|
Originally published In Press as doi:10.1074/jbc.M010231200 on March 5, 2001
J. Biol. Chem., Vol. 276, Issue 25, 22699-22708, June 22, 2001
Tumor Suppressor p53 Protein Is a New Target for
the Metastasis-associated Mts1/S100A4 Protein
FUNCTIONAL CONSEQUENCES OF THEIR INTERACTION*
Mariam
Grigorian ,
Susanne
Andresen,
Eugene
Tulchinsky,
Marina
Kriajevska,
Charlotte
Carlberg§,
Charlotte
Kruse,
Martin
Cohn¶,
Noona
Ambartsumian,
Annette
Christensen,
Galina
Selivanova , and
Eugene
Lukanidin
From the Department of Molecular Cancer Biology, Institute of
Cancer Biology, Danish Cancer Society, Strandboulevarden 49, DK-2100
Copenhagen Ø, Denmark and Microbiology and Tumor Biology
Center, Karolinska Institute, SE-171 77 Stockholm, Sweden
Received for publication, November 9, 2000, and in revised form, February 6, 2001
 |
ABSTRACT |
A physical and functional interaction between the
Ca2+-binding protein Mts1 (S100A4) and the tumor
suppressor p53 protein is shown here for the first time. We demonstrate
that Mts1 binds to the extreme end of the C-terminal regulatory domain
of p53 by several in vitro and in vivo
approaches: co-immunoprecipitation, affinity chromatography, and far
Western blot analysis. The Mts1 protein in vitro inhibits
phosphorylation of the full-length p53 and its C-terminal peptide by
protein kinase C but not by casein kinase II. The Mts1 binding
to p53 interferes with the DNA binding activity of p53 in
vitro and reporter gene transactivation in vivo, and
this has a regulatory function. A differential modulation of the p53
target gene (p21/WAF, bax, thrombospondin-1,
and mdm-2) transcription was observed upon Mts1
induction in tet-inducible cell lines expressing wild type
p53. Mts1 cooperates with wild type p53 in apoptosis induction. Our
data imply that the ability of Mts1 to enhance
p53-dependent apoptosis might accelerate the loss of wild
type p53 function in tumors. In this way, Mts1 can contribute to the
development of a more aggressive phenotype during tumor progression.
 |
INTRODUCTION |
The mts1/S100A4 gene has been isolated as a gene
specifically expressed in murine and human metastatic tumor cells (1). Expression of mts1 in nonmetastatic murine and human cell
lines results in a more malignant phenotype (2).
Mts1/S100A4 is a small 11-kDa protein that belongs to the S100 family
of Ca2+-binding proteins. The existence of multiple S100
protein targets may explain the involvement of the S100 proteins in a
large group of cellular events such as neurite growth, cell-cell
communication, cell growth, cell structure, energy metabolism,
contraction, motility, intracellular signaling, and cell division
(3).
Mts1 participates in the regulation of cytoskeletal dynamics and cell
motility by association with stress fibers, F-actin, and tropomyosin
(4, 5). In our laboratory, the heavy chain of nonmuscle myosin II
(MHC)1 was identified as a
target for Mts1 (6). The Mts1-MHC interaction results in the inhibition
of the protein kinase C (PKC)-mediated phosphorylation of the MHC
molecule and associates Mts1 with cell motility, which is one of the
determinative functions in the metastatic disease (7).
Tumor suppressor p53 protein is a transcriptional factor, which
regulates several cellular processes, creating limitations for
tumorigenic transformation. In response to
"proliferation-affecting" events (DNA damage, oncogenes, oxidative
stress, etc.), cells utilizing p53 pathways may switch to either growth
arrest, programmed cell death, or cell differentiation (8). The
pathways of p53 regulation are only starting to emerge.
As a transcriptional regulator, p53 modulates the expression of target
genes by binding to specific p53-responsive sites. The majority of
genes regulated by p53 are involved either in cell cycle control or apoptosis.
The p53 protein has three main functional domains. The N-terminal
transactivation domain interacts with several components of the basal
transcription machinery and provides a transcriptional regulation (9).
The central part of the protein contains the specific DNA-binding
domain, a hot spot for p53 mutations that affect its DNA binding
ability and lead to tumorigenic transformation of cells. The C-terminal
part of p53 is a multifunctional domain, responsible for
oligomerization, nuclear translocation, and binding to damaged DNA. In
addition, the C terminus negatively regulates the specific DNA binding
activity of the core domain. Binding to certain proteins, acetylation,
or phosphorylation by PKC and casein kinase II (CKII) abolish the
negative effect imposed by the C terminus. The C terminus regulates the
conversion of p53 from inactive to active forms and vice versa, thereby
modulating the transcriptional activity of p53 (10, 11).
Here we show a physical link between Mts1 and amino acid residues
360-393 of the C-terminal domain of p53. This interaction affects the
phosphorylation of p53 by PKC as well as its DNA binding capacity
in vitro. Moreover, Mts1 influences the transactivation of a
reporter gene placed under the control of p53-binding elements in
vivo and differentially modulates the transcription of
p53-regulated genes. Cooperation between wild type p53 and Mts1 may
induce an apoptotic response depending on environment and cell type.
 |
EXPERIMENTAL PROCEDURES |
Plasmids--
The coding region of mts1 was
cloned into pSK3 (Amersham Pharmacia Biotech) vector, giving a
construct pSV-mts1. pSVBcl2 was constructed by cloning the
Bcl2/XhoI insert from PEBS7-425 (gift of Dr. M. Jäättelä) into the pSK3 vector. The following mouse wild type p53 polymerase chain reaction products were designed. Product 1, the full-length coding region (390 aa) was amplified using the following primers: forward, CGGGATCCGACTGGATGACTGCCATGGA (includes BamHI site) and reverse,
CGAAGCTTCAGTCTGAGTCAGGCCCCACT (includes HindIII site);
product 2, N-terminal domain (106 aa): forward, same as the forward
primer for product 1, reverse: CGAAGTCTT GAAGCCATAGTTGCCCTGGTAAG
(includes HindIII site); product 3, DNA-binding domain (185 aa): forward, CGGGATCCCACCTGGGCTTCCTGCATGCT (includes BamHI
site), reverse, CGAAGCTTGGACTTCCTTTTTGCGGAAATTTTC (includes HindIII site); product 4, C-terminal domain (99 aa):
forward, CGGGATCCCTTTGCCCTGAACTGCCCCCA (includes BamHI
site), reverse, same as the reverse primer for product 1. The
polymerase chain reaction products were digested with
BamHI/HindIII and cloned into the bacterial
expression vector pQE30 (Qiagen, GmbH, Hilden, Germany). pSP65 m65
plasmid DNA (gift of Dr. J. Skouv) was used for the amplification of
mouse p53 and its domains. pC53-SN3 (human wild type p53) and pC53-SCX3
(human mutant p53, Val143 Ala) eukaryotic
expression plasmids were gifts of Dr. J. Skouv. For cloning into the
tet-inducible, conventional expression system, mts1 cDNA was excised, cloned into pUHD 10-3, and used
for transfection of cell lines producing reverse
tetracycline-controlled transactivator (pUHD172-neo)
(CLONTECH Laboratories GmbH, Heidelberg, Germany). p21-luc was constructed by cloning 13 copies of the p53-binding consensus element from the p21/WAF promoter, excised from pSK45-13-2 (provided by Dr. B. Vogelstein), into the pfLuc reporter construct containing the Photinus pyralis luciferase gene under the
minimal c-fos promoter. For Bax-luc construction 5'-TCG ACA
ATA TAG CCC ACG CCC AGG CTT GTC TC-3' and 3'-G TCC GAA CAG AGA TTG AAC
ACT CTA G-5' oligonucleotides were annealed, and the ends of
double-stranded DNA were extended with Escherichia coli DNA
polymerase I Klenow fragment. Four copies of head-to-tail orientated
fragments were cloned into the HindIII site of the pfLuc vector.
The -galactosidase expression plasmid (pCMV- -gal) was purchased
from CLONTECH. pBabe-Hyg contains the hygromycin
resistance gene and was a gift of Dr. J. Lukas. The pQE30 expression
vector, producing recombinant Mts1-His (7) plasmids encoding human wild
type and mutant p53 proteins fused with the GST protein, GST-p53 and
GST-p53 30 (12), were used.
Cell Line Transfection--
Cells were transfected by
electroporation: 1-3 × 106 cells in 100 µl of
phosphate saline buffer were transferred into an electroporation cuvette, and a single pulse of 250 V and 250 microfarads was applied using the Bio-Rad electroporation system. Clones were selected in the
presence of 400 µg of G418. For the conventional clones, double
selection with G418 and 200 µg/ml hygromycin was used. In the
transient transfection experiments, the efficiency of each transfection
was monitored by the use of co-transfection with a -galactosidase
expression vector, pCMV- -gal. At 24-48 h post-transfection, cells
were lysed, and the luciferase activity was measured using a
luminometer (Promega, Madison, WI). The same lysates were tested for
-galactosidase activity by using
o-nitrophenyl- -galactopyranoside (Sigma) as a chromogenic
substrate (13).
Immunofluorescence Analysis--
Cells were grown on 10-mm
glasses and fixed with freshly prepared 4% paraformaldehyde in PBS for
30 min on ice. 0.2% Triton X-100 was used to permeabilize the cells.
Primary and secondary antibody were applied in Dulbecco's
modified Eagle's culture medium with 10% fetal calf serum for 1 h at room temperature. The antibodies used were rabbit anti-mouse Mts1
affinity-purified antibody (1:500) and fluorescein
isothiocyanate-conjugated goat anti-rabbit IgG (1:100)
(Zymed Laboratories Inc.).
To evaluate the efficiency of transfection, the cells grown on one of
the glasses were fixed with 0.5% glutaraldehyde in PBS for 5 min,
washed three times with PBS, and incubated with X-gal staining solution
(1 mg/ml 5-bromo-4-chloro-3 indolyl -D-galactopyranoside (X-gal), 35 mM potassium ferricyanide, 35 mM
potassium ferrocyanide, and 2 mM MgCl2 in
PBS).
Preparation of Recombinant Proteins--
Histidine-tagged p53
and Mts1 proteins were expressed in XL-blue E. coli by
induction with 0.2 mM isopropyl
-D-thiogalactopyranoside for 4 h at 37 °C.
Protein isolation in denaturing conditions and the following
renaturation were performed according the manufacturer's protocol
(Qiagen GmbH, Hilden, Germany).
Western Blotting--
Protein isolation and Western blotting
were performed as described (6). Immunostaining and protein band
visualization with the ECL system SuperSignal® (Pierce) was carried
out according to the manufacturer's protocol.
Far Western (Blot Overlay)--
Proteins were separated by
SDS-PAGE and blotted to Immobilon-P (Millipore Corp., Bedford, MA).
After blotting, the membranes were preincubated in the blocking buffer:
0.2 M NaCl, 50 mM Tris-HCl, pH 7.5, 3% bovine
serum albumin, 0.1% polyethylene glycol 8000 for 2 h at room
temperature. Overlay with 1 µg/ml of recombinant Mts1 protein was
performed for 20 min at room temperature in 0.2 M NaCl, 50 mM Tris, pH 7.5, 12 mM -mercaptoethanol,
0.1% bovine serum albumin, 1% polyethylene glycol 8000, and 1 mM CaCl2. After three washes, the membranes
were immunoprobed with anti-Mts1 antibodies by standard Western
blotting procedure.
Immunoprecipitation and in Vitro Pull-down Assays--
Cells
were metabolically labeled for 4 h in methionine- and
cysteine-free medium supplemented with dialyzed and inactivated 10%
fetal calf serum with 0.2 mCi/ml [35S]methionine and
[35S]cysteine (Amersham Pharmacia Biothech). The cells
were lysed in Nonidet P-40 buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.6, 1% Nonidet P-40) supplemented with a
protease inhibitor mixture (1 mM dithiothreitol, 10 µg/ml
leupeptin, 2 µg/ml aprotonin, 0.1 mM phenylmethylsulfonyl
fluoride, 1 mM benzamidine) and precleared on 50% protein
A-Sepharose.
The lysates were then incubated for 2 h with anti-p53, pAb421
monoclonal antibody, (gift of Dr. J. Bartek), or anti-Mts1 rabbit serum. The precipitated proteins were separated on gradient SDS-PAGE (4-20%) and detected by autoradiography.
For the in vitro precipitation assay, 1 µg of recombinant
Mts1 was mixed with either the recombinant full-length p53
(product 1) or its domain peptides (products 2-4) in Nonidet P-40
buffer and precleared on protein A-Sepharose in the presence of
protease inhibitors for 1 h in the cold room. To the precleared
mixtures a fresh portion of the protein A-Sepharose and corresponding
anti-p53 antibodies were added (pAb421 for full-length and C-terminal
domain; pAb240 (gift of Dr. J. Bartek) for DNA-binding core domain; and pE-19 (Santa Cruz Biotechnology Inc., Santa Cruz, CA) for the N-terminal domain) and incubated for 2 h in a cold room.
Immunoprecipitates were washed five times with Nonidet P-40 buffer and
heated at 100 °C for 5 min. Proteins were separated on 15% PAGE and
transferred to an Immobilon-P membrane (Millipore). To detect the
co-immunoprecipitated Mts1 protein, the membranes were probed with
anti-Mts1 antibodies and developed by an ECL System.
Recombinant human wild type GST-p53 and GST-p53- 30 (deletion mutant
lacking aa 364-393) fusion proteins were used for pull-down experiments with the Mts1 recombinant protein. 5 µg of GST and GST
fusion proteins coupled with glutathione-Sepharose beads were incubated
with 2 µg of Mts1 in Nonidet P-40-containing buffer for 2 h in a
cold room with rotation. After five washings with Nonidet P-40 buffer,
proteins were isolated by boiling in protein-loading buffer for 5 min
and analyzed using Western blotting followed by Mts1 immunoprobing.
Phosphorylation Assays--
Reactions were performed in a
mixture (25 µl) containing 50 mM Tris-HCl, pH 7.6, 0.1 M NaCl, 10 mM MgCl2, 4 mM CaCl2, 2 mM dithiothreitol, 50 µM ATP, 2 µCi of [ -32P]ATP (>5,000
Ci/mmol; Amersham Pharmacia Biotech), 1 µM recombinant wild type p53, or its protein fragments for 30 min at 30 °C. The PKC
assay was done in the presence of 3.75 µg of phosphatidylserine (Sigma) by 0.016 µg of PKC (Roche Molecular Biochemicals). CKII was
purchased from (New England BioLabs), and 50 units were applied per
reaction. Recombinant Mts1 was used in concentrations of 0, 3, and 5 µM. Reactions were terminated by adding an equal volume of 2× SDS-loading buffer, and proteins were separated in 15%
SDS-PAGE. Gels were fixed in 5% trichloroacetic acid, dried, and
exposed to Kodak x-ray film. To quantify the intensity of the
protein bands, a Molecular Dynamics, Inc. (Sunnyvale, CA) computing
densitometry with ImageQuant software was used.
Electrophoretic Mobility Shift Assay (EMSA)--
Nuclear
extracts were prepared as previously described (13). To perform EMSA,
nuclear extracts were incubated with end-labeled oligonucleotides that
contained binding sites for p53 or Oct-1 proteins. Oligonucleotide
sequences were as follows: for Oct-1, TGCGAATGCAAATCACTAGAA; for p53,
GAACATGTCCCAACATGTTG, derived from the promoter of p21/WAF. The
reactions were carried out in 10 µl of the buffer containing 100 mM KCl, 1 mM MgCl2, 1 mM dithiothreitol, 0.1% Nonidet P-40, 0.5 mg/ml bovine
serum albumin, 5% glycerol. To perform the gel supershift analysis,
anti-p53 antibody pAb421 was added to the EMSA reaction mixtures. The
incubation with antibody was carried out for 1 h at 4 °C after
the binding reaction was completed.
Northern Blot Analysis--
CSML-0 conventional
Mts1-tet-inducible cells were grown at low and dense
conditions and induced with 2 µg/ml doxycyline for 0, 24, 48, and
72 h. RNA was isolated as described (14). Gel electrophoresis and
Northern blot analyses were performed as described (15). The same
filter was sequentially hybridized with murine p21/WAF,
bax, cyclin G1, and thrombospondin-1 (THBS1) probes. The
amounts of mRNA on the filters were calibrated by hybridization with [ -32P]ATP-labeled poly(U) probe. To quantify the
intensities of the bands, membranes were scanned using a Molecular
Dynamics computing densitometer with ImageQuant software.
 |
RESULTS |
Co-expression of Mts1 and wt-p53 Leads to Cell-specific
Apoptosis--
Plasmid DNAs encoding mts1 and neomycin
resistance were transfected into Mts1-negative CSML-0 and VMR-liv
cells. Fig. 1 shows that the clonal
survival of the transfected cells evaluated after 3 weeks was 4 times
lower compared with the mock-transfected ones (vector DNA). To
investigate the cause of low clonal survival, antiapoptotic Bcl2
cDNAs, in sense and antisense orientations, were co-transfected.
The data revealed that expression of the active (sense) Bcl2 acted as a
rescue factor and increased the relative clonal survival up to control
level, whereas the nonactive (antisense) Bcl2 did not. Taken together,
these results suggest that Mts1 expression induces programmed cell
death, which could be prevented by Bcl2 expression.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 1.
Clonal survival of CSML-0 and
VMR-liv cells transfected with Mts1/S100A4. The number of stable
clones was evaluated 3 weeks after transfection with expression
constructs pSV-mts1 (Mts1), Mts1 + Bcl2-s (Mts1 + B-s), and Mts1 + Bcl2-a (Mts1 + B-a). In all
transfections, pSVneo was co-transfected for neomycin selection.
Bcl2-s, the gene is in the sense orientation;
Bcl2-a, the gene is in the antisense orientation. Values
shown represent mean ± S.D. of three (CSML-0) and two (VMR-liv)
experiments.
|
|
Further experiments were designed to study the mechanism of the
mts1-induced apoptosis. Since p53 is a key trigger of
apoptosis, we addressed the question of whether Mts1-induced apoptosis
is dependent on functional p53. We analyzed the expression of Mts1 in a
number of human and mouse tumor cell lines of various origins and in immortalized mouse fibroblasts with known p53 status. The data
summarized in Table I show that all seven
tumor cell lines homozygous for wild type p53 displayed an
Mts1-negative phenotype, while 16 cell lines out of 18 with p53
abnormalities (mutated/deleted) are Mts1-positive. In immortalized
fibroblasts (NIH 3T3, 10T1/2, and L), the expression of
the Mts1 protein was abundant. Moreover, upon cultivation of primary
mouse fibroblasts in vitro, the expression of Mts1 was
increased after 2-3 passages (data not shown). The conversion of wild
type p53 into mutant conformation during the immortalization described
for 10T1/2 fibroblasts (16) might explain the co-existence of
Mts1 and p53 in fibroblasts. Data obtained in tumor cell lines
indicated a significant reverse correlation between wild type p53 and
Mts1 expression in tumor cell lines. The expression of Mts1 is
"allowed" when functional p53 is obstructed by mutation or other
mechanisms. It appears that the expression of Mts1 and wt-p53 are
mutually exclusive in the tumor cell lines tested.
To get insight into the role of p53 in Mts1-induced apoptosis, we
tested the survival of clones after transfection with mts1 in the presence or absence of p53 expression in two different cell
lines. The murine nonmetastatic adenocarcinoma CSML-0 line, which
contains wt-p53 and does not express Mts1, and p53-null human
osteosarcoma line Saos-2, heterogeneous for Mts1 expression (~80% of
Mts1-positive cells) were transfected with mts1, wt-p53, mt-p53, Mts1 + wt-p53, Mts1 + mt-p53, and vector DNA. The mutant p53
protein encoded by pC53-SCX3 is unable to bind DNA and act as a
transcriptional regulator. Moreover, it exhibits a dominant negative
effect and inhibits the activity of co-existing wt-p53 (17). The number
of clones was estimated 3 weeks after transfection. The results
presented in Fig. 2 demonstrate that the
lowest clonal survival was seen when both Mts1 and wt-p53 were
co-expressed (compare Saos-2 (bars 2 and
4) and CSML-0 (bars 1 and
4)). In CSML-0, which harbors wt-p53, the clonal survival
was 5 times lower in mts1 transfectants (bar
1) than in the control transfection (bar
6). In Saos-2 cells where p53 is deleted, the survival of the mts1-transfected clones (bar 1)
was comparable with the control transfection (bar
6). The transfection of mt-p53 did not affect clonal
survival (bars 3 and 5) as well as
transfection with the vector DNA (bar 6) in both
cell lines.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 2.
Clonal survival of singly and doubly
transfected Saos-2 and CSML-0 cell lines. Saos-2 (p53-null and
~70-80% Mts1-positive) and CSML-0 (wt-p53 and Mts1-negative) cells
were transfected with Mts1, wt-p53, and mt-p53 expression vectors. In 3 weeks, the number of clones was estimated. Values shown represent
mean ± S.D. of two separate experiments in triplicate.
|
|
To obtain more direct evidence of p53-dependent
Mts1-induced apoptosis, we used two approaches based on transient p53
transfection experiments. First, Mts1-negative (number 1109) and
positive (number 28) subclones of Saos-2 cells were transiently
transfected with the wt- and mt-p53 expression vectors, and the level
of p53 protein was analyzed after 24, 48, and 72 h using Western
blot analysis. As shown in Fig.
3A, 24-72 h
post-transfection, mt-p53 was readily expressed in Mts1-positive
Saos-2.28 cells. In contrast, the level of wt-p53 expression was much
lower as detected after 24 h of the transfection. At 48-72 h,
wt-p53 protein was practically undetectable. At the same time, the
expression of wt-p53 was abundant in Mts1-negative subclone 1109. In
control experiments, we were able to detect in subclone 28 abundant
expression of truncated p53 (N-terminal, core domain, C-terminal), but
not full-length functional p53 (data not shown). These results indicate
selective elimination of wt-p53-expressing Mts1-positive cells.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 3.
Simultaneous expression of Mts1
and wt-p53 in Saos-2 cell lines. Mts1-positive Saos2#28 and
Mts1-negative Saos2#1109 were transiently transfected with wt- and
mt-p53 expression constructs. Proteins were isolated at 24, 48, and
72 h, and p53 protein was analyzed by Western blot followed with
immunodetection using anti-p53 antibodies. After 48-72 h, the
expression of p53 in clone 28 is completely abolished contrary to clone
1109. The band in the C100 lane indicates the
position of the endogenous p53. Immunofluorescence analysis of
Mts1-inducible Saos-2#1109 cells transiently transfected with wt-p53 is
shown. Cells (Dox (+) and Dox ( )) were
transfected with wt-p53 expression vector. After 24 h, cells were
fixed and stained with anti-Mts1 antibodies (c and
d) and DAPI (a and b). Hallmarks of
apoptosis were easily detected in Mts1-induced cells upon the transient
expression of wt-p53 (a) compared with noninduced cells
(b). More than 25 fields were analyzed for each transfection
in three independent experiments. Magnification was × 800. CSML-0/tet-mts1#13L cells (Dox (+) and
Dox ( )) were transiently transfected with wt-p53. After
24 h, cells were fixed and subjected to terminal
deoxynucleotidyltransferase-mediated dUTP nick end labeling
(TUNEL) assay. Significant increase of the apoptotic
cell is seen under the Mts1 activation.
|
|
As an alternative approach, we took advantage of stable clones
expressing tet-inducible Mts1, which were derived from
Mts1-negative Saos-2#1109 and CSML-0 cells. Upon transient
transfection of wt-p53 in Saos-2#1109-expressing Mts1
(Dox(+)) (Fig. 3B, panel
c), cells bearing features of apoptosis were detected by
DAPI staining 24 h post-transfection (Fig. 3B,
panel a). mt-p53 did not initiate the cell death
program in Mts1-induced cells (data not shown). Parameters concerning
cell transfection efficiency and apoptotic hallmarks 15 h after
transfection are illustrated in Table II. After wt-p53 transfection in Saos-2#1109 cells, the number of nuclei with fragmented chromatin was 3 times higher in the presence of
Mts1 expression (Dox (+)) than in its absence (Dox
( )), reaching 15.6 and 5.1%, respectively (Fig.
3B, panels b and d).
Similarly, a 3-4 times higher number of apoptotic cells was detected
upon tet-induced Mts1 expression in CSML-0 cells, as
verified by TUNEL staining 24 h after transfection with wt-p53
(Fig. 3C). Taken together, these data suggest that Mts1
cooperates with p53 in triggering apoptosis.
View this table:
[in this window]
[in a new window]
|
Table II
Parameters for cell transfection and apoptotic hallmarks
The results of two independent experiments are summarized. The
parameters were estimated as an average sum in 10 random fields for
each of triplicate glasses at a magnification of × 800.
|
|
Mts1 Physically Interacts with p53--
Next, we studied whether
Mts1 co-operates directly with p53 via protein-protein interaction. To
answer this question, we used immunoprecipitation and far Western blot
analysis. Lysates from 35S-metabolically labeled CSML-100
(mt-p53- and Mts1-positive) and CSML-0 (wt-p53- and Mts1-negative)
cells were used for immunoprecipitation with anti-p53 and anti-Mts1
antibodies. As shown in Fig.
4A, an 11-kDa protein band
corresponding to Mts1 was detected in anti-p53 immunoprecipitates from
CSML-100 but not immunoprecipitates from CSML-0 cells. Conversely, a
protein corresponding to p53 in anti-Mts1 immunoprecipitates was
co-precipitated from CSML-100 cell lysate. A protein band corresponding
to MHC, a known Mts1 target (7), was detected in anti-Mts1
immunoprecipitates but not in anti-p53 and control immunoprecipitates.
This confirms that the anti-Mts1 antibodies used are able to
co-precipitate Mts1 together with its target proteins. The amount of
the Mts1 protein co-immunoprecipitated using anti-p53 antibody was
lower than that of p53 in anti-p53 precipitates. This might indicate
that only a minor portion of Mts1 is engaged in the interaction with
p53. Additionally, the specific radioactive activity per molecule of
p53 is 3 times higher than that of Mts1.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 4.
Mts1 physically interacts with p53.
A, immunoprecipitations of 35S-labeled CSML-0
and CSML-100 cell lysates with anti-Mts1 and anti-p53 antibodies. Cell
lysates were prepared using Nonidet P-40-containing buffer and
precipitated with anti-p53 monoclonal antibody pAb421, polyclonal
affinity-purified anti-Mts1 rabbit serum, and control serum.
Proteins in the precipitates were separated in gradient PAGE (4-20%)
and analyzed by autoradiography. B, pull-down of recombinant
Mts1 protein by recombinant p53 (product 1) and its domain peptides
(products 2-4). p53 proteins were mixed with recombinant Mts1 and
immunoprecipitated with control serum (control) and anti-p53
antibodies (Ab): pAb421 (#1), pE19
(#2), pAb240 (#3), and pAb421 (#4).
Immunoprecipitated proteins were separated by PAGE, and Western blot
was immunoprobed with anti-Mts1 antibody. Co-immunoprecipitation of
Mts1 with p53 was observed with full-length p53 (#1) and its
C-terminal domain (#4), but not with DNA-binding domain
(#3) and N-terminal domain (#2). C,
blot overlay (far Western) of recombinant p53 and its peptides with the
Mts1 protein. Full-length p53 (#1, lane
1), p53 domain peptides (#2, #3, and
#4, lanes 2, 3,
4), and recombinant fragment of MHC (lane
5) were separated in SDS-PAGE, transferred on the membrane,
and incubated with recombinant Mts1. Mts1 bound to proteins was
visualized by immunostaining with anti-Mts1 antibodies. On the parallel
gel, the same amounts of the recombinant proteins were loaded and
stained by Commassie Blue. D, binding of Mts1 with GST-p53
fusion proteins. GST-wt-p53, GST-p53 30 (deletion of aa 364-393) and
GST proteins were bound to glutathione-Sepharose beads and incubated
with recombinant Mts1 protein. Mts1 linked to protein beads was
recovered and analyzed by PAGE and Western blotting with anti-Mts1
antibodies.
|
|
To identify the region of p53 that interacts with Mts1, recombinant p53
peptides corresponding to the N-terminal (product 2) aa 1-106, the
core (product 3) aa 104-288, and the C-terminal (product 4) aa
289-390 of murine p53 were obtained. Full-length p53 (product 1) and
the domain peptides were incubated with recombinant Mts1 protein and
precipitated with anti-p53 antibodies followed by Western blot analysis
using anti-Mts1 antibodies. As shown in Fig. 4B, only
full-length p53 and the C-terminal domain are able to interact with Mts1.
Far Western blot analysis was used to further characterize the
interaction between Mts1 and p53. Full-length p53 and its functional domains immobilized on a membrane were incubated with recombinant Mts1
in conditions permitting an interaction between the proteins. Mts1
bound to p53 was detected using anti-Mts1 antibodies. The data shown in
Fig. 4C indicate that Mts1 physically interacts with
full-length p53 and the C-terminal domain of p53 (lanes
1 and 4). As a positive control, we used a
recombinant fragment of nonmuscle myosin, which is known to be an Mts1
target (Fig. 4C, lane 5). A Coomassie
Blue-stained gel, run in parallel, was used to verify the quantities of
the proteins.
For more precise mapping of the Mts1 binding site on the C-terminal
domain of p53, full-length GST-wt-p53 and GST-p53 30, lacking the
last 30 C-terminal residues, were used. The p53 fusion proteins as well
as the GST protein alone were incubated with recombinant Mts1. The
complexes were immobilized on glutathione-Sepharose 4B beads. The Mts1
protein bound to p53 was analyzed by SDS-PAGE followed by Western blot
analysis using anti-Mts1 antibodies. The data shown in Fig.
4D demonstrate that Mts1 binds to GST-p53 30 with much
lower efficiency than to full-length p53. This indicates the importance
of residues 364-393 of the C-terminal domain for the p53-Mts1 interaction.
Thus, our results taken together demonstrate a direct interaction
between Mts1 and the C-terminal domain of p53.
The Mts1 Protein Inhibits Phosphorylation of p53 by PKC--
We
showed previously that Mts1 interacts with MHC and inhibits the
phosphorylation of myosin by PKC (7). Since the Mts1-binding site of
p53 harbors both PKC and CKII phosphorylation sites, we investigated
whether Mts1 affects p53 phosphorylation. Recombinant full-length p53
(product 1) and its domain peptides (products 2-4) were phosphorylated
by PKC in the absence or presence of recombinant Mts1 and analyzed by
SDS-PAGE. The data obtained in three independent experiments indicate a
reliable 37% (S.D. ± 2.6%) inhibition of the PKC-mediated
phosphorylation of full-length p53 protein and 56% (S.D. ± 8.1%) of
its C-terminal fragment by Mts1 (Fig.
5A). Since Mts1 did not affect
the phosphorylation of the N-terminal and DNA-binding domains of p53 as
well as PKC autophosphorylation at the same conditions, we
exclude the possibility that the recombinant Mts1 protein acts as a
competitive substrate. Interestingly, no inhibition/activation of
CKII-mediated phosphorylation of full-length p53 or the C-terminal
domain was observed in the presence of Mts1 (Fig. 5B).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
Influence of Mts1 on phosphorylation of p53
and its domains in vitro. Phosphorylation by PKC.
#1, wt-p53 was phosphorylated in the absence and presence of
recombinant Mts1. #2, #3, and #4,
phosphorylation of p53 peptides (N-terminal, DNA-binding, and
C-terminal, respectively) at increasing concentrations of the Mts1
protein. Influence on PKC phosphorylation was observed with number 1 and 4 p53 proteins but not with numbers 2 and 3. B,
phosphorylation by CKII. Number 1 and 4 p53 proteins were
phosphorylated in the absence and presence of the recombinant Mts1. No
influence on CKII phosphorylation was detected.
Arrowheads, positions of the p53-derived
polypeptides.
|
|
In conclusion, our results revealed that Mts1 specifically inhibits the
phosphorylation of the C-terminal domain of p53 by PKC in
vitro.
Modulation of p53 DNA Binding Activity by Mts1--
To assess the
functional significance of the Mts1-p53 interaction, we investigated
whether Mts1 affects the DNA binding activity of p53 in EMSA. The data
obtained in experiments using the p53-binding site from the p21/WAF
promoter and nuclear extracts from CSML-0 cells are shown in Fig.
6. The presence of p53 in the complex was
proven by a supershift of the complex by anti-p53 antibody pAb421
(lane 4), and the specificity of DNA binding was
shown in competition experiments (lanes 2,
3, and 8). Incubation of nuclear extracts
containing wt-p53 with the recombinant Mts1 protein prior to the
addition of the labeled oligonucleotide decreased DNA binding activity
of p53 (lanes 5 and 6). The inhibition
was less prominent when Mts1 was added after the formation of p53-DNA complex (data not shown). This indicates that preformed Mts1-p53 complexes had a lower capacity to bind DNA. The influence of Mts1 on
p53-DNA binding capacity is strongly
Ca2+-dependent. The addition of EGTA to the
reaction mixture completely abolished the effect of Mts1 on p53-DNA
complex formation (lane 11), whereas in the
presence of 0.5 mM Ca2+ Mts1 almost completely
prevented binding of p53 with p21/WAF DNA (lanes
12 and 13). Data obtained show that Mts1 does not
influence Oct-DNA complex formation (lanes 14 and
15). These experiments demonstrate that Mts1 is able to
modulate the DNA binding capacity of p53.

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 6.
Influence of Mts1 on p53 DNA binding
activity. Nuclear extracts from CSML-0 and p53-binding element
from the p21/WAF promoter were used. A specificity of the p53-DNA
complex is proven using specific and nonspecific competitors
(lanes 2 and 3) and band supershift
with anti-p53 pAb421 antibody (lane 4). 0.5-1
µg of the recombinant Mts1 protein was added to the DNA-binding
reactions with specific oligonucleotide at 50 µM
Ca2+ (lanes 5 and 6) and
0.5-1 mM Ca2+ (lanes 12 and 13). 1 µg of wt-Mts1 was added to the control
oligonucleotide (Oct-1) (lane 15). The addition
of EGTA completely abolishes the Mts1 effect on p53-DNA binding
(lane 11).
|
|
Mts1 Affects p53-dependent Transcription--
The
results presented above suggest that Mts1 might be involved in the
modulation of p53-regulated gene expression. To test this idea, we
investigated the effect of Mts1 on the activity of p53 in
vivo. Mts1 expression vector was co-transfected along with a
luciferase reporter placed under the control of the synthetic p53-responsive elements from either p21/WAF (p21-luc) or Bax (Bax-luc) genes. Two different Mts1-negative cell lines, CSML-0 and VMR-liv, were
used in these experiments. The pCMV- -gal plasmid was co-transfected for evaluation of the transfection efficiency. The results of several
independent experiments are summarized in Fig.
7. In both cell lines, expression of Mts1
resulted in the inhibition of p21-luciferase activity, 60% in CSML-0
and 42% in VMR-liv. On the contrary, a slight (27-30%) increase of
Bax-luc reporter transactivation was observed in both cell lines. No
reporter gene expression was detected in p53-null Saos-2 cells,
confirming p53 dependence of both p21-luc and Bax-luc expression (data
not shown). Thus, Mts1 affects p53-mediated transcriptional activation
in vivo. Interestingly, the effect of Mts1, inhibition or
activation, depends on the particular response element.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Influence of Mts1 on transactivation of
p21/WAF- and Bax-luciferase reporter. CSML-0 and VMR-liv cells
were transfected with p21-luc and Bax-luc constructs either alone or
with Mts1 expression constructs. After 24 h, cells were harvested,
and luciferase activity was tested. pCMV- -gal plasmid was
co-transfected to evaluate the efficiency of transfection. Values shown
represent mean ± S.D. of three (p21-luc) and two (Bax-luc)
separate experiments.
|
|
Mts1 Modulates the Expression of p53-regulated Genes--
Next we
examined whether Mts1 can modify the expression of endogenous
p53-responsive genes. After induction of Mts1 expression by doxycyline
in CSML-0/tet/mts1 clone 13L, total RNA was
isolated from cells grown at low or high densities at different time
points. The data shown in Fig. 8 indicate
that Mts1 induction in CSML-0 cells differentially influenced
p53-dependent gene expression. Expression of p21/WAF was
suppressed 25-30% 24-48 h after Mts1 induction, in both sparse and
dense cultures. In contrast, expression of the proapoptotic gene
bax was activated 1.5-fold by Mts1 in the sparse culture and
more than 3-fold in the dense culture. The effect of Mts1 on cyclin G1
expression was minimal in both conditions. Modulation of the expression
of THBS1 by Mts1 was remarkable and strongly dependent on the cell
growth conditions. In sparse cultures, the induction of Mts1 led to
1.3-fold up-regulation of THBS1 transcription, whereas in dense
cultures Mts1 significantly (more than 65%) down-regulated THBS1
expression. The effect of Mts1 on mdm-2 transcription was
also dependent on the cell density. 72 h after induction of Mts1,
significant activation of Mdm-2 expression was observed in sparse
cultures, whereas in dense cultures the effect of Mts1 was weaker.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 8.
Influence of Mts1 on the transcription of
p53-regulated genes. Mts1-tet-inducible 13L CSML-0
clone was grown at low and high densities. Mts1 was induced by adding 2 µg/ml of doxycycline. Total RNAs were isolated at various time
periods after induction, and Northern blot analysis using p53-regulated
gene probes was performed sequentially with the same filter. To
normalize the amount of poly(A+) RNA on the membranes,
hybridization with labeled poly(U) was performed. To quantify the
intensities of bands and lanes, as in the case of poly(U), membranes
were scanned using a Molecular Dynamics computing densitometer with
ImageQuant software. Values showed represented means ± S.D. of
four (p21/WAF, THBS, and Bax) and two (cyclin G and Mdm-2) separate
experiments.
|
|
Thus, our results show that Mts1 is able to modulate the expression of
several p53-regulated genes. The effect of Mts1 was dependent on the
particular gene and cell growth conditions.
 |
DISCUSSION |
In the present study, we demonstrate a functional interaction
between the small Ca2+-binding protein Mts1/S100A4 and p53
tumor suppressor protein and characterize the biological significance
of this interaction.
It was initially observed that transfection of Mts1-negative tumor
cells with mts1 expression constructs results in intensive clonal death. Since co-transfection of the antiapoptotic gene bcl-2 was able to rescue the clones, we suggested that Mts1
induces cell death by apoptosis within 24-48 h after transfection.
Moreover, a direct cooperation of Mts1 and wt-p53 in the cell death was demonstrated by transfection of p53 expression constructs into Mts1-inducible cell lines. The data obtained demonstrate that the level
of p53-dependent apoptosis significantly increases upon Mts1 induction. These findings suggest that Mts1 and p53 cooperate in
the promotion of apoptosis.
Analysis of 26 tumor-derived cell lines revealed a significant reverse
correlation between the expression of wild type p53 and Mts1. This fact
may explain our observation that Mts1 promotes p53-induced apoptosis.
More likely, there is a selection against wt-p53 in Mts-1-expressing
tumor cells in vivo. Indeed, a trend for more p53-positive
human breast carcinomas to be positive for Mts1 compared with
p53-negative ones in immunohistological studies was demonstrated (18,
19). Although the status of p53 in these tumor samples was not tested
directly, the positive immunohistostaining indicates that p53 is
probably mutated, since the level of wt-p53 in most cells and tissues
is at or below the level of detection in paraffin-imbedded samples.
Although the association between p53 overexpression and the presence of
Mts1 in the above mentioned studies is not so striking compared with
our data, it nevertheless points to a similar conclusion.
The co-existence of wt-p53 and Mts1 in immortalized fibroblasts may be
explained by conformational transformation of p53, since it was
observed in the 10T1/2 cell line (16). The co-expression of Mts1
and elevated level of wt-p53 were shown in a dexamethasone-inducible clone of B16 melanoma cell line transfected with MMTV-mts1
(20). We assume that there may be more than one interpretation of these data. This could be due to functional inactivation of p53 by
glucocoticoid receptor, since it was shown that glucocoticoid receptor
forms a complex with p53 in vivo, resulting in cytoplasmic
sequestration of both p53 and glucocoticoid receptor (21).
Alternatively, dexamethasone-mediated pleiotrophic effect on gene
regulation, cell cycle, apoptosis, etc. in glucocoticoid
receptor-positive cells might neutralize p53/Mts1 cooperation.
The most prominent biological effects elicited by p53 as a
transcriptional activator are cell cycle arrest and apoptosis in response to diverse types of stress (22). A number of proteins that
interact with p53 and modulate its functional activity by covalent and
noncovalent modifications have been identified (8, 9). The C-terminal
basic domain of p53 was shown to negatively regulate the specific DNA
binding activity of the protein (9). Modulators of p53, which bind or
modify this region, dramatically affect the activity of the protein.
Interaction with the C-terminus-specific antibody pAb421 and
single-stranded RNA and DNA (23) and deletion of this regulatory domain
(24) abolish the negative regulatory role of the C terminus, thus
activating p53 (9). Additionally, phosphorylation of Ser392
by CKII or Ser371, Ser376, and
Ser378 by PKC results in protein activation (25).
Therefore, it is logical that Mts1, which, according to our data,
interacts with the C-terminal regulatory domain, is able to modulate
p53 activity.
Using several approaches, we have demonstrated a physical interaction
between p53 and Mts1. The Mts1-binding site is localized in the C
terminus of the p53 molecule, including aa 364-393. The interaction of
Mts1 with p53 results in inhibition of p53 phosphorylation by PKC but
not by CKII. Moreover, binding of Mts1 to p53 leads to the inhibition
of the complex formation between p53 and a p53-specific consensus
oligonucleotide derived from the p21/WAF promoter. The interaction of
p53 with another member of the S100 family, S100B, was shown
previously. S100B physically interacts with the C-terminal domain of
p53, inhibits its phosphorylation by PKC, and influences p53
oligomerization and biological activity (26). However, a direct
influence on the p53 transactivation activity is demonstrated only for
Mts1 so far. Recently, it was shown using NMR spectroscopy that a
peptide from the C-terminal domain of p53 (aa 367-388) does not have a
regular structure in its native form. Binding of S100B in the presence
of Ca2+ leads to conformational alterations of the
p53-derived peptide. The three-dimensional structure of the complex
reveals several hydrophobic and electrostatic interactions between
S100B and p53, which result in a sterical block by S100B of the
phosphorylation and acetylation sites of p53 (27). Such modifications
can in turn alter the transcriptional activation capacity of p53
(induction and repression). It is conceivable that Mts1, similarly to
S100B, can induce conformational changes in p53. However, this issue requires further elucidation.
Here we demonstrate that, via interaction with p53, Mts1 differentially
modulates the transactivation function of p53. Interestingly, the
effect of Mts1 on p53 is dependent on the particular target gene and
cellular environment. For instance, Mts1 inhibits the DNA binding
capacity of p53 to the p53-responsive element from the p21/WAF promoter
in vitro. In accordance with that, the expression of Mts1
in vivo down-regulates luciferase activity driven by the same p53-binding sequence. In contrast, more than 3-fold activation of
the proapoptotic bax gene expression occurs within
24-48 h following Mts1 induction. Presumably, cooperation between p53 and Mts-1 in apoptosis induction observed in our experiments is at
least partially due to the up-regulation of bax gene expression.
In the reporter gene assay, the presence of Mts1 stimulates luciferase
activity driven by the p53-responsive element from the bax
promoter only slightly. The disparity between the extent of RNA
up-regulation and reporter gene transactivation is probably due to a
requirement for additional regulatory elements present in the
full-length bax gene promoter.
An interesting pattern of gene expression was observed for THBS1,
another p53 target. The THBS1 gene is known to repress tumor progression, since it is an inhibitor of angiogenesis. Repression of
THBS1 promotes tumor vascularization, increasing the metastatic potential of tumor cells (28). We showed that Mts-1 strongly down-regulates THBS1 gene expression in dense cultures. This suggests that Mts1 might prevent the anti-angiogenic function of THBS1 in
vivo. These results are in line with our observation that Mts1 is
able to promote angiogenesis in vivo and in
vitro.2 However, in
sparse cultures, Mts1 up-regulated THBS1 gene expression. This might
indicate that the activity of Mts1 depends on the proliferation state
of cells and cellular environment. Since the conditions inside the
tumor rather resemble dense cultures, our results point to the
possibility that down-regulation of THBS1 by Mts1 might play an
important role in tumor angiogenesis.
The functional performance of the Mts1 and mutant p53 interaction in
tumor cells is a matter of great interest, since this combination is
widely represented in malignant tumor cells, as we have demonstrated.
An inverse, oncogenic function is shown for several "gain of
function" p53 mutants (29, 30). Some p53 mutants have oncogenic
properties due to the ability of these mutants to regulate the
expression of a new set of genes such as c-myc (31),
EGFR, PCNA, MDR-1 (32), and
BAG-1 (33). The requirement of the C-terminal domain
for the "gain of function" by p53 tumor-derived mutants was
demonstrated (31, 32). Since we show that Mts1 binds to the C-terminal
regulatory region of p53, there is an intriguing possibility that Mts1
can also modulate the activity of mutant p53 proteins. We propose that
Mts1 interacting with wild type p53 and stimulating apoptosis at early
stages of tumor development may contribute to the selection of the
malignant phenotype. At later stages, the Mts1 protein may be involved
in the regulation of gain of function mutant p53 molecules and
via modulation of the gene expression fulfill its "prometastatic" role and further advance tumor progression. Further studies elucidating the role of Mts1 in modulating the function of mutant p53 by C-terminal interaction might help to understand a mechanism of oncogenic potential
of mutant p53.
 |
ACKNOWLEDGEMENTS |
We thank Dr. J. Bartek for providing
hybridomas and cell lines and Dr. J. Lukas, Dr. J. Skouv, and Dr. M. Jäättelä for the plasmids.
 |
FOOTNOTES |
*
This study was supported by Grants from the Danish Cancer
Society, INTAS, Novo Nordisc Foundation, Dansk Kræftforsknings
Fond, and Danish Medical Research Council.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 45-35-25-73-13;
Fax: 45-35-25-77-21; E-mail: mg@cancer.dk.
§
Present address: Dept. of Biosciences at Novum, Karolinska
Institutet SE-141 57 Huddinge, Sweden.
¶
Present address: Dana Faber Cancer Institute and Harvard
Medical School, 44 Binney St., Boston, MA 02115.
Published, JBC Papers in Press, March 5, 2001, DOI 10.1074/jbc.M010231200
2
Ambartsumian, N., Klingelhofer, J., Grigorian,
M., Christensen, C., Kriajevska, M., Tulchinsky, E., Georgiev,
G., Berezin, V., Bock, E., Rygaard, J., Cao, R., Cao, Y., and
Lukanidin, E., (2001) Oncogene, in press.
 |
ABBREVIATIONS |
The abbreviations used are:
MHC, heavy chain of
nonmuscle myosin;
CKII, casein kinase II;
EMSA, electrophoretic
mobility shift assay;
GST, glutathione S-transferase;
PBS, phosphate-buffered saline;
PAGE, polyacrylamide gel electrophoresis;
PKC, protein kinase C;
THBS1, thrombospondin-1;
wt-p53, wild type p53;
mt-p53, mutant p53;
DAPI, 4',6-diamidino-2-phenylindole.
 |
REFERENCES |
| 1.
|
Ebralidze, A.,
Tulchinsky, E.,
Grigorian, M.,
Afanasyeva, A.,
Senin, V.,
Revazova, E.,
and Lukanidin, E.
(1989)
Genes Dev.
3,
10886-10893
|
| 2.
|
Lukanidin, E.,
and Georgiev, G. P.
(1996)
Curr. Top. Microbiol. Immunol.
213,
171-195
|
| 3.
|
Zimmer, D. B.,
Cornwall, E. H.,
Landar, A.,
and Song, W.
(1995)
Brain Res. Bull.
37,
417-429
|
| 4.
|
Takenaga, K.,
Nakamura, Y.,
Sakiyama, S.,
Hasegawa, Y.,
Sato, K.,
and Endo, H.
(1994)
J. Cell Biol.
124,
757-768
|
| 5.
|
Watanabe, Y.,
Usada, N.,
Minami, H.,
Morita, T.,
Tsugane, S.-I.,
Ishikawa, R.,
Kohama, K.,
Tomida, Y.,
and Hikada, H.
(1993)
FEBS Lett.
324,
51-55
|
| 6.
|
Kriajevska, M. V.,
Cardenas, M. N.,
Grigorian, M. S.,
Ambartsumian, N. S.,
Georgiev, N. S.,
and Lukanidin, E. M.
(1994)
J. Biol. Chem.
269,
19679-19682
|
| 7.
|
Kriajevska, M.,
Tarabykina, S.,
Bronstein, I.,
Maitland, N.,
Lomonosov, M.,
Hansen, K.,
Georgiev, G.,
and Lukanidin, G.
(1998)
J. Biol. Chem.
273,
9852-9856
|
| 8.
|
Levine, A. J.
(1997)
Cell
88,
323-331
|
| 9.
|
Ko, L. J.,
and Prives, C.
(1996)
Genes Dev.
10,
1054-1072
|
| 10.
|
Jayaraman, L.,
and Prives, C.
(1999)
Cell. Mol. Life. Sci.
55,
76-87
|
| 11.
|
Hupp, T. R.
(1999)
Cell. Mol. Life Sci.
55,
88-95
|
| 12.
|
Selivanova, G.,
Iotsova, V.,
Kiseleva, E.,
Stroem, M.,
Balakin, G.,
Grafstroem, R. C.,
and Wiman, K.
(1996)
Nucleic Acids Res.
24,
3560-3567
|
| 13.
|
Kustikova, O.,
Kramerov, D.,
Grigorian, M.,
Berezin, V.,
Bock, E.,
Lukanidin, E.,
and Tulchinsky, E.
(1998)
Mol. Cell. Biol.
18,
7095-7105
|
| 14.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
|
| 15.
|
Grigorian, M.,
Ambartsumian, N.,
Lykkesfeldt, A. E.,
Bastholm, L.,
Elling, F.,
Georgiev, G.,
and Lukanidin, E.
(1996)
Int. J. Cancer
67,
831-841
|
| 16.
|
Coleman, W. B.,
Grisham, J. W.,
and Smith, G. J.
(1994)
Carcinogenesis
15,
145-152
|
| 17.
|
Kern, S. E.,
Pietenpol, J. A.,
Thiagalingam, S.,
Seymour, A.,
Kinzel, K. W.,
and Vogelstein, B.
(1992)
Science
256,
827-830
|
| 18.
|
Platt-Higgins, A. M.,
Renshaw, C.,
West, C. R.,
Winstanley, J. H. R.,
Rudland, S. S.,
Barraclough, R.,
and Rudland, P.
(2000)
Int. J. Cancer
89,
198-208
|
| 19.
|
Rudland, P. S.,
Platt-Higgins, A.,
Renshaw, C.,
West, C.,
Winstanley, J. H. R.,
Robertson, L.,
and Barraclough, R.
(2000)
Cancer Res.
60,
1595-1603
|
| 20.
|
Parker, C.,
Whittaker, R. B.,
Usmani, B. A.,
Lakshmi, M. S.,
and Sherbet, G. V.
(1994)
DNA Cell Biol.
13,
1021-1028
|
| 21.
|
Sengupta, S.,
Vonesch, J. L.,
Waltzinger, C.,
Zheng, H.,
and Wasylyk, B.
(2000)
EMBO J.
19,
6051-6064
|
| 22.
|
Oren, M.,
and Prives, C.
(1996)
Biochim. Biophys. Acta
1288,
R13-R19
|
| 23.
|
Mundt, M.,
Hupp, T.,
Fritsche, M.,
Merkle, C.,
Hansen, S.,
Lane, D.,
and Groner, B.
(1997)
Oncogene
15,
237-244
|
| 24.
|
Hupp, T. R.,
Meek, D. W.,
Midgley, C. A.,
and Lane, D. P.
(1992)
Cell
71,
875-886
|
| 25.
|
Hupp, T. R.,
and Lane, D. P.
(1994)
Cold Spring Harbor Symp. Quant. Biol.
59,
195-206
|
| 26.
|
Scotto, C.,
Delphin, C.,
Deloulme, J. C.,
and Baudier, J.
(1999)
Mol. Cell. Biol.
19,
7168-7180
|
| 27.
|
Rust, R. R.,
Baldisseri, D. M.,
and Weber, D. J.
(2000)
Nat. Struct. Biol.
7,
570-574
|
| 28.
|
Roberts, D. D.
(1996)
FASEB. J.
10,
183-191
|
| 29.
|
Olson, D. C.,
and Levine, A. J.
(1994)
Cell Growth Differ
5,
61-71
|
| 30.
|
Dittmer, D.,
Pati, S.,
Zambetti, G.,
Chu, S.,
Teresky, A. K.,
More, M.,
Finlay, C.,
and Levine, A. J.
(1993)
Nat. Genet.
4,
42-46
|
| 31.
|
Frazier, M. W.,
He, X.,
Wang, J.,
Gu, Z.,
Cleveland, J. L.,
and Zambetti, G. P.
(1998)
Mol. Cell. Biol.
18,
3735-3743
|
| 32.
|
Lanyi, A.,
Deb, D.,
Seymour, R. C.,
Ludes-Meyers, J. H.,
Subler, M. A.,
and Deb, S.
(1998)
Oncogene
16,
3169-3179
|
| 33.
|
Yang, X.,
Pater, A.,
and Tang, S-C.
(1999)
Oncogene
18,
4546-4553
|
| 34.
|
Katayose, D.,
Gudas, J.,
Nguyen, H.,
Srivastava, S.,
Cowan, K. H.,
and Seth, P.
(1995)
Clin. Cancer Res.
1,
889-897
|
| 35.
|
Nigro, J. M.,
Baker, S. J.,
Preisinger, A. C.,
Jessup, J. M.,
Hostetter, R. K.,
Cleary, S. H.,
Bigner, S. H.,
Davidson, N.,
Baylin, S.,
Devilee, P.,
Glover, T.,
Collins, F. S.,
Weston, A.,
Modali, R.,
Harris, C. C.,
and Vogelstein, B.
(1989)
Nature
342,
705-708
|
| 36.
|
Kovach, J. S.,
McGovern, R. M.,
Cassady, J. D.,
Swanson, S. K.,
Wold, L. E.,
Vogelstein, B.,
and Sommer, S. S.
(1991)
J. Natl. Cancer Inst.
83,
1004-1009
|
| 37.
|
Elstner, E.,
Linker-Israeli, M.,
Said, J.,
Umel, T.,
de Vos, S.,
Shintaku, I. P.,
Heber, D.,
Binderup, L.,
Uskokovic, M.,
and Koeffler, H. P.
(1995)
Cancer Res.
55,
2822-2830
|
| 38.
|
Wang, N. P.,
To, H.,
Lee, W. H.,
and Lee, E. Y.
(1993)
Oncogene
8,
279-288
|
| 39.
|
Selivanova, G.,
Iotsova, V.,
Okan, I.,
Fritsche, M.,
Stroem, M.,
Groner, B.,
Grafstroem, R. C.,
and Wiman, K. G.
(1997)
Nat. Med.
3,
632-638
|
| 40.
|
Romano, J. W.,
Ehrhart, J. C.,
Duthu, A.,
Kim, C. M.,
Appella, E.,
and May, P.
(1989)
Oncogene
4,
1483-1488
|
| 41.
|
Casey, G.,
Lo-Hsueh, M.,
Lopez, M. E.,
Vogelstein, B.,
and Stanbridge, E. J.
(1991)
Oncogene
6,
1791-1797
|
| 42.
|
Gartel, A. L.,
Serfas, M. S.,
Gartel, M.,
Goufman, E.,
Wu, G. S.,
el-Deiry, W. S.,
and Tyner, A. L.
(1996)
Exp. Cell Res.
227,
171-181
|
| 43.
|
Rodrigues, N. R.,
Roman, A.,
Smith, M. E.,
Kerr, I. B.,
Bodmer, W. F.,
Gannon, J. V.,
and Lane, D. P.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7555-7559
|
| 44.
|
Felix, C. A.,
Kappel, C. C.,
Mitsudomi, T.,
Nau, M. M.,
Tsokos, M.,
Crouch, G. D.,
Nisen, P. D.,
Winick, N. J.,
and Helman, L. J.
(1992)
Cancer Res.
52,
2243-2247
|
| 45.
|
Isaacs, W. B.,
Carter, B. S.,
and Ewing, C. M.
(1991)
Cancer Res.
51,
4716-4720
|
| 46.
|
Kimura, M.,
Tagawa, M.,
Takenaga, K.,
Yamaguchi, T.,
Saisho, H.,
Nakagawara, A.,
and Sakiyama, S.
(1997)
Anticancer Res.
17,
879-883
|
| 47.
|
Cheng, Y. T.,
Li, Y. L.,
Wu, J. D.,
Long, S. B.,
Tzai, T. S.,
Tzeng, C. C.,
and Lai, M. D.
(1995)
Mol. Carcinog.
13,
173-181
|
| 48.
|
Yaginuma, Y.,
and Westphal, H.
(1991)
Cancer Res.
51,
6506-6509
|
| 49.
|
O'Connell, K. A.,
and Edidin, M.
(1990)
J. Immunol.
144,
521-525
|
| 50.
|
Wang, H.,
Mohammad, R. M.,
Werdell, J.,
and Shekhar, P. V. M.
(1998)
Int. J. Mol. Med.
1,
915-923
|
| 51.
|
Wadhwa, R.,
Takano, S.,
Robert, M.,
Yoshida, A.,
Nomura, H.,
Reddel, R. R.,
Mitsui, Y.,
and Kaul, S. C.
(1998)
J. Biol. Chem.
273,
29586-29591
|
| 52.
|
Hayashi, S.,
Kano, E.,
Matsumoto, H.,
Hatashita, M.,
Ohtsubo, T.,
Nishida, T.,
Shioura, H.,
and Kitai, R.
(1999)
J. Exp. Clin. Cancer Res.
18,
181-189
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. TSUNA, S.-I. KAGEYAMA, J. FUKUOKA, H. KITANO, Y. DOKI, H. TEZUKA, and H. YASUDA
Significance of S100A4 as a Prognostic Marker of Lung Squamous Cell Carcinoma
Anticancer Res,
July 1, 2009;
29(7):
2547 - 2554.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. van Dieck, M. R. Fernandez-Fernandez, D. B. Veprintsev, and A. R. Fersht
Modulation of the Oligomerization State of p53 by Differential Binding of Proteins of the S100 Family to p53 Monomers and Tetramers
J. Biol. Chem.,
May 15, 2009;
284(20):
13804 - 13811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Chen, D. Yu, A. Luo, W. Tan, C. Zhang, D. Zhao, M. Yang, J. Liu, D. Lin, and Z. Liu
Functional Role of S100A14 Genetic Variants and Their Association with Esophageal Squamous Cell Carcinoma
Cancer Res.,
April 15, 2009;
69(8):
3451 - 3457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. M. Ismail, D. G. Fernig, P. S. Rudland, C. J. Terry, G. Wang, and R. Barraclough
The basic C-terminal amino acids of calcium-binding protein S100A4 promote metastasis
Carcinogenesis,
December 1, 2008;
29(12):
2259 - 2266.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L Oslejskova, M Grigorian, S Gay, M Neidhart, and L Senolt
The metastasis associated protein S100A4: a potential novel link to inflammation and consequent aggressive behaviour of rheumatoid arthritis synovial fibroblasts
Ann Rheum Dis,
November 1, 2008;
67(11):
1499 - 1504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Tsoporis, S. Izhar, and T. G. Parker
Expression of S100A6 in Cardiac Myocytes Limits Apoptosis Induced by Tumor Necrosis Factor-{alpha}
J. Biol. Chem.,
October 31, 2008;
283(44):
30174 - 30183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Schneider, S. Kostin, C. C. Strom, M. Aplin, S. Lyngbaek, J. Theilade, M. Grigorian, C. B. Andersen, E. Lukanidin, J. Lerche Hansen, et al.
S100A4 is upregulated in injured myocardium and promotes growth and survival of cardiac myocytes
Cardiovasc Res,
July 1, 2007;
75(1):
40 - 50.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-H. Li and A. R. Bresnick
The S100A4 Metastasis Factor Regulates Cellular Motility via a Direct Interaction with Myosin-IIA.
Cancer Res.,
May 15, 2006;
66(10):
5173 - 5180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Luo, L. Ding, and N. Chegini
CCNs, fibulin-1C and S100A4 expression in leiomyoma and myometrium: inverse association with TGF-{beta} and regulation by TGF-{beta} in leiomyoma and myometrial smooth muscle cells
Mol. Hum. Reprod.,
April 1, 2006;
12(4):
245 - 256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. C. Garrett, K. M. Varney, D. J. Weber, and A. R. Bresnick
S100A4, a Mediator of Metastasis
J. Biol. Chem.,
January 13, 2006;
281(2):
677 - 680.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Tajeddine, J.-L. Gala, M. Louis, M. Van Schoor, B. Tombal, and P. Gailly
Tumor-Associated Antigen Preferentially Expressed Antigen of Melanoma (PRAME) Induces Caspase-Independent Cell Death In vitro and Reduces Tumorigenicity In vivo
Cancer Res.,
August 15, 2005;
65(16):
7348 - 7355.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Mueller, B. W. Schafer, S. Ferrari, M. Weibel, M. Makek, M. Hochli, and C. W. Heizmann
The Calcium-binding Protein S100A2 Interacts with p53 and Modulates Its Transcriptional Activity
J. Biol. Chem.,
August 12, 2005;
280(32):
29186 - 29193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Semov, M. J. Moreno, A. Onichtchenko, A. Abulrob, M. Ball, I. Ekiel, G. Pietrzynski, D. Stanimirovic, and V. Alakhov
Metastasis-associated Protein S100A4 Induces Angiogenesis through Interaction with Annexin II and Accelerated Plasmin Formation
J. Biol. Chem.,
May 27, 2005;
280(21):
20833 - 20841.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Grum-Schwensen, J. Klingelhofer, C. H. Berg, C. El-Naaman, M. Grigorian, E. Lukanidin, and N. Ambartsumian
Suppression of Tumor Development and Metastasis Formation in Mice Lacking the S100A4(mts1) Gene
Cancer Res.,
May 1, 2005;
65(9):
3772 - 3780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. R. Fernandez-Fernandez, D. B. Veprintsev, and A. R. Fersht
Proteins of the S100 family regulate the oligomerization of p53 tumor suppressor
PNAS,
March 29, 2005;
102(13):
4735 - 4740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lin, Q. Yang, Z. Yan, J. Markowitz, P. T. Wilder, F. Carrier, and D. J. Weber
Inhibiting S100B Restores p53 Levels in Primary Malignant Melanoma Cancer Cells
J. Biol. Chem.,
August 6, 2004;
279(32):
34071 - 34077.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Schmidt-Hansen, J. Klingelhofer, B. Grum-Schwensen, A. Christensen, S. Andresen, C. Kruse, T. Hansen, N. Ambartsumian, E. Lukanidin, and M. Grigorian
Functional Significance of Metastasis-inducing S100A4(Mts1) in Tumor-Stroma Interplay
J. Biol. Chem.,
June 4, 2004;
279(23):
24498 - 24504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Greenway, R. J. van Suylen, G. Du Marchie Sarvaas, E. Kwan, N. Ambartsumian, E. Lukanidin, and M. Rabinovitch
S100A4/Mts1 Produces Murine Pulmonary Artery Changes Resembling Plexogenic Arteriopathy and Is Increased in Human Plexogenic Arteriopathy
Am. J. Pathol.,
January 1, 2004;
164(1):
253 - 262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-W. Zhang, Y. Su, O. V. Volpert, and G. F. V. Woude
Hepatocyte growth factor/scatter factor mediates angiogenesis through positive VEGF and negative thrombospondin 1 regulation
PNAS,
October 28, 2003;
100(22):
12718 - 12723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. G. Ryan, L. Taliana, L. Sun, Z.-G. Wei, S. K. Masur, and R. M. Lavker
Involvement of S100A4 in Stromal Fibroblasts of the Regenerating Cornea
Invest. Ophthalmol. Vis. Sci.,
October 1, 2003;
44(10):
4255 - 4262.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Kim and D. M. Helfman
Characterization of the Metastasis-associated Protein, S100A4: ROLES OF CALCIUM BINDING AND DIMERIZATION IN CELLULAR LOCALIZATION AND INTERACTION WITH MYOSIN
J. Biol. Chem.,
August 8, 2003;
278(32):
30063 - 30073.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Xue, D. Plieth, C. Venkov, C. Xu, and E. G. Neilson
The Gatekeeper Effect of Epithelial-Mesenchymal Transition Regulates the Frequency of Breast Cancer Metastasis
Cancer Res.,
June 15, 2003;
63(12):
3386 - 3394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. S. Daoud, P. J. Munson, W. Reinhold, L. Young, V. V. Prabhu, Q. Yu, J. LaRose, K. W. Kohn, J. N. Weinstein, and Y. Pommier
Impact of p53 Knockout and Topotecan Treatment on Gene Expression Profiles in Human Colon Carcinoma Cells: A Pharmacogenomic Study
Cancer Res.,
June 1, 2003;
63(11):
2782 - 2793.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C L Li, V Martinez, B He, A Lombet, and B Perbal
A role for CCN3 (NOV) in calcium signalling
Mol. Pathol.,
August 1, 2002;
55(4):
250 - 261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Endo, K. Takenaga, T. Kanno, H. Satoh, and S. Mori
Methionine Aminopeptidase 2 Is a New Target for the Metastasis-associated Protein, S100A4
J. Biol. Chem.,
July 12, 2002;
277(29):
26396 - 26402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-i. Watanabe, T. Ozaki, T. Nakagawa, K. Miyazaki, M. Takahashi, M. Hosoda, S. Hayashi, S. Todo, and A. Nakagawara
Physical Interaction of p73 with c-Myc and MM1, a c-Myc-binding Protein, and Modulation of the p73 Function
J. Biol. Chem.,
April 19, 2002;
277(17):
15113 - 15123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Yan, H. Wang, and D. D. Boyd
ATF3 Represses 72-kDa Type IV Collagenase (MMP-2) Expression by Antagonizing p53-dependent trans-Activation of the Collagenase Promoter
J. Biol. Chem.,
March 22, 2002;
277(13):
10804 - 10812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kriajevska, M. Fischer-Larsen, E. Moertz, O. Vorm, E. Tulchinsky, M. Grigorian, N. Ambartsumian, and E. Lukanidin
Liprin beta 1, a Member of the Family of LAR Transmembrane Tyrosine Phosphatase-interacting Proteins, Is a New Target for the Metastasis-associated Protein S100A4 (Mts1)
J. Biol. Chem.,
February 8, 2002;
277(7):
5229 - 5235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Mazzucchelli
Protein S100A4: Too Long Overlooked by Pathologists?
Am. J. Pathol.,
January 1, 2002;
160(1):
7 - 13.
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|