![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 25, 22788-22796, June 22, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Medical Biochemistry, University of Aarhus,
DK-8000, Aarhus C, Denmark
Received for publication, January 30, 2001, and in revised form, March 12, 2001
We previously isolated and sequenced the
~250-kDa type 1 receptor sorLA/LR11, a mosaic protein with elements
characterizing the Vps10p domain receptor family as well as the low
density lipoprotein receptor family. The N terminus of the Vps10p
domain comprises a consensus sequence for cleavage by furin
(50RRKR53) that precedes a truncation
found in sorLA isolated from human brain. Here we show that sorLA, like
sortilin-1/neurotensin receptor-3, whose lumenal domain consists of a
Vps10p domain only, is synthesized as a proreceptor that is cleaved by
furin in late Golgi compartments. We show that the truncation
conditions the Vps10p domain for propeptide inhibitable binding of
neuropeptides and the receptor-associated protein. We further
demonstrate that avid binding of the receptor-associated protein,
apolipoprotein E, and lipoprotein lipase not inhibited by propeptide
occurs to sites located in other lumenal domains. In transfected cells,
about 10% of full-length sorLA were expressed on the cell surface
capable of mediating endocytosis. However, the major pool of receptors
was found in late Golgi compartments, suggesting possible interaction
with newly synthesized ligands. The results show that sorLA, following
activation by truncation, binds multiple ligands and may mediate both
endocytosis and sorting.
A new, highly conserved type 1 receptor, termed sorLA/LR11, was
recently identified in man, rodents, chicken, and hydra (1-6). SorLA
is a mosaic protein that, based on its domain structure, may be
regarded as a member of both the vacuolar protein sorting 10 protein
(Vps10p)1 domain receptor
family and the low density lipoprotein receptor (LDLR) family. The
lumenal part of the ~250-kDa mammalian receptor (see Fig. 1)
comprises a domain with homology to the yeast sorting protein Vps10p
and the mammalian Vps10p domain receptors sortilin-1 (7) and sorCS (8),
a cluster of five F/YWTD/ SorLA is mainly expressed in the nervous system but is also found in
non-neuronal tissues such as testis, ovary, and lymph nodes (1-4).
In situ hybridization analysis of adult murine brain showed
sorLA transcripts in specific neuronal populations, including Purkinje
cells of cerebellum and neurons in hippocampal formations and cerebral
cortex (4, 5). Similar results were obtained by immunohistochemistry,
which also suggested a predominating intracellular localization (9). In
addition, sorLA is expressed in cell bodies and proximal axons of
cultured rat sympathetic neurons (10). SorLA expression is
developmentally regulated, and high transcript levels are found during
periods of active morphogenesis (4, 5). Interestingly, sorLA is
up-regulated during proliferation and down-regulated following
differentiation of neuroblastoma cells (11). Concerning non-neuronal
cells, recent results have shown low expression of sorLA in normal
rabbit aortas but a comparatively marked expression in the intimal
smooth muscle cells of aortas displaying atheromatous lesions in
rabbits fed with a high cholesterol diet (12). These observations
suggest that sorLA may play a role in developmental cellular
proliferation and in pathological events.
Little is known about the molecular function of sorLA. Until now, two
ligands have been identified qualitatively by blotting to
electrophoretically resolved sorLA. One is the 39-kDa
receptor-associated protein (RAP) used for affinity purification of
sorLA from brain extracts (1). RAP is an endoplasmatic reticulum
resident protein that binds to clusters of LA repeats in all members of
the LDL receptor family (for review, see Refs. 13 and 14) and to
sortilin-1 (7, 15). The other is rabbit We recently showed that sortilin-1 (~95 kDa), whose lumenal part
consists of a Vps10p domain only, is conditioned for binding of ligands
such as RAP, neurotensin, and lipoprotein lipase (LpL) by
furin-mediated cleavage and removal of the propeptide (15, 17). SorLA
purified from brain tissue is N-terminally truncated, and the preceding
sequence 50RRKR53 abides by the consensus for
cleavage by furin (1). It therefore seemed possible that sorLA, like
sortilin-1, is synthesized as a proreceptor and activated by truncation.
The aim of the present work was to analyze whether sorLA is activated
by cleavage, to characterize binding of candidate ligands, and to
establish whether the receptor is endocytosis-competent. We show by
analysis of wild type and mutated minireceptors secreted from
transfected Chinese hamster ovary (CHO) cells that sorLA is activated
by furin-mediated cleavage and removal of the propeptide. The truncated
Vps10p domain was purified by affinity chromatography, and ligand
binding to this domain was compared with binding to purified soluble
sortilin-1 (i.e. the Vps10p domain) and to purified soluble
sorLA comprising the entire lumenal part (L-sorLA). We show that the
Vps10p domain of sorLA, like that of sortilin-1, binds propeptides,
neuropeptides, and RAP, apparently to overlapping sites. In addition,
we show avid binding of RAP, apoE, and LpL to different domains in
L-sorLA, presumably to the LA repeat cluster. In cells transfected with
full-length sorLA, about 10% of the receptors were expressed on the
cell surface, capable of mediating endocytosis and degradation of bound
ligand, whereas most receptors were found in perinuclear compartments
colocalizing with the Golgi protein golgin-97.
Antibodies and Ligands--
Rabbit anti-Vps10p domain peptide
anti-serum was raised (Neosystem, Strasburg, France) against the
synthetic peptide Gly370-Arg388 and used for
initial detection of sorLA-(54-731). Purified Vps10p domain (see
below) was used to generate a rabbit anti-sorLA Vps10p domain antibody,
and purified propeptide (residues 1-53) was used to generate
anti-propeptide antibody (DAKO, Glostrup, Denmark). To produce rabbit
antibodies against the LA repeat cluster for Western blotting of
full-length sorLA, the segment
(Val1044-Asn1532) was expressed in
Escherichia coli as a thioredoxin fusion protein and
partially purified by heat treatment as described for the LA repeats of
the LDL receptor (18). The Ig fractions were purified from rabbit serum
using protein A-Sepharose and kept at a stock concentration of ~5
mg/ml.
Recombinant RAP and GST-sortilin-1 propeptide, as well as the soluble
lumenal domain of sortilin-1 (i.e. the Vps10p domain), were
produced as described previously (15, 19). Coupling of peptides to
CNBr-activated Sepharose 4B (AP Biotech) followed instructions from the
manufacturer. The head activator purchased from Bachem (Heidelberg) was
monomerized by boiling 1 mM peptide in 0.1 M
HCl and neutralizing to pH 7.0 (20). Neurotensin was from Sigma, and
recombinant apoE, isoform 3, was from Calbiochem. LpL purified from
bovine milk as active dimeric enzyme (~600 units/mg) was a generous
gift from Dr. G. Olivecrona (Umeå University, Umeå, Sweden)
(21).
Expression of SorLA Constructs--
The sorLA cDNA
(GenBankTM accession number U60975) was obtained from two
overlapping clones, both in pBluescript SK: one from a human brain
CHO-K1 cells were cultured in serum-free HyQ-CCM5 CHO medium (HyClone,
Logan, UT) and transfected using FuGENE 6 (Roche Molecular Biochemicals). Stable transfectants were selected in medium containing 500 µg/ml Zeocin (Invitrogen). Clones expressing minireceptor (wild
type or mutated), L-sorLA, full-length sorLA, or IL-2R/sorLA chimera
were identified by Western blotting of culture medium or cell lysates.
Expression of SorLA Propeptide--
The propeptide sequence was
amplified from sorLA cDNA using a 5' primer containing a
BamHI site and the propeptide N-terminal sequence
(5'-CTTGGATCCGAAGTCTGGACGCAGAGG) and a 3' primer containing a stop
codon and a XhoI site C-terminal to the furin cleavage site
(5'-GTTCTCGAGTCACCGTTTCCTCCGGAG). Amplification of the GC-rich stretch
was facilitated by 5% Me2SO in the PCR reaction (23). The
purified PCR product was digested with BamHI/XhoI
and cloned into the pGEX-4T-1 vector (AP Biotech). The construct was
expressed in bacterial strain BL21(DE3) and purified by affinity
chromatography on glutathione-Sepharose. The fusion product was cleaved
with thrombin (Sigma), and the propeptide was separated from GST and residual fusion product using Centricon-10 (Amicon, Beverly, MA) and
concentrated using Centricon-3.
Metabolic Labeling, Affinity Precipitation, and Analysis of
Glycosylation--
The procedures essentially followed those published
for analysis of sortilin-1 (15). In brief, transfected cells were
biolabeled for 3-5 h in modified Eagle's medium without cysteine and
methionine using 200 µCi/ml Pro-mix (Amersham Pharmacia Biotech) in
the absence or the presence of 15 µg/ml brefeldin A (Roche Molecular
Biochemicals). Labeled sorLA protein in cell lysates or medium was
immunoprecipitated using anti-sorLA Vps10p domain antibody and
GammaBind G beads (AP Biotech) or precipitated using Sepharose beads
coupled with RAP or GST-sorLA propeptide. For treatment with PNGase-F
(Roche Molecular Biochemicals), washed GammaBind beads with
antibody-bound sorLA protein were heated (3 min, 95 °C) in 10 µl
of 1% SDS, heated again after addition of 90 µl 20 mM
sodium phosphate, 10 mM EDTA, 10 mM sodium
azide, 0.5% Triton X-10, pH 7.2, and cooled before the addition of 0.5 unit PNGase-F. Alternatively, washed beads were suspended in 100 µl
of 50 mM sodium phosphate, 0.01% SDS, 1 M
mercaptoethanol, pH 5.5, containing 4 milliunits of endoglycosidase H
(Endo-H; Roche Molecular Biochemicals). The reactions were
stopped after incubation for 16 h at 30 °C followed by analysis
by PAGE and autoradiography. The cleavage of cellular sorLA-(1-731)
minireceptor by furin was performed as described previously for soluble
sortilin-1 (15).
Purification of SorLA-(54-731) Vps10p Domain Minireceptor and
L-sorLA-(54-2107)--
GST-sorLA propeptide (15 mg) was coupled to 3 ml of CNBr-activated Sepharose, poured onto a column, and washed. The
medium (90 ml) recovered from transfected cells was recirculated on the column for 16 h at 4 °C, the column was washed, and
minireceptor was eluted in phosphate-buffered saline, 10 mM
EDTA, pH 4.0, into tubes containing Tris base for adjustment to pH 7.4. Purified sorLA-(54-731) was concentrated using Centricon-30, and the
yield was about 1 mg/liter medium. Soluble sorLA-(54-2107) was
prepared similarly, except that immobilized RAP was used routinely as
an affinity matrix (1, 19).
Surface Plasmon Resonance Analysis--
All of the
measurements were performed on a BIAcore 2000 instrument (Biacore,
Uppsala, Sweden) equipped with CM5 sensor chips. The carboxylated
dextran matrix of the chip was activated as described (15), and
purified sorLA-(54-731) or sorLA-(54-2107) was immobilized to an
estimated density of ~60 fmol/mm2 (flow cell 1). Samples
for binding (40 µl) were injected at 5 µl/min at 4 °C in 10 mM Hepes, 150 mM NaCl, 1.5 mM
CaCl2, 1 mM EGTA, 0.005% Tween 20, pH 7.4. Binding was expressed in relative response units as the response
obtained from the flow cell with immobilized minireceptor minus the
response obtained using an activated but uncoupled chip (flow cell 2).
The chip was regenerated by injecting 20 µl of 10 mM
glycine, 20 mM EDTA, 500 mM NaCl, 0.005% Tween
20, pH 4.0. Kinetic parameters were determined using BIAevaluation 3.0 software. The amount of ligand bound/mol immobilized minireceptor was
estimated by dividing the ratio
RUligand/massligand by
RUminireceptor/massminireceptor.
Immunocytochemistry--
For confocal microscopy, cells
transfected with full-length sorLA or mock-transfected cells were
washed, fixed with 4% paraformaldehyde (15 min), washed in
Tris/balanced salt solution, and, when appropriate, permeabilized in
the same buffer with 0.5% Triton X-100 (10 min) followed by
incubations with primary and secondary antibodies. Primary antibodies
were rabbit anti-Vps10 Ig and anti-golgin-97 (Molecular Probes, Eugene
OR). Secondary antibodies were anti-rabbit Ig conjugated with Alexa 488 (Molecular probes) and Cy-5 (Zymed Laboratories Inc.,
San Francisco, CA), respectively. The microscopy was performed using a
Zeiss LSM-5 instrument.
Quantification of Cell Surface-expressed SorLA--
The cells
were washed in ice-cold phosphate-buffered saline, pH 8.0, and
incubated with 0.5 mg/ml membrane-impermeable reagent sulfo-N-hydroxysuccinimidobiotin (Pierce) for 90 min at
4 °C. After washes in buffer with 50 mM Tris to quench
unreacted reagent, the cells were lysed (10 min, 4 °C) in 1% Triton
X-100, 20 mM Tris, 10 mM EDTA, 150 mM NaCl, pH 8.0, with proteinase inhibitors, and the
biotinylated cell surface proteins were precipitated with streptavidin-coupled Sepharose 4B beads (Zymed Laboratories
Inc. Lab, CA). The fractions of streptavidin-bound and unbound
sorLA were detected by Western blotting using horseradish
peroxidase-conjugated swine anti-rabbit Ig (DAKO) as a secondary
antibody and ECL (Amersham Pharmacia Biotech). Quantification was
performed using a FUJIFILM LAS-1000 plus luminescence image analyzer.
SorLA-mediated Degradation of GST-propeptide--
GST-sorLA
propeptide was iodinated to about 0.2 mol 125I/mol protein
using chloramine-T as the oxidizing agent and separated from unreacted
iodine using Sephadex G25F. The tracer was at least 98% precipitable
in trichloroacetic acid. The cells were incubated at 37 °C in 250 µl of medium with ~10.000 cpm 125I-GST-sorLA
propeptide, and an increase in the acid-soluble fraction was taken as a
measure of degradation.
Internalization of IL-2R/sorLA Chimera--
Transfectants or
CHO-K1 control cells were incubated for 2 h at 4 °C with
125I-labeled antibody (3 × 104 cpm/ml)
directed against the lumenal IL-2R domain (anti-Tac, Roche). Following
washings in ice-cold buffer, the cells were reincubated in 37 °C
warm medium for 0-60 min. The incubations were stopped at various
times by the addition of ice-cold Tris-HCl buffer, pH 2.5. The
supernatant was recovered after 5 min, and the cells were lysed in 1 M NaOH. The radioactivity was determined in both fractions
and defined as cell surface-associated (i.e. acid-releasable) and internalized ligand, respectively.
SorLA Propeptide Is Removed by Furin-mediated Cleavage--
To
determine whether sorLA is subject to functional propeptide cleavage,
CHO cells were stably transfected with a construct, sorLA-(1-731),
comprising the putative propeptide, the Vps10p domain, and the first
seven residues of the adjacent YWTD repeat cluster (Fig.
1). The transfectants were biolabeled,
and newly synthesized minireceptor secreted into the medium or present
in cell lysates was immunoprecipitated. The relatively small product (compared with full-length sorLA) facilitated analysis of molecular sizes. Fig. 2A shows that
minireceptor obtained from the medium (lane 1) had a
slightly higher apparent molecular weight than the species in the cell
lysate (lane 3). To eliminate differences in size caused by
differential glycosylation, N-linked sugars were removed by
treatment with PNGase-F. After deglycosylation, the cellular form was
larger than the secreted form (lane 4 versus lane 2)
signifying cleavage of the minireceptor. This occurred within cells or
at the cell surface because labeled minireceptor isolated from cell
lysates remained uncleaved upon incubation in conditioned CHO cell
medium (not shown). After deglycosylation and treatment with furin,
minireceptor from cell lysates achieved the same size as the species in
the medium (lane 5 versus lane 2), suggesting that furin is
the responsible reagent. These results were confirmed in transfected
cells biolabeled in the presence of brefeldin A, which causes retention
of newly synthesized proteins in endoplasmatic reticulum (24). Thus,
treatment with brefeldin A blocked secretion of the minireceptor (not
shown), and following deglycosylation with PNGase-F, treatment with
furin caused a truncation of the minireceptor retained within the cells
(lane 8 versus lane 7).
Treatment with Endo-H was performed to clarify whether cleavage took
part in the distal part of the synthetic pathway. Fig. 2B
shows that the uncleaved cellular form was deglycosylated by Endo-H
(lane 4 versus lane 3), whereas the secreted and cleaved minireceptor was insensitive to Endo-H (lane 2 versus lane
1). Thus, cleavage occurs after the addition of GlcNAc and complex oligosaccharides, i.e. in the furin-containing late Golgi
compartment/TGN.
To confirm the importance of furin, we expressed a minireceptor in
which the consensus cleavage site was disrupted by point mutations
(Fig. 1). Fig. 3A (lanes
2 and 4) shows that mutated minireceptor recovered from
medium and lysates of biolabeled transfectants achieved the same size
after treatment with PNGase-F in contrast to nonmutated
minireceptor treated in parallel (Fig. 3B, lanes 2 and 4). In addition, immunoblotting (Fig.
3C) demonstrated that the mutated but not the wild type
product reacted with anti-propeptide antibody, whereas both products
were recognized by anti-sorLA Vps10p antibody. When taken together, the
results establish that the sorLA minireceptor is synthesized as a
proprotein, which is converted to its mature form by furin-mediated
cleavage in TGN.
Purification of SorLA Vps10p Domain Minireceptor and
L-sorLA--
We reasoned that the Vps10p domain of sorLA, like that of
sortilin-1 (15), might bind RAP as well as its own propeptide. Minireceptors secreted from biolabeled transfectants were therefore subjected to affinity precipitation using Sepharose beads coupled with
RAP or GST-sorLA propeptide. Fig.
4A shows that the wild type
minireceptor was precipitated by both RAP (lane 1) and
propeptide (lane 2) beads, whereas minireceptor mutated in
the furin cleavage site was left in the supernatant to be precipitated
with antibodies (Fig. 4B). Analogous results were obtained
when using biolabeled L-sorLA comprising the entire lumenal domain (not
shown). Wild type sorLA minireceptor comprising the Vps10p domain and
L-sorLA were purified by affinity chromatography from the medium of
transfectants (Figs. 5A and
7A, insets), and N-terminal sequencing yielded
the sequence 54SAALQ, confirming that mature receptor had
been cleaved immediately after the consensus motif RRKR53.
To elucidate the domain specificity of ligands previously reported to
bind sortilin-1 (Fig. 1) or sorLA, we immobilized the Vps10p domains
sorLA-(54-731) and soluble sortilin-1-(45-725) (15) as well as
L-sorLA-(54-2107) onto chips for surface plasmon resonance analysis.
Comparison of Ligand Binding to SorLA and Sortilin-1 Vps10p
Domains--
The first aim was to characterize propeptide binding to
the sorLA Vps10p domain. Fig. 5A shows that the signal
(response units) obtained with 100 nM GST-sorLA propeptide
(pH 7.4) was about 6-fold higher than that obtained with 100 nM 53-residue sorLA propeptide. This is in accordance with
the molecular weight ratio of about 32/6 when regarding the
GST-propeptide as a monomer. Binding of GST-propeptide was abolished at
pH 5.0 (not shown), and 1 µM GST alone did not bind. The
Kd value for propeptide binding with or without GST
was calculated at 5-15 nM from a series of curves obtained
at pH 7.4 with concentrations ranging from 5 nM to 10 µM (not shown). When using a saturating concentration (10 µM), 0.6 mol of GST-sorLA propeptide was bound per mol
immobilized minireceptor. This suggests a 1:1 binding stoichiometry
because some immobilized molecules are likely to be unavailable for binding.
Prompted by the structural similarities between the sortilin-1 and
sorLA Vps10p domains, we next probed for binding of the GST-sortilin-1
propeptide to the chip with the sorLA Vps10p domain. As shown in Fig.
5B, the signal obtained at 100 nM GST-sortilin-1 propeptide was similar to that obtained at the same concentration of
GST-sorLA propeptide, and analysis of a series of curves (not shown)
confirmed similar binding affinities. Moreover, 100 nM sorLA propeptide reduced the signal obtained with GST-sortilin propeptide almost to the level obtained with sorLA propeptide alone
(Fig. 5B). The reverse experiment was also performed, and we
found that GST-sorLA propeptide binds to soluble sortilin-1 with a
Kd of about 10 nM (not shown). The
results demonstrate that sorLA and sortilin propeptides bind to the
Vps10p domains of sorLA and sortilin with about equal affinities.
Fig. 6A shows binding of 1 µM RAP to the sorLA Vps10p domain, and
Kd was estimated at about 100 nM from a
series of binding curves. The addition of 10 µM sorLA
propeptide blocked binding of RAP, i.e. propeptide alone
accounted for the observed response. Other experiments (not shown)
demonstrated that binding of 100 nM GST-sorLA propeptide
was inhibited by 10 µM RAP, thereby confirming
competition for binding to the sorLA Vps10p domain. These results are
similar to those obtained previously for binding of RAP and sortilin-1
propeptide to the sortilin-1 Vps10p domain, except that RAP shows a
lower affinity to the sorLA Vps10p domain than to the sortilin-1 Vps10p
domain (15).
Neurotensin was tested because sortilin-1 is an established receptor
for this 13-residue neuropeptide (15, 25). Fig. 6B shows
that binding of 1 µM RAP was inhibited about 60% by 20 µM neurotensin. This result and the size of the signal
obtained with 20 µM neurotensin alone are in broad
agreement with previous results obtained with soluble sortilin-1 (15).
The binding of GST-sorLA and GST-sortilin-1 propeptides were inhibited
20 and 50%, respectively, by 20 µM neurotensin, and in
control experiments neither RAP nor propeptide binding was inhibited by
20 µM bacitracin (not shown). The Kd
value for binding of neurotensin to sorLA minireceptor was estimated at
~30 nM from separate experiments with concentrations ranging from 5 nM to 20 µM, suggesting an
affinity slightly lower than that for binding to sortilin-1.
The head activator peptide was tested because a homobipeptide binds
with high affinity to a component in lysates of NT2 cells compatible
with sorLA (16). The experiments were performed using the monomerized
head activator reported to stimulate mitosis of NT2 cells at 2 nM concentration (16), as well as peptide dissolved directly in buffer. Binding of 100 nM GST-propeptide or 1 µM RAP was 50% inhibited by 20 µM head
activator, and Kd for direct binding of the peptide
was ~500 nM, although no accurate value could be measured
because of the small size of the signal (not shown). Binding to the
sortilin-1 Vps10p domain was indistinguishable from that to the sorLA
Vps10p domain, and we observed no difference between binding of the
monomerized peptide and the peptide dissolved directly in buffer (not shown).
apoE was tested because previous results have shown binding to
full-length sorLA (2), and LpL was tested because it binds to
sortilin-1 (17). However, binding of these ligands could not be
demonstrated to the sorLA Vps10p domain (not shown).
The results show that the sorLA and sortilin Vps10p domains bind
propeptides equally well and with high affinity. RAP and neurotensin
also bind to both Vps10p domains, although with lower affinity to the
sorLA Vps10p domain. The head activator binds to both domains with low
affinity, whereas apoE and LpL exhibit insignificant binding to the
sorLA Vps10p domain.
Comparison of Ligand Binding to SorLA Vps10p Domain and to
L-sorLA--
This was performed because sorLA, in contrast to
sortilin-1, comprises alternative domains including a cluster of LA
repeats similar to the ligand-binding repeats in LDLR family members. The results (not shown) demonstrated identical binding of propeptides, neurotensin, and the head activator to the two receptor constructs, signifying that binding of these ligands occurs only to the Vps10p domain. On the other hand, RAP displayed much higher binding to L-sorLA
than to the isolated Vps10p domain, and apoE and LpL also bound avidly
to L-sorLA. Fig. 7A shows two
components of RAP binding to L-sorLA. The minor rapidly dissociating
component is compatible with binding to the Vps10p domain
(Kd ~100 nM; Fig. 6), whereas the
slowly dissociating component must be due to binding to other sorLA
domains, most likely to the LA repeat cluster. The overall
Kd for high affinity RAP binding was estimated at
~0.1 nM from a series of curves, and this binding was not
inhibited by the sorLA propeptide (not shown). Recombinant apoE (Fig.
7B) and LpL (not shown) bound avidly to L-sorLA, and the
Kd value for apoE binding was calculated to be <1
nM. When taken together, the results suggest that sorLA is
a multifunctional receptor capable of binding several ligands to
distinct sites located in at least two domains.
SorLA Is Mainly in the Golgi Compartment and ~10% on the Cell
Surface--
Fig. 8A shows
the localization of full-length sorLA in permeabilized CHO cell
transfectants stained with anti-Vps10p antibody. It appears that sorLA
is mainly intracellular and colocalized with the Golgi autoantigen
golgin-97 in paranuclear compartments (Fig. 8, A
versus B), signifying predominant Golgi
localization. Fig. 8C shows a minor expression on the
surface of nonpermeabilized transfectants. No staining was observed in
mock-transfected cells when using the anti-Vps10p antibody (not shown).
To estimate the level of cell surface expression, the transfectants
were treated with the nonpermeable reagent
sulfo-N-hydroxysuccinylimidobiotin at 4 °C and lysed, and
biotinylated proteins were recovered on streptavidin-Sepharose beads.
Subsequently, samples of precipitated and of nonprecipitated protein
were subjected to SDS-PAGE, and their relative content of sorLA was
determined by Western blotting. Fig. 8D shows that
biotinylated (lane 1) and nonbiotinylated (lane 2) sorLA was readily detected, and scanning densitometry (see legend) revealed that about 10% of sorLA had been accessible to biotinylation and therefore represent the fraction of receptors expressed on the cell surface. As a control, we show that biotinylated sorLA did not bind to Sepharose beads without streptavidin but remained
in the unbound fraction (lanes 3 and 4). A double
band was observed on the Western blots in agreement with the pattern originally observed in sorLA isolated from brain (1). Because this
might be due to differential glycosylation, we immunoprecipitated sorLA
from metabolically labeled cells followed by treatment with PNGase-F
and analysis by SDS-PAGE. As shown in Fig. 8D (lane 5 versus lane 6), deglycosylation resulted in a single band,
signifying that the antibodies reacted with a single but differentially
glycosylated protein.
SorLA Mediates Endocytosis--
GST-sorLA propeptide was used to
assess whether cell surface expressed sorLA can mediate degradation of
extracellular ligand. As shown in Fig.
9A, the cells transfected with
full-length sorLA degraded 125I-GST-propeptide faster than
control cells, and degradation was not observed in conditioned medium.
Unlabeled GST-propeptide, but not GST alone (not shown), inhibited
degradation of labeled GST-propeptide half-maximally at about 300 nM (Fig. 9A), and RAP and neurotensin at high
concentrations (20 µM) inhibited propeptide degradation
by about 50 and 30%, respectively (not shown). In addition,
degradation was inhibited by the weak base chloroquine that raises pH
in intracellular compartments (Fig. 9A).
To measure internalization of cell surface bound ligand, we initially
incubated sorLA transfectants with 125I-GST-propeptide at
4 °C followed by incubation at 37 °C and assessment, at various
times, of acid-releasable and nonreleasable (i.e.
internalized) radioactivity. However, the results were difficult to
assess because of binding of GST-propeptide to surface structures other
than sorLA (not shown). We therefore used cells transfected with the IL-2R/sorLA chimera consisting of the transmembrane and cytoplasmic domains of sorLA and the lumenal domain of IL-2R (Tac/CD25), thus taking advantage of available highly specific anti-Tac antibodies (22).
125I-Labeled anti-Tac bound to the IL-2R/sorLA
transfectants at 4 °C but not to mock transfected cells (not shown).
As shown in Fig. 9B, about 60% of the
125I-anti-Tac, initially bound to the transfectants at
4 °C, was internalized after incubation for 15 min at 37 °C.
These results show that sorLA can mediate ligand uptake and
degradation, presumably in lysosomes.
The results show that sorLA is synthesized as an inactive
proreceptor that is converted to the mature ligand-binding form by
cleavage of a 53-residue N-terminal propeptide in the late Golgi
compartment/TGN. This is in accordance with the recent observation that
sorLA immunoprecipitated from metabolically labeled NT2 cells, when
deglycosylated, is initially in a slightly larger form than that
obtained after a chase (16). Furin is likely to be the main enzyme
responsible for cleavage because it is abundant in the Golgi
compartment/TGN. However, it is possible that other enzymes may also
participate in the conversion in vivo because proconvertases
of the subtilisin/Kex-2-like family have overlapping substrate
specificities. We also show that the isolated propeptide binds to
mature sorLA in a pH-dependent way and inhibits binding of
other ligands to the Vps10p domain. To achieve a fully active sorLA,
the propeptide must therefore be removed, most likely in an acidic
compartment. The mechanism of activation is analogous to that described
for sortilin-1 (15) and may characterize all members of the mammalian
Vps10p receptor family. In addition to sorLA and sortilin-1, the
family comprises sorCS/sortilin-2 (8) and two as yet
uncharacterized family members (26, 27), tentatively designated
sortilin-3 and -4 (accession numbers AB028982 and AB037750), both of
which have N-terminally located consensus sites for cleavage by furin.
Putative Role of Propeptide and RAP--
We show that mature sorLA
has at least two lumenal domains capable of binding multiple ligands.
One is the Vps10p domain, and the other is most likely the LA repeat
cluster similar to ligand-binding domains in LDLR family members. The
function of both propeptide and RAP may be to assist in protein folding
and/or to prevent aggregation provoked by premature ligand binding in the early synthetic pathway.
The propeptide, when still attached to sorLA, prevents binding to the
Vps10p domain. Surprisingly, we find that isolated sorLA and sortilin-1
propeptides, which share no obvious structural similarities, bind to
mature sorLA and sortilin-1 Vps10p domains with equal affinity. This
raises the possibility that propeptides may cross-bind on several
Vps10p receptors and modulate binding of external ligands.
Mature sorLA Vps10p domain also binds RAP, although with moderate
affinity, as previously shown for sortilin-1 (15). This is surprising
because RAP is an endoplasmatic reticulum resident protein thought to
be essentially absent in furin containing compartments (for review, see
Ref. 28). Although the functional significance is not understood, the
finding that RAP and propeptides cross-compete for binding to sorLA and
sortilin-1 Vps10p domains reflects a common theme in recognition that
may be shared among Vps10p family receptors.
However, RAP binds with a much higher affinity to the cluster of 11 LA
repeats than to the Vps10p domain. Recent studies on LRP have shown
that high affinity RAP binding depends on pairs of LA repeats each
harboring surface exposed acidic residues between CysIV and
CysV of the ~40 residue repeats (29). SorLA has five LA
repeats with exposed Asp/Glu residues (four in consecutive repeats)
that may explain the RAP binding. In contrast to the Vps10p domain, the
LA repeat cluster is exposed for premature ligand binding in the early
synthetic pathway, and RAP may protect the LA repeat cluster and
thereby prevent receptor aggregation as previously reported for LRP
(28). In addition, RAP may function as a folding chaperone for sorLA as
suggested for members of the LDLR family (30, 31).
Vps10p Domain Ligands--
Our results show overlapping, but not
identical, specificities for binding to mature sortilin-1 and sorLA
Vps10p domains. Thus, LpL (17) and
apoE2 bind to sortilin-1 but
not to the sorLA Vps10p domain (present results), whereas neurotensin
binds to both domains. Sortilin-1, also designated neurotensin
receptor-3 (15, 25), exhibits basically low expression on the surface
of neuronal cells. Upon secretion, neurotensin binds to the
G-protein-coupled neurotensin receptors-1 and -2, and as a result,
sortilin-1 is translocated to the cell surface and appears to
participate in the scavenging of neurotensin (25). Future studies
should show whether sorLA has a similar role in termination of
neurotensin signaling or may help in presenting neurotensin on the cell surface.
The result that sorLA binds the monomeric head activator peptide with
only a low affinity is surprising because the head activator homobipeptide binds to a component in lysates of NT2 cells with a
Kd value of 2-3 nM (16). One possible
explanation is that the affinity of the homobipeptide, which is an
artificial ligand, is much higher than that of monomeric peptide.
However, this seems unlikely because 2 nM monomeric head
activator causes a marked stimulation in mitosis of NT2 cells (16).
Although the question remains unresolved, it seems most likely that the head activator peptide, to achieve high affinity for sorLA, has to
interact with a component not present in the purified system. In
addition, the finding that sortilin-1 also displays low affinity binding of the head activator opens the possibility that this property
may be shared among several Vps10p receptors.
LA Repeat Cluster Ligands--
The results show high affinity
binding of the three ligands previously shown to interact with all
members of the mammalian LDLR family: RAP, apoE, and LpL (13, 14). The
main point is that sorLA has a domain with overall binding activity
comparable with that of classical LDLR family receptors. The large
members LRP and megalin, as well as the very low density lipoprotein
receptor, bind more than 30 structurally distinct ligands. These
receptors have overlapping specificities as well as ligands of their
own (13, 14), and future studies should specify the pattern for the
binding of ligands to sorLA.
Putative Function in Cells--
The distribution of
sorLA with ~10% on the cell surface and ~90% in perinuclear
compartments is similar to that of sortilin-1 (7, 17) and of mannose
6-phosphate receptors, which mediate both sorting of newly synthesized
ligands and uptake from the cell surface. This is in accordance with
the presence of acidic clusters in the cytoplasmic domains of these
receptors (Asp2162-Asp2170 in sorLA) that may
function as determinants for TGN localization (32). We show that sorLA
on the cell surface mediates uptake and degradation of bound ligand
similar to sortilin-1 (17), mannose 6-phosphate receptors, and LDLR
family receptors. In sorLA, internalization may depend on
Phe2144-Tyr2149, which is in accordance with
the overall internalization motif (F/Y)XXXX(F/Y), or on the
acidic cluster. In view of its predominant cellular localization, it
may be proposed that sorLA can also function as a sorting receptor
following interaction with ligands in the Golgi compartment/TGN where
furin mediates cleavage and activation of the Vps10p domain and where
RAP has been removed and retrieved to the endoplasmatic reticulum.
In conclusion, we show that the Vps10p domain of sorLA is activated by
cleavage in the late Golgi compartment/TGN and that cell
surface-expressed sorLA can mediate uptake and degradation of bound
ligand. We demonstrate the overlapping specificities of the sorLA and
sortilin-1 Vps10p domains for binding of propeptides and neuropeptides
and show that sorLA, in addition, has an overall binding activity
comparable with that of the LDLR family receptors.
We thank Dr. G. Olivecrona (University of
Umeå) for providing LpL and Nina Jørgensen and Annette B. Rasmussen
for expert technical assistance.
*
This work was supported by grants from the Danish Medical
Research Council, the Danish Biotechnology Program, the Novo Nordic Foundation, and the Aarhus University Research Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Medical
Biochemistry, University of Aarhus, Ole Worms Allé, Bldg. 170, DK-8000 Aarhus C, Denmark. Tel.: 45-89-422880; Fax:
45-86-131160; E-mail: jg@biokemi.au.dk.
Published, JBC Papers in Press, April 9, 2001, DOI 10.1074/jbc.M100857200
2
M. S. Nielsen, J. Gliemann, and C. M. Petersen, unpublished observation.
The abbreviations used are:
apoE, apolipoprotein
E;
CHO, Chinese hamster ovary;
Endo-H, endoglycosidase H;
GST, glutathione S-transferase;
IL-2R, interleukin 2 receptor
(Tac/CD 25);
LDLR, low density lipoprotein receptor;
LA, LDLR class A;
LpL, lipoprotein lipase;
L-sorLA, lumenal part of sorLA;
PAGE, polyacrylamide gel electrophoresis;
PNGase-F, glycosidase-F;
RAP, receptor-associated protein;
TGN, trans-Golgi network;
Vps10p, vacuolar
protein sorting 10 protein;
PCR, polymerase chain
reaction.
Activation and Functional Characterization of the
Mosaic Receptor SorLA/LR11*
,
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-propeller modules, an epidermal
growth factor precursor-like module, and a cluster of 11 LDLR class A
(LA) repeats, all found in LDLR family members, and a domain of six
structural elements (fibronectin type III repeats) found in neural cell
adhesion molecules. SorLA has a single transmembrane domain and a
54-residue cytoplasmic tail comprising features typical of both
endocytosis- and sorting-competent receptors (1, 2).
-very low density
lipoprotein (2), a chylomicron remnant surrogate rich in
apolipoprotein E (apoE) that also binds to the LA repeat clusters of
LDLR family members. In addition, the neuropeptide head activator binds
to a component in solubilized human neuronal NT2 cells that most likely
represents sorLA (16). The head activator, a conserved 11-residue
peptide of unknown function in mammals, stimulates head-specific growth
in hydra and is reported to stimulate mitosis in NT2 cells (6, 16).
These results, together with the structural features, suggest that
sorLA is a multifunctional receptor that may be involved in ligand
transport and sorting and perhaps in the propagation of ligand-induced signaling.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ZAP cDNA library (Stratagene, La Jolla, CA) covering the
C-terminal 1925 amino acid residues and one overlapping clone in
pBK-CMV from a Jurkat
ZAP Express library covering the N terminus
and a 5'-untranslated sequence (1). A fragment covering the 5' end was
generated by cleaving the Jurkat clone with NarI and
blunt-ended with T4 polymerase followed by NheI cleavage. The brain-derived clone was cleaved with XbaI (blunt-ended)
and NheI. The full-length sorLA sequence was generated by
inserting the NarI/NheI Jurkat 5' fragment into
the predigested brain-derived clone, and a
NotI/XhoI fragment covering full-length sorLA was then transferred from pBluescript to the pcDNA 3.1/Zeo(+) vector (Invitrogen, Carlsbad, CA). A fragment covering residues 1-731 was
amplified by PCR using a T7 5' primer and a 3' primer containing an
XhoI cleavage site and the C terminus of the fragment
(GACCTCGAGTTACTCGTTCTCTTCGAGGGG) and cloned into the same vector to
produce the soluble minireceptor. The consensus site for cleavage by
furin Arg-Arg-Lys-Arg53 was mutated to Gly-Arg-Lys-Gly by
PCR-mediated overlap extension of two PCR fragments produced with (i)
forward mutation primer (5'-AGAAGCCGCTCGGGAGGAAAGGGAGCGCTGCCCT)
and primer downstream in the sorLA sequence and (ii) reverse mutation
primer (5'-AGGGCAGCGCTCCCT TTCCTCCCGAGCGGCTTCT) and primer
upstream in the vector. The NotI/PpuMI-cleaved PCR fragment was cloned into NotI/PpuMI-cleaved
sorLA-(1-731) pcDNA 3.1/Zeo(+). To produce a construct covering
the entire lumenal part (L-sorLA), full-length sorLA in pBluescript was
digested with NsiI and XhoI. A linker with
compatible ends encoding Ser2098 to Asp2107
followed by two stopcodons was constructed and, following annealing of
the 5'-phosphorylated oligonucleotides
(TCTGCAACGCAGGCTGCCAGATCTACGGATTGATGAC and
TCGAGTCATCAATCCGTAGATCTGGCAGCCTGCGTTGCAGATGCA), the linker was
inserted into the NsiI/XhoI-predigested
pBluescript vector. Finally, the resulting
NotI/XhoI fragment covering sorLA-(1-2107) was
transferred to the pcDNA 3.1/Zeo(+) vector. To produce a construct covering the lumenal part of the interleukin 2 receptor (Tac/CD25) and
the transmembrane and cytoplasmic domains of sorLA (IL-2R/sorLA chimera), IL-2R was transferred from pCMVIL-2R (22) by
NheI-XbaI digestion and ligation to pcDNA
3.1/Zeo(+), and the IL-2R/sorLA chimera was obtained by PCR-mediated
overlap extension of two fragments. One was produced by PCR with
pCMVIL-2R as a template using primer containing a partial sorLA
transmembrane sequence and an IL-2R lumenal domain sequence
(5'-CACCACAGCAGCAACCTGGTACTCTGTTGT) in combination with an upstream
IL-2R primer. The other was produced by PCR with sorLA as template
using the reversed primer (5'-ACAACAGAGTACCAGGTTGCTGCTGTGGTG) in
combination with a downstream primer in pcDNA 3.1/Zeo(+). The extended fragment was digested with Bsu36I and
XhoI and cloned into predigested IL-2R/pcDNA 3.1/Zeo(+).
All constructs were verified by DNA sequencing.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (17K):
[in a new window]
Fig. 1.
Schematic representation of sorLA and sorLA
minireceptor constructs. SorLA comprises a Vps10p domain
(gray) followed by five (F/Y)WTD/
-propeller domains, an
epidermal growth factor precursor-like module (open circle),
11 LA repeats (filled circles), six fibronectin type III
repeats (squares), a transmembrane domain, and a cytoplasmic
domain. Minireceptor constructs (sorLA-(1-731)) comprise
the Vps10p domain and 7 amino acid residues of the adjacent domain. The
arrow indicates the position and sequence of the wild type
or mutated consensus site for cleavage by furin. The peptide preceding
the consensus site is shown in dark gray. Sortilin-1, whose
lumenal domain consists of a Vps10p domain, is shown for
comparison.

View larger version (30K):
[in a new window]
Fig. 2.
Cleavage of the sorLA minireceptor. CHO
cell transfectants were biolabeled for 4 h with Pro-mix in
cysteine and methionine-free medium in the absence or the presence of
15 µg/ml brefeldin A. Minireceptor was then immunoprecipitated from
medium and cell lysates and analyzed by reducing SDS-PAGE before and
after treatment with PNGase-F and/or furin (A) or Endo-H
(B). Each panel shows autoradiography of a
2,5-diphenyloxazole-impregnated 8% acrylamide gel. Molecular
size markers are shown to the left.

View larger version (26K):
[in a new window]
Fig. 3.
Propeptide cleavage in cells depends on an
intact consensus sequence. G50RKG53 mutant
(A) and wild type (B) minireceptor were
immunoprecipitated from medium and cell lysates of biolabeled
transfectants and analyzed by reducing SDS-PAGE before and after
treatment with PNGase-F. Each panel shows autoradiography of
a 2,5-diphenyloxazole-impregnated gel, and the
arrows indicate the positions of deglycosylated minireceptor
relative to its match from lysate or medium. C shows Western
blots of medium containing secreted wild type (Wt) or mutant
(M) minireceptor using anti-propeptide antibody or
anti-Vps10p domain antibody.

View larger version (58K):
[in a new window]
Fig. 4.
Binding of minireceptor to immobilized RAP
and GST-sorLA propeptide. Biolabeled wild type (A) and
50GRKG53 (B) minireceptor were
precipitated from culture medium using Sepharose beads coated with RAP
(lane 1) or propeptide (lane 2), and unbound
receptor left in the medium was subsequently immunoprecipitated
(lanes 1a and 2a). The precipitates were analyzed
by reducing SDS-PAGE and autoradiography of
2,5-diphenyloxazole-impregnated gels.

View larger version (22K):
[in a new window]
Fig. 5.
Binding of sorLA and sortilin-1 propeptides
to the sorLA Vps10p domain. Binding was measured using surface
plasmon analysis with 43 fmol of sorLA-(54-731) minireceptor
immobilized onto the chip. The chip was superfused with
ligand-containing buffer at 100 s followed by buffer alone at
600 s. A, sensorgrams of 100 nM GST-sorLA
propeptide, 100 nM sorLA propeptide, or 1 µM
GST at pH 7.4. Note that the size of the signal with sorLA propeptide
is reduced as compared with that of GST-sorLA propeptide in accordance
with its lower molecular weight. The inset shows the purity
of the sorLA Vps10p domain (silver-stained gel). B,
sensorgrams of 100 nM GST-sortilin-1 propeptide binding in
the absence or the presence of 100 nM sorLA propeptide and
of 100 nM sorLA propeptide alone.

View larger version (20K):
[in a new window]
Fig. 6.
Binding of RAP to the sorLA Vps10p domain;
competition by sorLA propeptide and neurotensin. A, the
dashed line shows binding of 1 µM RAP. The
superimposed curves (arrow) represent 1 µM RAP plus 10 µM sorLA propeptide or 10 µM sorLA propeptide alone. B, sensorgrams show
binding of 1 µM RAP in the absence or the presence of 20 µM neurotensin and of 20 µM neurotensin
alone. NT, neurotensin.

View larger version (20K):
[in a new window]
Fig. 7.
Binding of RAP and apoE to L-sorLA. The
receptor was immobilized onto the chip, and binding was measured as
explained in the legend to Fig. 5. A, sensorgrams for
binding of RAP. The inset shows the purity of L-sorLA
covering the lumenal part of the receptor (residues 54-2107).
B, sensorgrams for binding of apoE and isoform-3.

View larger version (44K):
[in a new window]
Fig. 8.
Localization of full-length sorLA in CHO
transfectants. A-C, confocal laser microscopy of CHO
cells transfected with full-length sorLA. A, anti-Vps10p
domain antibody-stained permeabilized cells. B, the same
cells stained with anti-golgin antibody. Secondary antibodies were
anti-rabbit Ig conjugated with Alexa 488 and Cy-5, respectively.
C, anti-Vps10p domain antibody-stained nonpermeabilized
cells. D, Western blots of biotinylated and nonbiotinylated
sorLA in lysates of transfectants. The cells were surface-biotinylated
and lysed, and biotinylated material was recovered on
streptavidin-Sepharose. Lane 1, biotinylated sorLA
representing 26% of the amount bound to streptavidin-Sepharose.
Lane 2, nonbiotinylated sorLA in the same lysate
representing 3% of the amount not bound to streptavidin-Sepharose.
Scanning densitometry of the gel revealed in two experiments that 10.2 and 10.3% of sorLA had been accessible to surface biotinylation.
Lane 3, absence of biotinylated material on Sepharose
without streptavidin. Lane 4, recovery of sorLA in the
nonbound fraction. Lanes 5 and 6, reducing
SDS-PAGE of sorLA immunoprecipitated from biolabeled transfectants
followed by ECL of the 2,5-diphenyloxazole-impregnated gels
before and after deglycosylation with PNGase-F. Molecular size markers
refer to lanes 5 and 6.

View larger version (11K):
[in a new window]
Fig. 9.
SorLA-mediated internalization and
degradation of ligand. A, cells transfected with
full-length sorLA and nontransfected cells (
1 × 105/well) were incubated for 90 min at 37 °C in 250 µl
of medium with ~10.000 cpm 125I-GST-sorLA propeptide and
unlabeled GST-propeptide as indicated. The tracer was 98% precipitable
in 12% trichloroacetic acid, and the percentage of increase in
solubility was taken as a measure of degradation. The filled
circles represent transfected cells as the means values of
triplicate determinations. Open circles, control CHO cells.
Filled square, transfectants incubated in the
presence of 100 µM chloroquine. Open square,
medium conditioned by incubation with transfectants for 90 min. Each
point represents the mean of four values ± S.D. B,
cells transfected with IL-2R/sorLA chimera were incubated for 2 h
at 4 °C with ~30.000 cpm 125I-anti Tac Ig and washed,
followed by incubation at 37 °C for the times indicated. The points
show the percentages of cell-associated radioactivity not released by
acid treatment (mean ± S.D., n = 3).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
Present address: Faculty of Biology, Vrije University, de
Boelelaan 1087, 1081 HV Amsterdam, The Netherlands.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Jacobsen, L.,
Madsen, P.,
Moestrup, S. K.,
Lund, A. H.,
Tommerup, N.,
Nykjær, A.,
Sottrup-Jensen, L.,
Gliemann, J.,
and Petersen, C. M.
(1996)
J. Biol. Chem.
271,
31379-31383
2.
Yamazaki, H.,
Bujo, H.,
Kusunoki, J.,
Seimiya, K.,
Kanaki, T.,
Morisaki, N.,
Schneider, W. J.,
and Saito, Y.
(1996)
J. Biol. Chem.
271,
24761-24768
3.
Mörwald, S.,
Yamazaki, H.,
Bujo, H.,
Kusunoki, J.,
Kanaki, T.,
Seimiya, K.,
Morisaki, N.,
Nimpf, J.,
Schneider, W. J.,
and Saito, Y.
(1997)
Arterioscler. Thromb. Vasc. Biol.
17,
996-1002
4.
Kanaki, T.,
Bujo, H.,
Hirayama, S.,
Tanaka, K.,
Yamazaki, H.,
Seimiya, K.,
Morisaki, N.,
Schneider, W. J.,
and Saito, Y.
(1998)
DNA Cell Biol.
17,
647-657
5.
Hermans-Borgmeyer, I.,
Hampe, W.,
Schinke, B.,
Methner, A.,
Nykjær, A.,
Süsens, U.,
Fenger, U.,
Herbarth, B.,
and Schaller, H. C.
(1998)
Mech. Dev.
70,
65-76
6.
Hampe, W.,
Urny, J.,
Franke, I.,
Hoffmeister-Ullerich, S. A. H.,
Herrmann, D.,
Petersen, C. M.,
Lohmann, J.,
and Schaller, H. C.
(1999)
Development
126,
4077-4086
7.
Petersen, C. M.,
Nielsen, M. S.,
Nykjær, A.,
Jacobsen, L.,
Tommerup, N.,
Rasmussen, H. H.,
Røigaard, H.,
Gliemann, J.,
Madsen, P.,
and Moestrup, S. K.
(1997)
J. Biol. Chem.
272,
3599-3605
8.
Hermey, G.,
Riedel, I. B.,
Hampe, W.,
Schaller, H. C.,
and Hermans- Borgmeyer, I.
(1999)
Biochem. Biophys. Res. Commun.
266,
347-351
9.
Motoi, Y.,
Aizawa, T.,
Haga, S.,
Nakamura, S.,
Namba, Y.,
and Ikeda, K.
(1999)
Brain Res.
833,
209-215
10.
Posse de Chaves, E. I.,
Vance, D. E.,
Campenot, R. B.,
Kiss, R. S.,
and Vance, J. E.
(2000)
J. Biol. Chem.
275,
19883-19890
11.
Hirayama, S.,
Bujo, H.,
Yamazaki, H.,
Kanaki, T.,
Takahashi, K.,
Kobayashi, J.,
Schneider, W. J.,
and Saito, Y.
(2000)
Biochem. Biophys. Res. Commun.
275,
365-373
12.
Kanaki, T.,
Bujo, H.,
Hirayama, S.,
Ishii, I.,
Morisaki, N.,
Schneider, W. J.,
and Saito, Y.
(1999)
Arterioscler. Thromb. Vasc. Biol.
19,
2687-2695
13.
Gliemann, J.
(1998)
Biol. Chem. Hoppe-Seyler
379,
951-964
14.
Hussain, M. M.,
Strickland, D. K.,
and Bakillah, A.
(1999)
Annu. Rev. Nutr.
19,
141-172
15.
Petersen, C. M.,
Nielsen, M. S.,
Jacobsen, C.,
Tauris, J.,
Jacobsen, L.,
Gliemann, J.,
Moestrup, S. K.,
and Madsen, P.
(1999)
EMBO J.
18,
595-604
16.
Hampe, W.,
Riedel, I. B.,
Lintzel, J.,
Bader, C. O.,
Franke, I.,
and Schaller, H. C.
(2000)
J. Cell Sci.
113,
4475-4485
17.
Nielsen, M. S.,
Jacobsen, C.,
Olivecrona, G.,
and Gliemann, J.
(1999)
J. Biol. Chem.
274,
8832-8836
18.
Simmons, T.,
Newhouse, Y. M.,
Arnold, K. S.,
Innerarity, T. L.,
and Weisgraber, K. H.
(1997)
J. Biol. Chem.
272,
25531-25536
19.
Petersen, C. M.,
Ellgaard, L.,
Nykjær, A.,
Vilhardt, F.,
Vorum, H.,
Thøgersen, H. C.,
Nielsen, M. N.,
Jacobsen, L.,
Moestrup, S. K.,
and Gliemann, J.
(1996)
EMBO J.
15,
4165-4173
20.
Bodenmüller, H.,
Schilling, E.,
Zachmann, B.,
and Schaller, H. C.
(1986)
EMBO J.
5,
1825-1829
21.
Bengtsson-Olivecrona, G.,
and Olivecrona, T.
(1991)
Methods Enzymol.
197,
345-356
22.
LaFlamme, S. E.,
Thomas, L. A.,
Yamada, S. S.,
and Yamada, K. M.
(1994)
J. Cell Biol.
126,
1287-1298
23.
Sun, Y.,
Hegamyer, G.,
and Colburn, N. H.
(1993)
BioTechniques
15,
372-374
24.
Misumi, Y.,
Misumi, Y.,
Miki, K.,
Tkatsuki, A.,
Tamura, G.,
and Ikehara, Y.
(1986)
J. Biol. Chem.
261,
11398-11403
25.
Mazella, J.,
Zsurger, N.,
Navarro, V.,
Chabry, J.,
Kaghad, M.,
Caput, D.,
Ferrara, P.,
Vita, N.,
Gully, D.,
Maffrand, J. P.,
and Vincent, J. P.
(1998)
J. Biol. Chem.
273,
26273-26276
26.
Kikuno, R.,
Nagase, T.,
Ishikawa, K.,
Hirosawa, M.,
Miyajima, N.,
Tanaka, A.,
Kotani, H.,
Nomura, N.,
and Ohara, O.
(1999)
DNA Res.
6,
197-205
27.
Nagase, T.,
Kikuno, R.,
Ishikawa, K. I.,
Hirosawa, M.,
and Ohara, O.
(2000)
DNA Res.
7,
65-73
28.
Willnow, T. E.
(1998)
Biol. Chem.
379,
1025-1031
29.
Andersen, O. M.,
Christensen, L. L.,
Christensen, P. A.,
Sørensen, E. S.,
Jacobsen, C.,
Moestrup, S. K.,
Etzerodt, M.,
and Thøgersen, H. C.
(2000)
J. Biol. Chem.
275,
21017-21024
30.
Obermoeller, L. M.,
Warshawsky, I.,
Wardell, M. R.,
and Bu, G.
(1997)
J. Biol. Chem.
272,
10761-10768
31.
Savonen, R.,
Obermoeller, L. M.,
Trausch-Azar, J. S.,
Schwartz, A. L.,
and Bu, G.
(1999)
J. Biol. Chem.
274,
25877-25882
32.
Voorhees, P.,
Deignan, E.,
van Donselaar, E.,
Humphry, J.,
Marks, M. S.,
Peters, J. P.,
and Bonifacino, J. S.
(1995)
EMBO J.
14,
4961-4975
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
S. S. Wang, W. Shi, X. Wang, L. Velky, S. Greenlee, M. T. Wang, T. A. Drake, and A. J. Lusis Mapping, Genetic Isolation, and Characterization of Genetic Loci That Determine Resistance to Atherosclerosis in C3H Mice Arterioscler. Thromb. Vasc. Biol., December 1, 2007; 27(12): 2671 - 2676. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Schmidt, A. Sporbert, M. Rohe, T. Reimer, A. Rehm, O. M. Andersen, and T. E. Willnow SorLA/LR11 Regulates Processing of Amyloid Precursor Protein via Interaction with Adaptors GGA and PACS-1 J. Biol. Chem., November 9, 2007; 282(45): 32956 - 32964. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Nielsen, C. Gustafsen, P. Madsen, J. R. Nyengaard, G. Hermey, O. Bakke, M. Mari, P. Schu, R. Pohlmann, A. Dennes, et al. Sorting by the Cytoplasmic Domain of the Amyloid Precursor Protein Binding Receptor SorLA Mol. Cell. Biol., October 1, 2007; 27(19): 6842 - 6851. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Fiete, Y. Mi, E. L. Oats, M. C. Beranek, and J. U. Baenziger N-Linked Oligosaccharides on the Low Density Lipoprotein Receptor Homolog SorLA/LR11 Are Modified with Terminal GalNAc-4-SO4 in Kidney and Brain J. Biol. Chem., January 19, 2007; 282(3): 1873 - 1881. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Offe, S. E. Dodson, J. T. Shoemaker, J. J. Fritz, M. Gearing, A. I. Levey, and J. J. Lah The Lipoprotein Receptor LR11 Regulates Amyloid beta Production and Amyloid Precursor Protein Traffic in Endosomal Compartments J. Neurosci., February 1, 2006; 26(5): 1596 - 1603. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Spoelgen, C. A. F. von Arnim, A. V. Thomas, I. D. Peltan, M. Koker, A. Deng, M. C. Irizarry, O. M. Andersen, T. E. Willnow, and B. T. Hyman Interaction of the Cytosolic Domains of sorLA/LR11 with the Amyloid Precursor Protein (APP) and beta-Secretase beta-Site APP-Cleaving Enzyme J. Neurosci., January 11, 2006; 26(2): 418 - 428. [Abstract] |