|
Originally published In Press as doi:10.1074/jbc.M010873200 on April 13, 2001
J. Biol. Chem., Vol. 276, Issue 25, 23018-23027, June 22, 2001
An araC-controlled Bacterial
cre Expression System to Produce DNA Minicircle Vectors for
Nuclear and Mitochondrial Gene Therapy*
Brian W.
Bigger ,
Oleg
Tolmachov,
Jean-Marc
Collombet,
Michalis
Fragkos,
Iwona
Palaszewski, and
Charles
Coutelle
From the Cystic Fibrosis Gene Therapy Group, Division of Biomedical
Sciences, SAF Bldg., Imperial College of Science, Technology and
Medicine, Exhibition Rd., London SW7 2AZ, United Kingdom
Received for publication, December 1, 2000, and in revised form, April 2, 2001
 |
ABSTRACT |
The presence of CpG motifs and their associated
sequences in bacterial DNA causes an immunotoxic response following the
delivery of these plasmid vectors into mammalian hosts. We describe a
biotechnological approach to the elimination of this problem by the
creation of a bacterial cre recombinase expression system,
tightly controlled by the arabinose regulon. This permits the
Cre-mediated and -directed excision of the entire bacterial
vector sequences from plasmid constructs to create supercoiled gene
expression minicircles for gene therapy. Minicircle yields using
standard culture volumes are sufficient for most in vitro
and in vivo applications whereas minicircle expression
in vitro is significantly increased over standard plasmid
transfection. By the simple expedient of removing the bacterial DNA
complement, we significantly reduce the size and CpG content of these
expression vectors, which should also reduce DNA-induced inflammatory
responses in a dose-dependent manner. We further describe
the generation of minicircle expression vectors for mammalian
mitochondrial gene therapy, for which no other vector systems currently
exist. The removal of bacterial vector sequences should permit
appropriate transcription and correct transcriptional cleavage from the
mitochondrial minicircle constructs in a mitochondrial environment and
brings the realization of mitochondrial gene therapy a step closer.
 |
INTRODUCTION |
There is increasing evidence to suggest that plasmid DNA used for
non-viral gene delivery can cause unacceptable inflammatory responses
in eukaryotes (1-5). These immunotoxic responses are largely due to
the presence of unmethylated CpG motifs and their associated
stimulatory sequences on plasmids, following bacterial propagation of
plasmid DNA. Simple methylation of DNA in vitro may be
enough to reduce an inflammatory response but is likely to result in
severely depressed gene expression (6). The removal of CpG islands by
cloning out, or elimination of non-essential sequences is more
successful in reducing inflammatory responses but is time-consuming and
tedious (7).
Because bacterial DNA contains on average four times more CpG islands
than does mammalian DNA (8), a good solution is to entirely eliminate
the bacterial control regions from gene delivery vectors during the
process of plasmid production.
Removal of bacterial sequences needs to be efficient, using the
smallest possible excision site, while creating supercoiled DNA
minicircles, consisting solely of gene expression elements under
appropriate mammalian control regions.
This can be achieved by the use of Cre recombinase, a bacteriophage
P1-derived integrase (9-11), catalyzing site-specific recombination
between direct repeats of 34 base pairs (loxP sites).
In the case of a supercoiled plasmid containing DNA flanked by two
loxP sites in the same orientation, Cre recombination
produces two DNA molecules that are topologically unlinked, circular,
and mainly supercoiled (10), each containing a single
34-bp1 loxP site.
Efficient minicircle production requires the use of a stable bacterial
based cre expression system for efficient production of
supercoiled DNA. However, currently available bacterial strains do not
have sufficient control of cre recombinase expression to avoid leakage during the bacterial and concomitant plasmid growth phases (12).
This leads to premature Cre recombination, resulting in loss of the
replication-deficient minicircle due to out-competition by the
replication-competent and antibiotic-resistant bacterial vector.2
We therefore utilized the tightly controlled arabinose expression
system (13-15, for review see Ref. 16) to create a
cre-expressing bacterial strain, which is both stable and
easily controllable by altering the carbon source available for
metabolism by these bacteria.
To increase minicircle yield we have improved the kinetics of the
cre/loxP reaction by modification of the loxP
sites (17, 18) to induce a shift in reaction equilibrium toward
increased production of minicircle. This will also serve to reduce
concatamer formation from multiple copies of minicircle DNA.
This approach to eliminating bacterial DNA from delivery vectors is
also stimulated by our work on the development of expression vectors
for use in mitochondrial gene therapy. Our aim is to express an
ornithine transcarbamylase gene sequence, modified for mitochondrial translation (sOTC), within mitochondria (19). Because no vectors exist
for mammalian mitochondrial gene expression, we have inserted the sOTC
gene between two tRNA genes within the entire mouse mitochondrial genome, cloned into a bacterial plasmid vector for propagation (19,
20). Due to the rarity of non-coding sequences within mammalian mtDNA
the presence of a bacterial vector is likely to be deleterious to
either or all of the processes of mitochondrial RNA splicing,
replication, and transcription. Elimination of the bacterial vector
sequences should both overcome this problem and reduce the size of
these vectors, increasing the ease of their introduction into mitochondria.
In this paper we describe the construction and testing of a bacterial
strain exhibiting tightly controlled and efficient expression of
cre recombinase. We have developed this system for DNA
minicircle generation using a wide range of producer plasmids designed
for both nuclear and mitochondrial gene expression with sizes ranging from 6 to 20 kb. We also demonstrate the use of mutant loxP
sites to direct the Cre reaction resulting in improved yields of
supercoiled luciferase minicircle, as well as showing significantly
increased gene expression in vitro of this construct over
standard plasmid vectors.
 |
EXPERIMENTAL PROCEDURES |
Plasmids, Strains, and Oligonucleotides
Plasmid pBC SK(+) was purchased from Stratagene, Plasmid
pDSRed1-N1 was purchased from CLONTECH. Plasmids
p705Cre, pBAD33Cre, and pSVpAX1, as well as bacterial strain MM294,
were kind gifts from Dr. F. Buchholz and Dr. A. F. Stewart (EMBL).
Plasmid pCIKluc was a gift from Dr. D. Gill and Dr. S. Hyde (Oxford
University). Mitochondrial plasmids pRSmtOTCAPr, and
pRSmtJMC, were made as previously described (21). Oligonucleotides (Genosys) DLOX
5'-GGAATTCATAACTTCGTATAATGTATGCTATACGAAGTTATTAATCTCGAGTAATAACTTCGTATAATGTATGCTATACGAAGTTATGGTACCGCGCCCG-3' and REVDL 5'-CGGGCGCGGTACCATAACT-3' were used to synthesize a DNA
fragment with two loxP sites to ultimately create plasmid pDlox3, as well as to reconstruct the ND5/ND6 junction to create pDlox1. Oligonucleotides LINK1
5'-TCGAGTCGACTCTAGAGGATCCGAGCTCCCCGGGAAGCTTCTGCAGT-3' and LINK2
5'-TCGAACTGCAGAAGCTTCCCGGGGAGCTCGGATCCTCTAGAGTCGAC-3' were used to
create a polylinker sequence for the plasmid pDlox3. Oligonucleotides
LoxF
5'-CTCGAATTCATAACTTCGTATAGCATACATTATACGAACGGTACTCGAGTACCGTTCGTATAGCATACATTATACGAAGTTATGGTACCAAAAA-3' and LoxR5'-TTTTTGGTACCATAACT-3' were used to create LE and RE mutant
loxP sites to ultimately create construct pFIX. Primers NsiICre 5'-GTGAATGATGTAGCCGTCAAG-3' (homologous to a sequence in the
cre gene) and CreIntFwd 5'-CCATGATTACGGATTCAC-3' (homologous to nucleotides 2-18 of the chromosomal lacZ gene) were used
to amplify a 1.9-kb region, demonstrating insertion of the
cre-araC cassette into the bacterial genome. All
constructs were sequenced over the insertion regions and gene
expression regions, including loxP sites, using the Big Dye
kit (PerkinElmer Life Sciences), on a PerkinElmer Life Sciences 377 sequencing apparatus.
Construction of the pBAD75Cre-targeting Plasmid
Plasmid p705Cre was adapted by the excision of part of the
cre gene, the promoter, and most of the CI 857 temperature-sensitive repressor, at NsiI/RsrII
sites. This 583-bp fragment was then replaced with the 1624-bp control
regions from pBAD33Cre, including the same part of the cre
gene, the BAD promoter, and the araC regulator,
also using NsiI/RsrII sites to create pBAD75Cre.
Construction of the MM219Cre Strain
The recombination-competent (recA+) bacterial strain
MM294 was transformed with pBAD75Cre, and the cre/araC
cassette was inserted into the bacterial lacZ gene using the
targeting method of Hamilton et al. (22) (Fig. 1) to produce
strain MM219Cre.
Construction of pDlox1 and pDlox3 Dual loxP Plasmids
The SacI site was removed from pBC SK(+) by
SacI digestion, filling-in with Klenow (Life Technologies,
Inc.) and religation. Two loxP sites were inserted into the
resulting pBC SK-SacI0 plasmid by
annealing DLOX and REVDL oligonucleotides, endfilling with Klenow,
digesting of both the fragment and the plasmid by EcoRI/KpnI and subsequently ligating to create
pDlox1. The polylinker was removed by XbaI/PstI
digestion, endfilled with Klenow, and ligated to form pDlox2. Then a
new polylinker formed by the annealing of LINK1 and LINK2 was
introduced between the loxP sites of pDlox2 at
XhoI to create pDlox3.
Construction of pNIXluc and Mutant loxP Containing pFIXluc
Nuclear Plasmids
Plasmid pNIXluc was created by the insertion of the
BamHI/BglII luciferase cassette from pCIKluc,
into the BamHI site of pDlox3.
Dual mutant loxP sites (LE and RE) were introduced into
pBCSK+ by annealing LoxF and LoxR oligos, filled-in with Pfx
polymerase (Life Technologies Inc.), digesting further with
EcoRI/KpnI, and ligating to create pMlox1. The
unwanted polylinker was removed from pMlox1 by
PstI/XbaI digestion, Klenow treatment, and
self-ligation to produce pMlox2. A replacement polylinker was added
within the loxP sites by the insertion of the entire
pDSRed1-N1 plasmid at XhoI (pMlox3), before removal of the
remainder of pDSRed1-N1, excluding the polylinker, by
BamHI/NheI digestion, endfilling using Klenow,
and subsequent ligation to create pFIX. Plasmid pFIXluc was created by
the replacement of the pDSRed1-N1 BamHI/BglII fragment from pMlox3 with the BamHI/BglII
luciferase cassette from pCIKluc.
Construction of pMEV8, pMEV46, pMEV88 Mitochondrial
Plasmids
Construct pMEV8 was made by the insertion of pDlox1 into the
unique XhoI site of
pRSmtOTCAPr XhoI (21). The
ampicillin-resistant vector pRS316 was removed from this construct by
digestion with SacI and religation to form pMEV8.
Construct pMEV46 was formed by exchange of pRS406 with pDlox3 at the
BamHI site of pRSmtJMC (21). Construct pMEV88 was
constructed by the deletion of the 16 S and most of the 12 S rRNA genes
at the Klenow-filled BlpI/SnaBI sites of pMEV46.
Minicircle Production and Purification
Electrocompetent MM219Cre cells (25 µl) were
electro-transformed (Bio-Rad Gene pulser) according to the
manufacturer's instructions, with the appropriate minicircle producer
plasmids. Transformed cells were allowed to recover for 1 h in
Luria-Bertani media (LB) containing 1% glucose, before plating on LB
1% glucose containing 30 µg/µl chloramphenicol (Cm). Selected
colonies were amplified in LB 1% glucose, Cm and frozen in 20% v/v
glycerol. Transformed cells containing a minicircle producer plasmid
were grown as a 5-ml starter culture overnight at 37 °C in LB 1%
glucose with Cm, before inoculation of 500-ml flasks. The most
successful growth and cre induction conditions were as
follows:
Technique 1--
Cells were grown overnight in a shaking
incubator at 37 °C in modified M9 minimal media (with the addition
of 0.2% yeast extract) (Difco) supplemented with 0.2% glucose and 30 µg/µl Cm (Sigma-Aldrich). Cells were pelleted at 5000 rpm for 10 min before resuspension in 1 volume of modified M9 minimal media. After
washing, cells were re-pelleted at 5000 rpm and resuspended in the same
volume of cre induction media (modified M9 minimal media
supplemented with 0.5% L-arabinose (Sigma-Aldrich)) and
further grown in a shaking incubator at 37 °C for 2-4 h.
Technique 2--
Cells were grown overnight at 37 °C in LB
supplemented with 0.5% glucose and 30 µg/µl Cm. Cells were
pelleted at 5000 rpm for 10 min before resuspension in 1 volume of M9
minimal media. After washing, cells were re-pelleted at 5000 rpm and
resuspended in the same volume of cre induction media (M9
minimal media supplemented with 0.5% L-arabinose) and
further grown in a shaking incubator at 37 °C for 4-6 h.
One liter of cells was treated in 5 mg/ml lysozyme in 40 ml of
solution I (50 mM glucose, 25 mM Tris.Cl pH
8.0, 10 mM EDTA), followed by lysis in 80 ml (0.2N NaOH,
1% SDS) and finally neutralized in 60 ml of 3 M potassium
acetate (pH 4.8). The cleared supernatant was isopropanol-precipitated,
and the resulting DNA solution was further purified by RNA
precipitation in 6 M lithium chloride, RNase treatment, and
phenol/chloroform extraction (23). This technique provides very high
yields of DNA per liter of culture (~10 mg).
The resulting pool of DNA products, producer plasmid, and excised
bacterial vector were cut with the triple-cutting PvuII for
luciferase plasmids and with NotI for mitochondrial
plasmids. Undigested supercoiled minicircle could then be
density-separated from linear producer plasmid and excised bacterial
vector on a cesium chloride gradient using the intercalating agent
ethidium bromide (24) or, more effectively, propidium iodide. Removal of cesium chloride was achieved by dilution in 3 volumes of water, ethanol precipitation, and two washes in 70% ethanol (25). Minicircle DNA was run through cation exchange columns AG50W-X8 (Bio-Rad) to
remove ethidium bromide or propidium iodide according to the manufacturer's instructions to achieve maximal DNA yield from the columns.
Transfection of Mammalian Cells with Minicircles and Control
Plasmids
2 × 105 cells were seeded into a 24-well
tissue culture plate in 1 ml of growth medium (DMEM (Life Technologies) + 10% (v/v) fetal calf serum (FCS)) and incubated at 37 °C until
50-80% confluent (~16 h). 0.24-0.5 µg of DNA in 100 µl of
OPTIMEM media (Life Technologies) was complexed to LipofectAMINE (Life
Technologies, Inc.) in 100 µl of OPTIMEM media (2 mg/ml) in the ratio
of 10 µl of LipofectAMINE/µg of DNA, according to the
manufacturer's instructions. To obtain six replicates per treatment,
this reaction was appropriately scaled-up and the DNA-liposome complex
was allowed to form at 37 °C for 20 min. Cells were washed once in
OPTIMEM, and a 200-µl reaction volume of complexed DNA in OPTIMEM was
then overlaid onto the cells in each well. 4 h later 1 ml of DMEM
containing 10% (v/v) FCS was added and the incubation continued at
37 °C. 24 h after the start of transfection, the media was
exchanged (DMEM + FCS) and 24 h following this, cells were
harvested and transgene activity was measured.
Measurement of Relative Luciferase Activity and Statistical
Analysis
Luciferase activity was measured using the Luciferase Reporter
Gene Assay kit (Roche Molecular Biochemicals) on a Lucy1 luminometer (Anthos, Life Technologies, Inc., UK) according to the manufacturer's instructions. The total protein per measurement was determined in a
colorimetric assay using the Micro BCA Protein Assay Reagent kit
(Pierce, Rockford, IL) according to the manufacturer's instructions. Relative light units of luciferase activity per minute per measurement were then adjusted to that obtained for 1 mg of total protein per measurement.
Significance tests were based on the mean from six replicates for each
assay. To satisfy requirements for analysis of variance, raw data was
transformed by taking the Log10 of each figure. This results in data that are relatively normally distributed (Shapiro-Wilk test) within treatments, with more equal treatment variances.
We have used the analysis of variance to determine the pooled variance
for the 9 treatments and subsequently used a method for multiple
comparisons based on the Studentized range (Q) between means, which is considerably more stringent than either 95% confidence intervals based on 1.96 (standard error) or the least significant difference test. Given that all sample sizes are equal between compared
treatments (six replicates each), this determines a critical value
( ) for the difference between the largest and the smallest sample
means and applies this to the whole experimental set to obtain a 95%
confidence interval between any pair of means. The value of the
Q method is such that, when comparing all of the differences
between means in this manner over a large number of treatments, the
probability that no erroneous claims of significance are made is
95%.
 |
RESULTS |
Creation of a Bacterial Strain Expressing cre Recombinase under the
Control of the Arabinose Regulon--
We modified the vector
pBAD33Cre, a direct derivative of the pBAD33 expression vector (26)
containing the arabinose control regulon (araC), to create a
new cre recombinase-expressing bacterial strain (Fig.
1).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Insertion of cre/araC into
the chromosomal lacZ locus of MM294 bacteria.
a, the plasmid pBAD75Cre contains the
cre/ara expression cassette flanked by areas of homology to
the bacterial lacZ gene ( lacZ1 and
lacZ2). The chromosomal lacZ gene
has been represented here by five regions for simplicity of reference:
lacZ start region, lacZ1 region,
lacZ Mid region, lacZ2 region and
finally lacZ end region, all of which make up the complete
lacZ gene. Use of the temperature-sensitive plasmid
replicon, pSC101ts, permits selection for
integration of the entire plasmid into the lacZ locus, by
using conditions non-permissive for plasmid growth (44 °C) and
selection for white chloramphenicol-resistant (Cmr)
colonies (loss of function of pSC101ts as shown
by X). A second recombination (excision) event, removing the
bacterial vector sequences, is selected for by propagation at 30 °C
permissive for plasmid replication, and selection of white
Cmr colonies. The excised plasmid is not capable of
lacZ expression, because it still lacks the start and end of
the lacZ gene. Cmr selection may be dropped for
3 days, resulting in loss of the Cmr plasmid, giving white
chloramphenicol-sensitive colonies containing the integrated
cre/ara cassette. b, targeted insertion of the
cre/ara cassette was tested by PCR amplification of a 1.9-kb
fragment using one primer in the cre gene and another in the
chromosomal part of the lacZ gene. Colony
442 was the result of the first recombination
event to insert the entire pBAD75Cre plasmid into the lacZ
gene and serves here as a positive control. Colonies 218 and
219 are the result of a second recombination (excision)
event leaving solely the cre/ara cassette in the chromosome
at lacZ. Colony 252blue has resulted in the
excision of the entire plasmid and serves as a negative control.
|
|
The plasmid, p705Cre, which also expresses cre recombinase,
has a leaky PR-based expression cassette flanked by
regions of homology to the bacterial lacZ gene, permitting
targeted insertion into the bacterial genome by homologous recombination.
Replacement of the cre expression cassette in p705Cre with
the cre/araC expression cassette from pBAD33Cre resulted in
the creation of a targeting plasmid pBAD75Cre.
Controlled cre expression from this new plasmid was tested
by co-transforming bacteria with pBAD75Cre and the Cre reporter construct pSVpaX1, which uses a convenient lacZ-based assay
for Cre activity (27). Growth on LB media containing arabinose led to
Cre-mediated excision of a 1.1-kb segment from this plasmid and
lacZ inactivation giving white colonies. Growth on media
containing glucose led to no Cre-mediated excision, thus leaving the
lacZ gene intact and resulting solely in blue colonies (not
shown). This provides good evidence that plasmid-based cre
expression from the arabinose regulon is absent on growth in
glucose-containing media, whereas growth in arabinose-containing media
(in the absence of glucose) results in successful cre expression.
Targeted cre/araC insertion into the recA+
bacterial strain MM294 using pBAD75Cre was achieved by successive
rounds of targeted recombination and excision at the lacZ
chromosomal locus and the use of the temperature-sensitive plasmid
replicon pSC101ts (22) (Fig. 1).
A PCR-based assay was used to determine successful targeted
cre/araC insertion into the lacZ gene (Fig. 1,
inset) thus creating strain MM219Cre
(F · supE44 endA1
thi-1 hsdR17 lacZ::araC-Cre).
Construction of Minicircle Producer Constructs--
To expedite
the process of construct manufacture for both nuclear and mitochondrial
expression, a multicloning plasmid containing dual loxP
sites flanking a polylinker (pDlox3) was created from the basic vector
pBCSK(+). This plasmid permits easy insertion of expression cassettes
or mitochondrial sequences into the polylinker region, to create
minicircle producer plasmids.
The initial construct for nuclear expression was generated by cloning
of the luciferase reporter gene and CMV promoter from the high
expression plasmid pCIKluc, into the loxP flanked polylinker of pDlox3. The resulting plasmid, pNIXluc, contains a luciferase expression cassette of minimal size flanked by loxP sites to
permit removal of bacterial sequences by Cre recombination to create mNIXluc minicircle (Fig.
2a).

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 2.
Minicircle producer constructs.
a, plasmid pNIXluc for constitutive mammalian luciferase
expression was constructed by insertion of the CMV/luc
cassette from pCIKluc into pDlox3. This construct will form minicircles
by the Cre-directed excision of bacterial vector sequences at
loxP sites. Differential digestion of the resulting products
with an enzyme that cuts only in the bacterial vector, and not in the
expression minicircle, permits purification of supercoiled minicircle
from unwanted linearized producer plasmid and excised bacterial vector
using cesium chloride density separation gradients. In the case of
mitochondrial constructs, NotI was used to digest the
bacterial vector, while PvuII was used to digest bacterial
vector from luciferase constructs for nuclear gene delivery.
b, plasmid pMEV8 was constructed as described under
"Experimental Procedures." To further reduce the size of
mitochondrial constructs, regions of mitochondrial DNA were
PCR-amplified and cloned (three regions shown by blue
arrows), to create pMEV46 (8.7 kb), including the D loop, the 12 S
and 16 S rRNA regions, the sOTC gene, and the origin of
light-chain replication.
|
|
We have previously created a 22-kb construct designed for mitochondrial
expression based on the insertion of a modified OTC gene between two
tRNA sites within the entire mouse mtDNA (19-21). This expression
construct is difficult to modify due to its instability (21) and
presents problems for introduction into mitochondria by
electroporation, due to its large size
(28).3 In addition, the
bacterial vector falls within the mitochondrial gene COXIII,
is not easily removable, and is likely to abolish mitochondrial gene function.
To ameliorate this situation, the loxP-flanked
pDlox1 vector was inserted into pRSmtOTCAPr at
XhoI, and the pRS316 vector was removed to create the
mitochondrial minicircle producer plasmid pMEV8. This XhoI
site in mouse mtDNA is situated in a 14-bp area where the
ND5 gene coded on the heavy strand overlaps the terminal
coding region of the ND6 gene, oriented in the opposite
direction on the light strand. The terminal regions of the
ND5 and ND6 genes were reconstructed between the
loxP sites of the insertion vector pDlox1 to ensure complete
transcription from these genes within pMEV8 (Fig. 2b).
The mitochondrial minicircle resulting from Cre-mediated excision of
pDlox1 from pMEV8 (mMEV8), contains a single 34-bp loxP site flanked by the reconstructed ND5 and ND6
genes. This should minimize the impact of incorrect splicing resulting
from the presence of a foreign sequence on transcribed mitochondrial
minicircle DNA.
Smaller mitochondrial constructs were also made to permit more
efficient DNA transfer into mitochondria, by PCR amplification of key
regions of the mitochondrial genome and the sOTC gene (21). Construct
pMEV46 consists of the mitochondrial D loop, 12 S, 16 S rRNA, the
origin of light chain replication and several tRNAs, with the
loxP-flanked pDlox3 inserted at the already artificial Thr/Ser tRNA gene junction (Fig. 2b). An even smaller 6.8-kb
derivative, pMEV88 (not shown), lacks most of the 12 S and 16 S rRNA
regions of pMEV46.
Because tRNAs are believed to act as cleavage signals within
polycistronic mtRNA transcripts (29, 30) we anticipate that the 34-bp
loxP site will have minimal impact on mitochondrial transcription in these constructs.
All of these minicircle producer constructs are designed to permit
excision of the bacterial vector (pDlox1 or pDlox3 ) by Cre
recombination to leave solely a 34-bp loxP site within the resulting minicircle constructs (Fig. 2).
Cre Recombinase Activity and Minicircle Production in MM Bacterial
Strains--
Our novel Escherichia coli strain, MM219Cre,
expresses cre recombinase under tight control of the
araC regulon. The AraC protein acts as both a positive and
negative regulator of Cre activity. In the presence of arabinose in
growth media, transcription from the BAD promoter is turned
on; in its absence, transcription proceeds at a very low level. The
addition of glucose to growth media, which lowers levels of 3',5'-cAMP,
further down-regulates the catabolite-repressed BAD promoter
(13-15).
MM219Cre cells transformed with different minicircle producer plasmids
showed effective repression of cre recombinase over a range
of media types using varying levels of glucose. We used minicircle
production and the presence of excised bacterial vector as indicators
of leaky cre recombinase expression. The three media types
used for bacterial growth in decreasing order of richness were: LB,
modified M9 minimal media (containing 0.2% yeast extract) and M9
minimal media, incorporating a range of glucose concentrations from
0.2% to 2%. Rich media (LB) leads to the most rapid growth of both
bacteria and plasmid but also results in the exhaustion of glucose.
Bacterial growth in M9 minimal media gives comparatively poor bacterial
and hence plasmid yields. Initial glucose concentrations higher than
about 1% also lead to significant inhibition of bacterial growth, as a
result of the Crabtree effect (16, 31, 32), although cre
induction is still effectively repressed.
The best growth conditions were obtained using levels of 0.2-0.5%
glucose with any of the media types, striking a balance between
bacterial and thus plasmid replication and down-regulated cre expression.
However, growth of MM219Cre cells containing the largest plasmid, pMEV8
(20.7 kb), in LB 0.2-0.5% glucose leads to a slight induction of
cre, minicircle production, and subsequent loss of minicircle during growth. Assuming that there is slight cre
expression during bacterial growth using low glucose levels, the
potential toxicity of the largest mitochondrial construct may help to
induce loss of replication-deficient minicircle during plasmid
replication under chloramphenicol selection.
We do not observe significant minicircle production (and subsequent
loss) using the same low glucose media growth conditions in the case of
any other minicircle producer constructs. This is in accordance with
data on pBAD expression plasmids for which no significant gene
induction effects have been observed under similar low glucose
conditions (26). By changing media type to modified M9 minimal media,
glucose levels could be kept low (0.2%) and still effectively
down-regulate cre expression using pMEV8, although this
richer media type permitted increased plasmid yields over that of
minimal media alone.
Following bacterial and plasmid growth, induction of cre
recombinase and thus minicircle production used LB, modified M9
minimal media, or M9 minimal media, containing levels of arabinose from 0.2 to 2%. Arabinose levels had little effect on overall minicircle yields, whereas incubation times of 4-6 h produced the greatest yields
of minicircle from smaller plasmids (Fig.
3a), and shorter incubation
times of 2-4 h resulted in the largest mitochondrial minicircle mMEV8
(Fig. 3b).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 3.
Time courses of minicircle production from
nuclear and mitochondrial constructs. a, MM219Cre cells
containing construct pNIXluc (6.5 kb) were grown overnight in LB + 0.5% glucose before induction of cre recombinase expression
by media exchange to M9 minimal media + 0.5% arabinose for 2-24 h.
This results in the appearance of two new supercoiled excision
products; bacterial vector pDlox3 (3.4 kb) and luciferase minicircle
mNIXluc (3.1 kb). The additional bands above 6.5 kb supercoiled
probably represent various alternate concatenations (linear,
open circular) of the original plasmid pNIXluc, as well
as supercoiled concatamers of both pDlox3 and mNIXluc (induced lanes
only). The best induction times for effective production of minicircle
were between 4 and 6 h. b, MM219Cre cells containing
mitochondrial producer construct pMEV8 were grown overnight in LB + 2%
glucose, prior to cre recombinase induction in M9 minimal
media + 0.5% arabinose for 10-150 min. All products were digested
with EcoRI. Induction of cre was evident from the
appearance of bands corresponding to mitochondrial minicircle mMEV8
(15, 2, and 0.2 kb) in addition to those of pMEV8 (13.9, 4.5, 2, and
0.2 kb) as well as a linear-excised vector (pDlox1 ) band at 3.4 kb.
Cre induction appears to initiate as soon as 10 min after
initial media change, is obvious after 60 min, and reaches equilibrium
at 120-150 min.
|
|
The two best techniques for minicircle production were as follows.
Technique 1: Growth in modified minimal media, 0.2% glucose overnight,
washing in modified minimal media and induction for 2-6 h in modified
minimal medium containing 0.5% arabinose. Technique 2: Growth in LB,
0.5% glucose overnight, washing in minimal media, and induction for
4-6 h in minimal media containing 0.5% arabinose.
Following cre recombinase induction, the supercoiled
minicircle could be purified away from producer plasmid and
excised bacterial vector by restriction enzyme digestion of the latter
two forms and purification of supercoiled minicircle using a cesium
chloride gradient.
Technique 1 was effective for minicircle production from smaller
plasmids, with a purified minicircle yield of up to 200 µg/liter culture, as well as being the only effective method for producing yields of 40 µg/liter culture of minicircle from the large
mitochondrial construct pMEV8.
Interestingly, technique 2 produced slightly higher yields of
minicircle using smaller plasmids but was very ineffective for minicircle production from the larger pMEV8 construct, presumably due
to minicircle loss during bacterial growth.
Media step-down from rich to minimal medium as observed in technique 2 did not seem to reduce cre expression as might be expected but, in contrast, led to a small increase in yields of supercoiled minicircle.
Creation and Testing of a Mutant loxP Containing
Construct--
Cre recombination may occur between and within
minicircle constructs, producer plasmids, and bacterial vectors
resulting in double, triple, etc. concatamers as a result of the
equilibrium kinetics exhibited by the reaction. Although a significant
proportion of the minicircle produced is in the monomeric-supercoiled
form, reduction of the formation of minicircle concatamers as well as the ability to drive the Cre reaction toward minicircle production should permit increased yields of minicircle.
Modification of the terminal 5 nucleotides on one side of the
loxP site to create left element (LE) loxP sites,
or vice versa to create right element (RE) loxP sites,
results in a slightly reduced Cre interaction at these sites (17).
Modification of both sides of the loxP site to produce LE/RE
double mutant loxP sites results in a severely reduced Cre
interaction (17, 18). Recombination between two partially mutant
loxP sites, one LE and one RE, leads to the production of a
double mutant loxP site (LE/RE) and an unmutated wild type
loxP site (WT) in the two products (Fig.
4).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4.
Driving the Cre recombinase reaction to
completion by the use of mutant loxP sites. We
constructed a new luciferase expression construct, identical to pNIXluc
but containing mutant loxP sites, with, respectively, a left
element (LE) (bracketed text in shaded box) and right
element (RE) (mutation in lowercased text) mutation in the
last 5 bp of each site -(pFIXluc). Recombination between a LE
loxP and a RE loxP site results in an excised
bacterial vector product containing a wild type loxP site
(pMlox3 ) and a minicircle product (pFIXluc) containing a double
mutant LE/RE loxP site. Cre recombinase has a slightly
reduced affinity for either an LE site or an RE site; however, it has a
severely compromised recognition of an LE/RE site, which results in a
shift in the equilibrium toward minicircle production. In addition,
because LE/RE double-mutant sites do not easily recombine with each
other, the formation of minicircle concatamers should be reduced.
|
|
Reverse kinetics in this reaction are extremely poor, due to the
reduced affinity of Cre for the LE/RE double mutant loxP site. Thus there is a directed drive toward production of an LE/RE site
(17, 18).
Following this concept we created a producer plasmid to contain a
mutant LE loxP site and a mutant RE loxP site
flanking the polylinker region (pFIX). The CMV/luciferase
cassette from pCIKluc was inserted between the LE and RE
loxP sites to create a new minicircle producer vector
pFIXluc. Growth and induction of this producer plasmid pFIXluc using
technique 2 resulted in increased levels of monomeric minicircle
compared with excised bacterial vector (Fig.
5). Because the construct has been
designed such that the minicircle mFIXluc always contains the LE/RE
double mutant loxP site, this is probably a result of
reduced minicircle concatamerization and a shift in equilibrium toward
minicircle production. This results in a significant increase in
overall yield of mFIXluc minicircle over pFIXluc to 300 µg per
liter of bacterial culture.

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 5.
Comparison of the dynamics of the
Cre/loxP interaction for normal or mutant
loxP sites. MM219 cells were transformed with
either pNIXluc (normal loxP sites) or pFIXluc (mutant
loxP sites) and grown overnight in LB + 0.5% glucose. Cre
induction was carried out in M9 minimal media + 0.5% arabinose for
4 h. All plasmids are undigested. Cre recombination of either
producer plasmid (pNIXluc or pFIXluc, each 6.4 kb) produces the
respective supercoiled minicircle (mNIXluc or mFIXluc, 3.1 kb) as
shown, including excised bacterial vector
(pDlox3 /pMlox3 , 3.4 kb). Cre recombination of pNIXluc
resulted in roughly equal quantities of the three major reaction
components, producer plasmid, minicircle, and excised vector (6.5, 3.1, and 3.4 kb, respectively). However, recombination of pFIXluc (6.4 kb),
although not complete, produces a greater quantity of minicircle
mFIXluc (3.1 kb) compared with excised bacterial vector (3.4 kb). This
is probably due to a reduced ability of Cre to recombine minicircle
mFIXluc products with either themselves or the producer plasmid,
because of the double mutant loxP site in the minicircle.
Cesium chloride-purified minicircle mFIXluc does show some
concatamerization (6.2 kb, minicircle X2; 9.3 kb, minicircle X3, etc.),
probably as a result of general recombination from the MM219Cre
recA+ strain, but most of the minicircle DNA was in the
single 3.1-kb supercoiled concatamer form. Supercoiled mFIXluc
minicircle yields from 1 liter of bacterial culture of 0.35 mg were,
however, considerably higher than those of pNIXluc (0.25 mg) from the
same culture volume.
|
|
Although maximal obtainable yields of luciferase minicircle measured by
spectrophotometry with 260/280 ratios approaching 1.8 were in the
region of 5-600 µg/liter of bacterial culture, gel quantification of
DNA did not support this data, giving levels ~30% lower. Further
RNase treatment and phenol/chloroform purification was performed in
these cases to obtain agreement between spectrophotometry and gel data.
This may have been the result of residual ethidium bromide/propidium
iodide skewing spectrophotometry readings, thus emphasizing the
importance of cross-checking measurement data within batches using gel
quantification methods.
The MM219Cre strain is recA+, which probably explains the
continued occurrence of supercoiled concatamers of mFIXluc minicircle (Fig. 5), despite the severely compromised Cre interaction at the
double mutant loxP sites. Despite this, all mFIXluc
concatamer forms could be resolved to the same size (3.1 kb) by
enzymatic digestion (not shown), suggesting simple concatamerization
rather than rearrangements. The possibility of large-scale
rearrangements and plasmid deletions using MM219Cre seems unlikely,
because the large mitochondrial clones pMEV8 and
pRSmtOTCAPr can be stably maintained with no observable
rearrangements. In further support of this, it has been possible to
clone and stably maintain a 150-kb bacterial artificial
chromosome in MM219Cre cells.4 An recA+
strain may actually encourage stable maintenance of some large
constructs by permitting repair of damaged constructs.
Gene Expression in Vitro Using Luciferase Minicircle
Constructs--
To test the versatility of luciferase expression from
our latest nuclear minicircle within mammalian cells, we chose to
perform three comparative tests using LipofectAMINE complexed to DNA to obtain cellular transfection. In each test we compared luciferase minicircle mFIXluc with its parent plasmid pFIXluc, as well as with the
original plasmid from which pFIXluc was derived (pCIKluc), all of which
contain a luciferase cassette driven by a CMV promoter. Treatment
regimes over six replicates for each construct are summarized in Table
I and Fig.
6.
View this table:
[in this window]
[in a new window]
|
Table I
Summary of the three treatment regimes used to transfect HeLa cells
with DNA constructs using the same ratio of LipofectAMINE to DNA in
each case (20:1 µg)
|
|

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Comparisons of luciferase activity from HeLa
cells transfected with liposome/DNA complexes using different
minicircle and plasmid constructs. a, means of six
replicates of luciferase activity following transfection with
DNA/LipofectAMINE complexes (ratio at 20 µg of LipofectAMINE/µg of
DNA). Treatment regimes of mole:mole ratios with stuffer DNA and
weight:weight and mole:mole without stuffer comparisons are given in
Table I. Plasmids pFIXluc and pCIKluc gave roughly similar levels of
luciferase activity in mole:mole ratios with stuffer, demonstrating
similar gene expression and transfection abilities. Minicircle
luciferase activity was increased over pFIXluc by 4.5-fold in mole:mole
ratios with stuffer DNA, 8.8-fold in weight:weight ratios and 152-fold
in mole:mole ratios without stuffer. The first increase demonstrates an
intrinsic increase in minicircle transfection ability or gene
expression, probably as a result of multimeric concatamers of
minicircle. The second shows that the increased (2.1-fold) number of
transcriptional units gives a concomitant increase in transgene
activity without changing LipofectAMINE quantities. The final figure
demonstrates the cytotoxicity of LipofectAMINE, because reduced
quantities of this reagent with minicircle result in vastly increased
transfection efficiency. Although these figures are adjusted for total
protein quantities per measurement, cell cytotoxicity will still result
in reduced gene expression from the surviving cells. b,
log10 transforming data from luciferase activity provide a
method for satisfying the conditions required to perform analysis of
variance (normality of data and equal variances). In this case
F is extremely significant at p 1.7 × 10 18. We then used the Studentized values of
Q to perform a multiple comparisons test between any two
pairs of means from these values. The resulting bar shows
the minimum distance required between any two means for at least 95%
confidence in a significant difference. We can see that comparative
increases in luciferase activity from minicircle over either pFIXluc or
pCIKluc within each treatment are significant at this level
(p 0.05) in all cases.
|
|
The initial treatment of mole:mole with stuffer DNA compares
equal molar ratios of each construct, with the total weight of DNA
adjusted to 0.5 µg per well using pDlox2 plasmid. This permits equal
levels of LipofectAMINE to be used for transfection in each case, thus minimizing differences resulting from the cytotoxicity of
LipofectAMINE. It should therefore result in equal numbers of
transcriptional luciferase units being delivered to cells in each case
and is thus the most unbiased comparison of minicircle function. The
weight:weight treatment compares equal weights of DNA from each
construct. LipofectAMINE levels are again equal throughout the
treatment, but 2.1 times the amount of minicircle luciferase cassettes
should be transfected over pFIXluc. Finally the mole:mole without
stuffer treatment allows comparison of molar ratios of constructs with
variable LipofectAMINE quantities, while keeping the same ratio of
LipofectAMINE to DNA (20:1 µg). Although this permits the
transfection of equal numbers of transcriptional luciferase units, the
variable LipofectAMINE will give varying results depending on the
cytotoxicity of LipofectAMINE.
Fig. 6 demonstrates the results of these three treatments using three
plasmids over six replicates in two different graphical representations: (a) first, the means of raw data are
presented for each plasmid on a semi-log scale; (b) second,
the means of log-transformed data with 95% confidence limits between
any pair of means are presented. The Studentized Q test for
multiple comparisons, as shown in this case, gives a single bar
representing the minimum distance required between any two means to
provide 95% confidence in a significant difference. This is in
contrast to a 95% confidence interval calculated for an individual
mean (1.96 × standard error), given by two opposite
bars flanking the mean.
Basic luciferase expression from pFIXluc was roughly comparable to that
of pCIKluc (its precursor) in the mole:mole + stuffer comparison,
suggesting that gene expression and transfection efficiency from the
adapted construct pFIXluc is undiminished. In the weight:weight comparison there was a slight but insignificant increase in luciferase activity by pCIKluc over pFIXluc as expected given the increased number
of luciferase cassettes theoretically delivered (1.1-fold). Finally,
there was a significant increase of pCIKluc luciferase activity over
pFIXluc in the mole:mole without stuffer treatment. Despite equal molar
quantities of luciferase cassettes transfected per construct, the
difference is probably due to reduced LipofectAMINE in the case of
pCIKluc producing less cytotoxicity.
Comparisons between the luciferase expression from pFIXluc and
mFIXluc were quite conclusive in demonstrating increased minicircle luciferase expression over pFIXluc in all treatments.
Surprisingly, the mole:mole with stuffer treatment produced a 4.5-fold
increase in luciferase activity for minicircle over pFIXluc, which was
statistically significant (p 0.05) within the
treatment. Theoretically, these transfection conditions represent those
most likely to give equal levels of transfection in the case of each
construct. It should be noted however that, although all constructs
were produced in the same way, minicircle production involved cre
recombination, which produces multimeric concatamers of minicircle, as
well as the predominant monomeric form. Multimeric plasmid forms have
previously been shown to increase marker gene activity following
transfection in vitro (33), perhaps because they provide a
more efficient template for nuclear transcription.
Not surprisingly, weight:weight comparisons showed an 8.8-fold increase
of minicircle transgene activity over parent plasmid (pFIXluc)
(significant at p < 0.05), as expected given that 2.1 times more luciferase cassettes were transfected over the mFIXluc mole:mole with stuffer treatment.
Finally, minicircle luciferase activity over pFIXluc for mole:mole
comparisons with no stuffer DNA was vastly increased (152-fold) (significant at p < 0.05). This increase should be
treated with caution, because it serves to highlight the limitations of
LipofectAMINE as a transfection reagent, where reduced LipofectAMINE
quantities in the case of minicircle transfection cause a huge increase
in transgene activity despite equimolar transfection. Indeed,
transfection of 0.5 µg of DNA into HeLa cells using this reagent at
the applied ratio 20:1 is already becoming toxic to these cells. This
is also supported by the transfection of pCIKluc using the same
treatment and only slightly less LipofectAMINE, giving a 4.5-fold
increase over pFIXluc. Interestingly, transfection comparisons on HeLa cells using either mole:mole with stuffer or weight:weight ratios of
0.25 µg of DNA (at LipofectAMINE levels not toxic to HeLa cells) still show increased minicircle luciferase activity over parental plasmid (not shown).
 |
DISCUSSION |
We describe the creation of a bacterial strain expressing
cre recombinase under the tight control of the
araC regulon, which can be used to produce large quantities
of DNA minicircle in vivo. We have also developed a range of
minicircle constructs for both mitochondrial expression of
sOTC and for nuclear luciferase expression. In
addition, we demonstrate both effective and substantially increased luciferase expression from nuclear minicircle constructs over both
parental plasmids.
Previous techniques for minicircle production (34-36), have used
bacterial phage integrase-mediated recombination to produce minicircle DNA. This system results in attL or
attR excision sites of 100-165 bp, following recombination
(37). By contrast, the Cre-mediated recombination system employed here
results in a recognition site of only 34 bp (9-11), thus producing a
minimal construct size.
Yields of over 300 µg of purified minicircle per liter of culture are
sufficient for most in vitro and in vivo
applications, whereas further scale-up and optimization of the process
seems likely to be relatively straightforward.
The mitochondrial minicircles eliminate bacterial sequences that may be
able to act specifically as potential mitochondrial origins of
replication (38), or break-points for transcription. However, we cannot
be sure that even a 34-bp loxP site insertion into gene
junction sites will not disrupt transcription and maintenance of these
constructs in mitochondria.
Although the reduced-size mitochondrial constructs pMEV46 and pMEV88,
made by gene deletion, present additional concerns for stability
in organello, the minicircle constructs resulting from these
producer plasmids (mMEV46, mMEV88) are now of a size that should enable
their electroporation into mitochondria (28). We are currently
investigating the internalization and functionality of these
mitochondrial constructs.
The nuclear minicircle vectors mNIXluc and mFIXluc clearly possess the
advantage of being approximately half the size of their plasmid
counterparts. As such, these small constructs demonstrate 4.5-fold
increased luciferase activity over their parental plasmid counterparts
when transfected on a mole:mole basis (with stuffer DNA) and 8.8-fold
increase on a weight:weight basis. The huge increase seen in the
mole:mole without stuffer comparison (152-fold) only serves to
highlight the versatility of these vectors in reducing the cytotoxic
load of DNA/liposome complexes to cells while maximizing the number of
transcriptional units transfected. Indeed by the simple expedient of
removing the entire bacterial DNA complement, we have also reduced the
CpG content of most of these expression vectors by more than 60%. As
such, minicircle expression vectors are likely to provide a useful tool
for reducing inflammatory responses in non-viral vector delivery
in vivo as well as the increased transgene activity already
demonstrated in vitro.
 |
ACKNOWLEDGEMENTS |
We thank Drs. F. Buchholz and A. F. Stewart (EMBL) for the kind gifts of plasmids p705Cre, pBAD33Cre, and
pSVpAX1, as well as bacterial strain MM294. Also Drs. D. Gill and S. Hyde (Oxford University) generously provided us with the high
luciferase expression plasmid pCIKluc prior to publication.
 |
FOOTNOTES |
*
This work was supported by the Medical Research Council,
The March of Dimes Birth Defects Foundation, and the Association Française de Lutte Centre la Mucoviscidose.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Fax: 0207-594-3015;
E-mail: b.bigger@ic.ac.uk.
Published, JBC Papers in Press, April 13, 2001, DOI 10.1074/jbc.M010873200
2
B. W. Bigger, unpublished.
3
J.-M. Collombet, unpublished.
4
S. Howe, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
bp, base pair(s);
sOTC, synthetic ornithine transcarbamylase gene;
kb, kilobase(s);
DMEM, Dulbecco's modified Eagle's medium;
FCS, fetal
calf serum;
PCR, polymerase chain reaction;
CMV, cytomegalovirus;
LE, left element loxP site;
RE, right element loxP
site;
WT, wild type.
 |
REFERENCES |
| 1.
|
Krieg, A. M.
(1996)
J. Lab. Clin. Med.
128,
128-133
|
| 2.
|
Yew, N. S.,
Wang, K. X.,
Przybylska, M.,
Bagley, R. G.,
Stedman, M.,
Marshall, J.,
Scheule, R. K.,
and Cheng, S. H.
(1999)
Hum. Gene Ther.
10,
223-234
|
| 3.
|
Norman, J.,
Denham, W.,
Denham, D.,
Yang, J.,
Carter, G.,
Abouhamze, A.,
Tannahill, C. L.,
MacKay, S. L.,
and Moldawer, L. L.
(2000)
Gene Ther.
7,
1425-1430
|
| 4.
|
McLachlan, G.,
Stevenson, B. J.,
Davidson, D. J.,
and Porteous, D. J.
(2000)
Gene Ther.
7,
384-392
|
| 5.
|
Krieg, A. M.
(1999)
J. Gene Med.
1,
56-63
|
| 6.
|
Krieg, A. M.
(2000)
Mol. Ther.
1,
209-210
|
| 7.
|
Yew, N. S.,
Zhao, H.,
Wu, I. H.,
Song, A.,
Tousignant, J. D.,
Przybylska, M.,
and Cheng, S. H.
(2000)
Mol. Ther.
1,
255-262
|
| 8.
|
Swartz, M. N. T., T. A.,
and Kornberg, A.
(1962)
J. Biol. Chem.
237,
1961-1967
|
| 9.
|
Abremski, K.,
Hoess, R.,
and Sternberg, N.
(1983)
Cell
32,
1301-1311
|
| 10.
|
Abremski, K.,
and Hoess, R.
(1984)
J. Biol. Chem.
259,
1509-1514
|
| 11.
|
Sternberg, N.,
Sauer, B.,
Hoess, R.,
and Abremski, K.
(1986)
J. Mol. Biol.
187,
197-212
|
| 12.
|
Buchholz, F.,
Ringrose, L.,
Angrand, P. O.,
Rossi, F.,
and Stewart, A. F.
(1996)
Nucleic Acids Res.
24,
4256-4262
|
| 13.
|
Hirsh, J.,
and Schleif, R.
(1973)
J. Mol. Biol.
80,
433-444
|
| 14.
|
Hahn, S.,
Dunn, T.,
and Schleif, R.
(1984)
J. Mol. Biol.
180,
61-72
|
| 15.
|
Kosiba, B. E.,
and Schleif, R.
(1982)
J. Mol. Biol.
156,
53-66
|
| 16.
|
Neidhardt, F. C.
(1987)
in
Escherichia coli and Salmonella typhimurium, Cellular and Molecular Biology
(Ingraham, J. L.
, Brooks-Low, K.
, Magasanik, B.
, Schaechter, M.
, and Umbarger, H. E., eds), Vol. 2
, American Society for Microbiology, Washington, DC
|
| 17.
|
Albert, H.,
Dale, E. C.,
Lee, E.,
and Ow, D. W.
(1995)
Plant J.
7,
649-659
|
| 18.
|
Araki, K.,
Araki, M.,
and Yamamura, K.
(1997)
Nucleic Acids Res.
25,
868-872
|
| 19.
|
Wheeler, V. C.,
Prodromou, C.,
Pearl, L. H.,
Williamson, R.,
and Coutelle, C.
(1996)
Gene
169,
251-255
|
| 20.
|
Wheeler, V. C.,
Aitken, M.,
and Coutelle, C.
(1997)
Gene
198,
203-209
|
| 21.
|
Bigger, B.,
Tolmachov, O.,
Collombet, J. M.,
and Coutelle, C.
(2000)
Anal. Biochem.
277,
236-242
|
| 22.
|
Hamilton, C. M.,
Aldea, M.,
Washburn, B. K.,
Babitzke, P.,
and Kushner, S. R.
(1989)
J. Bacteriol.
171,
4617-4622
|
| 23.
|
Tolmachov, O. E.
(1990)
Biotekhnologiya
1,
25
|
| 24.
|
Radloff, R.,
Bauer, W.,
and Vinograd, J.
(1967)
Biochemistry
57,
1514-1521
|
| 25.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 26.
|
Guzman, L. M.,
Belin, D.,
Carson, M. J.,
and Beckwith, J.
(1995)
J. Bacteriol.
177,
4121-4130
|
| 27.
|
Buchholz, F.,
Angrand, P. O.,
and Stewart, A. F.
(1996)
Nucleic Acids Res.
24,
3118-3119
|
| 28.
|
Collombet, J.-M.,
Wheeler, V. C.,
Vogel, F.,
and Coutelle, C.
(1997)
J. Biol. Chem.
272,
5342-5347
|
| 29.
|
Ojala, D.,
Merkel, C.,
Gelfand, R.,
and Attardi, G.
(1980)
Cell
22,
393-403
|
| 30.
|
Ojala, D.,
Montoya, J.,
and Attardi, G.
(1981)
Nature
290,
470-474
|
| 31.
|
Aristidou, A. A.,
San, K. Y.,
and Bennett, G. N.
(1999)
Biotechnol. Prog.
15,
140-145
|
| 32.
|
Gschaedler, A.,
Robas, N.,
Boudrant, J.,
and Branlant, C.
(1999)
Biotechnol. Bioeng.
63,
712-720
|
| 33.
|
Leahy, P.,
Carmichael, G. G.,
and Rossomando, E. F.
(1997)
Nucleic Acids Res.
25,
449-450
|
| 34.
|
Darquet, A. M.,
Cameron, B.,
Wils, P.,
Scherman, D.,
and Crouzet, J.
(1997)
Gene Ther.
4,
1341-1349
|
| 35.
|
Darquet, A. M.,
Rangara, R.,
Kreiss, P.,
Schwartz, B.,
Naimi, S.,
Delaere, P.,
Crouzet, J.,
and Scherman, D.
(1999)
Gene Ther.
6,
209-218
|
| 36.
|
Kreiss, P.,
Cameron, B.,
Darquet, A. M.,
Scherman, D.,
and Crouzet, J.
(1998)
Appl. Microbiol. Biotechnol.
49,
560-567
|
| 37.
|
Landy, A.
(1989)
Annu. Rev. Biochem.
58,
913-949
|
| 38.
|
Kazakova, T. B. M.,
Babich, S. G.,
Golovina, G. I.,
Mel'nikova, M. P.,
and Tsymbalenko, N. V.
(1983)
Genetika
19,
381-387
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Wu, X. Xiao, P. Zhao, G. Xue, Y. Zhu, X. Zhu, L. Zheng, Y. Zeng, and W. Huang
Minicircle-IFN{gamma} Induces Antiproliferative and Antitumoral Effects in Human Nasopharyngeal Carcinoma
Clin. Cancer Res.,
August 1, 2006;
12(15):
4702 - 4713.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Farrow, L. B. Barrett, M. Stevenson, K. D. Fisher, J. Finn, R. Spice, M. A. Allan, M. Berry, A. Logan, L. W. Seymour, et al.
Cytoplasmic expression systems triggered by mRNA yield increased gene expression in post-mitotic neurons
Nucleic Acids Res.,
July 11, 2006;
34(11):
e80 - e80.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Vaysse, R. Harbottle, B. Bigger, A. Bergau, O. Tolmachov, and C. Coutelle
Development of a Self-assembling Nuclear Targeting Vector System Based on the Tetracycline Repressor Protein
J. Biol. Chem.,
February 13, 2004;
279(7):
5555 - 5564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Tolmachova, R. Anders, J. Stinchcombe, G. Bossi, G. M. Griffiths, C. Huxley, and M. C. Seabra
A General Role for Rab27a in Secretory Cells
Mol. Biol. Cell,
January 1, 2004;
15(1):
332 - 344.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|