![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 25, 22565-22572, June 22, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, March 2, 2001, and in revised form, April 11, 2001
E-cadherin is a major adherens junction
protein of epithelial cells, with a central role in cell-cell adhesion
and cell polarity. Newly synthesized E-cadherin is targeted to the
basolateral cell surface. We analyzed targeting information in the
cytoplasmic tail of E-cadherin by utilizing chimeras of E-cadherin
fused to the ectodomain of the interleukin-2 E-cadherin is expressed on the lateral membranes of epithelial
cells where it accumulates as a major component of the adherens junction. The cadherins in adherens junctions have central roles in
establishing and maintaining cell-cell adhesion and cell polarity in
epithelia and participate in morphogenesis during development (1-4).
The continual expression and function of E-cadherin is important in its
role as a tumor suppressor and the loss of E-cadherin function
contributes to tumor invasion and progression in carcinomas (5).
Mature, human E-cadherin is a 728-amino acid, single pass transmembrane
protein (6). The E-cadherin ectodomain is involved in
Ca2+-dependent homotypic binding to E-cadherins
on adjacent cell membranes, and its cytoplasmic tail is involved in a
series of protein interactions providing a link to the actin
cytoskeleton. The cytoplasmic tail of E-cadherin is bound directly to
Epithelial cells are morphologically and functionally polarized with
distinct complements of cell surface proteins and lipids at the apical
or basolateral poles. Maintenance of this polarity requires that newly
synthesized proteins are sorted and targeted to specific membrane
domains (10-12). Sorting of proteins to the apical domain of polarized
cells occurs via lipid raft interactions or through oligosaccharides
(13-15), whereas specific amino acids motifs act as sorting signals to
target membrane proteins to the basolateral cell surface (reviewed in
Ref. 16). For example, tyrosine-based motifs target the low density
lipoprotein receptor to the basolateral domain of polarized cells (17),
whereas a dileucine motif is utilized by other proteins, like the Fc
receptor (18). Both types of signals can also be used to direct
endocytosis from the plasma membrane, although the structural
requirements for each pathway may differ (19-22). Yet other amino acid
motifs can be used by selected proteins for basolateral targeting
(23-25). Previous studies on adhesion molecules have defined a
dileucine signal that functions in the basolateral targeting of the
Lutheran glycoprotein (26) and a similar dihydrophobic signal in CD44 (27). The basolateral targeting of neural cell adhesion molecule (N-CAM) has been attributed to a cytoplasmic tail sequence
without classic motif homology (23). Detailed information and further insights are needed into how other classes of adhesion proteins, including cadherins, are sorted and trafficked in polarized cells.
Recently, the polarized epithelial cells of the pig kidney
LLC-PK1 line have been distinguished as having aspects of
inverted polarity. Roush et al. (28) noted that some
typically basolateral proteins, such as the H,K-ATPase The correct placement of E-cadherin on the plasma membrane is required
from an early stage to help establish and maintain cell polarity (32).
The mechanisms that mediate the sorting and polarized delivery of
E-cadherin to the surface have not been elucidated. Previous studies
have shown that Cell Culture--
Madin-Darby canine kidney (MDCK) and pig
kidney (LLC-PK1) cell lines were grown and passaged as
described previously (38) in Dulbecco's modified Eagle's medium (Life
Technologies, Inc., Grand Island, NY) supplemented with 10% fetal calf
serum and 2 mM glutamine in 5% CO2 and 95% air.
Antibodies--
Mouse monoclonal antibodies (Transduction
Laboratories, Lexington, KY) raised against a conserved region of the
cytoplasmic domain of human E-cadherin and against cDNA Construction and Expression--
Chimeric fusions
between human E-cadherin cDNAs and the cDNA encoding for Tac
were generated in the pCDNA3 expression vector. Molecular cloning
techniques were performed according to Sambrook et al. (39),
using reagents from New England BioLabs (Beverly, MA). All constructs
were confirmed by DNA sequencing. cDNAs encoding the transmembrane
plus cytoplasmic domains (residues 554-728), the cytoplasmic tail
(residues 578-728), or the amino-terminal half of the cytoplasmic tail
(578) of human E-cadherin were amplified using PCR with specific
oligonucleotide primers. E-cadherin residue numbers correspond to the
mature protein as defined previously (6). The oligonucleotide primers
contained restriction endonuclease sites allowing generation of
in-frame fusions with the Tac cDNA. Cloning the respective PCR
products into pCMV-IL2R (40) using the HindIII and
XbaI sites generated the pCMV-Tac/Ecad-(578-728) and
pCMV-Tac/Ecad-(578-653) plasmids. The entire Tac/E-cadherin cDNA constructs were then subcloned into the pCDNA3 expression vector (Invitrogen, Carlsbad, CA) that also encodes for the neomycin selection marker. The resulting constructs were termed
Tac/Ecad-(578-728) and Tac/Ecad-(578-653). To generate the
Tac/Ecad-(554-728) plasmid, an EcoRV restriction
endonuclease site was introduced using PCR at the end of the
extracellular domain of the Tac cDNA within pCDNA3. This
modification altered residue 239 of the Tac cDNA from an Asp to a
Gln. The final plasmid was generated by cloning the E-cadherin PCR
product into the EcoRV and XbaI sites.
E-cadherin-GFP encodes the full-length E-cadherin sequence with the
green fluorescence protein (GFP) fused to the carboxyl terminus of the
cytoplasmic domain. Initially, a SacII restriction endonuclease site was introduced at the carboxyl terminus of the full-length cDNA of E-cadherin. This was achieved by the PCR
amplification of the entire E-cadherin cDNA using specific
oligonucleotide primers using pCDNA3-hECad (41) as a template. The
3'-primer included the SacII site and a XbaI
site. The resulting PCR product was digested with SgrA1 and
XbaI and subcloned into pCDNA3-hECad using the same
sites. The open reading frame of GFP was amplified by PCR using
specific oligonucleotide primers and pEGFP-N1
(CLONTECH, Palo Alto, CA) as a template. The
5'-primer contained a SacII site that allowed the resulting
PCR product to be cloned into the SacII site introduced into
in the carboxyl terminus of E-cadherin.
Mutagenesis of the two leucine residues at positions 587 and 588 of
human E-cadherin to alanines was performed using oligonucleotide cloning. The construct pCMV-Tac/Ecad-(578-728) was digested with HindIII and XbaI to remove a 55-bp fragment that
included the codons for the dileucine residues. The digested plasmid
was then ligated with the annealed, phosphorylated, synthetic
oligonucleotides 5'-AGCTTCGTCGACGCGCGGTGGTCAAAGAGCCCGCAGCACCCCCAGAGGATGACAC3-' and 5'-CCGGGTGTCATCCTCTGGGGGTGCTGCGGGCTCTTTGACCACCGCGCGTCGACGA3'. These complementary oligonucleotides contain a
5'-HindIII end and a 3'-XbaI end, as well as
codons encoding for LRRRAVVKEPAAPPEDD (altered residues are
underlined). The resulting construct was termed
Tac/Ecad-(578-728)
For transfection and expression of cDNAs, sub-confluent
LLC-PK1 or MDCK cells were transfected with plasmid DNA (2 µg) in complex with LipofectAMINE Plus reagent (Life Technologies,
Inc., Gaithersburg, MD) according to the manufacturer's guidelines. For stably expressing lines, transfected cells were passaged and maintained in media containing G418 (Geneticin, Life Technologies, Inc.); cells were kept under selection for 7-10 days and then plated
at low density for ring cloning of surviving cells. Clonal cell lines
were generated and then assessed by indirect immunofluorescence and
immunoblotting to select lines with different levels of recombinant protein expression.
Indirect Immunofluorescence--
Confluent monolayers of cells
grown on glass coverslips or on Transwell polycarbonate filters
(Corning Costar, Cambridge, MA) were generally fixed in 4%
paraformaldehyde in PBS for 90 min and then permeabilized in PBS
containing 0.1% Triton X-100 for 5 min. In one experiment
LLC-PK1 cells were fixed in ice-cold methanol for 10 min.
Cells were then incubated sequentially with primary antibody (1 h) and
then secondary antibodies (30 min) using PBS containing bovine serum
albumin (Sigma Chemical Co., St. Louis, MO) as a blocking buffer. Cells
were mounted on slides in PBS/glycerol (50/50) containing 1%
n-propyl-galate. For some experiments, cells were treated
with 10 µM cycloheximide (Sigma), which was added to the
medium for various times up to 4 h prior to fixation. Cells on
coverslips were examined by epifluorescence using an Olympus Provis
AX-70 microscope, and images were collected with a CCD300ET-RCX camera
(DageMTI, Michigan City, IN) using National Institutes of Health IMAGE
software. Cells growing on Transwell filters were examined using a
Bio-Rad MRC-600 confocal laser-scanning microscope mounted on a Zeiss
Axioskop, and XY and XZ sections were generated using Bio-Rad
MRC-600 CoMOS software.
Immunoprecipitation and Immunoblotting--
Confluent monolayers
of transfected MDCK and LLC-PK1 cells were solubilized in
cold RIPA buffer (1% Triton X-100, 1% deoxycholate, 0.1% SDS, 0.15 NaCl, 5 mM EDTA, 25 mM Tris-HCl, pH 7.4)
containing protease inhibitors (Roche Molecular Biochemicals, Germany)
on ice. Post-nuclear supernatants were incubated with the Tac antibody for 2 h and then with washed protein G beads (Sigma) for a further 2 h. Precipitates were recovered by centrifugation then washed through several rounds of RIPA buffer and 20 mM Tris-HCl
(pH 7.4) prior to solubilization in concentrated SDS-PAGE sample
buffer. Proteins in cell extracts and immunoprecipitates were separated on 8% SDS-PAGE reducing gels and then transferred to polyvinylidene difluoride Immunobilon-P membranes (Millipore, Bedford, MA) and stained
with 0.1% Coomassie Brilliant Blue to ensure even protein transfer and
protein loading. Membranes were immunoblotted by sequential incubations
in primary antibody, horseradish peroxidase-conjugated secondary
antibody followed by chemiluminescence detection with Supersignal West
Pico (Pierce Chemical Co., Rockford, IL). Different luminescence
exposures were collected and exposures in the linear range were used.
Surface Biotinylation--
Confluent monolayers of
LLC-PK1 cells stably expressing Tac/Ecad-(578-728) or
Tac/Ecad-(578-653) grown on filters were incubated in media containing
1.5 mg/ml Sulfo-NHS-SS-biotin (Pierce), applied to either the apical or
basal side of the filter, for 60 min on ice. Filters were then washed
several times in cold PBS before cells were scraped off and lysed in
cold RIPA buffer. Soluble cell fractions were incubated with
streptavidin beads (Sigma) in RIPA buffer, pH 7.4, for 2 h with
rotation. Beads were then washed in several rounds of RIPA buffer and
20 mM Tris-HCl (pH 7.4). Biotinylated proteins bound to the
streptavidin beads and unlabeled proteins in the supernatants were
analyzed by SDS-PAGE, immunoblotting, and densitometry to quantitate
the relative amounts of biotinylated Tac/Ecad proteins.
Basolateral Targeting of E-cadherin--
E-cadherin is delivered
to the basolateral surface of polarized MDCK cells, where it gives a
typical and widely documented staining pattern using specific
antibodies (Fig. 1a). The same antibody did not stain E-cadherin in paraformaldehyde-fixed
LLC-PK1 cells (Fig. 1c), but it did produce cell
surface staining of E-cadherin in methanol-fixed LLC-PK1
cells (31 and Fig. 1b). Hence E-cadherin is expressed
endogenously in both cell lines and is found in a polarized
distribution. A tagged construct of human GFP-E-cadherin was expressed
in MDCK cells, generating a clear basolateral surface staining pattern
with GFP antibodies, showing that GFP-E-cadherin is targeted in a
manner analogous to the endogenous protein (Fig. 1d).
GFP-E-cadherin was also expressed in epithelial LLC-PK1
cells, where it was also targeted in a polarized fashion to the
basolateral membrane (Fig. 1e).
Targeting of Tac/E-cadherin Chimeras--
For targeting studies we
utilized chimeras consisting of the ectodomain of Tac fused to the
cytoplasmic tail of E-cadherin (Fig.
2A). Chimeric cDNAs
expressed in epithelial cells all produced proteins of the expected
molecular masses (Fig. 2B). Tac typically localizes to the
apical membrane in polarized cells (Ref. 36 and Fig.
3, a and b),
therefore, any basolateral signal in the E-cadherin cytoplasmic domain
is predicted to redirect Tac from apical to basolateral membranes.
cDNAs for Tac alone or chimeric proteins were transfected into MDCK
and LLC-PK1 cells, and clonal, stably transfected cell
lines were selected. Antibodies against Tac were used to detect the
chimeric proteins and determine their localization by indirect
immunofluorescence and confocal microscopy.
Chimeras containing the full cytoplasmic tail of E-cadherin were
expressed and found to redirect Tac to the basolateral domain in both
MDCK and LLC-PK1 cells. Both Tac/Ecad-(578-728) and
Tac/Ecad-(554-728), which additionally encodes the transmembrane
domain of E-cadherin, were localized by epifluorescence and by confocal
imaging to the basolateral membranes of MDCK and LLC-PK1
cells (Fig. 3). Thus the presence or absence of the E-cadherin
transmembrane domain had no effect on targeting. These results indicate
that the Tac/E-cadherin chimeras are efficiently synthesized and
transported to the cell surface and that the cytoplasmic tail of
E-cadherin contains positive sorting information, capable of rerouting
Tac to a basolateral trafficking pathway. MDCK cells expressing
Tac/Ecad-(578-728) showed no concomitant loss of endogenous E-cadherin
staining on the basolateral surface (not shown), suggesting that the
sorting and targeting machinery in these cells has not been saturated or subverted by the overexpressed protein.
Basolateral Targeting Mediated by the Membrane-proximal E-cadherin
Tail--
As the first step in a more detailed analysis of the
cytoplasmic tail of E-cadherin, a truncation mutant was created to
effectively bisect the cytoplasmic tail, leaving only the
membrane-proximal portion of the tail fused to Tac. The resulting
Tac/Ecad-(578-653) construct was expressed in MDCK and
LLC-PK1 cells (Fig. 4).
Immunofluorescence staining and confocal analysis showed that it was
distributed in a polarized fashion. There was no staining of apical
membranes when antibody was applied to either unpermeabilized cells
(not shown) or permeabilized cells, however, there was staining of the
basolateral membranes in LLC-PK1 and MDCK cells expressing Tac/Ecad-(578-653) (Fig. 4, a and c). Thus,
chimeras containing either the full-length tails or only the
membrane-proximal tails are trafficked similarly and have the same
polarized surface distribution.
We noted that, in cells from several different clones stably expressing
Tac/Ecad-(578-653), there was intracellular staining of
Tac/Ecad-(578-653) in a perinuclear, Golgi-like pattern in addition to
basolateral surface staining (Fig. 4a). This pattern was not
regularly seen in cell lines expressing chimeras with full-length tails
(Tac/Ecad-(554-728) or Tac/Ecad-(578-728)). LLC-PK1 cells
expressing Tac/Ecad-(578-653) were treated with cycloheximide to stop
protein synthesis and fixed and stained at various times after addition
of the drug. There was a sequential loss of intracellular staining
followed at longer times by a diminution of cell surface staining. Fig.
4 shows that after 2 h of treatment, all of the intracellular
staining had disappeared, leaving only staining of Tac/Ecad-(578-653)
at the basolateral surface. From this it was concluded that
intracellular staining in these cells represents a transient
accumulation of newly synthesized Tac/Ecad-(578-653) in the
biosynthetic pathway and that the membrane-proximal chimera is
transported to the basolateral membrane at a slower rate than Tac/Ecad-(578-728).
The targeting of Tac/Ecad-(578-653) was finally tested using a surface
biotinylation assay to measure and quantify its appearance on the
plasma membrane domains of confluent, polarized cells. Cell surface
biotinylation was performed on cell lines stably expressing
Tac/Ecad-(578-728) and Tac/Ecad-(578-653). Addition of biotin
reagents to the basal sides of the monolayers labeled most of the
Tac/Ecad-(578-728) and Tac/Ecad-(578-653) proteins, whereas from the
apical side almost no labeling occurred in either case (see Table
I). Together these results show that a
chimeric protein, containing only the membrane-proximal half of the
E-cadherin cytoplasmic tail, has sufficient information to direct
efficient sorting and targeting to the basolateral cell surface, albeit perhaps at a slower rate than constructs with the full-length cytoplasmic tail.
A Dileucine Motif Is Responsible for Basolateral Targeting of
E-cadherin--
Sequence analysis of the membrane-proximal E-cadherin
tail encoded by the region in Tac/Ecad-(578-653) revealed the presence of two putative targeting motifs. Sequence alignment of members of the
type I cadherins, of which E-cadherin is the prototype, and type II
cadherins (42), revealed that a dileucine motif at position 587 is
highly conserved across species and preserved in almost all members of
the family (Fig. 5A). To test
this dileucine motif for targeting information, the leucines at
positions 587 and 588 were changed to alanines in the chimeras encoding
the full-length tail and membrane-proximal tail, using oligonucleotide cloning. The resulting mutated chimeras, termed
Tac/Ecad-(578-728) Binding of
The membrane-proximal Tac/Ecad-(578-653) construct is missing the
carboxyl-terminal E-cadherin is one of the proto-typical polarized membrane proteins
in epithelia. It is delivered to the basolateral membrane and is
concentrated in adherens junctions where it participates in cell-cell
adhesion. To address how E-cadherin is trafficked and targeted in
polarized cells, we made use of Tac/E-cadherin chimeras expressed in
two epithelial cell lines. Our findings show that chimeras containing
full-length or truncated cytoplasmic tails of E-cadherin were
effectively sorted and trafficked to the basolateral surface domain in
MDCK and LLC-PK1 cells. Furthermore, this polarized
targeting was lost after deletion of a single, dominant targeting motif
in the proximal region of the tail. Three main conclusions emerged from
these experiments; (i) that a single dileucine motif at 587 is able to
convey basolateral targeting information in Tac/E-cadherin chimeras and
that this signal is necessary for basolateral sorting; (ii) that
LLC-PK1 cells are able to correctly sort and traffic
E-cadherin using a dileucine-based mechanism, in contrast to proteins
sorted by tyrosine-based signals that are mis-trafficked in these
cells, and (iii) that Chimeras containing the full cytoplasmic tail of E-cadherin,
Tac/Ecad-(578-728) and Tac/Ecad-(554-728), were efficiently targeted and trafficked to the basolateral domain of MDCK and
LLC-PK1 cells in a similar manner to that of endogenous
E-cadherin or GFP-E-cadherin in either cell line. The Tac ectodomain
did not interfere with the intracellular trafficking or processing in
the full-length tail constructs, because there was no evidence of less
efficient membrane delivery or retention within the secretory pathway.
The transmembrane domain has been implicated in mediating lateral association and adhesive strength of cadherins in the plasma membrane, without affecting surface delivery (43). Amino acid sequences within
transmembrane segments can, however, be involved in targeting as
exemplified by the apical targeting signal in one of the transmembrane segments of the The correct basolateral targeting of the Tac/Ecad-(578-653) construct
first indicated that the membrane-proximal tail region alone is
sufficient for membrane targeting and that distal regions of the tail
are not required for targeting or surface delivery. In our hands,
mutants with the truncated tail of E-cadherin, Tac/Ecad-(578-653), were processed, targeted, and delivered to the basolateral cell surface, albeit at a slower rate than constructs with the full cytoplasmic tail. Transient accumulation of Tac/Ecad-(578-653) in the
biosynthetic pathway, seen as intracellular staining in LLC-PK1 cells, indicated that it was trafficked less
efficiently than the full-length tail. Partial accumulation of
Tac/Ecad-(578-653) was similarly noted in MDCK cells, although the
truncated tail mutants did eventually reach the cell surface. Our
findings are in contrast to those of a previous study in which a series
of chimeras representing truncation mutants of the E-cadherin tail fused to a GP-2 ectodomain, were found to be very poorly trafficked (34). Only about 10% of the truncated GP-2 chimeric proteins in that
study reached the surface of MDCK cells and were randomly sorted,
whereas the majority of the proteins were blocked or degraded early in
the secretory pathway (34). On the basis of the correct targeting and
delivery of Tac/Ecad-(578-653), which contains similar tail regions to
some of the mutants in the previous study, we hypothesize that the poor
processing and trafficking of those chimeras may have been due to the
influence of the GP-2 ectodomain rather than being a function of
E-cadherin trafficking or accessory proteins (see below).
The membrane-proximal tail region of E-cadherin has been implicated in
a number of functions. Cadherin clustering and adhesive strength were
shown to be affected by mutations in the membrane-proximal region of
the C-cadherin tail (45). Binding of the p120ctn protein
has also been shown to occur in this region (45, 46), and some of the
amino acid sequences mapped by two-hybrid analysis, as being
specifically involved in the binding of p120ctn (47), overlap
with the dileucine targeting signal identified in this study. It is
therefore likely that this membrane-proximal region of the tail is
involved in multiple, temporally regulated protein interactions that
are important, initially for E-cadherin transport, and then for
adhesive function at the cell surface. Positive sorting mediated by the
Tac/Ecad-(578-653) membrane-proximal tail allowed us to focus on
putative sorting signals in this region. The dileucine motif at 587 was
chosen here as a candidate targeting signal. Despite being in the
non-conserved region of the tail, sequence alignments revealed that the
dileucine consensus motif is highly conserved throughout cadherins of
type I or II cadherin families (42). We therefore predict that this
dileucine will function to target all similar transmembrane cadherins
to basolateral domains of polarized epithelial cells. Cadherins in
which the dileucines are not conserved include cadherins 5 (VE-cadherin) and 20. The glycosyl phosphatidylinositol-anchored
cadherin 13 (T-cadherin), as expected, does not have a dileucine motif
(48).
Our experimental results, therefore, confirmed that the dileucine motif
in E-cadherin does function as a targeting signal. Replacing the
leucines with alanines in the full-length or truncated tail constructs
resulted in a complete loss of basolateral targeting. The dileucine
signal in E-cadherin has an acidic amino acid cluster on its
carboxyl-terminal side that is highly conserved throughout dileucine-containing cadherins and is similar to targeting motifs in
other basolateral proteins, including furin (49), invariant chain (50),
and low density lipoprotein receptor (22). In some cases, such as for
furin, these acidic clusters have been shown to be important for the
function of dileucine signals in basolateral targeting (49). Dileucine
signals functioning in endocytosis typically have an acidic residue at
the There are additional motifs sharing consensus with targeting signals
encoded in the E-cadherin tail. Tyrosines at two places within the
tail, one being in the membrane-proximal region and another at the
carboxyl terminus, were deleted in a previous study and found to have
no role in targeting of E-cadherin (34). There is a combined
YXX Both MDCK and LLC-PK1 cell lines form polarized epithelial
monolayers in culture that show patent basolateral trafficking and
secretion of soluble proteoglycans (54, 55). Due to the reported
inverse polarity of LLC-PK1 (28, 30), it was of interest to
also analyze E-cadherin trafficking in these cells. Our findings verify
that E-cadherin is trafficked correctly to the basolateral surface of
the LLC-PK1 cells, and we show that this targeting, as in
MDCK cells, is directed by a dileucine motif. This provides new
evidence to confirm that basolateral targeting via dileucine-based mechanisms functions correctly in LLC-PK1 cells. The
correct targeting of endogenous E-cadherin, GFP-E-cadherin, and
Tac/Ecad constructs suggests that dileucine-based sorting is fully
sufficient to direct basolateral trafficking in these cells.
LLC-PK1 cells are defective in targeting of tyrosine-based
motifs due to the absence of the µ1B chain (30). However, the sorting
of dileucine motifs occurs through interaction with the Finally, the current study also provides new insights into the role of
The polarized targeting of E-cadherin is of seminal importance to the
maintenance of epithelial polarity and function. Targeting signals and
mechanisms must ensure the accurate basolateral delivery of newly
synthesized E-cadherin and of internalized and recycled E-cadherin for
its incorporation into adherens junctions. In this study we demonstrate
one such mechanism, basolateral sorting directed via a dileucine
signal. Future studies will address specific roles for additional
signals and perhaps for some of the accessory proteins in
cadherin/catenin complexes.
We thank Susan La Flamme for providing
materials and acknowledge Darren Brown, Marita Goodwin, and Juliana
Venturato for their technical support.
*
This work was funded in part by grants from the National
Health and Medical Research Council (to J. L. S. and
A. S. Y.) and from the Australian Research Council as part of the
Special Research Center for Functional Genomics.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
A Wellcome Trust International Senior Medical Research Fellow.
Published, JBC Papers in Press, April 18, 2001, DOI 10.1074/jbc.M101907200
The abbreviations used are:
MDCK, Madin-Darby
canine kidney cells;
GFP, green fluorescence protein;
IL-2R, interleukin-2 receptor;
LLC-PK1, pig kidney proximal
tubular epithelial cell line;
PAGE, polyacrylamide gel electrophoresis;
PBS, phosphate-buffered saline;
PCR, polymerase chain reaction;
Tac, IL-2R
A Dileucine Motif Targets E-cadherin to the Basolateral Cell
Surface in Madin-Darby Canine Kidney and LLC-PK1 Epithelial
Cells*
§,
,
,
§,
**,
§, and

Institute for Molecular Bioscience, the
§ Department of Biochemistry, and the
Department of
Physiology & Pharmacology, University of Queensland, Brisbane,
Queensland 4072, Australia and the ¶ Memorial Sloan-Kettering
Cancer Center, New York, New York 10021
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(IL-2
) receptor
expressed in Madin-Darby canine kidney and LLC-PK1
epithelial cells. Chimeras containing the full-length or
membrane-proximal half of the E-cadherin cytoplasmic tail were
correctly targeted to the basolateral domain. Sequence analysis of the
membrane-proximal tail region revealed the presence of a highly
conserved dileucine motif, which was analyzed as a putative targeting
signal by mutagenesis. Elimination of this motif resulted in the loss
of Tac/E-cadherin basolateral localization, pinpointing this dileucine
signal as being both necessary and sufficient for basolateral targeting
of E-cadherin. Truncation mutants unable to bind
-catenin were
correctly targeted, showing, contrary to current understanding, that
-catenin is not required for basolateral trafficking. Our results
also provide evidence that dileucine-mediated targeting is maintained
in LLC-PK1 cells despite the altered polarity of
basolateral proteins with tyrosine-based signals in this cell line.
These results provide the first direct insights into how E-cadherin is
targeted to the basolateral membrane.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-catenin or plakoglobin, and thereby to
-catenin and actin
(reviewed in Ref. 2). The binding site for
-catenin has been mapped
by deletion mutagenesis to the distal 76 amino acids of the carboxyl
terminus of E-cadherin (7), with critical residues found in the last 30 amino acid domain (8). Aside from its participation as a member of the cadherin-bound adherens junction complex,
-catenin is involved in
the Wnt signaling pathway through its interactions with a cytoplasmic adenomatous polyposis coli complex and with the Lef/Tcf transcription factors in the nucleus (reviewed in Ref. 9).
subunit, are
delivered to the apical pole of LLC-PK1 cells. Mis-sorting
of basolateral proteins in LLC-PK1 cells led to subsequent
analysis of their AP-1 adaptor complexes. Most polarized epithelial
cells express a special µ1B subunit, which directs polarized sorting
to the basolateral surface (29). It has now been shown that
LLC-PK1 cells express a µ1A subunit but not the µ1B
subunit and that this results in aberrant sorting of proteins with
tyrosine-based signals, a defect that can be overcome by expression of
recombinant µ1B protein (30). Cadherin staining in LLC-PK1 cells
appears to be basolateral (31), although the trafficking of these
proteins in this cell line has not been studied in detail.
-catenin binds to E-cadherin early in the
biosynthetic pathway, implying that the two proteins, and perhaps
others, are transported to the cell surface together as a complex (33).
More recently, it was suggested that
-catenin plays an essential
role in the trafficking of E-cadherin, based on observations that
mutagenized proteins, with reduced binding to
-catenin, were not
efficiently delivered to the surface (34). It has also been previously
noted that the cytoplasmic tail of E-cadherin does contain motifs with
homology to known targeting signals (34, 35), which could potentially
function to guide its trafficking. In this study we set out to test
putative signals in the cytoplasmic tail of E-cadherin for possible
basolateral targeting information. Our experiments also addressed the
role of
-catenin in this targeting. We utilized a series of chimeras to express the E-cadherin cytoplasmic tail, or mutagenized versions thereof, using Tac (the
subunit of the IL-2 receptor) as an ectodomain marker. Tac is a 273-amino acid protein that has previously been used as a reporter protein for trafficking studies (36, 37). These
constructs were expressed in
MDCK1 cells, in which the
basolateral surface expression of E-cadherin is well established, and
in another epithelial cell line LLC-PK1 cells. Using these
model systems we have identified a positive targeting signal in
E-cadherin that is responsible for basolateral delivery. Our results
provide new insights into the trafficking of E-cadherin and its
accessory proteins (catenins), and the findings are also significant to
our understanding of cell polarity and sorting pathways in epithelia.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-catenin were
used; Tac was recognized using a mouse monoclonal antibody (B-B10,
BIOSOURCE International, Camarillo, CA) and a
rabbit polyclonal antibody directed against the green fluorescence
protein (GFP) (Molecular Probes Inc., Eugene, OR) was also used for
staining. Secondary antibodies included Cy3-conjugated sheep anti-mouse
and goat anti-rabbit IgGs (Jackson ImmunoResearch Labs, West Grove, PA)
and a horseradish peroxidase-conjugated sheep anti-mouse IgG (AMRAD,
Victoria, Australia).
S1.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (153K):
[in a new window]
Fig. 1.
Localization of E-cadherin. MDCK and
LLC-PK1 cells were generally fixed with paraformaldehyde
and labeled with a mouse monoclonal antibody to localize endogenous
E-cadherin by immunofluorescence. a, E-cadherin staining in
MDCK cells on cell boundaries is at the basolateral domain;
b, in LLC-PK1 cells fixed in methanol, there is
typical basolateral surface staining; c, in
LLC-PK1 cells fixed in paraformaldehyde the E-cadherin
antibody gave no staining. GFP-E-cadherin is localized by the GFP
antibody on the basolateral membrane of transfected MDCK cells
(d) and LLC-PK1 cells (e). There is
also some intracellular, perinuclear staining of newly synthesized
GFP-E-cadherin in LLC-PK1 cells (arrows).
Bar, 2.5 µm.

View larger version (29K):
[in a new window]
Fig. 2.
A, diagrammatic representation of
chimeras. Chimeras were made by fusing amino-terminal regions of Tac,
encompassing the extracellular domain and transmembrane domain to the
full-length carboxyl-terminal cytoplasmic tail of E-cadherin
(shaded) (Tac/Ecad-(578-728)). In some constructs the
transmembrane domain of Tac was replaced with that of E-cadherin
(Tac/Ecad-(554-728)). In Tac/Ecad-(578-653) the E-cadherin tail was
truncated leaving only the membrane-proximal region. B,
extracts of MDCK (lane 1) and LLC-PK1 cells
(lanes 2-5) were probed by immunoblotting with the
E-cadherin antibody to detect Tac/Ecad chimeras. Proteins of the
expected molecular weight were detected for each of the Tac/Ecad
chimeras (Tac/Ecad-(578-728), 72 kDa; Tac/Ecad-(554-728), 72 kDa;
Tac/Ecad-(578-653), 62 kDa; Tac/Ecad-(578-728)
S1, 72 kDa (see also
Fig. 5)).

View larger version (167K):
[in a new window]
Fig. 3.
Localization of Tac/E-cadherin chimeras.
Immunofluorescence staining of Tac or Tac/E-cadherin chimeras in stably
transfected cell lines using the Tac antibody. Upper views
show cross sections of monolayers; lower views in each panel
represent XZ sections of filter-grown cells. MDCK (a) and
LLC-PK1 (b) cells overexpressing full-length Tac
on their apical domains; c, Tac/Ecad-(554-728) expressed in
LLC-PK1 cells is localized on the basolateral membrane. The
Tac/Ecad-(578-728) construct is also on the basolateral domains of
transfected LLC-PK1 cells (d) and MDCK cells
(e). Bars, 2.5 µm.

View larger version (61K):
[in a new window]
Fig. 4.
Immunofluorescence localization of the
membrane-proximal chimera. LLC-PK1 (a,
b) and MDCK (c) cells overexpressing
Tac/Ecad-(578-653) were stained with the Tac antibody. The
truncated chimera encoding only the membrane-proximal tail localized to
the basolateral domains of confluent cells. There was also some
intracellular, perinuclear staining in untreated cells (a)
that disappeared after 2 h of treatment with cycloheximide
(b). Bars, 2.5 µm.
Cell surface subjected to biotinylation
S1 and Tac/Ecad-(578-653)
S1, were transfected
into LLC-PK1 and MDCK cells and then localized by
immunofluorescence (Fig. 5B). Tac/Ecad-(578-728)
S1 and
Tac/Ecad-(578-653)
S1 were localized at the apical surfaces of
transfected LLC-PK1 and MDCK cells, in patterns similar to the apical Tac (Fig. 3, a and 3b) and distinct
from the basolateral non-mutated chimeras. Thus removal of the
dileucine motif at 587 from the E-cadherin cytoplasmic domain resulted
in a loss of basolateral targeting information. We conclude that this
motif is a positive sorting signal for the basolateral membrane
localization of E-cadherin and that it is necessary to direct sorting.
The high level of conservation of this dileucine motif throughout the
cadherins family further suggests that it has a key functional role. A
second potential targeting signal of the type NPXY is
present in the sequence of Tac/Ecad-(578-653). This tyrosine-based
signal at position 600 was not tested here and is not considered a
likely candidate for targeting, based on experimental data from another study (34) and our observation that the motif is not conserved in
cadherins across different species.

View larger version (129K):
[in a new window]
Fig. 5.
A, sequence alignment of cadherins with
conserved cytoplasmic tails (type I and II families as defined by
Nollet et al. (42)). Sequence alignment of the
membrane-proximal tail regions of cadherin family members, including
E-cadherin (cadherin 1), N-cadherin (cadherin 2),
and VE-cadherin (cadherin 5). A dileucine motif at position
587 (shaded) in E-cadherin (cadherin 1) is highly
conserved across members of the family and is relatively close to the
transmembrane domain (underlined) in the membrane-proximal
region of the tail. B, targeting of dileucine deletion
mutants. MDCK and LLC-PK1 cells expressing
Tac/Ecad-(578-728)
S1 or Tac/Ecad-(578-653)
S1 were stained with
the Tac antibody. Both constructs with deleted dileucine motifs, now
show apical targeting. Prominent apical staining only, is now seen in
both cell lines expressing Tac/Ecad-(578-728)
S1 or
Tac/Ecad-(578-653)
S1. Bars, 2.5 µm.
-Catenin--
-Catenin is known to bind to the
cytoplasmic tail of E-cadherin early in the biosynthetic pathway and
has previously been implicated in trafficking to the cell surface (34).
Therefore, Tac/E-cadherin chimeras were tested for their ability to
bind to
-catenin. The interaction of endogenous E-cadherin in MDCK cells with
-catenin was demonstrated by co-immunoprecipitation of
the two proteins using an E-cadherin antibody (Fig.
6A). Tac/Ecad-(578-728) was
immunoprecipitated with the Tac antibody from extracts of transfected
MDCK and LLC-PK1 cells, and
-catenin co-precipitating in
the complex was detected by immunoblotting. In extracts of both MDCK
and LLC-PK1 cells,
-catenin was bound to
Tac/Ecad-(578-728) (Fig. 6B). This finding suggests that
the full-length cytoplasmic tail in Tac/Ecad-(578-728) is correctly
folded and processed in a manner conducive to effective trafficking and
surface delivery.

View larger version (21K):
[in a new window]
Fig. 6.
Co-immunoprecipitation of
-catenin. A, proteins
immunoprecipitated from untransfected MDCK cells with a monoclonal
antibody to E-cadherin were probed by immunoblotting with the
E-cadherin antibody (top) or with a
-catenin antibody
(bottom). Proteins at 120 and 92 kDa, respectively, were
detected. B, the Tac antibody was used to immunoprecipitate
chimeras from transfected LLC-PK1 cells. The
-catenin
antibody was then used for immunoblotting supernatants (SN lanes
1, 3, and 5) and immunoprecipitates
(IP lanes 2, 4, and 6).
-Catenin
was co-precipitated with Tac/Ecad-(578-728) (lane 2) but
not with the truncated Tac/Ecad-(578-653) chimera (lane 4).
Deletion of the dileucine targeting motif (Tac/Ecad-(578-728)
S1)
did not affect co-precipitation of
-catenin (lane
6).
-catenin binding domain, and
co-immunoprecipitation experiments confirm that, as expected,
-catenin was not co-precipitated with this truncated chimeric
protein (Fig. 6B). Endogenous E-cadherin and chimeras with
full-length E-cadherin tails were able to efficiently bind and
co-immunoprecipitate
-catenin (Fig. 6, A and
B). Deletion of the 587 dileucine targeting signal had no
effect on binding of
-catenin, which was efficiently co-precipitated
with Tac/Ecad-(578-728)
S1 (Fig. 6B). The correct
basolateral targeting of Tac/Ecad-(578-653) in the absence of bound
-catenin now demonstrates that
-catenin is not essential for
basolateral sorting and targeting in either MDCK or LLC-PK1
cells. The complexing of
-catenin with newly synthesized E-cadherin
may be required for other roles in biosynthetic processing or
trafficking, for instance, the loss of
-catenin binding may
account for the increased intracellular accumulation and apparently
slower trafficking of the Tac/Ecad-(578-653) mutants.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-catenin is not required for basolateral
targeting and surface delivery of E-cadherin.
-subunit of the gastric parietal H,K-ATPase (44). Our experiments directly tested the E-cadherin transmembrane domain, with the finding that this region of the protein has no role in basolateral targeting nor in sorting or membrane delivery of
Tac/E-cadherin chimeras. Overall the results obtained with the
Tac/E-cadherin chimeras point to the cytoplasmic tail of E-cadherin as
having positive basolateral sorting information, in keeping with many other type I membrane proteins.
4 position (D/EXXXLL) (21, 51, 52). In contrast, the
cadherin dileucine signal typically has a basic lysine or arginine in
the
4 position. It is, therefore, unlikely that this motif will also
function as an endocytosis motif.
tyrosine and dileucine motif (673), similar in
structure to the overlapping motif, which has been shown to be
responsible for basolateral targeting of the pIg F receptor in MDCK
cells (53). There is also a motif belonging to the YXX
group, with a tyrosine at the second X position (705).
Both of these latter signals are adjacent to, or within, the
-catenin binding domain and are thus predicted to be sequestered
when E-cadherin is complexed to
-catenin. The possibility remains
open, however, that any of these additional signals might be uncovered
during dynamic protein interactions and therefore could act as
targeting signals during further trafficking of surface E-cadherin. One or more of these signals could, for instance, target E-cadherin to
clathrin-coated vesicles for endocytosis and recycling (35) after it
reaches the basolateral plasma membrane. Overall, analysis of targeting
motifs points to a dileucine signal rather than tyrosine-based signals
being responsible for the polarized sorting and basolateral delivery of
E-cadherin.
subunits of
the adaptor complex (56), allowing correct sorting of proteins such as
T cell receptor sub-unit (CD3
), Fc receptor, and E-cadherin. The
correct targeting of endogenous E-cadherin and Tac/Ecad constructs in
LLC-PK1 cells acts as further evidence that this targeting
does, in fact, rely on dileucine rather than tyrosine motifs. The full
nature of the adaptor complexes or that required for post-Golgi
transport of E-cadherin in either LLC-PK1 or MDCK
epithelial cells have yet to be characterized.
-catenin in E-cadherin trafficking.
-Catenin is a cytoplasmic
protein with affinity for the cytoplasmic tail of E-cadherin, it binds
to E-cadherin early in the biosynthetic pathway, forming a stable
complex that is transported to the cell surface (33). Chen and
colleagues (34) concluded that
-catenin is required for the
biosynthetic processing and trafficking of E-cadherin, based on a
correlation between deletion of residues within or near the
-catenin
binding domain and loss of surface delivery in GP-2-E-cadherin chimeras
and other constructs. However, our current results suggest a different
scenario. We showed that full-length tail chimeras co-precipitated
-catenin in similar proportion to that seen in endogenous
E-cadherin-
-catenin complexes. Upon expressing the
Tac/Ecad-(578-653) chimera, which clearly did not bind
-catenin, we
found it was correctly targeted and transported to the cell surface,
suggesting that
-catenin is not required for sorting or delivery
under these conditions.
-Catenin may have a role in facilitating or
optimizing the transport, processing, or folding of newly synthesized
E-cadherin. All of these factors might well contribute to the slower
processing and transient accumulation of Tac/Ecad-(578-653) that we
noted in the absence of
-catenin. Recent biophysical and biochemical
analyses further suggest that
-catenin binding might also serve to
protect the E-cadherin tail from degradation (57). Our finding, that
-catenin is not required for basolateral targeting or surface
delivery, sheds new light on
-catenin as having a role in
facilitating, but not directing, cadherin trafficking.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES

To whom correspondence should be addressed: Tel.:
61-7-3365-8242; Fax: 61-7-3665-4388; E-mail:
r.teasdale@imb.uq.edu.au.
![]()
ABBREVIATIONS
chain;
RIPA, radioimmune precipitation buffer;
bp, base pair(s);
CMV, cytomegalovirus.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Takeichi, M.
(1995)
Curr. Opin. Cell Biol.
7,
619-627
2.
Yap, A. S.,
Brieher, W. M.,
and Gumbiner, B. M.
(1997)
Annu. Rev. Cell Dev. Biol.
13,
119-146
3.
Gumbiner, B. M.
(1996)
Cell
84,
345-357
4.
Gumbiner, B. M.
(2000)
J. Cell Biol.
148,
399-404
5.
Yap, A. S.
(1998)
Cancer Invest.
16,
252-261
6.
Rimm, D. L.,
and Morrow, J. S.
(1994)
Biochem. Biophys. Res. Commun.
200,
1754-1761
7.
Ozawa, M.,
Ringwald, M.,
and Kemler, R.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
4246-4250
8.
Stappert, J.,
and Kemler, R.
(1994)
Cell Adhes. Commun.
2,
319-327
9.
Polakis, P.
(2000)
Genes Dev.
14,
1837-1851
10.
Brown, D.,
and Stow, J. L.
(1996)
Physiol. Rev.
76,
245-297
11.
Ikonen, E.,
and Simons, K.
(1998)
Semin. Cell. Dev. Biol.
9,
503-509
12.
Mostov, K. E.,
Verges, M.,
and Altschuler, Y.
(2000)
Curr. Opin. Cell Biol.
12,
483-490
13.
Simons, K.,
and Ikonen, E.
(1997)
Nature
387,
569-572
14.
Benting, J. H.,
Rietveld, A. G.,
and Simons, K.
(1999)
J. Cell Biol.
146,
313-320
15.
Rodriguez-Boulan, E.,
and Gonzalez, A.
(1999)
Trends Cell Biol.
9,
291-294
16.
Heilker, R.,
Spiess, M.,
and Crottet, P.
(1999)
Bioessays
21,
558-567
17.
Matter, K.,
Hunziker, W.,
and Mellman, I.
(1992)
Cell
71,
741-753
18.
Hunziker, W.,
and Fumey, C.
(1994)
EMBO J.
13,
2963-2967
19.
Lin, S.,
Naim, H. Y.,
and Roth, M. G.
(1997)
J. Biol. Chem.
272,
26300-26305
20.
Odorizzi, G.,
and Trowbridge, I. S.
(1997)
J. Biol. Chem.
272,
11757-11762
21.
Pond, L.,
Kuhn, L. A.,
Teyton, L.,
Schutze, M. P.,
Tainer, J. A.,
Jackson, M. R.,
and Peterson, P. A.
(1995)
J. Biol. Chem.
270,
19989-19997
22.
Matter, K.,
Yamamoto, E. M.,
and Mellman, I.
(1994)
J. Cell Biol.
126,
991-1004
23.
Le Gall, A. H.,
Powell, S. K.,
Yeaman, G. A.,
and Rodriguez-Boulan, E.
(1997)
J. Biol. Chem.
272,
4559-4567
24.
Distel, B.,
Bauer, U.,
Le Borgne, R.,
and Hoflack, B.
(1998)
J. Biol. Chem.
273,
186-193
25.
Hobert, M. E.,
Kil, S. J.,
Medof, M. E.,
and Carlin, C. R.
(1997)
J. Biol. Chem.
272,
32901-32909
26.
El Nemer, W.,
Colin, Y.,
Bauvy, C.,
Codogno, P.,
Fraser, R. H.,
Cartron, J. P.,
and Le Van Kim, C. L.
(1999)
J. Biol. Chem.
274,
31903-31908
27.
Sheikh, H.,
and Isacke, C. M.
(1996)
J. Biol. Chem.
271,
12185-12190
28.
Roush, D. L.,
Gottardi, C. J.,
Naim, H. Y.,
Roth, M. G.,
and Caplan, M. J.
(1998)
J. Biol. Chem.
273,
26862-26869
29.
Ohno, H.,
Tomemori, T.,
Nakatsu, F.,
Okazaki, Y.,
Aguilar, R. C.,
Foelsch, H.,
Mellman, I.,
Saito, T.,
Shirasawa, T.,
and Bonifacino, J. S.
(1999)
FEBS Lett.
449,
215-220
30.
Folsch, H.,
Ohno, H.,
Bonifacino, J. S.,
and Mellman, I.
(1999)
Cell
99,
189-198
31.
Lechner, J.,
Krall, M.,
Netzer, A.,
Radmayr, C.,
Ryan, M. P.,
and Pfaller, W.
(1999)
Kidney Int.
55,
2178-2191
32.
Tanentzapf, G.,
Smith, C.,
McGlade, J.,
and Tepass, U.
(2000)
J. Cell Biol.
151,
891-904
33.
Hinck, L.,
Nathke, I. S.,
Papkoff, J.,
and Nelson, W. J.
(1994)
J. Cell Biol.
125,
1327-1340
34.
Chen, Y. T.,
Stewart, D. B.,
and Nelson, W. J.
(1999)
J. Cell Biol.
144,
687-699
35.
Le, T. L.,
Yap, A. S.,
and Stow, J. L.
(1999)
J. Cell Biol.
146,
219-232
36.
Rajasekaran, A. K.,
Humphrey, J. S.,
Wagner, M.,
Miesenbock, G.,
Le Bivic, A.,
Bonifacino, J. S.,
and Rodriguez-Boulan, E.
(1994)
Mol. Biol. Cell
5,
1093-1103
37.
Mallet, W. G.,
and Maxfield, F. R.
(1999)
J. Cell Biol.
146,
345-359
38.
Narula, N.,
McMorrow, I.,
Plopper, G.,
Doherty, J.,
Matlin, K. S.,
Burke, B.,
and Stow, J. L.
(1992)
J. Cell Biol.
117,
27-38
39.
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
40.
LaFlamme, S. E.,
Akiyama, S. K.,
and Yamada, K. M.
(1992)
J. Cell Biol.
117,
437-447
41.
Lecuit, M.,
Dramsi, S.,
Gottardi, C.,
Fedor-Chaiken, M.,
Gumbiner, B.,
and Cossart, P.
(1999)
EMBO J.
18,
3956-3963
42.
Nollett, F.,
Kools, P.,
and van Roy, F.
(2000)
J. Mol. Biol.
299,
551-572
43.
Huber, O.,
Kemler, R.,
and Langosch, D.
(1999)
J. Cell Sci.
112,
4415-4423
44.
Dunbar, L. A.,
Aronson, P.,
and Caplan, M. J.
(2000)
J. Cell Biol.
148,
769-778
45.
Yap, A. S.,
Niessen, C. M.,
and Gumbiner, B. M.
(1998)
J. Cell Biol.
141,
779-789
46.
Ohkubo, T.,
and Ozawa, M.
(1999)
J. Biol. Chem.
274,
21409-21415
47.
Thoreson, M. A.,
Anastasiadisa, P. Z.,
Daniel, J. M.,
Ireton, R. C.,
Wheelock, M. J.,
Johnson, K. R.,
Hummingbird, D. K.,
and Reynolds, A. B.
(2000)
J. Cell Biol.
148,
189-202
48.
Doyle, D. D.,
Goings, G. E.,
Upshaw-Earley, J.,
Page, E.,
Ranscht, B.,
and Palfrey, H. C.
(1998)
J. Biol. Chem.
273,
6937-6943
49.
Simmen, T.,
Nobile, M.,
Bonifacino, J. S.,
and Hunziker, W.
(1999)
Mol. Cell. Biol.
19,
3136-3144
50.
Simonsen, A.,
Bremnes, B.,
Nordeng, T. W.,
and Bakke, O.
(1998)
Eur. J. Cell Biol.
76,
25-32
51.
Honing, S.,
Sandoval, I. V.,
and von Figura, K.
(1998)
EMBO J.
17,
1304-1314
52.
Dietrich, J.,
Kastrup, J.,
Nielsen, B. L.,
Odum, N.,
and Geisler, C.
(1997)
J. Cell Biol.
138,
271-281
53.
Orzech, E.,
Schlessinger, K.,
Weiss, A.,
Okamoto, C. T.,
and Aroeti, B.
(1999)
J. Biol. Chem.
274,
2201-2215
54.
de Almeida, J. B.,
and Stow, J. L.
(1991)
Am. J. Physiol.
260,
C691-C700
55.
Stow, J. L.,
de Almeida, J. B.,
Narula, N.,
Holtzman, E. J.,
Ercolani, L.,
and Ausiello, D. A.
(1991)
J. Cell Biol.
114,
1113-1124
56.
Rapoport, I.,
Chen, Y. C.,
Cupers, P.,
Shoelson, S. E.,
and Kirchhausen, T.
(1998)
EMBO J.
17,
2148-2155
57.
Huber, A. H.,
Stewart, D. B.,
Laurents, D. V.,
Nelson, W. J.,
and Weis, W. I.
(2000)
J. Biol. Chem.
276,
12301-12309
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. Desclozeaux, J. Venturato, F. G. Wylie, J. G. Kay, S. R. Joseph, H. T. Le, and J. L. Stow Active Rab11 and functional recycling endosome are required for E-cadherin trafficking and lumen formation during epithelial morphogenesis Am J Physiol Cell Physiol, August 1, 2008; 295(2): C545 - C556. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Theard, M. A. Raspe, D. Kalicharan, D. Hoekstra, and S. C.D. van IJzendoorn Formation of E-Cadherin/{beta}-Catenin-based Adherens Junctions in Hepatocytes Requires Serine-10 in p27(Kip1) Mol. Biol. Cell, April 1, 2008; 19(4): 1605 - 1613. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yamamura, N. Nishimura, H. Nakatsuji, S. Arase, and T. Sasaki The Interaction of JRAB/MICAL-L2 with Rab8 and Rab13 Coordinates the Assembly of Tight Junctions and Adherens Junctions Mol. Biol. Cell, March 1, 2008; 19(3): 971 - 983. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Miyashita and M. Ozawa A dileucine motif in its cytoplasmic domain directs -catenin-uncoupled E-cadherin to the lysosome J. Cell Sci., December 15, 2007; 120(24): 4395 - 4406. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Murphy, K. E. Shapira, Y. I. Henis, and E. B. Leof A Unique Element in the Cytoplasmic Tail of the Type II Transforming Growth Factor-beta Receptor Controls Basolateral Delivery Mol. Biol. Cell, October 1, 2007; 18(10): 3788 - 3799. [Abstract] [Full Text] [PDF] |
||||
![]() |
|