells. Cadherins in which the dileucines are not conserved include cadherins 5 (VE-cadherin) and 20. The glycosyl phosphatidylinositol-anchored cadherin 13 (T-cadherin), as expected, does not have a dileucine motif (48).

Our experimental results, therefore, confirmed that the dileucine motif in E-cadherin does function as a targeting signal. Replacing the leucines with alanines in the full-length or truncated tail constructs resulted in a complete loss of basolateral targeting. The dileucine signal in E-cadherin has an acidic amino acid cluster on its carboxyl-terminal side that is highly conserved throughout dileucine-containing cadherins and is similar to targeting motifs in other basolateral proteins, including furin (49), invariant chain (50), and low density lipoprotein receptor (22). In some cases, such as for furin, these acidic clusters have been shown to be important for the function of dileucine signals in basolateral targeting (49). Dileucine signals functioning in endocytosis typically have an acidic residue at the -4 position (D/EXXXLL) (21, 51, 52). In contrast, the cadherin dileucine signal typically has a basic lysine or arginine in the -4 position. It is, therefore, unlikely that this motif will also function as an endocytosis motif.

There are additional motifs sharing consensus with targeting signals encoded in the E-cadherin tail. Tyrosines at two places within the tail, one being in the membrane-proximal region and another at the carboxyl terminus, were deleted in a previous study and found to have no role in targeting of E-cadherin (34). There is a combined YXXphi tyrosine and dileucine motif (673), similar in structure to the overlapping motif, which has been shown to be responsible for basolateral targeting of the pIg F receptor in MDCK cells (53). There is also a motif belonging to the YXXphi group, with a tyrosine at the second X position (705). Both of these latter signals are adjacent to, or within, the beta -catenin binding domain and are thus predicted to be sequestered when E-cadherin is complexed to beta -catenin. The possibility remains open, however, that any of these additional signals might be uncovered during dynamic protein interactions and therefore could act as targeting signals during further trafficking of surface E-cadherin. One or more of these signals could, for instance, target E-cadherin to clathrin-coated vesicles for endocytosis and recycling (35) after it reaches the basolateral plasma membrane. Overall, analysis of targeting motifs points to a dileucine signal rather than tyrosine-based signals being responsible for the polarized sorting and basolateral delivery of E-cadherin.

Both MDCK and LLC-PK1 cell lines form polarized epithelial monolayers in culture that show patent basolateral trafficking and secretion of soluble proteoglycans (54, 55). Due to the reported inverse polarity of LLC-PK1 (28, 30), it was of interest to also analyze E-cadherin trafficking in these cells. Our findings verify that E-cadherin is trafficked correctly to the basolateral surface of the LLC-PK1 cells, and we show that this targeting, as in MDCK cells, is directed by a dileucine motif. This provides new evidence to confirm that basolateral targeting via dileucine-based mechanisms functions correctly in LLC-PK1 cells. The correct targeting of endogenous E-cadherin, GFP-E-cadherin, and Tac/Ecad constructs suggests that dileucine-based sorting is fully sufficient to direct basolateral trafficking in these cells. LLC-PK1 cells are defective in targeting of tyrosine-based motifs due to the absence of the µ1B chain (30). However, the sorting of dileucine motifs occurs through interaction with the beta  subunits of the adaptor complex (56), allowing correct sorting of proteins such as T cell receptor sub-unit (CD3gamma ), Fc receptor, and E-cadherin. The correct targeting of endogenous E-cadherin and Tac/Ecad constructs in LLC-PK1 cells acts as further evidence that this targeting does, in fact, rely on dileucine rather than tyrosine motifs. The full nature of the adaptor complexes or that required for post-Golgi transport of E-cadherin in either LLC-PK1 or MDCK epithelial cells have yet to be characterized.

Finally, the current study also provides new insights into the role of beta -catenin in E-cadherin trafficking. beta -Catenin is a cytoplasmic protein with affinity for the cytoplasmic tail of E-cadherin, it binds to E-cadherin early in the biosynthetic pathway, forming a stable complex that is transported to the cell surface (33). Chen and colleagues (34) concluded that beta -catenin is required for the biosynthetic processing and trafficking of E-cadherin, based on a correlation between deletion of residues within or near the beta -catenin binding domain and loss of surface delivery in GP-2-E-cadherin chimeras and other constructs. However, our current results suggest a different scenario. We showed that full-length tail chimeras co-precipitated beta -catenin in similar proportion to that seen in endogenous E-cadherin-beta -catenin complexes. Upon expressing the Tac/Ecad-(578-653) chimera, which clearly did not bind beta -catenin, we found it was correctly targeted and transported to the cell surface, suggesting that beta -catenin is not required for sorting or delivery under these conditions. beta -Catenin may have a role in facilitating or optimizing the transport, processing, or folding of newly synthesized E-cadherin. All of these factors might well contribute to the slower processing and transient accumulation of Tac/Ecad-(578-653) that we noted in the absence of beta -catenin. Recent biophysical and biochemical analyses further suggest that beta -catenin binding might also serve to protect the E-cadherin tail from degradation (57). Our finding, that beta -catenin is not required for basolateral targeting or surface delivery, sheds new light on beta -catenin as having a role in facilitating, but not directing, cadherin trafficking.

The polarized targeting of E-cadherin is of seminal importance to the maintenance of epithelial polarity and function. Targeting signals and mechanisms must ensure the accurate basolateral delivery of newly synthesized E-cadherin and of internalized and recycled E-cadherin for its incorporation into adherens junctions. In this study we demonstrate one such mechanism, basolateral sorting directed via a dileucine signal. Future studies will address specific roles for additional signals and perhaps for some of the accessory proteins in cadherin/catenin complexes.

    ACKNOWLEDGEMENTS

We thank Susan La Flamme for providing materials and acknowledge Darren Brown, Marita Goodwin, and Juliana Venturato for their technical support.

    FOOTNOTES

* This work was funded in part by grants from the National Health and Medical Research Council (to J. L. S. and A. S. Y.) and from the Australian Research Council as part of the Special Research Center for Functional Genomics.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** A Wellcome Trust International Senior Medical Research Fellow.

Dagger Dagger To whom correspondence should be addressed: Tel.: 61-7-3365-8242; Fax: 61-7-3665-4388; E-mail: r.teasdale@imb.uq.edu.au.

Published, JBC Papers in Press, April 18, 2001, DOI 10.1074/jbc.M101907200

    ABBREVIATIONS

The abbreviations used are: MDCK, Madin-Darby canine kidney cells; GFP, green fluorescence protein; IL-2R, interleukin-2 receptor; LLC-PK1, pig kidney proximal tubular epithelial cell line; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; Tac, IL-2Ralpha chain; RIPA, radioimmune precipitation buffer; bp, base pair(s); CMV, cytomegalovirus.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Takeichi, M. (1995) Curr. Opin. Cell Biol. 7, 619-627
2. Yap, A. S., Brieher, W. M., and Gumbiner, B. M. (1997) Annu. Rev. Cell Dev. Biol. 13, 119-146
3. Gumbiner, B. M. (1996) Cell 84, 345-357
4. Gumbiner, B. M. (2000) J. Cell Biol. 148, 399-404
5. Yap, A. S. (1998) Cancer Invest. 16, 252-261
6. Rimm, D. L., and Morrow, J. S. (1994) Biochem. Biophys. Res. Commun. 200, 1754-1761
7. Ozawa, M., Ringwald, M., and Kemler, R. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 4246-4250
8. Stappert, J., and Kemler, R. (1994) Cell Adhes. Commun. 2, 319-327
9. Polakis, P. (2000) Genes Dev. 14, 1837-1851
10. Brown, D., and Stow, J. L. (1996) Physiol. Rev. 76, 245-297
11. Ikonen, E., and Simons, K. (1998) Semin. Cell. Dev. Biol. 9, 503-509
12. Mostov, K. E., Verges, M., and Altschuler, Y. (2000) Curr. Opin. Cell Biol. 12, 483-490
13. Simons, K., and Ikonen, E. (1997) Nature 387, 569-572
14. Benting, J. H., Rietveld, A. G., and Simons, K. (1999) J. Cell Biol. 146, 313-320
15. Rodriguez-Boulan, E., and Gonzalez, A. (1999) Trends Cell Biol. 9, 291-294
16. Heilker, R., Spiess, M., and Crottet, P. (1999) Bioessays 21, 558-567
17. Matter, K., Hunziker, W., and Mellman, I. (1992) Cell 71, 741-753
18. Hunziker, W., and Fumey, C. (1994) EMBO J. 13, 2963-2967
19. Lin, S., Naim, H. Y., and Roth, M. G. (1997) J. Biol. Chem. 272, 26300-26305
20. Odorizzi, G., and Trowbridge, I. S. (1997) J. Biol. Chem. 272, 11757-11762
21. Pond, L., Kuhn, L. A., Teyton, L., Schutze, M. P., Tainer, J. A., Jackson, M. R., and Peterson, P. A. (1995) J. Biol. Chem. 270, 19989-19997
22. Matter, K., Yamamoto, E. M., and Mellman, I. (1994) J. Cell Biol. 126, 991-1004
23. Le Gall, A. H., Powell, S. K., Yeaman, G. A., and Rodriguez-Boulan, E. (1997) J. Biol. Chem. 272, 4559-4567
24. Distel, B., Bauer, U., Le Borgne, R., and Hoflack, B. (1998) J. Biol. Chem. 273, 186-193
25. Hobert, M. E., Kil, S. J., Medof, M. E., and Carlin, C. R. (1997) J. Biol. Chem. 272, 32901-32909
26. El Nemer, W., Colin, Y., Bauvy, C., Codogno, P., Fraser, R. H., Cartron, J. P., and Le Van Kim, C. L. (1999) J. Biol. Chem. 274, 31903-31908
27. Sheikh, H., and Isacke, C. M. (1996) J. Biol. Chem. 271, 12185-12190
28. Roush, D. L., Gottardi, C. J., Naim, H. Y., Roth, M. G., and Caplan, M. J. (1998) J. Biol. Chem. 273, 26862-26869
29. Ohno, H., Tomemori, T., Nakatsu, F., Okazaki, Y., Aguilar, R. C., Foelsch, H., Mellman, I., Saito, T., Shirasawa, T., and Bonifacino, J. S. (1999) FEBS Lett. 449, 215-220
30. Folsch, H., Ohno, H., Bonifacino, J. S., and Mellman, I. (1999) Cell 99, 189-198
31. Lechner, J., Krall, M., Netzer, A., Radmayr, C., Ryan, M. P., and Pfaller, W. (1999) Kidney Int. 55, 2178-2191
32. Tanentzapf, G., Smith, C., McGlade, J., and Tepass, U. (2000) J. Cell Biol. 151, 891-904
33. Hinck, L., Nathke, I. S., Papkoff, J., and Nelson, W. J. (1994) J. Cell Biol. 125, 1327-1340
34. Chen, Y. T., Stewart, D. B., and Nelson, W. J. (1999) J. Cell Biol. 144, 687-699
35. Le, T. L., Yap, A. S., and Stow, J. L. (1999) J. Cell Biol. 146, 219-232
36. Rajasekaran, A. K., Humphrey, J. S., Wagner, M., Miesenbock, G., Le Bivic, A., Bonifacino, J. S., and Rodriguez-Boulan, E. (1994) Mol. Biol. Cell 5, 1093-1103
37. Mallet, W. G., and Maxfield, F. R. (1999) J. Cell Biol. 146, 345-359
38. Narula, N., McMorrow, I., Plopper, G., Doherty, J., Matlin, K. S., Burke, B., and Stow, J. L. (1992) J. Cell Biol. 117, 27-38
39. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
40. LaFlamme, S. E., Akiyama, S. K., and Yamada, K. M. (1992) J. Cell Biol. 117, 437-447
41. Lecuit, M., Dramsi, S., Gottardi, C., Fedor-Chaiken, M., Gumbiner, B., and Cossart, P. (1999) EMBO J. 18, 3956-3963
42. Nollett, F., Kools, P., and van Roy, F. (2000) J. Mol. Biol. 299, 551-572
43. Huber, O., Kemler, R., and Langosch, D. (1999) J. Cell Sci. 112, 4415-4423
44. Dunbar, L. A., Aronson, P., and Caplan, M. J. (2000) J. Cell Biol. 148, 769-778
45. Yap, A. S., Niessen, C. M., and Gumbiner, B. M. (1998) J. Cell Biol. 141, 779-789
46. Ohkubo, T., and Ozawa, M. (1999) J. Biol. Chem. 274, 21409-21415
47. Thoreson, M. A., Anastasiadisa, P. Z., Daniel, J. M., Ireton, R. C., Wheelock, M. J., Johnson, K. R., Hummingbird, D. K., and Reynolds, A. B. (2000) J. Cell Biol. 148, 189-202
48. Doyle, D. D., Goings, G. E., Upshaw-Earley, J., Page, E., Ranscht, B., and Palfrey, H. C. (1998) J. Biol. Chem. 273, 6937-6943
49. Simmen, T., Nobile, M., Bonifacino, J. S., and Hunziker, W. (1999) Mol. Cell. Biol. 19, 3136-3144
50. Simonsen, A., Bremnes, B., Nordeng, T. W., and Bakke, O. (1998) Eur. J. Cell Biol. 76, 25-32
51. Honing, S., Sandoval, I. V., and von Figura, K. (1998) EMBO J. 17, 1304-1314
52. Dietrich, J., Kastrup, J., Nielsen, B. L., Odum, N., and Geisler, C. (1997) J. Cell Biol. 138, 271-281
53. Orzech, E., Schlessinger, K., Weiss, A., Okamoto, C. T., and Aroeti, B. (1999) J. Biol. Chem. 274, 2201-2215
54. de Almeida, J. B., and Stow, J. L. (1991) Am. J. Physiol. 260, C691-C700
55. Stow, J. L., de Almeida, J. B., Narula, N., Holtzman, E. J., Ercolani, L., and Ausiello, D. A. (1991) J. Cell Biol. 114, 1113-1124
56. Rapoport, I., Chen, Y. C., Cupers, P., Shoelson, S. E., and Kirchhausen, T. (1998) EMBO J. 17, 2148-2155
57. Huber, A. H., Stewart, D. B., Laurents, D. V., Nelson, W. J., and Weis, W. I. (2000) J. Biol. Chem. 276, 12301-12309


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Desclozeaux, J. Venturato, F. G. Wylie, J. G. Kay, S. R. Joseph, H. T. Le, and J. L. Stow
Active Rab11 and functional recycling endosome are required for E-cadherin trafficking and lumen formation during epithelial morphogenesis
Am J Physiol Cell Physiol, August 1, 2008; 295(2): C545 - C556.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. Theard, M. A. Raspe, D. Kalicharan, D. Hoekstra, and S. C.D. van IJzendoorn
Formation of E-Cadherin/{beta}-Catenin-based Adherens Junctions in Hepatocytes Requires Serine-10 in p27(Kip1)
Mol. Biol. Cell, April 1, 2008; 19(4): 1605 - 1613.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. Yamamura, N. Nishimura, H. Nakatsuji, S. Arase, and T. Sasaki
The Interaction of JRAB/MICAL-L2 with Rab8 and Rab13 Coordinates the Assembly of Tight Junctions and Adherens Junctions
Mol. Biol. Cell, March 1, 2008; 19(3): 971 - 983.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Y. Miyashita and M. Ozawa
A dileucine motif in its cytoplasmic domain directs -catenin-uncoupled E-cadherin to the lysosome
J. Cell Sci., December 15, 2007; 120(24): 4395 - 4406.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. J. Murphy, K. E. Shapira, Y. I. Henis, and E. B. Leof
A Unique Element in the Cytoplasmic Tail of the Type II Transforming Growth Factor-beta Receptor Controls Basolateral Delivery
Mol. Biol. Cell, October 1, 2007; 18(10): 3788 - 3799.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol Genet