![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 25, 22810-22818, June 22, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Physiology and Biophysics, University of
Arkansas for Medical Sciences, Little Rock, Arkansas 72205
Received for publication, December 22, 2000, and in revised form, March 14, 2001
The roles of the components of the Sec34p
protein complex in intracellular membrane trafficking, first identified
in the yeast Saccharomyces cerevisiae, have yet to be
characterized in higher eukaryotes. We cloned a human cDNA whose
predicted amino acid sequence showed 41% similarity to yeast Sec34p
with homology throughout the entire coding region. Affinity-purified
antibodies raised against the human SEC34 protein (hSec34p) recognized
a cellular protein of 94 kDa in both soluble and membrane fractions.
Like yeast Sec34p, cytosolic hSec34p migrated with an apparent
molecular mass of 300 kDa on a glycerol velocity gradient,
suggesting that it is part of a protein complex. Immunofluorescence
microscopy localized hSec34p to the Golgi compartment in cells of
all species examined, where it co-localized well with the
cis/medial Golgi marker membrin and partially co-localized
with cis-Golgi network marker p115 and
trans-Golgi marker TGN38. The co-localization with membrin
was maintained at 15 °C and after microtubule depolymerization with
nocodazole. During transport of the tsO45 vesicular stomatitis virus G
protein through the Golgi, there was significant overlap with the
hSec34p compartment. Green fluorescent protein-hSec34 expressed
in HeLa cells was restricted to Golgi cisternae, and its membrane
association was sensitive to brefeldin A treatment. Taken together,
our findings indicate that hSec34p is part of a peripheral membrane
protein complex localized on cis/medial Golgi cisternae
where it may participate in tethering intra-Golgi transport vesicles.
Protein transport through the secretory pathway occurs
via transport vesicles under the direction of a large set of protein components (1). The process can be divided into three stages: (a) vesicle budding, (b) vesicle docking, and
(c) membrane fusion, with distinct sets of proteins
mediating each stage. The budding stage involves recruitment of coat
proteins to the membrane and culminates with the release of coated
vesicles (2). Vesicular transport between membrane compartments
requires high specificity and tight regulation to deliver cargo
molecules in donor vesicles to the correct acceptor organelle and
thereby maintain the integrity of distinct compartments. To ensure the
proper directionality of membrane flow, the target organelle must
possess appropriate molecular machinery allowing for specific
recognition and docking of the incoming vesicle. The docking reaction
is likely to require a set of integral membrane proteins on the vesicle
and target membranes, termed
SNAREs.1 Initially,
the SNARE proteins were thought to confer specificity through their
pair-wise interactions (3). However, more recent evidence suggests that
SNAREs cannot be the only targeting components; some SNAREs can
function at several transport steps in vivo (4), SNAREs that
faithfully function at different transport steps in vivo can
interact promiscuously in vitro, and some SNAREs have been
found in multiple SNARE complexes (5). Likewise, members of the Rab
GTPase family were at first thought to be the principle determinants
for targeting specificity because distinct family members display
unique organellar localizations that correlate with their site of
action (6). However, it has been demonstrated that a single chimeric
Rab protein can function at two transport steps (7), indicating that
the Rabs cannot be the sole determinants for specificity in vesicle docking.
Given that neither Rabs nor SNAREs are the sole determinants of
targeting specificity, other components must play important roles.
Additional candidates include the so-called tethering factors, which
are proteins that link donor and acceptor vesicle membranes prior to
SNARE-SNARE interactions (8). Tethering factors are a diverse group of
proteins with a tendency to form elongated, coiled-coil structures
and/or to assemble into large, multimeric complexes (for review, see
Ref. 9). However, because they are peripheral membrane proteins and
therefore must interact with integral membrane components with distinct
localizations, once again, tethering factors cannot be the sole
determinants of targeting specificity. Taken together, these results
indicate that specificity in vesicle docking and fusion might be
generated by the interaction of several factors in such a way that no
individual component plays the dominant role.
A recent genetic screen identified temperature-sensitive alleles of two
yeast genes, SEC34 and SEC35, that, when
incubated at the restrictive temperature, are defective in ER to Golgi
transport and accumulate large numbers of 50-nm vesicles (10). Mutant alleles of these genes can be efficiently suppressed by YPT1, which
encodes the Rab GTPase required early in the secretory pathway, or by
SLY1-20, which encodes a dominant form of the ER to Golgi SNARE-associated protein Sly1p. Weaker suppression is evident upon
overexpression of genes encoding the v-SNAREs SEC22,
BET1, or YKT6, a trait shared with all previously
characterized ER to Golgi tethering factors (11-13). Based on these
data, it was hypothesized that SEC34 and SEC35
might be involved in tethering. This was demonstrated to be the case
for SEC34 and SEC35 by the discovery that these
genes displayed a genetic interaction with genes involved in tethering
and that both Sec34p and Sec35p are required in an in vitro
tethering assay (12, 13). Using a cell-free assay that measures
distinct steps in vesicle transport from the ER to the Golgi, it was
shown that Sec34p and Sec35p are required for a vesicle docking stage
catalyzed by the tethering factor Uso1p (12). These genetic and
biochemical results suggest that Sec34p and Sec35p may act with Uso1p
to dock ER-derived vesicles to the Golgi.
Sec34p is a peripheral membrane protein with a calculated molecular
mass of 93 kDa. Fractionation of yeast cytosol indicates that Sec34p
and Sec35p exist in an ~450-kDa protein complex (13, 14). Recently
Sec34p has also been described as Grd20p, a protein involved in the
proper localization of yeast enzymes to the trans-Golgi network (TGN) (15). A severe defect in TGN localization of Kex2p and
missorting of vacuolar carboxypeptidase Y occurs rapidly after loss of
Grd20p function. A complete loss of GRD20 function also results in a severe growth defect, although the growth defect appears
to be independent of the TGN sorting defect. The Grd20/Sec34 protein is
only partially localized to the TGN, so it is possible that the
observed Golgi localization defects of Kex2p are indirect and a
manifestation of defects in Golgi recycling. Alternatively, Sec34p
might be a general transport factor that is involved in several
membrane trafficking steps. Additional experiments will be required to
unambiguously address these possibilities.
In this study, we report the cloning and sequencing of a novel
membrane-associated human protein, p94. Based on several independent lines of evidence, we propose that p94 is hSec34, the human orthologue of yeast Sec34p. p94 has sequence and structural homology to the yeast
vesicle tethering factor Sec34p, it localizes to the
cis-Golgi, and like yeast Sec34p, it exists as a component
of high molecular complex. Although yeast Sec34p is predicted to act on
the same transport step as Uso1p, the localization of hSec34p and its
sensitivity to Brefeldin A differ from that of p115, a human orthologue
of Uso1p. Therefore, we propose that hSec34 may function on the vesicle transport step that is distinct from the one that requires p115.
Cloning of hSec34p--
The sequence encoding the amino-terminal
part of the hSec34 was amplified from a human colon cDNA library
(Marathon-ReadyTM cDNA, CLONTECH)
using the Marathon adaptor primer (5' primer, ccatcctaatacgactcactatagggcc) and an internal hSEC34-specific primer
(3' primer, gtaactgacttgtgagggtctgtagtgtg). The polymerase chain
reaction was carried out using high fidelity Pfu
TurboTM polymerase from Stratagene (La Jolla, CA). The
resulting 850-bp DNA fragment was cloned into pBluscript vector
digested with NotI and SmaI. The SEC34 open
reading frame was cloned from a human fetal brain cDNA
library using a two-stage Rapid-ScreenTM system (OriGene
Technologies Inc., Rockville, MD). The cDNA library was screened by
PCR according to the manufacturer's recomendations using HSEC34
gene-specific primers (5' primer, gcttccaattgaagacttgtgc; 3' primer,
gcaaagctttagaaagacactg). The resulting positive clone in the vector
pCMV6-XL4 contained a 4.5-kilobase hSec34 cDNA (pCMV-hSec34).
Plasmid Construction--
To construct a His6 fusion
to the amino terminus of hSec34p (pHis6
Plasmids encoding CFP-membrin and CFP-Syntaxin 5 were from R. H. Scheller (Stanford University School of Medicine, Stanford, CA), the
plasmid encoding GFP-Sec13 was from F. Gorelick (Yale University School
of Medicine, New Haven, CT), and the plasmid encoding VSVG-tsO45-GFP
was from M. A. McNiven (Mayo Clinic, Rochester, MN).
Generation of Anti-hSec34p Antibody--
A 247-amino acid
protein that corresponded to hSec34p amino acid sequences from 35 to
281 was expressed in bacteria and purified by nickel chelate column
chromatography. The purified protein was used to immunize rabbits, and
specific antibodies were affinity-purified from the serum on
nitrocellulose strips containing electroblotted His6
Northern Analysis--
Northern blot analyses were performed
using human poly(A)+ RNA blots (MTNTM) purchased
from CLONTECH. A 1255-bp EcoRI fragment of hSec34 cDNA corresponding to amino acids 210-628 was labeled with [ Cell Culture and Transfection--
HeLa cells used in this study
were cultured at 37 °C in Dulbecco's modified Eagle's medium
supplemented with 15 mM Hepes, 2.5 mM
L-glutamine, 10% fetal bovine serum, 100 units/ml
penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B
in a 5% CO2 incubator. Transfections were performed using
the Gene Jammer transfection reagent according to the manufacturer's
recommendations (Stratagene). Cells were split into four-chamber
coverglass dishes (Nalge Nunc International) at a density of 7 × 104 cells/well 24 h before transfection.
Cell Fractionation--
HeLa cells were cultured to confluence
in 100-mm dishes. Cells were washed three times with phospate-buffered
saline (PBS) and were scraped in 1 ml of 20 mM Hepes-KOH
buffer, pH 7.4, supplemented with a proteinase inhibitor mixture (Roche
Molecular Biochemicals). The cells were disrupted using a Potter
homogenizer, and cell lysis was verified using phase contrast
microscopy. Cytosol and membranes were separated by centrifuging the
lysate in a Beckman TLA-55 rotor at 150,000 × g (30 min, 4 °C). The pellet was resuspended in 1 ml of 20 mM
Hepes-KOH buffer, pH 7.4, 0.1 M NaCl, and 1% CHAPS and
incubated on ice for 30 min. Insoluble material was removed by
centrifugation at 21,000 × g for 5 min at 4 °C to
yield a solubilized membrane fraction.
SDS-Polyacrylamide Gel Electrophoresis and Western
Blotting--
Protein samples were solubilized in SDS-polyacrylamide
gel electrophoresis sample buffer, heated at 95 °C for 5 min, and
analyzed on 12% gels. For Western blotting, separated proteins were
transferred to nitrocellulose membranes by electroblotting. Membranes
were blocked with 10% nonfat dry milk in Tris-buffered saline with 0.05% Tween 20 (TBST) for 30 min and were incubated with
affinity-purified rabbit anti-hSec34p antibodies (1:500) in 5% bovine
serum albumin TBST for 1 h at room temperature. Primary antibody
binding was detected using goat anti-rabbit horseradish
peroxidase-conjugated secondary antibodies diluted in 5% milk TBST for
40 min at room temperature. Secondary antibodies were detected using a
chemiluminescence reagent kit (PerkinElmer Life Sciences).
Glycerol Velocity Centrifugation--
HeLa cell cytosol or CHAPS
solubilized membranes (2 mg total protein) were layered onto a 12-ml
linear 10-30% glycerol (w/v) gradient in 20 mM Hepes-KOH,
pH 7.4. Molecular mass markers purchased from Sigma were loaded onto a
second gradient (669 kDa thyroglobulin, 443 kDa apoferritin, 200 kDa
Tissue Distribution--
Freshly harvested rat tissues (100 mg)
were homogenized in 200 µl of 2% SDS, 10 mM Tris-HCl, pH
7.4, 1 mM EDTA using a Potter-Elvehjem homogenizer. The
lysates were heated 5 min at 95 °C and 20 min at 60 °C and then
were cleared by centrifugation at 21,000 × g for 10 min at room temperature. Protein content was measured using the BCA
reagent (Pierce) to normalize sample loading for Western blot analysis.
Immunofluorescence Microscopy--
Cells grown on coverslips or
in four-chamber coverglass dishes were fixed with 3% paraformaldehyde
in PBS for 10 min. After quenching aldehyde groups with 0.1% of sodium
borohydride in PBS, the cells were permeabilized with 0.1% saponin in
PBS. Double immunofluorescence labeling was performed with rabbit and
mouse antibodies diluted 1:500 in PBS containing 0.2% fish skin
gelatin, 1% bovine serum albumin, and 0.1% saponin. The reactions
contained affinity-purified rabbit anti-hSec34p antibody and either
mouse monoclonal anti-membrin antibody (Stressgene, Victoria, Canada) or mouse monoclonal anti-p115 (M. G. Waters, Princeton University, Princeton, NJ). Polyclonal affinity-purified anti-TGN38 was a generous
gift from M. A. McNiven (Mayo Clinic). Secondary goat anti-rabbit
Alexa 488, goat anti-rabbit Texas Red, and goat anti-mouse Alexa 594 (Molecular Probes, Eugene, OR) antibodies were used at 1:500 dilution. No cross-reaction was observed in control
experiments. The coverslips were mounted in Prolong (Molecular Probes,
Eugene, OR) and viewed using a ×63 1.4na PlanApochromatic objective
fitted to a Zeiss Axiovert S microscope (Thornwood, NY) equipped with filters specific for green and red fluorophores and a Hamamtsu C5985
monochrome chilled CCD camera (Hamamatsu Photonics, Hamamatsu City,
Japan). The digitized images were cropped, colored, assembled, and
labeled in Adobe Photoshop.
The imaging of living cells expressing different proteins fused with
GFP, CFP, and YFP proteins was performed in four-chamber coverglass dishes (Nalge Nunc International) using the same equipment and the appropriate filter sets. For experiments with brefeldin A (BfA)
and nocodazole, HeLa cells were transfected with pGFP-hSec34. After
24-36 h, the cells were treated with 1-5 µg/ml BfA at 37 °C for
15-30 min or with 10 µM nocodazole for 2 h. For
double nocodazole/BfA experiments, the cells were first incubated with 10 µM nocodazole for 2 h at 37 °C, BfA (final
concentration, 5 µg/ml) was then added, and the living cells were
imaged at 5-min intervals. VSVG-tsO45-GFP-transfected cells were either
kept at the nonpermissive temperature (39.5 °C) or shifted to 15, 25, or 32 °C for 1 h. After paraformaldehyde fixation, cells
were labeled with primary antibodies followed by Alexa 594-labeled anti-mouse and Texas Red-labeled anti-rabbit secondary antibodies as
described above.
Because many secretory factors are evolutionarily conserved, we
determined whether the components of the yeast Sec34p/Sec35p complex
were also conserved in higher eukaryotes. Searches of the
GenBankTM data base did not yield any Sec35p homologues,
but several human expressed sequence tags were discovered with a high
degree of similarity to Sec34p.
We used the primary sequence of expressed sequence tag z21242 to design
an expressed sequence tag-specific oligonucleotide and used the RACE
procedure to amplify a 5' 850-bp-long fragment from human colon
cDNA. The resulting DNA fragment encoded a 269-amino acid
polypeptide highly homologous to Sec34p. A complete 4.5-kilobase human
cDNA was obtained by PCR screening of an arrayed human fetal brain
cDNA library with hSec34-specific primers. The complete cDNA
for hSec34 was sequenced (GenBankTM accession number
AF349676) and found to contain a 2484-bp open reading frame encoding a
828-amino acid polypeptide homologous to Sec34p with a calculated
molecular mass of 94 kDa. The hSec34p polypeptide has no predicted
transmembrane or other membrane anchoring sequences and contains a
predicted coiled-coil domain (amino acid residues 126-205) and a
putative "leucine zipper" domain (amino acid residues 399-420).
The predicted amino-terminal coiled-coil domain is evolutionary
conserved among all Sec34-like proteins (Fig.
1). Several large fragments of the HSEC34
cDNA sequence are identical to to GenBankTM AL139326
high throughput genomic sequencing phase entry draft sequence
from chromosome XIII clone RP11-351K3, indicating that HSEC34 gene is
on human chromosome XIII.
The strongest homology between the yeast and human proteins is found in
a region containing amino acid residues 174-280 (32% identity and
54% similarity) and in a region containing amino acid residues
554-626 (34% identity and 52% similarity), indicating that the
functional elements of the protein could reside in these regions. These
regions are also highly conserved in potential homologues of Sec34
found in the Drosophila melanogaster genome data base
(AAF51107) and the genomes of Schizosaccharomyces pombe (CAB51337), Candida albicans (unfinished fragment of
complete genome Contig6-2488 obtained from the Stanford DNA Sequencing and Technology Center), Arabidopsis thaliana (AAG30981), and
Caenorhabditis elegans (computed from the genomic Y71F9AM
DNA sequence available at the Sanger Center). The aligned amino
acid sequences of the putative Sec34p-related proteins are shown in
Fig. 1, and their pairwise sequence identities are shown in Table
I. We also have found that the
carboxyl-terminal half (amino acid residues 301-807) of hSec34p is
similar (21% identical and 40% similar) to the central domain (amino
acid residues 610-1106) of the endosomal tethering factor EEA1 (data
not shown).
Identification of a Human Orthologue of Sec34p as
a Component of the cis-Golgi Vesicle Tethering
Machinery*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
hSec34), a
843-bp fragment of hSec34 was amplified by PCR creating a
BamHI site adjacent to the codon for the first amino acid of
hSec34 (5' primer, caggatccatggcggaggcggcgctgttg) and an internal
hSEC34-specific primer (gtaactgacttgtgagggtctgtagtgtg). The PCR product
was cloned into the pTOPO vector using a Zero BluntTM
TOPOTM PCR cloning kit (Invitrogen, Carlsbad, CA). Next, an
870-bp BamHI-PstI fragment from pTOPO-NhSec34
containing the 5' region of hSec34 was ligated into BamHI-
and PstI-digested pQE30 (Qiagen, Valencia, CA). To generate
a green fluorescent protein hSec34 fusion (pEGFP-hSec34), the plasmids
pQE30-NhSec34 and pCMV-hSec34 were digested with BamHI/KasI and KasI/PstI,
respectively. The resulting 101- and 2462-bp fragments were ligated
into pEGFP-C1 from CLONTECH that was digested with
BglII/PstI. To generate cyan and yellow color variants, the BspEI-SalI fragment of pEGFP-hSec34
was ligated into BspEI/SalI-digested pCFP-C1 and
pYFP-C1 vectors to generate pCFP-hSec34 and pYFP-hSec34.
hSec34 protien.
-32P]dCTP in a random priming reaction and used
as the probe. Prehybridization and hybridization were performed in
standard hybridization buffer (16) containing 50% formamide at
42 °C.
-amylase, and 66 kDa bovine serum albumin). The gradients were
centrifuged in a Beckman SW40 rotor at 120,000 × g for
15 h with slow acceleration and deceleration. Fractions (1 ml)
were collected through a hole punched in the bottom of the tube and
concentrated by trichloroacetic acid precipitation (17).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (148K):
[in a new window]
Fig. 1.
Protein sequence analysis of Sec34p
homologues. Shown are the deduced amino acid sequences of S. cerevisiae Sec34 (NP_011084), human hSec34 (AF349676), D. melanogaster AAF51107, S. pombe CAB51337, A. thaliana AAG30981, C. albicans (translation of the
unfinished fragment of complete genome Contig6-2488 obtained from the
Stanford DNA Sequencing and Technology Center), and C. elegans (translated from the genomic Y71F9AM.2-4 DNA sequence
available at the Sanger Center). The black boxes denote
identical residues, and gray shading denotes conserved
residues. The conserved amino-terminal and carboxyl-terminal domains
are boxed. Optimal alignment was produced with the ClustalW
program.
Relative sequence identity/similarity of Sec34p-related proteins
Northern blot analysis for HSEC34 revealed a transcript of about 4.5 kilobases in length that is abundantly and ubiquitously expressed in
all tissues examined with the highest RNA level observed in pancreas
and testis and the lowest level found in lung (Fig. 2A). By contrast the level of
a control transcript (
-actin) was more abundant in lung than in
pancreas and testis. Ubiquitous expression is indeed a feature expected
of an essential molecule like Sec34. Therefore, we conclude that the
cDNA isolated from the fetal brain library represents a full-length
hSec34 RNA molecule.
|
The sequence encoding the amino-terminal part of hSec34p was used to
develop protein-specific rabbit polyclonal antibodies. Affinity-purified anti-hSec34p antibodies recognize a 94-kDa protein in
HeLa cell extracts (Fig. 3A,
lane 1), in numerous rat tissues (Fig. 2B), and
in extracts from CV-1, HEK 293, and all other mammalian cell lines
tested (Fig. 3B and data not shown). Interestingly, two
different high molecular mass species in addition to the 94-kDa polypeptide are detected in brain and heart (Fig. 2B). This
may indicate the presence of a family of hSec34 immunologically related proteins with different tissue distributions. These proteins may be
involved in specific membrane trafficking pathways in specialized tissues. Additional experiments are required to determine whether these
immunologically related proteins are functionally and structurally related to the hSec34p.
|
To determine whether the major 94-kDa protein was hSec34p, HeLa cells were transfected with hSec34p under control of cytomegalovirus promoter and analyzed by Western blotting. Overexpressed hSec34p comigrated with the endogenous 94-kDa immunoreactive protein (Fig. 3A, lane 2), indicating that hSec34p is encoded by the HSEC34 cDNA that we cloned. Further, a new immunoreactive 120-kDa protein appeared in cells engineered to overexpress a GFP-hSec34p hybrid protein (Fig. 3A, lane 3).
We next determined whether hSec34p, like its yeast orthologue Sec34p, was a peripheral membrane protein. In proliferating HeLa cell cultures (30-50% confluency), 60-90% of the hSec34p was associated with the membrane pellet (Fig. 3B, HeLa, lane M). A similar distribution was observed in CV-1 cells (Fig. 3B, CV-1), and several different mammalian tissue extracts (data not shown). A membrane-bound pool of hSec34p was also concentrated on Golgi membranes purified from rat liver (Fig. 3C).
To determine whether soluble hSec34p exists in a high molecular mass complex, membranes and cytosols were fractionated on glycerol velocity gradients (Fig. 3D). In HeLa cytosols, hSec34p migrated as a 300-kDa species, indicating that it is part of a protein complex (Fig. 3D). In HeLa membranes, hSec34p was found in even larger protein complex(es) that may indicate associations with cognate t-SNARE membrane receptors. These observations for hSec34p are consistent with those for yeast Sec34p, which is also associated with a high molecular mass protein complex (13, 14).
hSec34p Co-localizes with the v-SNARE Membrin in Living HeLa Cells
at 37 or 15 °C and in the Presence of Nocodazole--
We determined
the intracellular localization of hSec34p using affinity-purified
anti-hSec34p antibodies (Fig.
4A). Indirect immunofluorescence microscopy revealed that hSec34p is primarily localized in the juxtanuclear region of HeLa cells along with the
v-SNARE membrin, a cis/medial Golgi localized protein (18) (Fig. 4A). Similar co-localization was observed in
living HeLa (Fig. 4A, middle row) and CV-1
(Fig. 4B, top row) cells co-transfected with
plasmids encoding CFP-membrin (19) and YFP-hSec34. To more rigorously
assess the co-localization of hSec34p and membrin, a temperature shift
experiment was performed. Incubation of the cells at 15 °C inhibits
anterograde ER to Golgi transport (20, 21), whereas retrograde
transport appears less affected such that the net effect on the
localization of a cis-Golgi protein is redistribution from
the juxtanuclear region to enlarged peripheral vesicular-tubular
compartment (22). To determine whether hSec34p exhibits such a
redistribution in concert with membrin, HeLa cells were incubated at
15 °C for 3 h. YFP-hSec34p and CFP-membrin were present on
membrane elements scattered throughout the cell and co-localized in all
structures (Fig. 4A, bottom row). We also used a
pharmacological approach to explore the co-localization of hSec34p and
membrin. Nocodazole treatment induces microtubule depolymerization that
leads to fragmentation and dispersal of the Golgi (23). Fig.
4B shows that after nocodazole treatment YFP-hSec34 was
localized on the same Golgi fragments as was CFP-membrin (lower
row). Thus, in three different situations, hSec34p is localized to
the same cis/medial Golgi compartment as is membrin.
|
We used CFP-hSec34 to confirm that our CFP, GFP, and YFP fusion proteins had biochemical properties consistent with those we have defined for endogenous hSec34p. CFP-hSec34 expressed in CV-1 cells (Fig. 3B) and in HeLa cells (data not shown) was found in both cytoplasmic and membrane fractions similar to endogenous hSec34p. CFP-hSec34 was also efficiently incorporated into high molecular mass (~300 kDa) complexes as defined by glycerol velocity gradients in both soluble (Fig. 3D, CV-1p, row C) and membrane (Fig. 3D, CV-1p, row M) fractions. We suggest that the functional pool of hSec34p contains both CFP-hSec34 and hSec34p (fraction marked with an asterisk). In addition to this functional pool, there is also a large pool of monomeric CFP-hSec34p in cytosols. This is most likely due to overexpression, because monomers of endogenous hSec34p are not detectable in either the HeLa or the CV-1 cytosols.
GFP-VSVG Moves through hSec34p-positive Compartment--
To
provide more direct evidence that hSec34p localized to the
cis-face of the Golgi apparatus, we used the
temperature-sensitive vesicular stomatitis virus G protein, tsO45-VSVG,
that transits the secretory pathway (24). HeLa cells were
co-transfected with pCFP-hSec34 and a plasmid encoding tsO45-VSVG fused
with GFP (GFP-VSVG) (25). In cells expressing GFP-VSVG at 39.5 °C,
newly synthesized protein is trapped in the ER, whereas CFP-hSec34 is
localized in the juxtanuclear region (Fig.
5, top row). When new protein synthesis was inhibited with cycloheximide and the cells were incubated
at 15 °C, the GFP-VSVG preferentially accumulated in pre-Golgi
intermediates (26) where its distribution partially overlapped with
that of CFP-hSec34p (Fig. 5, 15 °C row). Some VSVG was
observed at ER exit sites at the cell periphery (marked by
arrowheads) that lacked CFP-hSec34. Incubation at 25 °C
led to a redistribution of GFP-VSVG to the Golgi apparatus where it is
completely co-localized with CFP-hSec34. Finally, prolonged incubation
at 32 °C led to redistribution of GFP-VSVG from the CFP-hSec34-positive compartment to the plasma membrane (Fig. 5, bottom row). Thus, a model secretory protein transits the
hSec34 compartment.
|
GFP-hSec34p Localization Is Distinct from the Localization of p115
and TGN38--
The vesicle tethering factor p115 is predominantly
associated with vesicular-tubular clusters adjacent to the Golgi stack (27) and cycles extensively between the Golgi and the earlier compartments of the secretory pathway (28). A yeast homologue of p115,
Uso1p, has been characterized and shown to function in the same step of
the secretory pathway as does Sec34p in tethering ER-derived vesicles
to cis-Golgi cisternae (11, 13, 29). Secretory membrane
trafficking in mammalian cells has more morphologically distinct steps
compared with the yeast secretory pathway (for instance, yeast do not
have morphologically identifiable vesicular-tubular clusters), and it
was therefore important to compare localization of hSec34 and p115.
Yeast Sec34p has been partially co-localized with
trans-Golgi marker proteins (15). We have tested whether hSec34p is co-localized with either human p115 (30, 31) or the
trans-Golgi marker TGN38 (32, 33). In HeLa and CV-1 cells, GFP-hSec34 was generally localized in what appear to be the same juxtanuclear membranes as p115 and TGN38 (Fig.
6), but the GFP-hSec34 signal only
partially overlapped with p115 and TGN38 in both untreated and
nocodazole-treated cells. Interestingly, after a short treatment with
nocodazole (30-60 min), GFP-hSec34-bearing Golgi fragments were
completely separated from TGN38-positive membranes (data not shown).
The distinctive localization of GFP-Sec34 on the p115 and
TGN38-negative membranes was even more evident when the Golgi complex
was analyzed by confocal microscopy (Fig. 6B). Thus,
GFP-Sec34 is either localized to distinct Golgi membrane domains devoid of p115 and TGN38, or there is intermingling of distinct
hSec34p-positive and p115- and TGN38-positive Golgi vesicles in the
juxtanuclear compartment.
|
hSec34p Association to Golgi Membranes Is Sensitive to Brefeldin
A--
Treatment of cultured cells with the fungal metabolite BfA
induces the formation of extensive membrane tubules from the Golgi apparatus, trans-Golgi network, and early endosomes in a
microtubule-dependent manner (34). This is thought to be
due to the inhibition of nucleotide exchange by BfA onto the
ADP-ribosylation factor, a low-molecular mass GTP-binding protein (35)
that prevents assembly of cytosolic coat proteins (including
COPI components) onto target membranes. At the same time,
extensive retrograde transport of Golgi components to the ER mediated
by growth of Golgi tubules occurs in the presence of BfA, leading to a
complete loss of Golgi structure (22). After a 30-min BfA treatment,
normally Golgi-resident proteins are detected in a characteristic ER
pattern, whereas COPII components and tethering factor p115 are
found in punctate structures scattered throughout the cell (28, 36). In
cells treated with BfA, GFP-hSec34 (Fig.
7, A and C), as
well as the endogenous hSec34p (Fig. 7B), were displaced
from the Golgi cisternae to the cytosol. After an incubation with BfA
for 30 min, a ~7-fold increase in soluble hSec34 was observed (Fig.
7B). The diffuse distribution of hSec34 after BfA treatment
was distinct from that of p115 that was found in punctate structures
(Fig. 7C). In cells first pretreated with nocodazole and
then incubated with BfA (Fig. 7A, lower row),
GFP-hSec34 was displaced from the Golgi fragments to the cytosol with
kinetics similar to that of control cells.
|
hSec34 Associated with Static Golgi Cisternae and Excluded from
Transport Vesicles--
Having established that hSec34p is primarily
associated with the cis/medial Golgi apparatus, we sought to
determine whether hSec34 was also present on ER-derived or intra-Golgi
vesicles. In yeast cells, Sec34p acts in the tethering of ER-derived
vesicles to cis-Golgi. In an in vitro trafficking
assay, acceptor (Golgi) membranes prepared from sec34-2
mutant cells were found to be defective (13). The t-SNARE protein Sed5p
has also been shown to operate in the same compartment (37). Therefore,
we compared the localization of YFP-hSec34 and the t-SNARE CFP-Syntaxin
5 in time lapse studies of HeLa cells (Fig.
8A). Both molecules were
largely localized in the juxtanuclear region, but whereas CFP-Syntaxin
5 was also found on rapidly moving vesicular structures (Fig.
8A, left column) probably representing
anterograde and intra-Golgi vesicles (18), YFP-hSec34 remained
localized to relatively static Golgi cisternae (Fig. 8A,
left column). The GFP-hSec34 was not associated with the
-COP-positive vesicular structures (data not shown). A
similar situation was observed when HeLa cells were co-transfected with
plasmids encoding YFP-hSec34 and GFP-hSec13. As reported previously
(38), GFP-hSec13 was localized to small cytoplasmic vesicles
distributed throughout the cytoplasm but most concentrated in a
juxtanuclear region (Fig. 8B, right panel). By
contrast, YFP-hSec34 was exclusively found on the juxtanuclear Golgi
stacks (Fig. 8B, left panel).
|
| |
DISCUSSION |
|---|
|
|
|---|
In this study, we report the cloning and characterization of a novel membrane-associated human protein, p94. Based on three independent lines of evidence, we propose that the ubiquitously expressed p94 is the orthologue of the yeast Golgi tethering factor Sec34p. p94 has sequence and structural homology to Sec34p; it partially localizes to membranes, it is found in high molecular mass complexes, and it localizes morphologically to the cis/medial Golgi cisternae. We have therefore named this new protein hSec34p.
In addition to hSec34p, Sec34p homologues are encoded in genomes of different eukaryotic species ranging from yeast (Candida and Schizosaccharomyces), worms (Caenorhabditis), plants (Arabidopsis), and flies. Interestingly, all of the Sec34-like proteins are very similar in length with sizes ranging from 735 to 884 amino acids. The strongest homology between the different Sec34-related proteins is found in two regions, one located in the amino-terminal region of the protein (amino acid residues 174-280 in hSec34p), and another located in the carboxyl-terminal region (amino acid residues 554-626 in hSec34p). In addition, in all Sec34-related proteins, the polypeptide sequence immediately adjacent to or partially overlapping the amino-terminal homology domain (amino acid residues 126-206 in hSec34p) is predicted to form a coiled-coil structure. The predicted coiled-coil domain and the amino-terminal homology domain are both present in temperature-sensitive truncated forms of yeast Sec34p (14) that are functional at permissive temperatures. This region may therefore represent a unique feature of the Sec34 protein family that is responsible for Golgi binding by the Sec34p complex in mammalian cells. The carboxyl-terminal part of the protein, which is dispensable in yeast, may play a structural role in stabilizing the Sec34p complex.2 Interestingly, mammalian data base searches using the human Sec34p sequence revealed that the carboxyl-terminal two-thirds of the protein (amino acid residues 301-810) is 40% similar to the early endosomal tethering factor EEA1. EEA1 has been shown to physically interact with Rab5 and the endosomal t-SNARE Syntaxin 6 (39, 40). In the yeast cell, Sec34p and the Rab protein Ypt1p play a role in tethering ER-derived vesicles to the cis-Golgi (13). Thus, it is possible that the evolutionarily conserved domains in Sec34p may function to connect Rab proteins and SNAREs to facilitate vesicle tethering to the cis-Golgi in all eukaryotic cells.
We have determined that hSec34p is a peripheral membrane protein localized to the cis/medial cisternae of Golgi apparatus. On these membranes it co-localizes with the cis-Golgi operating v-SNARE membrin and its t-SNARE partner Syntaxin 5. Unlike the SNAREs, which are present on both the relatively static Golgi cisternae and on rapidly moving transport vesicles (18), hSec34p only localizes to the Golgi cisternae, a feature that is in good agreement with a proposed role for hSec34p as component of vesicle tethering machinery.
Characterization of the soluble and membrane-bound pools of hSec34p on glycerol velocity gradients demonstrates that the protein is a part of a high molecular mass complex(es). Similarly, yeast Sec34p behaves as a component of a high molecular mass complex when soluble proteins are separated on gel filtration columns (13, 14) and on glycerol velocity gradients.3 In this complex, yeast Sec34p is stably associated with another tethering protein Sec35p (12-14). However, searches of the GenBankTM data base did not reveal any human Sec35p homologues. Nearly half of Sec35p is predicted to form a coiled-coil structure (12), a feature common for all proteins involved in vesicle tethering. HSec34p may well interact with proteins other than a Sec35p homologue in both soluble and membrane-bound fractions. Indeed, immunoprecipitations from the cytoplasmic and from detergent-solubilized membrane fractions isolated from [35S]methionine-labeled cells reveal several polypeptide bands with molecular sizes distinct from what we would expect for a Sec35p homologue (data not shown).
When the dynamics of hSec34p were analyzed together with anterograde transport of ER-arrested VSVG, the picture was also largely in agreement with the proposed Golgi tethering role for the hSec34 protein complex. Transfected cells incubated for 6 h at 39.5 °C showed distinct ER staining of VSVG-GFP. At 15 °C a fraction of VSVG clearly moved to ER exit sites and to scattered Golgi elements where it co-localized with CFP-hSec34p. The co-localization of hSec34p with the anterograde cargo was even more evident after incubation at 25 °C; then all VSVG moved to the Golgi apparatus. However, after prolonged incubation at the permissive temperature of 32 °C, VSVG moved to the plasma membrane where it no longer co-localized with hSec34p.
In Saccharomyces cerevisiae, SEC34 genetically interacts with another vesicle tethering factor USO1 (11, 13, 29). Uso1p in yeast is clearly involved in movement of anterograde ER-derived vesicles to Golgi apparatus (11, 13, 29), and full-length Uso1 protein is required for the assembly of functional ER-Golgi SNARE complexes (11, 13, 29). The phenotype of sec34 mutants is more complex. Besides the ER to Golgi trafficking defects (11, 13, 29), sec34/grd20 mutants mislocalize several Golgi-resident proteins and underglycosylate the secretory enzyme invertase (11, 13, 29). This feature was previously observed for mutant vti1, a v-SNARE involved in the retrograde intra-Golgi trafficking (11, 13, 29). In addition, Sec34p physically interacts with the subset of yeast SNARE proteins involved in retrograde trafficking.3
The mammalian orthologue of Uso1p, p115, participates in the assembly
and maintenance of normal Golgi structure and is required for ER to
Golgi vesicle trafficking at a pre-Golgi stage (41, 42). We find that
p115 is only partially co-localized with hSec34p on Golgi cisternae and
on scattered Golgi fragments in cells treated with nocodazole. Although
both proteins appear to be localized on the same membrane elements,
they are apparently preferentially enriched in different membrane
subdomains. As is the case in yeast, it is possible that in mammalian
cells both p115 and the hSec34 protein complex are regulating different
sides of cis-Golgi-oriented membrane trafficking. In this
model, p115 would tether anterograde ER-derived vesicles, whereas the
hSec34p complex would regulate proper targeting of retrograde
intra-Golgi vesicles. Additional experiments using in vitro
transport assays and the cloned hSec34 we have characterized will be
required to test this model.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Fred Gorelick, Mark McNiven, Richard Scheller, and Gerry Waters for the generous gifts of antibodies and GFP-tagged proteins.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Physiology
and Biophysics, University of Arkansas for Medical Sciences, 4301 W. Markham, Slot 750, Little Rock, AR 72205. Tel.: 501-603-1170; Fax: 501-296-1469; E-mail: lupashinvladimirv@uams.edu.
Published, JBC Papers in Press, April 5, 2001, DOI 10.1074/jbc.M011624200
2 V. V. Lupashin and E. S. Suvorova, unpublished observations.
3 E. S. Suvorova, R. C. Kurten, and V. V. Lupashin, unpublished observation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: SNARE, soluble N-ethylmaleimide-sensitive fusion protein attachment receptor; t-SNARE, target SNARE; ER, endoplasmic reticulum; TGN, trans-Golgi network; bp, base pair; PCR, polymerase chain reaction; GFP, green fluorescent protein; CFP, cyan fluorescent protein; YFP, yellow fluorescent protein; VSVG, vesicular stomatitis virus G protein; PBS, phospate-buffered saline; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; BfA, brefeldin A; contig, group of overlapping clones; COP, coat protein(s).
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Rothman, J. E. (1994) Nature 372, 55-63 |
| 2. | Schekman, R., and Orci, L. (1996) Science 271, 1526-1533 |
| 3. | Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., and Rothman, J. E. (1993) Nature 362, 318-324 |
| 4. | Fischer von Mollard, G., Nothwehr, S. F., and Stevens, T. H. (1997) J. Cell Biol. 137, 1511-1524 |
| 5. | Lupashin, V. V., Pokrovskaya, I. D., McNew, J. A., and Waters, M. G. (1997) Mol. Biol. Cell 8, 2659-2676 |
| 6. | Ferro-Novick, S., and Novick, P. (1993) Annu. Rev. Cell Biol. 9, 575-599 |
| 7. | Brennwald, P., and Novick, P. (1993) Nature 362, 560-563 |
| 8. | Pfeffer, S. R. (1999) Nat Cell Biol 1, E17-E22 |
| 9. | Waters, M. G., and Pfeffer, S. R. (1999) Curr. Opin. Cell Biol. 11, 453-459 |
| 10. | Wuestehube, L. J., Duden, R., Eun, A., Hamamoto, S., Korn, P., Ram, R., and Schekman, R. (1996) Genetics 142, 393-406 |
| 11. | Sapperstein, S. K., Lupashin, V. V., Schmitt, H. D., and Waters, M. G. (1996) J. Cell Biol. 132, 755-767 |
| 12. | VanRheenen, S. M., Cao, X., Lupashin, V. V., Barlowe, C., and Waters, M. G. (1998) J. Cell Biol. 141, 1107-1119 |
| 13. | VanRheenen, S. M., Cao, X., Sapperstein, S. K., Chiang, E. C., Lupashin, V. V., Barlowe, C., and Waters, M. G. (1999) J. Cell Biol. 147, 729-742 |
| 14. | Kim, D. W., Sacher, M., Scarpa, A., Quinn, A. M., and Ferro-Novick, S. (1999) Mol. Biol. Cell 10, 3317-3329 |
| 15. | Spelbrink, R. G., and Nothwehr, S. F. (1999) Mol. Biol. Cell 10, 4263-4281 |
| 16. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , p. 7.52, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY |
| 17. | Bensadoun, A., and Weinstein, D. (1976) Anal. Biochem. 70, 241-250 |
| 18. | Hay, J. C., Klumperman, J., Oorschot, V., Steegmaier, M., Kuo, C. S., and Scheller, R. H. (1998) J. Cell Biol. 141, 1489-1502 |
| 19. | Chao, D. S., Hay, J. C., Winnick, S., Prekeris, R., Klumperman, J., and Scheller, R. H. (1999) J. Cell Biol. 144, 869-881 |
| 20. | Saraste, J., Palade, G. E., and Farquhar, M. G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6425-6429 |
| 21. | Beckers, C. J., and Balch, W. E. (1989) J. Cell Biol. 108, 1245-1256 |
| 22. | Lippincott-Schwartz, J., Donaldson, J. G., Schweizer, A., Berger, E. G., Hauri, H. P., Yuan, L. C., and Klausner, R. D. (1990) Cell 60, 821-836 |
| 23. | Rogalski, A. A., and Singer, S. J. (1984) J. Cell Biol. 99, 1092-1100 |
| 24. | Beckers, C. J., Keller, D. S., and Balch, W. E. (1987) Cell 50, 523-534 |
| 25. | Cao, H., Thompson, H. M., Krueger, E. W., and McNiven, M. A. (2000) J. Cell Sci. 113, 1993-2002 |
| 26. | Bannykh, S. I., Rowe, T., and Balch, W. E. (1996) J. Cell Biol. 135, 19-35 |
| 27. | Ladinsky, M. S., Mastronarde, D. N., McIntosh, J. R., Howell, K. E., and Staehelin, L. A. (1999) J. Cell Biol. 144, 1135-1149 |
| 28. | Nelson, D. S., Alvarez, C., Gao, Y. S., Garcia-Mata, R., Fialkowski, E., and Sztul, E. (1998) J. Cell Biol. 143, 319-331 |
| 29. | Lupashin, V. V., Hamamoto, S., and Schekman, R. W. (1996) J. Cell Biol. 132, 277-289 |
| 30. | Nakamura, N., Lowe, M., Levine, T. P., Rabouille, C., and Warren, G. (1997) Cell 89, 445-455 |
| 31. | Waters, M. G., Clary, D. O., and Rothman, J. E. (1992) J. Cell Biol. 118, 1015-1026 |
| 32. | Luzio, J. P., Brake, B., Banting, G., Howell, K. E., Braghetta, P., and Stanley, K. K. (1990) Biochem. J. 270, 97-102 |
| 33. | Humphrey, J. S., Peters, P. J., Yuan, L. C., and Bonifacino, J. S. (1993) J. Cell Biol. 120, 1123-35 |
| 34. | Lippincott-Schwartz, J., and Cole, N. B. (1995) Biochem. Soc. Trans. 23, 544-548 |
| 35. | Morinaga, N., Adamik, R., Moss, J., and Vaughan, M. (1999) J. Biol. Chem. 274, 17417-17423 |
| 36. | Shaywitz, D. A., Orci, L., Ravazzola, M., Swaroop, A., and Kaiser, C. A. (1995) J. Cell Biol. 128, 769-777 |
| 37. | Cao, X., and Barlowe, C. (2000) J. Cell Biol. 149, 55-66 |
| 38. | Shugrue, C. A., Kolen, E. R., Peters, H., Czernik, A., Kaiser, C., Matovcik, L., Hubbard, A. L., and Gorelick, F. (1999) J. Cell Sci. 112, 4547-4556 |
| 39. | Christoforidis, S., McBride, H. M., Burgoyne, R. D., and Zerial, M. (1999) Nature 397, 621-625 |
| 40. | Simonsen, A., Gaullier, J. M., D'Arrigo, A., and Stenmark, H. (1999) J. Biol. Chem. 274, 28857-28860 |
| 41. | Allan, B. B., Moyer, B. D., and Balch, W. E. (2000) Science 289, 444-448 |
| 42. | Alvarez, C., Fujita, H., Hubbard, A., and Sztul, E. (1999) J. Cell Biol. 147, 1205-1222 |
| 43. | Fleischer, B. (1974) Methods Enzymol. 31, 180-191 |
This article has been cited by other articles:
![]() |
A. Shestakova, E. Suvorova, O. Pavliv, G. Khaidakova, and V. Lupashin Interaction of the conserved oligomeric Golgi complex with t-SNARE Syntaxin5a/Sed5 enhances intra-Golgi SNARE complex stability J. Cell Biol., December 17, 2007; 179(6): 1179 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun, A. Shestakova, L. Hunt, S. Sehgal, V. Lupashin, and B. Storrie Rab6 Regulates Both ZW10/RINT-1 and Conserved Oligomeric Golgi Complex-dependent Golgi Trafficking and Homeostasis Mol. Biol. Cell, October 1, 2007; 18(10): 4129 - 4142. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kubota, M. Sano, S. Goda, N. Suzuki, and K. Nishiwaki The conserved oligomeric Golgi complex acts in organ morphogenesis via glycosylation of an ADAM protease in C. elegans Development, January 15, 2006; 133(2): 263 - 273. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sztul and V. Lupashin Role of tethering factors in secretory membrane traffic Am J Physiol Cell Physiol, January 1, 2006; 290(1): C11 - C26. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Ungar, T. Oka, E. Vasile, M. Krieger, and F. M. Hughson Subunit Architecture of the Conserved Oligomeric Golgi Complex J. Biol. Chem., September 23, 2005; 280(38): 32729 - 32735. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Oka, E. Vasile, M. Penman, C. D. Novina, D. M. Dykxhoorn, D. Ungar, F. M. Hughson, and M. Krieger Genetic Analysis of the Subunit Organization and Function of the Conserved Oligomeric Golgi (COG) Complex: STUDIES OF COG5- AND COG7-DEFICIENT MAMMALIAN CELLS J. Biol. Chem., September 23, 2005; 280(38): 32736 - 32745. [Abstract] [Full Text] [PDF] |
||||