|
Originally published In Press as doi:10.1074/jbc.M101687200 on April 13, 2001
J. Biol. Chem., Vol. 276, Issue 25, 22954-22964, June 22, 2001
Transcription Regulation and Protein Subcellular
Localization of the Truncated Basic Hair Keratin hHb1- N in Human
Breast Cancer Cells*
Anne
Boulay ,
Catherine H.
Régnier,
Patrick
Anglard,
Isabelle
Stoll,
Catherine
Tomasetto, and
Marie-Christine
Rio§
From the Institut de Génétique et de Biologie
Moléculaire et Cellulaire, CNRS/INSERM U184/ULP BP 163, 67404 Illkirch Cedex, C.U. de Strasbourg, France
Received for publication, February 22, 2001, and in revised form, April 9, 2001
 |
ABSTRACT |
An aberrant truncated hHb1 hair keratin
transcript, named hHb1- N, was previously identified in breast
carcinomas. No normal tissue tested so far, including hairy skin,
expressed hHb1- N, indicating that hHb1- N is related to
carcinogenesis. In the present study, we investigated the mechanism by
which such truncated transcript was generated in breast cancer cell
lines. We found that hHb1- N transcription is initiated at an unusual
cryptic promoter within the fourth intron of the hHb1 gene
and is dependent on two proximal Sp1 binding sites for its baseline
activity. Moreover, hHb1- N transcription is increased in response to
DNA demethylation by the 5-aza-2'-deoxycytidine drug. This
induction is dependent on protein neosynthesis, indicating that an
additional factor is required. In addition, we showed that the
hHb1- N transcript is translated in vivo as a truncated
hHb1 protein that is missing the 270 amino-terminal residues. The
hHb1- N protein exhibits a filament pattern throughout the cytoplasm
and partially co-localizes with cytokeratin filaments, indicating its
participation in the cytoskeleton network. hHb1- N might alter the
adhesive properties of cancer cells.
 |
INTRODUCTION |
Keratin intermediate filaments are expressed in various epithelial
tissues. Two types of keratin, the acidic type I and the basic type II,
combine in a stoichiometric fashion to form the fundamental unit.
Keratin heterodimers further associate to form the 10-nm intermediate
filament network (1). Simple or stratified epithelia differentially
express pairs of "soft" or cytokeratins, whereas hard epithelia
such as hair or nails express specific pairs of "hard" or hair
keratins. It has been assumed from biochemical data that hair follicles
express four different pairs of keratins. However, nine human acidic
hair keratin genes have been identified and classified into three
subgroups according to gene structure and sequence conservation (2).
From the nine likely basic heterodimeric partners, six genes have been
cloned (3).
By differential screening of a cDNA library established from
metastatic lymph nodes derived from a breast cancer, we previously identified the MLN137 cDNA that proved to be identical to the 3'-half of the human hair keratin basic 1 (hHb1)1 cDNA (4). Using
5'- and 3'-probes specific for the hHb1 hair keratin, we established
that breast carcinomas specifically express a 5'-truncated form of the
hHb1 mRNA, including the second -helical subdomain and the
specific carboxyl-terminal tail domain. MLN137 was therefore called
hHb1- N, because the putative protein corresponded to an hHb1 keratin
truncated at its amino terminus. In situ hybridization showed that the hHb1- N mRNA is ectopically expressed in
malignant epithelial cells of primary breast carcinomas and metastases
(5). This truncated transcript has thus far never been detected in hairy skin samples.
Aberrant forms of soft keratins have been shown to be responsible for
several epidermal genetic diseases (6). Moreover, abnormal cytokeratin
expression patterns have been widely used as tumor markers, because
they correlate with different types of epithelial differentiation and
function (7). Some recent data have revealed point mutations in the
hHb1 and hHb6 hair keratins in monilethrix, a rare inherited hair
disorder (8-10). In addition, hHb1 expression has been observed in
pilomatricomas, epidermal tumors exhibiting follicular differentiation
(11, 12). hHb1- N is, however, the first hair keratin whose
expression is detected in carcinomas derived from a tissue different
from the epidermis.
Several studies have demonstrated that amino- or
carboxyl-terminal-truncated cytokeratins can be incorporated into the
intermediate filament network. Keratin proteins bearing small deletions
are incorporated without evident modification of the cytoskeleton, whereas larger deletions can lead to the complete collapse of the
intermediate filament network (13, 14). Intermediate filaments are
likewise physiologically composed of obligatory heterodimers of
specific cytokeratins or hair keratins. Forced expression of a foreign
keratin through transient transfection showed that it can still
efficiently incorporate into the pre-existing network as newly formed
intermediate filaments (13, 14). The expression of a truncated keratin
could thus have significant relevance for cancer progression, because
it could lead to severe disturbances of the intermediate filament
network itself and of its interaction with desmosomal or hemidesmosomal
proteins, which are essential for the maintenance of cell integrity
(6).
Hair is a complex specialized epithelial structure, and hair keratin
gene expression patterns are precisely controlled. However, the
mechanisms by which hair keratin genes are regulated are poorly understood. Few human hair keratin gene promoters have been studied so
far. Comparison of gene promoters of hair keratin and hair keratin-associated proteins of human, mouse, and sheep origin have
allowed for the identification of conserved putative regulatory elements (15). Several promoters share consensus binding sites for the
Sp1, AP1, AP2, and NF-1 transcription factors. Nevertheless, a
prominent motif is recognized as a binding site for lymphoid enhancer
factor 1, originally identified as a pre-B and T cell-specific protein
(16). A central role for this factor in hair keratin gene transcription
and hair follicle patterning has been demonstrated by various mouse
transgenesis experiments (17, 18).
In the present study, we characterized the mechanisms leading to the
ectopic expression of the truncated hHb1 hair keratin in breast
carcinomas. hHb1- N expression does not result from a translocation
or rearrangement of the hHb1 locus. We actually demonstrated
that its transcription is controlled by a cryptic promoter present in
the 4th intron of the hHb1 gene. In addition, we studied the
subcellular localization of the hHb1- N protein in cancer cells.
 |
EXPERIMENTAL PROCEDURES |
Cell Cultures--
The HBL100 breast-immortalized cell line, the
MCF7, SKBR3, and T47D breast cancer cell lines, and the HeLa cervix
cancer cell line were maintained in culture with Dulbecco's modified
Eagle's medium supplemented with 10% fetal calf serum and 0.6 µg/ml
insulin (for MCF7 and T47D). When the cells were treated with
5-aza-2'-deoxycytidine (5-Aza-2'dC, Sigma Chemical Co., St. Louis, MO),
4 × 105 MCF7, 2 × 106 SKBR3, and
8 × 105 T47D cells were seeded in 10-cm dishes (day
0). 5-Aza-2'dC was added to the growth medium (at 0.5, 2, or 10 µg/ml) in two (or three, as indicated) 24-h pulses on days 2 and 5 (and day 8). Cells were used 24 h after treatment for RNA
isolation. In experiments using cycloheximide (Sigma), 2 µg/ml
5-Aza-2'dC was first added to the medium for 5 days and cells were
additionally treated with 2, 10, or 50 µg/ml cycloheximide for the
last 72 or 24 h.
cDNA Probes--
The hHb1 5'- and 3'-specific cDNA
probes and the 36B4 (acidic ribosomal protein, GenBankTM accession
number M17885) cDNA probe have already been described (5). Exon 9 of hHb6 gene was amplified by PCR from SKBR3 genomic
DNA using the following primers:
5'-GAGAGAATTCCACTACTGCCCCTGTTGTCTC and
5'-GAGAGAATTCCTACAGAGAGAGACCATGGCG (EcoRI sites
are underlined), cloned into pBluescript and used as a specific
probe. All probes were labeled by random priming with
[ -32P]dCTP using the Klenow enzyme (Amersham Pharmacia
Biotech).
Genomic DNA Isolation and Southern Blot Analysis--
HBL100,
MCF7, SKBR3, and T47D cells were plated in 15-cm dishes. At confluency,
cells were washed twice with PBS and lysed in (10 mM Tris,
pH 8, 0.1 M EDTA, 20 µg/ml boiled pancreatic RNase, 0.5%
SDS, 100 µg/ml proteinase K (Roche Diagnostic Corp., Berkeley, CA))
for 16 h at 42 °C. Genomic DNA was ethanol-precipitated and resuspended in 1 mM Tris, pH 7.5, 0.1 mM EDTA.
20 µg of MCF7, SKBR3, and T47D genomic DNA was digested with the
appropriate restriction enzymes under conditions recommended by the
supplier (New England BioLabs), separated by 0.8% agarose gel
electrophoresis, and transferred onto a Hybond N+ nylon
membrane according to the manufacturer (Amersham Pharmacia Biotech).
Hybridization with the hHb1 3'-cDNA probe was performed in the same
conditions except for the Northern blot (see below).
RNA Isolation and Northern Blot Analysis--
Cell cultures were
washed with phosphate-buffered saline (PBS), and RNA extraction was
carried out by the guanidinium thiocyanate phenol/chloroform procedure
as previously described (19). Northern blot was processed as previously
described (4). Briefly, 10 µg of total RNA was denatured at 65 °C
for 5 min and electrophoresed on a 1% agarose gel in the presence of
2.2 M formaldehyde, prior to transfer onto a Hybond-N nylon
membrane (Amersham Pharmacia Biotech). The Northern blot was hybridized
with the appropriate probes for 24 h at 42 °C.
Primer Extension--
Primer extension was performed according
to the protocol described in a previous study (20). Two picomoles of
antisense oligonucleotides complementary to hHb1- N cDNA (either
5'-CGGCAATGATGCAGTCCATGT or 5'-GACAATGTCGTCATACTGTGC) were labeled at
the 5' terminus with [ -32P]ATP using the T4 DNA
polynucleotide kinase (New England BioLabs). The probe (106
cpm) was co-precipitated with 40 µg of SKBR3 total RNA, or liver total RNA as a negative control, and resuspended in 30 µl of
hybridization buffer (80% formamide, 40 mM PIPES, pH 6.4, 400 mM NaCl, 1 mM EDTA, pH 8). After heat
denaturation, hybridization was performed overnight at 37 °C. After
ethanol precipitation, cDNA was elongated by 40 units of avian
myeloblastosis virus reverse transcriptase (Amersham Pharmacia Biotech,
Uppsala, Sweden) in 25 µl of elongation buffer containing 3.5 µl of
dNTP (4 mM each), 5 µl of reverse transcriptase
buffer, 1.25 µl of RNAsin for 90 min at 42 °C. The reaction was
stopped by addition of 1 µl of EDTA 0.5 M, and RNA was
digested 30 min at 37 °C with 1 µg of RNase A. The elongated cDNA was extracted with phenol/chloroform, ethanol-precipitated, and resuspended in 6 µl of loading buffer (98% formamide, 10 mM EDTA, 0.025% xylene cyanol blue, 0.025% bromphenol
blue). The single-stranded cDNA was resolved by electrophoresis on
a 6% polyacrylamide denaturing gel containing 8 M urea.
hHb1 cDNA sequencing reactions were performed using the same
antisense oligonucleotides according to the manufacturer (Amersham
Pharmacia Biotech, Cleveland, OH) and run in parallel to localize the
initiation sites of transcription. The gel was vacuum-dried and exposed
24-36 h for autoradiography.
RACE-PCR--
RACE-PCR was performed according to the
manufacturer (Marathon cDNA Amplification Kit,
CLONTECH Laboratories Inc., Palo Alto, CA).
Briefly, 2 µg of SKBR3 poly(A)+ RNA (5) were
reverse-transcribed by 20 units of avian myeloblastosis virus reverse
transcriptase. Double-stranded cDNA was ligated to the Marathon
cDNA Adaptor by 1 unit of T4 DNA ligase. The 5'-end of the
hHb1- N cDNA was first amplified by PCR using 5 units of Taq polymerase (Sigma Chemical Co.) in the presence of the
sense adaptor primer (AP1) and the antisense primer
5'-GACTGAGCCACCGCGGCCTCCAGCTTG (designed in exon 6) specific of the
hHb1- N cDNA. The hHb1- N cDNA was further amplified using
internal primer 5'-GATCTCCTCCTTGGTGCGGCG (designed in the exon 5) and
cloned into the pTAdv vector (CLONTECH Laboratories). Thirty hHb1- N clones were sequenced.
Plasmid Constructs--
The hHb1 gene was
PCR-amplified from SKBR3 and HBL100 genomic DNA using standard
conditions with 5 units of Deep Vent polymerase (New England BioLabs)
in the presence of 200 µM of each dNTP and 50 pmol of
each of the following primers: 5'-primer,
5'-GAGAGAATTCACCCAAACGTCCAGGAGGATCATCATG and 3'-primer,
5'-GAGAGAATTCGTAGCTGAGCACTTGCTCCAGGCG (EcoRI
restriction sites are underlined). The hHb1 gene was
cloned into the EcoRI-digested pBluescript plasmid
(Stratagene Inc., La Jolla, CA). The nucleotide sequence was verified
from independently amplified genes.
Luciferase constructs containing varying lengths of the hHb1- N
promoter were generated by PCR and inserted upstream of the firefly
luciferase reporter gene into SacI/XhoI-digested
pGL3basic vector (Promega Corp., Madison, WI). The following primers
were used, their positions are referred relative to the most upstream transcription initiation site of hHb1- N: the sense primers are 5'-ATTTCTCTATCGATAGGTACCGAGCTCACCTGCGGATCAGGATTT
( 3311/+22), 5'-ATTTCTCTATCGATAGGTACCGAGCTCGATGTGGACTGCGCCTAC (A;
305/+22), 5'-ATTTCTCTATCGATAGGTACCGAGCTCACTTCCTGAGGCGGCTGT (B;
235/+22), 5'-ATTTCTCTATCGATAGGTACCGAGCTCGGGAGTGTTGGACAGGAT (C;
150/+22), 5'-ATTTCTCTATCGATAGGTACCGAGCTCGGACCAGAGAAAGCCTGA (D;
85/+22), 5'-ATTTCTCTATCGATAGGTACCGAGCTCCCTGTGTTCTCAACTAAA
(E; 38/+22), and the antisense primer is
5'-AAGCTTACTTAGATCGCAGATCTCGAGTTGACAACCACGGAGGTG for all
the constructs (SacI and XhoI restriction sites
are, respectively, underlined).
Potential positive regulatory fragments of the hHb1- N
promoter were PCR-amplified and inserted upstream of the SV40 promoter into the pGL3promoter vector using the sense primers
5'-GAGACTCGAGACTTCCTGAGGCGGCTGTATG (position B;
235/ 214), 5'-GAGACTCGAGGGGAGTGTTGGACAGGATGTG
(position C; 150/ 129), and the antisense primers
5'-GAGACTCGAGACCCCCAACTCTCCTCTCTGC (position C;
172/ 151), 5'-GAGACTCGAGCCAACCCTGCCCCCTCACACA (position D; 107/ 86), 5'-GAGACTCGAGCCAACCCACCATGTCCTGACT
(position E; 60/ 39). A double-stranded oligonucleotide
(DE; 85/ 39) corresponding to the annealed oligonucleotides
5'-TCGAGGAATTCGGACCAGAGAAAGCCTGAGGAGGTGGAGTCAGGACATGGTGGGTTGGC, and
5'-TCGAGCCAACCCACCATGTCCTGACTCCACCTCCTCAGGCTTTCTCTGGTCCGAATTCC, was inserted into the pGL3promoter plasmid.
Mutation of Sp1 and GT box binding sites was performed by site-directed
mutagenesis (21) in the 85/+22 construct using the primers
5'-TGTCCTGACTGGAATTCCTCAGGCT
and 5'-GAGAACACAGCCCCATATGCCATGTCCTGACTC (mutated nucleotides (underlined) generate EcoRI and
NdeI restriction sites (italics)).
All the constructs were verified by sequencing.
Promoter Activity Analysis--
MCF7 cells were transiently
transfected in 10-cm dishes using the calcium phosphate procedure with
5 µg of luciferase reporter plasmid, 5 µg of pCH110 plasmid
(Amersham Pharmacia Biotech) as an internal control for normalization
and 5 µg of pBluescribe plasmid. After an overnight incubation, cells
were washed and further incubated for 24-36 h. The cells were washed
and scrapped in PBS, transferred in an Eppendorf tube, and lysed with
150 µl of passive lysis buffer (Promega Corp., Madison, WI). Cell
debris were removed by centrifugation. 50 µl of cell extracts were
assayed for luciferase activity in an EG&G Berthold luminometer as
outlined by the manufacturer (Promega Corp.). The results were
normalized for -galactosidase activity. All transfections were
performed in duplicates or triplicates and repeated three times.
Nuclear Protein Extraction--
Nuclear extracts were performed
as previously described (20). Briefly, subconfluent cell cultures were
washed twice with PBS and resuspended in 0.8 ml of low salt buffer A
(10 mM HEPES-KOH, pH 7.9, 1.5 mM
MgCl2, 10 mM KCl, 0.5 mM DTT, 0.2 mM phenylmethylsulfonyl fluoride, protease inhibitor
mixture (including pepstatin, antipain, aprotinin, leupeptin, and
chymostatin at 2.5 µg/ml each, Roche Molecular Biochemicals,
Indianapolis, IN)). After 10 min on ice, the lysate was centrifuged and
the pellet was resuspended in high salt buffer C (20 mM
HEPES-KOH, pH 7.9, 26% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM phenylmethylsulfonyl fluoride,
protease inhibitor mixture). Nuclei were incubated for 30 min on ice
and centrifuged to remove cell debris. Protein concentration was
estimated by Bradford assay.
In Vitro DNase I Footprinting--
Footprinting was performed as
previously described (20). The 305/+22 promoter deletion fragment was
cloned into pBluecript SK+ and released by EcoRI and
EagI digestion. The resulting fragment was isolated and
purified to label the coding and non-coding strands by incorporating
either [ -32P]dCTP or [ -32P]dATP
(filling in the EagI and EcoRI overhangs,
respectively) with the Klenow enzyme. The purified labeled probes
(20,000 cpm) were mixed with 1 µg of poly[d(I·C)], 50 µg
of nuclear extract, and 50 µl of binding buffer (20 mM
HEPES-KOH, pH 7.9, 20% glycerol, 1 mM CaCl2,
10 mM MgCl2, 0.2 mM EDTA, 1 mM DTT), in the presence of 60 mM KCl in a
final volume of 100 µl. Binding was allowed to proceed for 15 min at
room temperature. DNA was digested for 2 min by DNase I (grade I, Roche
Molecular Biochemicals, Indianapolis, IN) at 15 milliunits/µl for
naked DNA, and 1-4 units/µl DNase I in the presence of protein
extract. The reaction was stopped by addition of 100 µl of stop
solution (1% SDS, 200 mM NaCl, 20 mM EDTA, pH
8, 40 µg/ml tRNA, 100 µg/ml proteinase K) 15 min at 37 °C. DNA
was extracted with phenol/chloroform, precipitated and resuspended in 5 µl of denaturing loading buffer. Digested DNA was resolved by
electrophoresis on a 6% polyacrylamide denaturing sequencing gel
containing 8 M urea. Sequencing reactions of known sequences were run in parallel to define the protected nucleotides. The
gel was vacuum-dried and exposed 24-36 h for autoradiography.
Electrophoretic Mobility Shift Assay--
Double-stranded
oligonucleotides with 5'-overhangs (20): Sp1,
5'-GTCTGAGGAGGTGGAGTCA and
5'-GACTCCTCCACCTCAGTTG; mutated Sp1,
5'-GTCTGATGAGGTTGAGTCA and
5'-GACTACTCCAACTCAGTTG; GT box, 5'-GTTCAGGACATGGTGGGTGGGGCTGTGTTCTCA and
5'-AGTCCTGTACCACCCACCCCGACACAAGAGTTG; mutated GT box,
5'-GTTCAGGACATGGCATACGGGGCTGTGTTCTCA and
5'-AGTCCTGTACCGTATGCCCCGACACAAGAGTTG (core binding
site or the mutated nucleotides are underlined) were labeled
with [ -32P]dCTP and [ -32P]dATP using
Klenow polymerase. Labeled probes (20,000 cpm) were added to 20 µl of
binding reaction containing 10 µl of binding buffer (20 mM HEPES-KOH, pH 7.9, 20% glycerol, 1 mM
CaCl2, 10 mM MgCl2, 0.2 mM EDTA, 1 mM DTT), 0.8 µg of
poly[d(I·C)] and 60 mM KCl and incubated with 6 µg of
nuclear extract for 15 min at room temperature. Competition and
supershift assays were performed by adding to the binding reaction a
100× excess of cold oligonucleotide and 0.4 µg of anti-Sp1 and/or
anti- Sp3 polyclonal antibodies (Santa Cruz Biotechnology Inc., Santa
Cruz, CA), respectively. The protein-DNA and protein-DNA-antibody
complexes were separated from the free probe by electrophoresis through
a 5% non-denaturing polyacrylamide gel. The gels were vacuum-dried and
exposed for autoradiography.
Protein Extraction and Western Blot Analysis--
The
rabbit polyclonal antiserum 1622 was obtained by immunization with the
synthetic peptide GISSLGVGSCGSSCRKC corresponding to the last
carboxyl-terminal residues of hHb1 coupled to ovalbumin using the
m-maleimidobenzoyl-N-hydroxysuccinimide ester
cross-linking reagent (Pierce, Rockford, IL), as previously
described (22).
Polytronized mouse back skin and cell lines were twice sonicated in (20 mM Tris, pH 7.5, 0.6 M KCl, 0.1% Triton X-100)
to prepare soluble and insoluble protein-enriched fractions. The protein extracts were separated by SDS-polyacrylamide gel
electrophoresis under reducing conditions and transferred onto a
nitrocellulose membrane. The hHb1- N protein was revealed with the
rabbit anti-hHb1 antiserum purified against the synthetic peptide. The
pan-cytokeratin monoclonal antibody C-11 (Sigma Chemical Co.)
recognizes simple- and stratified-epithelial cytokeratins. hHb1- N in
fusion with the GFP was recognized by the 1622 antiserum directed
against hHb1.
Immunofluorescence--
hHb1- N cDNA (GenBankTM accession
number X80197) was fused with the green fluorescence protein (GFP) tag
in the EcoRI-digested pEGFP-N2 vector
(CLONTECH Laboratories Inc.), and hHb1- N protein was localized using GFP fluorescence. Immunofluorescence detection of
the intermediate filaments was performed using the pan-cytokeratins C-11 antibody. Isolated HeLa cells were seeded on 12-mm coverslips in
24-well dishes and transfected with the pEGFP-N2-hHb1- N vector using
FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, IN). Cells were
fixed with 4% paraformaldehyde, washed, and permeabilized by two
washes of 10 min with 0.1% Triton X-100. Nonspecific binding sites
were blocked with 1% bovine serum albumin. Cells were incubated with
the pan-cytokeratin C-11 antibody for 1 h, washed, and then incubated for 30 min with a mouse-specific antibody coupled to the Cy-3
fluorochrome. Nuclei were stained with Hoechst. Labeled cells were
analyzed by fluorescence microscopy.
 |
RESULTS |
hHb1- N Expression in Human Breast Cancer Cell Lines--
Having
previously identified the ectopic expression of the truncated hHb1
mRNA, hHb1- N, in breast cancers (4, 5) we extended the
characterization of its expression using human breast cancer cell
lines. The truncated mRNA is expressed at various levels in the
different cell lines tested. hHb1- N is expressed in the MCF7 cell
line at basal levels, whereas high mRNA expression was found in the
SKBR3 cell line (Fig. 1). The T47D cell
line did not synthesize hHb1- N at a detectable level. According to previous data (5), hHb1- N expression was also not detected in normal
hairy skin (Fig. 1). So far, hHb1- N was only detected in mammary
cancer tissues and cell lines.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
hHb1 basic hair keratin is expressed as a
truncated isoform (hHb1- N) in human breast
cancer cell lines. 10 µg of total RNA of scalp, MCF7, SKBR3, and
T47D breast cancer cell lines were separated on a 1% agarose gel,
transferred onto a nitrocellulose membrane, and hybridized with an hHb1
3'-specific probe. The loading was controlled by 36B4
hybridization.
|
|
Absence of Genomic Alteration in the hHb1 Gene--
We decided to
evaluate the mechanism responsible for the expression of hHb1- N in
breast cancer cells. Expression of tumor cell-specific truncated
mRNA can result from gene alterations occurring during cell
transformation such as gene deletion, rearrangement, and chromosomal
translocation. In addition, the hHb1 gene maps to 12q11-13
(23, 24), a chromosomal region known to present several breakpoints in
solid tumors (25). To find out whether hHb1- N results from a genomic
deletion or rearrangement, we digested genomic DNA isolated from breast
cancer cell lines with five different restriction enzymes and analyzed
the restriction patterns of the hHb1 gene locus by Southern
blotting (Fig. 2 and data not shown). The
restriction pattern was identical between DNA from cell lines that
transcribed the hHb1- N (MCF7 and SKBR3) and the one that did not
(T47D). Thus, its expression does not arise from a translocation or an
obvious rearrangement event occurring in the hHb1 locus. We
next cloned the hHb1 gene by PCR from genomic DNA of the
SKBR3 cells and of the HBL100 immortalized breast cancer cells that expresses hHb1- N at a low level (data not shown). Up to 500 bp upstream of exon 1 of independently amplified genes from each cell line
was sequenced and showed the absence of a minor rearrangement event
over the promoter and gene sequences (GenBankTM accession numbers
Y19206 and Y13621) (23). Taken together, these data show that hHb1- N
expression is not due to a genomic alteration occurring in the
hHb1 locus.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 2.
hHb1- N does not
result from genomic alteration at the hHb1 locus.
A, schematic representation of the hHb1 gene. The
exons are depicted by boxes; the closed boxes
correspond to the hHb1- N coding region. The 3'-specific probe is
represented as a broken horizontal line above the
hHb1 gene. BglII restriction sites are indicated
by vertical bars. B, genomic DNA isolated from
MCF7, SKBR3, and T47D cells was digested with BglII or
BamHI restriction enzymes. Southern blot was hybridized with
the 3'-specific probe of hHb1. The size of the restriction
fragments containing the hHb1- N coding region is identical in the
different cell lines.
|
|
Mapping of the hHb1- N Transcription Initiation
Sites--
Another mechanism leading to the expression of truncated
mRNAs is the use of alternative promoters and/or alternative
splicing. To define a putative transcriptional regulatory region, we
first mapped the hHb1- N transcriptional start site by primer
extension (Fig. 3). An oligonucleotide
complementary to the hHb1- N mRNA was hybridized to total RNA
isolated from SKBR3 cells, which express high level of hHb1- N, or
control liver RNA. Extension of the cDNA resulted in six intense
SKBR3-specific cDNA bands, each differing in length by only one
nucleotide (92-97 bp), indicating that six adjacent sites located
around the hHb1 intron 4-exon 5 junction (nucleotides
3314-3319, starting from the regular translation initiation site of
the hHb1 gene) (23) are used for hHb1- N transcription
initiation. Two additional minor initiation sites were also mapped in
exon 5 (nucleotides 3324 and 3345). These sites were confirmed using
different SKBR3 RNA preparations and a second specific oligonucleotide
(Fig. 3). We subsequently confirmed the initiator nucleotides by
sequencing cDNA obtained by rapid amplification of cDNA 5'-ends
(RACE-PCR) of the hHb1- N at the positions 3314-3319 (data not
shown). Therefore, hHb1- N transcription is initiated at six adjacent
nucleotides located around the intron 4-exon 5 junction of the
hHb1 gene.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 3.
hHb1- N transcription
is initiated around the intron 4-exon 5 junction. Specific
antisense oligonucleotides 5'-GACAATGTCGTCATACTGTGC (left
panel) or 5'-CGGCAATGATGCAGTCCATGT (right panel)
were labeled and hybridized at 37 °C to 40 µg of SKBR3 or
liver total RNAs. The elongated single-stranded cDNAs were
resolved on a denaturing polyacrylamide gel. hHb1- N transcription
initiation sites were mapped relative to the full-length hHb1 cDNA
(on the left) and gene (on the right) sequences.
Initiator nucleotides are indicated in boldface capital
letters.
|
|
Identification of Promoter Activity in Intron 4 of the hHb1
Gene--
To determine the nature of the alternative promoter leading
to the hHb1- N expression, we analyzed the promoter activity of the
region 5' to the transcription initiation sites. We fused 5'-deleted
fragments to the firefly luciferase reporter gene in the promoterless
pGL3basic vector and defined their promoter activity by transient
transfection of MCF7 cells. The largest construct encompassing exon 1 to part of exon 5 of the hHb1 gene ( 3311/+22) showed a
50-fold induction of the luciferase activity relative to the pGL3basic
vector background (Fig. 4A).
Shorter 5'-deleted constructs beginning at exon 4 (A; 305/+22) and
mid-exon 4 (B; 235/+22) stimulated luciferase activity at a higher
extent (140- and 220-fold, respectively). Therefore, the first 235 bp
encompassing intron 4 contain a promoter activity responsible for
hHb1- N expression. In contrast, the upstream 3-kb region
( 3311/ 236) possesses a weak silencer activity. We further studied
the hHb1- N promoter located in intron 4 of the hHb1 gene.
The 5' deletions of the positive regulatory region (C; 150/+22 and D;
85/+22) progressively decreased luciferase activity (Fig.
4A). The shortest construct (E; 38/+22) retained a 4- to
5-fold stimulation of luciferase activity, indicating the
presence of a minimal promoter in the first 38 bp. Analyses of the
transcriptional potential of fragments encompassing the 3'-half of the
hHb1 gene did not allow the identification of additional
positive or negative regulatory activities (data not shown). Taken
together, we conclude that the 235 bp immediately upstream of the
initiation sites account for the hHb1- N transcription. hHb1- N
expression results from the activation of an alternative cryptic
promoter.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 4.
Intron 4 of hHb1 gene contains
hHb1- N promoter activity. In the
schematic representation of the hHb1 gene, exons are
depicted by open boxes. Luciferase reporter gene
(Luc) constructs are described under "Experimental
Procedures." Transcriptional activity was estimated in transiently
transfected MCF7 cells by luciferase assay and normalized for
transfection efficiency. Transfections were performed in triplicates
and repeated at least three times (mean ± S.D.). A,
serial 5'-deleted fragments of the hHb1 gene (thick
line) were fused to the luciferase reporter gene in the pGL3basic
vector to estimate promoter activity. B, overlapping
constructs encompassing hHb1- N regulatory sequences were fused to
the strong SV40 promoter in pGL3promoter vector to test their
regulatory activity.
|
|
To further characterize these cis-acting regulatory DNA
sequences, we examined whether they could modulate the activity of the
heterologous SV40-promoter present in the pGL3-promoter vector (Fig.
4B). The highest level of luciferase expression relative to
the SV40-promoter activity was found for the largest construct (BE,
235/ 39), consistent with the presence of positive regulatory elements. Its activity was only slightly reduced when BC or DE regions
were removed (CE, 150/ 39 and BD, 235/ 86, respectively). The
upstream region BC ( 235/ 151) did not modify by itself the SV40-promoter activity. In contrast, CD ( 150/ 86) or DE fragments ( 85/ 39) stimulated 2.5- and 2-fold the luciferase expression, respectively. Positive regulatory elements are thus mainly located in
these two CD and DE fragments. In the context of the hHb1- N proximal
promoter, deletion experiments showed that the DE fragment is more
active than the CD fragment (Fig. 4A). However, in the context of an heterologous promoter, isolated CD and DE fragments have
similar positive regulatory activities (Fig. 4B). Therefore, our results indicate that CD and DE fragments cooperate together and
with the minimal promoter region to induce hHb1- N expression.
Localization and Characterization of hHb1- N Regulatory
Elements--
To localize more precisely the regulatory elements that
account for the hHb1- N promoter activity, we mapped transcription factor-protected regions in the AE fragment by in vitro
DNase I footprinting experiments (Fig.
5A). The antisense strand of the 305/+22 promoter construct (A) was labeled and incubated with or
without nuclear extracts from MCF7, SKBR3, and T47D cells. Partial DNase I digestions were electrophoresed and analyzed on a
denaturing polyacrylamide gel. In the presence of nuclear extracts, three protected regions were detected between nucleotides 36 and 51
(FP I), nucleotides 57 and 72 (FP II), and nucleotides 102 and
123 (FP III) relative to the most 5'-transcription start site. Thus,
FP I- and FP II-protected regions are located within the DE fragment
that has a strong positive regulatory activity, whereas the third one,
FP III, is located in the CD fragment. These regions were protected
with a similar efficiency whether the nuclear extracts were isolated
from cells that express the hHb1- N mRNA (MCF7, SKBR3) or the one
that did not (T47D).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5.
Analyses of the regulatory elements present
in the hHb1- N promoter. A, the
305/+22 promoter fragment was analyzed by DNase I footprinting in the
absence or the presence of 50 µg of nuclear extract from breast
cancer cell lines as indicated. Naked and protected DNA were partially
digested with decreasing concentrations of DNase I and electrophoresed
in denaturing conditions. The three protected regions FP I to III were
mapped by means of a sequencing ladder. B, nucleotide
sequence of the exon 4 to mid-exon 5 region of the hHb1 gene
is represented, and the positions are indicated on the right
in respect to the relative translation initiation site of the hHb1
protein. hHb1 gene sequence was identical to the data bank
gene sequence except two nucleotides (nucleotides 3273 and 3275 are G
instead of T and C, respectively). hHb1- N promoter regulatory
elements are positioned within the hHb1 gene. hHb1- N
transcription initiation sites are boxed. Promoter sequence
positions are indicated on the left relative to the first
transcription initiator nucleotide. The 5'-ends of the serial deleted
promoter fragments are depicted by arrows and their
relative letters. DNase I footprint-protected sequences are
underlined and are referred to as FP I to
III. Putative Sp1 binding sites have been identified in the
protected regions and marked in boldface letters.
C, a double-stranded oligonucleotide that encompasses the
putative Sp1 binding element in the FP II protected region was labeled
and incubated with 6 µg of nuclear extract from MCF7, SKBR3, or T47D
cells. The complexes were separated from the free probe using a 5%
polyacrylamide gel. D, competition and supershift analyses
were done using MCF7 nuclear extracts. Competition experiments were
performed using a 100 molar excess of the wild-type (wt) or
a mutated (mt) oligonucleotide. Addition of Sp1 or Sp3
polyclonal antibodies (Ab) led to the disappearance of the
slower and the two faster migrating complexes, respectively, and to the
formation of a slower migrating ternary complex (SS,
supershift). Co-addition of Sp1 and Sp3 antibodies resulted
in the supershift of all three specific complexes. NS
indicates nonspecific binding.
|
|
We next wanted to identify the transcription factors that are able to
bind to these protected elements in the hHb1- N promoter. Analysis of
their sequences revealed the presence of two putative binding elements
for transcription factors of the Sp1 family. We identified a GT box
element (5'-GGTGGGTGGGG) in the FP I region and a Sp1 binding element
(5'-GAGGTGGAG) in the FP II region (Fig. 5B). However, no
known binding element could be found in the FP III region present in
the CD fragment. We next designed double-stranded oligonucleotides that
encompass the GT box element or the Sp1 binding element, and carried
out their ability to bind to transcription factors by electromobility
shift assays. Incubation of the GT box element (data not shown) or the
Sp1 binding element probes (Fig. 5C) with nuclear extracts
from MCF7, SKBR3, or T47D cells revealed three similar protein-DNA
complexes. The specificity of these complexes was demonstrated by their
efficient competition by an excess of cold wild-type but not of mutated
oligonucleotide (Fig. 5D). Addition of polyclonal antibodies
raised against Sp1 or Sp3 resulted in the complete elimination of the
slower migrating or the two faster migrating complexes, respectively,
and allowed for the formation of supershifted complexes (Fig.
5D). Finally, simultaneous incubation with both antibodies
supershifted all three specific complexes. Taken together, these data
demonstrate that the Sp1 and Sp3 transcription factors are the proteins
involved in the specific complexes formed with both Sp1 binding element and GT box element probes.
To ensure that the Sp1 binding sites are effectively responsible for
the transcriptional activity, mutated 85/+22 promoter fragments (D)
were generated (Fig. 6). Mutation of the
Sp1 binding element ( Sp1) or GT box element
( GTbox) resulted in a significant decrease of
the transcriptional activity. Moreover, the double-mutated construct
( Sp GT) dramatically inhibited
transcriptional activity. This activity is equivalent to that of the
38/+22 proximal promoter (E), showing therefore that mutation of the
two elements completely abolished the activity of the DE region. These
assays confirm that the two Sp1 binding sites are responsible for the
positive activity of the DE fragment.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
The Sp1 binding element and the GTbox element
are responsible for the in vitro positive regulatory
activity. 85/+22 fragments with single ( Sp1 or GTbox) or
double ( Sp GT) mutated Sp1/Sp3 binding sites were cloned in the
pGL3basic vector. Luciferase activity was assayed in MCF7 cells.
Transfections were done in duplicates and repeated three times
(mean ± S.D.). Sp1, Sp1 binding element;
GTbox, GT box element; mt, mutated.
|
|
Epigenetic Regulation of hHb1- N Expression--
The promoter
analyses indicated that the positive regulatory cis-elements
that drive hHb1- N expression are restricted to intron 4 of
hHb1 gene. Moreover, all the regulatory factors we have
identified (i.e. Sp1 and Sp3 transcription factors) are
present and active in cells, independently of their capacity to
transcribe hHb1- N (Fig. 5, A and C). In
addition, six basic hair keratin genes have been identified (3).
hHb1 hair keratin is highly related to hHb6
(GenBankTM accession number AJ000263) (23). In particular, intron 4 sequences of hHb1 and hHb6 are 98% conserved, and the three protected regions identified by footprinting are strictly
conserved. Moreover, using in vitro reporter assays in MCF7
cells, the intron 4 of hHb6 is able to drive the expression of the luciferase reporter gene at a similar extent to that of the
corresponding hHb1 region (data not shown). We
studied, therefore, whether hHb6 hair keratin is expressed in breast
cancer cell lines. Neither full-length nor truncated hHb6 is detected
in breast cancer cell lines that express high or detectable level of
hHb1- N, whereas the 2-kb hHb6 full-length transcript is detected in
the hairy skin sample (Fig. 7). Thus, the
specificity of in vivo expression of hHb1- N in breast
cancer does not solely lie in the promoter sequence but might also be
dependent on an epigenetic process.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 7.
hHb6 basic hair keratin is not expressed in
breast cancer cell lines. The Northern blot of Fig. 1 was
rehybridized with a 3'-specific probe of hHb6. Full-length hHb6 is
expressed as a 2-kb mRNA in human scalp. No truncated form can be
seen in breast cancer cells. The probe slightly hybridized to 28 S
ribosomal RNA. The lower band observed in scalp is due to
the presence of 18 S RNA.
|
|
Gene methylation/demethylation events are involved in cancer
progression-dependent gene expression (26). To examine
whether methylation might regulate hHb1- N expression, we treated
MCF7, SKBR3, and T47D cells with increasing doses of
5-aza-2'-desoxycytidine (5-Aza-2'dC), a DNA methyltransferase inhibitor
(Fig. 8A). 5-Aza-2'dC is
incorporated into the newly synthesized DNA strand during replication and depletes the cell of methyltransferase activity by forming a
covalent complex with the enzyme. Cells were treated with two 24-h
pulses on days 2 and 5 with 0.5, 2, or 10 µg/ml 5-Aza-2'dC, and RNA
were prepared on day 7. At 0.5 and 2 µg/ml, the cells still grew and
no significant changes in their morphology were noticed. However, at 10 µg/ml, the cells stopped growing and cell death was significant,
especially for SKBR3 cells (Fig. 8A, lane 8). The
cell lines displayed different responses to 5-Aza-2'dC treatment. The
basal level of hHb1- N expression in MCF7 cells was increased in a
dose-dependent manner. However, the high level of hHb1- N
expression was not modified in SKBR3 cells, and 5-Aza-2'dC treatment
did not induce hHb1- N expression in the T47D cell line even at the
highest dose. The effect of consecutive 5-Aza-2'dC pulses was also
tested (Fig. 8B). MCF7 cells were treated with one, two, or
three 24-h pulses with 2 µg/ml 5-Aza-2'dC dose, and total RNA was
prepared 24 h after the end of the last treatment. Northern blot
analysis showed that hHb1- N expression increased with the number of
pulses. We conclude that hHb1- N expression is dependent on genomic
DNA demethylation.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 8.
hHb1- N is induced in
response to 5-Aza-2'-desoxycytidine treatment. A, MCF7,
SKBR3, and T47D cells were treated with two 24-h pulses using either
0.5 (lanes 2, 6, and 10), 2 (lanes 3, 7, and 11), or 10 µg/ml
(lanes 4, 8, and 12) 5-Aza-2'dC. Total
RNA was prepared 24 h after the end of the second treatment.
Northern blot (10 µg of RNA) hybridization was performed using
3'-hHb1 and 36B4 probes for loading control. B, MCF7 cells
were treated with 2 µg/ml 5-Aza-2'-dC during one, two, or three 24-h
pulses. RNA were isolated 24 h after the end of the last
treatment. hHb1- N expression was assayed using the 3'-hHb1 probe.
C, MCF7 cells were treated with 2 µg/ml 5-Aza-2'dC for 5 days, then with 2, 10, or 50 µg/ml cycloheximide for the last 72 or
24 h. hHb1- N expression was assayed by Northern blot using the
3'-hHb1 probe.
|
|
We analyzed whether hHb1- N expression could be induced through an
indirect mechanism requiring protein neosynthesis. 2 µg/ml 5-Aza-2'dC
was added in the culture medium of MCF7 cells for 5 days. During the
last 72 or 24 h of 5-Aza-2'dC treatment, cells were additionally
treated with 2, 10, or 50 µg/ml cycloheximide, an inhibitor of
protein translation. Cycloheximide was not deleterious for MCF7 cells,
because the growth rate decreased only slightly at the highest
concentration. However, the cycloheximide treatment resulted in the
reduction of hHb1- N expression in a dose- and time-dependent manner (Fig. 8C). Therefore,
these data show that hHb1- N induction through DNA demethylation is
indirect and requires protein neosynthesis.
hHb1- N Protein Expression in Vivo--
hHb1- N protein (Fig.
9A) translation was assessed
with a purified rabbit polyclonal antibody raised against the
carboxyl-terminal peptide of the tail domain of hHb1 hair keratin. By
Western blot, this antibody recognized several proteins from the
insoluble fraction of a mouse back skin extract (Fig. 9B).
This antibody does not recognize cytokeratins, because no bands were
detected in cancer cell line extracts, indicating that it is specific
of hair keratins. Accordingly, the pan-cytokeratin C-11 antibody, which
recognizes simple and stratified epithelial cytokeratins, detected
several bands of about 30-75 kDa in the insoluble fraction of all
breast cancer cell line extracts (Fig. 9C). The 30-kDa
hHb1- N protein was specifically detected in both soluble and
insoluble fractions of SKBR3 cells (Fig. 9B) that exhibited
the highest levels of hHb1- N mRNA (Fig. 1). Our results indicate
that the hHb1- N protein is translated in vivo in breast
cancer cells.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 9.
hHb1- N protein is
partially co-localized within cytokeratin intermediate filaments.
A, schematic representation of the hHb1
(upper) and hHb1- N (lower) proteins. The rod
domain of hHb1 contains conserved -helical structures
(1A, 1B, 2A, and 2B)
interrupted by linker sequences (L1, L12, and
L2). It is flanked by the terminal head- and tail-domains.
The hHb1- N protein (amino acids 270-506) contains the second
-helical subdomain and the tail-domain. B, soluble
(left panel) and insoluble (right panel) protein
extracts of mouse back skin or cell lines were resolved by
SDS-polyacrylamide gel electrophoresis on a 10% acrylamide gel.
hHb1- N protein was detected with the 1622 rabbit polyclonal antibody
raised against the carboxyl-terminal peptide of the tail domain of
hHb1. The size of the protein detected in SKBR3 cells is consistent
with the hHb1- N size. Note that full-length hair keratins were only
detected in the insoluble fraction of hairy skin. There is no
cross-reaction with cytokeratins. C, the blot corresponding
to the insoluble extracts was reprobed with the monoclonal antibody
C-11 recognizing several cytokeratins. D, Western blot
analysis of cell extracts (30 µg) from HeLa cells transfected with
GFP or hHb1- N-GFP expression vectors. Revelation was performed using
the 1622 antiserum directed against hHb1- N. E,
transfected hHb1- N-GFP was localized in HeLa cells by GFP
fluorescence (green, middle panel). The
cytokeratin intermediate filament network was detected by indirect
immunofluorescence using the pan-cytokeratins antibody C-11 and
Cy3-coupled anti-mouse antibodies (red, upper
panel). Co-localization of hHb1- N-GFP and intermediate
filaments is shown in yellow (lower panel).
|
|
Subcellular Localization of the hHb1- N Protein--
The
expression of such a truncated hair keratin in breast cancer cells
prompted us to analyze whether it could participate to the cytoskeleton
network. Subcellular localization of hHb1- N protein was studied by
fluorescence microscopy (Fig. 9E, middle panel).
We could not study the localization of the endogenous hHb1- N keratin
in SKBR3 cells, because these cells are poorly adhesive rounded cells
and display a very high nucleus-to-cytoplasm ratio. Thus, a GFP tag was
fused to the hHb1- N cDNA at the carboxyl-terminal end and
transiently transfected in HeLa cells that did not express hHb1- N
(Fig. 9B). We verified by Western blot that the fusion protein was expressed and not degraded in HeLa cells (Fig.
9D). A carboxyl-terminal GFP tag has been shown not to
interfere with the incorporation of a keratin into intermediate
filaments (27). Cells transfected with the GFP alone displayed a faint
homogeneous staining in the cytoplasm (data not shown). HeLa cell
morphology was not significantly modified upon hHb1- N transfection.
The hHb1- N protein was detected in the cytoplasm in a non-homogenous distribution, illustrative of a filament network. The hHb1- N protein
accumulated at the cell periphery and in large cytoplasmic filaments
that became thinner near the cell membrane (Fig. 9E, middle panel).
To determine whether hHb1- N protein co-localizes with cytokeratin
filaments, double immunofluorescence was performed with the
pan-cytokeratin monoclonal antibody C-11. Intermediate filaments form a
network in the cytoplasm that is denser in the perinuclear region (Fig.
9E, upper panel). Double detection of the
hHb1- N and cytokeratin proteins showed that hHb1- N partially
co-localizes with the endogenous intermediate filament network, notably
in some large bundles (Fig. 9E, lower panel).
Furthermore, the hHb1- N filament network extends further toward the
cell membrane than does the cytokeratin network.
 |
DISCUSSION |
The hHb1 hair keratin has been reported to be expressed in
pilomatricoma skin tumors, which are characterized by a follicular differentiation (11, 12). Surprisingly, although the normal hHb1 promoter is silent in normal and malignant breast
cells, because no full-length hHb1 mRNA was detected in these
cells, a truncated hHb1 mRNA isoform (hHb1- N) was observed in
cancerous epithelial cells of breast carcinomas (4, 5). Thus, hHb1 is
the first hair keratin whose expression was documented in carcinomas other than skin carcinomas. In addition, this expression of hHb1 is
particularly intriguing, because it corresponds to a 5'-truncated isoform never documented so far. In this study, we provide insights into the transcriptional mechanism responsible for this expression and
into the presence of the corresponding protein in cancer cells.
We looked for the ectopic expression of other basic hair keratins,
namely hHb3, hHb5 and hHb6, as well as the hHb1 acidic heterodimeric
partner hHa1 in breast cancer cell lines. None of these keratins were
detected in the cell lines. Due to the high conservation of basic hair
keratin gene structures and sequences (23, 24), the regulatory
mechanism responsible for the ectopic expression of the hHb1- N
mRNA must be tightly controlled. Basic hair keratin genes are
clustered on chromosome 12q13, a common locale for chromosomal
breakpoints in several cancer types, including breast cancers (25).
However, we did not detect any chromosomal rearrangement or
modification of the hHb1 gene. hHb1- N expression is
therefore not the result of gene or chromosomal alteration. Moreover,
no sequence differences were found in the gene locus between breast
cancer cell lines that express hHb1- N and those that do not.
hHb1- N expression is never detected in the hair follicle and,
consequently, is unlikely to involve the same transcriptional elements
as the full-length hHb1 basic hair keratin. Alternative promoter is a
frequent mean through which diversity in the complex physiological
patterns of gene expression are created (28). Moreover, cancer-specific
expression has also been described to be achieved through specific
cryptic promoters silent in physiological conditions (29). Thus,
because hHb1- N transcription is initiated at the intron 4-exon 5 junction of the hHb1 gene, its expression may be due to the
specific activation of a cryptic promoter. We defined an hHb1- N
promoter located in the fourth intron of the hHb1 gene. A
short 38-bp promoter fragment is sufficient to induce transcription of
the luciferase reporter gene. Its activity is stimulated by two
functional Sp1 binding sites that are located close to the minimal
promoter. Site-directed mutagenesis of these elements inhibited the
stimulation of the expression of the minimal hHb1- N promoter.
Furthermore, electromobility shift assays allowed for the
identification of Sp1- and Sp3-containing complexes. These transcription factors are ubiquitously expressed and are involved in
the regulation of numerous genes (30). Therefore, hHb1- N expression
results from the specific activation of a cryptic promoter containing
two Sp1 binding sites located next to a minimal promoter.
However, several observations suggest the need for a more complex
transcriptional regulation of hHb1- N expression. Thus, the intronic
sequence containing the hHb1- N promoter activity is 98% conserved
in the hHb6 basic hair keratin gene. Nevertheless, there is
no in vivo expression of truncated hHb6, although this intronic hHb6 region is able to in vitro induce
transcription. These data suggest that an additional regulatory
mechanism should be responsible for hHb1 in vivo expression
in breast cancer cells. Subsequently, the hHb1- N promoter is
composed of an initiator element and two functional Sp1 binding
elements. Analysis by DNase I-hypersensitive sites mapping and
transient reporter gene assays did not reveal additional
cis-acting positive regulatory regions within an 8-kb
genomic region encompassing the hHb1- N coding region and the 5'- and
3'-flanking sequences.2
Interestingly, transcription from the TATA-less promoter of the leukosialin gene is also mediated by a single GTbox element
40 bp upstream of the transcription start site, but no other
cis-acting regulatory activity responsible for the cell
type-specific expression could be identified (31). However, DNA
methylation around the 5'-flanking region of the leukosialin
gene is required to shut off the high level of expression, showing that
tissue-specific expression is achieved by alteration of DNA methylation
(32). We thus wondered whether the epigenetic processes of methylation could be involved in the breast cancer cell-specific expression of
hHb1- N. We showed that the endogenous hHb1- N expression is increased in response to 5-Aza-2'dC, a demethylating reagent, in MCF7
breast cancer cells, and this effect is dose-dependent. DNA
methylation is, therefore, clearly involved in hHb1- N
transcriptional regulation.
However, because hHb1- N expression is not induced in T47D cells in
response to 5-Aza-2'dC, we also propose that another protein should
participate to the breast cancer cell specificity of hHb1- N expression. Consistently, because hHb1- N is never expressed under normal physiological conditions but only in transformed cells, its
induction in response to DNA demethylation should involve an indirect
mechanism. Indeed, blocking protein expression by cycloheximide led to
the abolition of hHb1- N transcription in response to 5-Aza-2'dC
treatment. Thus, the induction of hHb1- N does not result from the
direct demethylation of the hHb1- N genomic region. This result
raises the possibility of the involvement of the induction or the
increased activation of a transactivator. Sp1 activity was previously
shown to be increased in response to demethylating reagents at the
level of protein stability (33) or DNA binding activity (34). However,
in the hHb1- N promoter, neither Sp1 expression nor its binding
activity were notably altered in response to 5-Aza-2'dC.2
We thus exclude the possibility that the effect of 5-Aza-2'dC occurs at
the Sp1 gene locus or at a gene locus whose product modifies Sp1
activity. hHb1- N induction through demethylation is thus dependent
on the synthesis and/or activation of an unknown protein. Therefore,
the expression of an undefined factor in response to 5-Aza-2'dC could
be sufficient to induce the expression of hHb1- N and presumably
other target genes, whose products might be essential in promoting
cancer progression.
We have also investigated the translation of hHb1- N mRNA. We
raised a polyclonal antibody against the carboxyl-terminal end of the
hHb1 protein. This antibody allowed for the specific detection of hair
basic keratins in the insoluble fraction of mouse skin extracts.
Endogenous hHb1- N protein was detected in both soluble and insoluble
fractions of the SKBR3 breast cancer cell line extracts, showing that
the truncated hHb1- N mRNA is translated in vivo. Because insoluble fractions contain the structural cytoskeleton proteins, this also suggested that hHb1- N might be at least
partially associated with the cytoskeleton. Consistently,
fluorescence-mediated localization of the hHb1- N protein in
HeLa-transfected cells depicts a filament network covering the entire
cytoplasm of the cell, indicating that hHb1- N either participates in
the cytoskeleton or homo-polymerizes to constitute a particular network.
Keratins form obligatory heterodimers in vivo and have
specific functions that are fulfilled by the amino- and
carboxyl-terminal domains (35-38). In epidermal keratin replacement
experiments in mouse, the carboxyl-terminal domain clearly dictates the
function of a chimeric keratin (38). Forced expression of some foreign keratins enables their integration into the endogenous intermediate filament network both in cell culture and in in vivo mouse
models (35, 38-40). Moreover, forced expression of an
amino-terminal-truncated epidermal cytokeratin beginning at the 1B
subdomain was shown to lead to the collapse of the intermediate
filament network, resulting in very thin bundles of jagged fibers (39).
Altogether, these results suggested that the hHb1- N protein might
fulfill a dominant negative function by inducing the collapse of the
intermediate filament network. However, the cytokeratin network,
partially overlapping that of hHb1, was not obviously modified upon
hHb1- N expression, showing that hHb1- N does not induce its
collapse, and suggesting that hHb1- N protein is unlikely to be
incorporated during neo-synthesis of intermediate filaments. Finally,
the intermediate filaments are a dynamic structure in continuous motion
(27), and replacement of incorporated keratins with soluble subunits is
a constant mechanism to ensure filament dynamism (41). Thus, hHb1- N
may be involved in similar process and alters the function of the
pre-existing keratin filaments through its specific carboxyl-terminal domain. In this context, it has been shown that mHa1 or mHb4 hair keratins transiently expressed in HeLa cancer cells can be incorporated in cytokeratin intermediate filaments without evident alteration of the
network (42).
 |
ACKNOWLEDGEMENT |
We thank S. Chan for critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by funds from INSERM, CNRS,
the Hôpital Universitaire de Strasbourg, the Bristol-Myers Squibb Pharmaceutical Research Institute, the Association pour la Recherche sur le Cancer, the Ligue Nationale Française contre le Cancer and
the Comités du Haut-Rhin et du Bas-Rhin, and the Fondation de
France.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Recipient of a Ligue Nationale Française contre le Cancer fellowship.
§
To whom correspondence should be addressed: Tel.: 33-3-88-65-34-24;
Fax: 33-3-88-65-32-01; E-mail: rio@igbmc.u-strasbg.fr.
Published, JBC Papers in Press, April 13, 2001, DOI 10.1074/jbc.M101687200
2
A. Boulay, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
hHb1, human hair
keratin basic 1;
5-Aza-2'dC, 5-aza-2'-deoxycytidine;
PCR, polymerase
chain reaction;
PBS, phosphate-buffered saline;
PIPES, 1,4-piperazinediethanesulfonic acid;
DTT, dithiothreitol;
GFP, green
fluorescence protein;
bp, base pair(s);
kb, kilobase(s).
 |
REFERENCES |
| 1.
|
Bloemendal, H.,
and Pieper, F. R.
(1989)
Biochim. Biophys. Acta
1007,
245-253
|
| 2.
|
Rogers, M. A.,
Winter, H.,
Wolf, C.,
Heck, M.,
and Schweizer, J.
(1998)
J. Biol. Chem.
273,
26683-26691
|
| 3.
|
Rogers, M. A.,
Winter, H.,
Langbein, L.,
Wolf, C.,
and Schweizer, J.
(2000)
J. Invest. Dermatol.
114,
464-472
|
| 4.
|
Tomasetto, C.,
Regnier, C.,
Moog-Lutz, C.,
Mattei, M. G.,
Chenard, M. P.,
Lidereau, R.,
Basset, P.,
and Rio, M. C.
(1995)
Genomics
28,
367-376
|
| 5.
|
Regnier, C. H.,
Boulay, A.,
Asch, P. H.,
Wendling, C.,
Chenard, M. P.,
Tomasetto, C.,
and Rio, M. C.
(1998)
Br J Cancer
78,
1640-1644
|
| 6.
|
Fuchs, E.
(1997)
Mol. Biol. Cell
8,
189-203
|
| 7.
|
Nathrath, W. B.,
and Lane, E. B.
(1994)
in
Prospects in Diagnosis and Treatment of Breast Cancer
(Schmitt, M.
, and Kindermann, G., eds)
, pp. 57-62, Elsevier Science, New York
|
| 8.
|
Winter, H.,
Rogers, M. A.,
Gebhardt, M.,
Wollina, U.,
Boxall, L.,
Chitayat, D.,
Babul-Hirji, R.,
Stevens, H. P.,
Zlotogorski, A.,
and Schweizer, J.
(1997)
Hum Genet
101,
165-169
|
| 9.
|
Korge, B. P.,
Hamm, H.,
Jury, C. S.,
Traupe, H.,
Irvine, A. D.,
Healy, E.,
Birch-MacHin, M.,
Rees, J. L.,
Messenger, A. G.,
Holmes, S. C.,
Parry, D. A.,
and Munro, C. S.
(1999)
J. Invest. Dermatol.
113,
607-612
|
| 10.
|
Winter, H.,
Rogers, M. A.,
Langbein, L.,
Stevens, H. P.,
Leigh, I. M.,
Labreze, C.,
Roul, S.,
Taieb, A.,
Krieg, T.,
and Schweizer, J.
(1997a)
Nat. Genet.
16,
372-374
|
| 11.
|
Regnier, C. H.,
Asch, P. H.,
Grosshans, E.,
and Rio, M. C.
(1997)
Exp. Dermatol.
6,
87-90
|
| 12.
|
Cribier, B.,
Asch, P. H.,
Regnier, C.,
Rio, M. C.,
and Grosshans, E.
(1999)
Br. J. Dermatol.
140,
600-604
|
| 13.
|
Albers, K.,
and Fuchs, E.
(1987)
J. Cell Biol.
105,
791-806
|
| 14.
|
Coulombe, P. A.,
Chan, Y. M.,
Albers, K.,
and Fuchs, E.
(1990)
J. Cell Biol.
111,
3049-3064
|
| 15.
|
Rogers, G. E.,
and Powell, B. C.
(1993)
J. Invest. Dermatol.
101,
50S-55S
|
| 16.
|
van Genderen, C.,
Okamura, R. M.,
Farinas, I.,
Quo, R. G.,
Parslow, T. G.,
Bruhn, L.,
and Grosschedl, R.
(1994)
Genes Dev.
8,
2691-2703
|
| 17.
|
Zhou, P.,
Byrne, C.,
Jacobs, J.,
and Fuchs, E.
(1995)
Genes Dev.
9,
700-713
|
| 18.
|
DasGupta, R.,
and Fuchs, E.
(1999)
Development
126,
4557-4568
|
| 19.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
|
| 20.
|
Luo, D.,
Guerin, E.,
Ludwig, M. G.,
Stoll, I.,
Basset, P.,
and Anglard, P.
(1999)
J. Biol. Chem.
274,
37177-37185
|
| 21.
|
Noel, A.,
Santavicca, M.,
Stoll, I.,
L'Hoir, C.,
Staub, A.,
Murphy, G.,
Rio, M. C.,
and Basset, P.
(1995)
J. Biol. Chem.
270,
22866-22872
|
| 22.
|
Muller, D.,
Wolf, C.,
Abecassis, J.,
Millon, R.,
Engelmann, A.,
Bronner, G.,
Rouyer, N.,
Rio, M. C.,
Eber, M.,
Methlin, G.,
and Basset, P.
(1993)
Cancer Res.
53,
165-169
|
| 23.
|
Bowden, P. E.,
Hainey, S. D.,
Parker, G.,
Jones, D. O.,
Zimonjic, D.,
Popescu, N.,
and Hodgins, M. B.
(1998)
J. Invest. Dermatol.
110,
158-164
|
| 24.
|
Rogers, M. A.,
Nischt, R.,
Korge, B.,
Krieg, T.,
Fink, T. M.,
Lichter, P.,
Winter, H.,
and Schweizer, J.
(1995)
Exp. Cell Res.
220,
357-362
|
| 25.
|
Van de Ven, W. J.,
Schoenmakers, E. F.,
Wanschura, S.,
Kazmierczak, B.,
Kools, P. F.,
Geurts, J. M.,
Bartnitzke, S.,
Van den Berghe, H.,
and Bullerdiek, J.
(1995)
Genes Chromosomes Cancer
12,
296-303
|
| 26.
|
Jones, P. A.,
and Laird, P. W.
(1999)
Nat. Genet.
21,
163-167
|
| 27.
|
Windoffer, R.,
and Leube, R. E.
(1999)
J. Cell Sci.
112,
4521-4534
|
| 28.
|
Ayoubi, T. A.,
and Van De Ven, W. J.
(1996)
FASEB J.
10,
453-460
|
| 29.
|
Bernard, O.,
Azogui, O.,
Lecointe, N.,
Mugneret, F.,
Berger, R.,
Larsen, C. J.,
and Mathieu-Mahul, D.
(1992)
J. Exp. Med.
176,
919-925
|
| 30.
|
Philipsen, S.,
and Suske, G.
(1999)
Nucleic Acids Res.
27,
2991-3000
|
| 31.
|
Kudo, S.,
and Fukuda, M.
(1994)
Eur. J. Biochem.
223,
319-327
|
| 32.
|
Kudo, S.,
and Fukuda, M.
(1995)
J. Biol. Chem.
270,
13298-13302
|
| 33.
|
Ammanamanchi, S.,
Kim, S. J.,
Sun, L. Z.,
and Brattain, M. G.
(1998)
J. Biol. Chem.
273,
16527-16534
|
| 34.
|
Shin, T. H.,
Paterson, A. J.,
Grant, J. H. d.,
Meluch, A. A.,
and Kudlow, J. E.
(1992)
Mol. Cell. Biol.
12,
3998-4006
|
| 35.
|
Takahashi, K.,
Folmer, J.,
and Coulombe, P. A.
(1994)
J. Cell Biol.
127,
505-520
|
| 36.
|
Paladini, R. D.,
and Coulombe, P. A.
(1998)
J. Cell Biol.
142,
1035-1051
|
| 37.
|
Hutton, E.,
Paladini, R. D., Yu, Q. C.,
Yen, M.,
Coulombe, P. A.,
and Fuchs, E.
(1998)
J. Cell Biol.
143,
487-499
|
| 38.
|
Paladini, R. D.,
and Coulombe, P. A.
(1999)
J. Cell Biol.
146,
1185-1201
|
| 39.
|
Albers, K.,
and Fuchs, E.
(1989)
J. Cell Biol.
108,
1477-1493
|
| 40.
|
Galou, M.,
Gao, J.,
Humbert, J.,
Mericskay, M.,
Li, Z.,
Paulin, D.,
and Vicart, P.
(1997)
Biol. Cell
89,
85-97
|
| 41.
|
Miller, R. K.,
Khuon, S.,
and Goldman, R. D.
(1993)
J. Cell Biol.
122,
123-135
|
| 42.
|
Yu, D. W.,
Pang, S. Y.,
Checkla, D. M.,
Freedberg, I. M.,
Sun, T. T.,
and Bertolino, A. P.
(1991)
J. Invest. Dermatol.
97,
354-363
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|