Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M010873200 on April 13, 2001

J. Biol. Chem., Vol. 276, Issue 25, 23018-23027, June 22, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/23018    most recent
M010873200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bigger, B. W.
Right arrow Articles by Coutelle, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bigger, B. W.
Right arrow Articles by Coutelle, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

An araC-controlled Bacterial cre Expression System to Produce DNA Minicircle Vectors for Nuclear and Mitochondrial Gene Therapy*

Brian W. BiggerDagger, Oleg Tolmachov, Jean-Marc Collombet, Michalis Fragkos, Iwona Palaszewski, and Charles Coutelle

From the Cystic Fibrosis Gene Therapy Group, Division of Biomedical Sciences, SAF Bldg., Imperial College of Science, Technology and Medicine, Exhibition Rd., London SW7 2AZ, United Kingdom

Received for publication, December 1, 2000, and in revised form, April 2, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The presence of CpG motifs and their associated sequences in bacterial DNA causes an immunotoxic response following the delivery of these plasmid vectors into mammalian hosts. We describe a biotechnological approach to the elimination of this problem by the creation of a bacterial cre recombinase expression system, tightly controlled by the arabinose regulon. This permits the Cre-mediated and -directed excision of the entire bacterial vector sequences from plasmid constructs to create supercoiled gene expression minicircles for gene therapy. Minicircle yields using standard culture volumes are sufficient for most in vitro and in vivo applications whereas minicircle expression in vitro is significantly increased over standard plasmid transfection. By the simple expedient of removing the bacterial DNA complement, we significantly reduce the size and CpG content of these expression vectors, which should also reduce DNA-induced inflammatory responses in a dose-dependent manner. We further describe the generation of minicircle expression vectors for mammalian mitochondrial gene therapy, for which no other vector systems currently exist. The removal of bacterial vector sequences should permit appropriate transcription and correct transcriptional cleavage from the mitochondrial minicircle constructs in a mitochondrial environment and brings the realization of mitochondrial gene therapy a step closer.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

There is increasing evidence to suggest that plasmid DNA used for non-viral gene delivery can cause unacceptable inflammatory responses in eukaryotes (1-5). These immunotoxic responses are largely due to the presence of unmethylated CpG motifs and their associated stimulatory sequences on plasmids, following bacterial propagation of plasmid DNA. Simple methylation of DNA in vitro may be enough to reduce an inflammatory response but is likely to result in severely depressed gene expression (6). The removal of CpG islands by cloning out, or elimination of non-essential sequences is more successful in reducing inflammatory responses but is time-consuming and tedious (7).

Because bacterial DNA contains on average four times more CpG islands than does mammalian DNA (8), a good solution is to entirely eliminate the bacterial control regions from gene delivery vectors during the process of plasmid production.

Removal of bacterial sequences needs to be efficient, using the smallest possible excision site, while creating supercoiled DNA minicircles, consisting solely of gene expression elements under appropriate mammalian control regions.

This can be achieved by the use of Cre recombinase, a bacteriophage P1-derived integrase (9-11), catalyzing site-specific recombination between direct repeats of 34 base pairs (loxP sites).

In the case of a supercoiled plasmid containing DNA flanked by two loxP sites in the same orientation, Cre recombination produces two DNA molecules that are topologically unlinked, circular, and mainly supercoiled (10), each containing a single 34-bp1 loxP site.

Efficient minicircle production requires the use of a stable bacterial based cre expression system for efficient production of supercoiled DNA. However, currently available bacterial strains do not have sufficient control of cre recombinase expression to avoid leakage during the bacterial and concomitant plasmid growth phases (12).

This leads to premature Cre recombination, resulting in loss of the replication-deficient minicircle due to out-competition by the replication-competent and antibiotic-resistant bacterial vector.2

We therefore utilized the tightly controlled arabinose expression system (13-15, for review see Ref. 16) to create a cre-expressing bacterial strain, which is both stable and easily controllable by altering the carbon source available for metabolism by these bacteria.

To increase minicircle yield we have improved the kinetics of the cre/loxP reaction by modification of the loxP sites (17, 18) to induce a shift in reaction equilibrium toward increased production of minicircle. This will also serve to reduce concatamer formation from multiple copies of minicircle DNA.

This approach to eliminating bacterial DNA from delivery vectors is also stimulated by our work on the development of expression vectors for use in mitochondrial gene therapy. Our aim is to express an ornithine transcarbamylase gene sequence, modified for mitochondrial translation (sOTC), within mitochondria (19). Because no vectors exist for mammalian mitochondrial gene expression, we have inserted the sOTC gene between two tRNA genes within the entire mouse mitochondrial genome, cloned into a bacterial plasmid vector for propagation (19, 20). Due to the rarity of non-coding sequences within mammalian mtDNA the presence of a bacterial vector is likely to be deleterious to either or all of the processes of mitochondrial RNA splicing, replication, and transcription. Elimination of the bacterial vector sequences should both overcome this problem and reduce the size of these vectors, increasing the ease of their introduction into mitochondria.

In this paper we describe the construction and testing of a bacterial strain exhibiting tightly controlled and efficient expression of cre recombinase. We have developed this system for DNA minicircle generation using a wide range of producer plasmids designed for both nuclear and mitochondrial gene expression with sizes ranging from 6 to 20 kb. We also demonstrate the use of mutant loxP sites to direct the Cre reaction resulting in improved yields of supercoiled luciferase minicircle, as well as showing significantly increased gene expression in vitro of this construct over standard plasmid vectors.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmids, Strains, and Oligonucleotides

Plasmid pBC SK(+) was purchased from Stratagene, Plasmid pDSRed1-N1 was purchased from CLONTECH. Plasmids p705Cre, pBAD33Cre, and pSVpAX1, as well as bacterial strain MM294, were kind gifts from Dr. F. Buchholz and Dr. A. F. Stewart (EMBL). Plasmid pCIKluc was a gift from Dr. D. Gill and Dr. S. Hyde (Oxford University). Mitochondrial plasmids pRSmtOTCAPr, and pRSmtJMC, were made as previously described (21). Oligonucleotides (Genosys) DLOX 5'-GGAATTCATAACTTCGTATAATGTATGCTATACGAAGTTATTAATCTCGAGTAATAACTTCGTATAATGTATGCTATACGAAGTTATGGTACCGCGCCCG-3' and REVDL 5'-CGGGCGCGGTACCATAACT-3' were used to synthesize a DNA fragment with two loxP sites to ultimately create plasmid pDlox3, as well as to reconstruct the ND5/ND6 junction to create pDlox1. Oligonucleotides LINK1 5'-TCGAGTCGACTCTAGAGGATCCGAGCTCCCCGGGAAGCTTCTGCAGT-3' and LINK2 5'-TCGAACTGCAGAAGCTTCCCGGGGAGCTCGGATCCTCTAGAGTCGAC-3' were used to create a polylinker sequence for the plasmid pDlox3. Oligonucleotides LoxF 5'-CTCGAATTCATAACTTCGTATAGCATACATTATACGAACGGTACTCGAGTACCGTTCGTATAGCATACATTATACGAAGTTATGGTACCAAAAA-3' and LoxR5'-TTTTTGGTACCATAACT-3' were used to create LE and RE mutant loxP sites to ultimately create construct pFIX. Primers NsiICre 5'-GTGAATGATGTAGCCGTCAAG-3' (homologous to a sequence in the cre gene) and CreIntFwd 5'-CCATGATTACGGATTCAC-3' (homologous to nucleotides 2-18 of the chromosomal lacZ gene) were used to amplify a 1.9-kb region, demonstrating insertion of the cre-araC cassette into the bacterial genome. All constructs were sequenced over the insertion regions and gene expression regions, including loxP sites, using the Big Dye kit (PerkinElmer Life Sciences), on a PerkinElmer Life Sciences 377 sequencing apparatus.

Construction of the pBAD75Cre-targeting Plasmid

Plasmid p705Cre was adapted by the excision of part of the cre gene, the promoter, and most of the CI 857 temperature-sensitive repressor, at NsiI/RsrII sites. This 583-bp fragment was then replaced with the 1624-bp control regions from pBAD33Cre, including the same part of the cre gene, the BAD promoter, and the araC regulator, also using NsiI/RsrII sites to create pBAD75Cre.

Construction of the MM219Cre Strain

The recombination-competent (recA+) bacterial strain MM294 was transformed with pBAD75Cre, and the cre/araC cassette was inserted into the bacterial lacZ gene using the targeting method of Hamilton et al. (22) (Fig. 1) to produce strain MM219Cre.

Construction of pDlox1 and pDlox3 Dual loxP Plasmids

The SacI site was removed from pBC SK(+) by SacI digestion, filling-in with Klenow (Life Technologies, Inc.) and religation. Two loxP sites were inserted into the resulting pBC SK-SacI0 plasmid by annealing DLOX and REVDL oligonucleotides, endfilling with Klenow, digesting of both the fragment and the plasmid by EcoRI/KpnI and subsequently ligating to create pDlox1. The polylinker was removed by XbaI/PstI digestion, endfilled with Klenow, and ligated to form pDlox2. Then a new polylinker formed by the annealing of LINK1 and LINK2 was introduced between the loxP sites of pDlox2 at XhoI to create pDlox3.

Construction of pNIXluc and Mutant loxP Containing pFIXluc Nuclear Plasmids

Plasmid pNIXluc was created by the insertion of the BamHI/BglII luciferase cassette from pCIKluc, into the BamHI site of pDlox3.

Dual mutant loxP sites (LE and RE) were introduced into pBCSK+ by annealing LoxF and LoxR oligos, filled-in with Pfx polymerase (Life Technologies Inc.), digesting further with EcoRI/KpnI, and ligating to create pMlox1. The unwanted polylinker was removed from pMlox1 by PstI/XbaI digestion, Klenow treatment, and self-ligation to produce pMlox2. A replacement polylinker was added within the loxP sites by the insertion of the entire pDSRed1-N1 plasmid at XhoI (pMlox3), before removal of the remainder of pDSRed1-N1, excluding the polylinker, by BamHI/NheI digestion, endfilling using Klenow, and subsequent ligation to create pFIX. Plasmid pFIXluc was created by the replacement of the pDSRed1-N1 BamHI/BglII fragment from pMlox3 with the BamHI/BglII luciferase cassette from pCIKluc.

Construction of pMEV8, pMEV46, pMEV88 Mitochondrial Plasmids

Construct pMEV8 was made by the insertion of pDlox1 into the unique XhoI site of pRSmtOTCAPrDelta XhoI (21). The ampicillin-resistant vector pRS316 was removed from this construct by digestion with SacI and religation to form pMEV8.

Construct pMEV46 was formed by exchange of pRS406 with pDlox3 at the BamHI site of pRSmtJMC (21). Construct pMEV88 was constructed by the deletion of the 16 S and most of the 12 S rRNA genes at the Klenow-filled BlpI/SnaBI sites of pMEV46.

Minicircle Production and Purification

Electrocompetent MM219Cre cells (25 µl) were electro-transformed (Bio-Rad Gene pulser) according to the manufacturer's instructions, with the appropriate minicircle producer plasmids. Transformed cells were allowed to recover for 1 h in Luria-Bertani media (LB) containing 1% glucose, before plating on LB 1% glucose containing 30 µg/µl chloramphenicol (Cm). Selected colonies were amplified in LB 1% glucose, Cm and frozen in 20% v/v glycerol. Transformed cells containing a minicircle producer plasmid were grown as a 5-ml starter culture overnight at 37 °C in LB 1% glucose with Cm, before inoculation of 500-ml flasks. The most successful growth and cre induction conditions were as follows:

Technique 1-- Cells were grown overnight in a shaking incubator at 37 °C in modified M9 minimal media (with the addition of 0.2% yeast extract) (Difco) supplemented with 0.2% glucose and 30 µg/µl Cm (Sigma-Aldrich). Cells were pelleted at 5000 rpm for 10 min before resuspension in 1 volume of modified M9 minimal media. After washing, cells were re-pelleted at 5000 rpm and resuspended in the same volume of cre induction media (modified M9 minimal media supplemented with 0.5% L-arabinose (Sigma-Aldrich)) and further grown in a shaking incubator at 37 °C for 2-4 h.

Technique 2-- Cells were grown overnight at 37 °C in LB supplemented with 0.5% glucose and 30 µg/µl Cm. Cells were pelleted at 5000 rpm for 10 min before resuspension in 1 volume of M9 minimal media. After washing, cells were re-pelleted at 5000 rpm and resuspended in the same volume of cre induction media (M9 minimal media supplemented with 0.5% L-arabinose) and further grown in a shaking incubator at 37 °C for 4-6 h.

One liter of cells was treated in 5 mg/ml lysozyme in 40 ml of solution I (50 mM glucose, 25 mM Tris.Cl pH 8.0, 10 mM EDTA), followed by lysis in 80 ml (0.2N NaOH, 1% SDS) and finally neutralized in 60 ml of 3 M potassium acetate (pH 4.8). The cleared supernatant was isopropanol-precipitated, and the resulting DNA solution was further purified by RNA precipitation in 6 M lithium chloride, RNase treatment, and phenol/chloroform extraction (23). This technique provides very high yields of DNA per liter of culture (~10 mg).

The resulting pool of DNA products, producer plasmid, and excised bacterial vector were cut with the triple-cutting PvuII for luciferase plasmids and with NotI for mitochondrial plasmids. Undigested supercoiled minicircle could then be density-separated from linear producer plasmid and excised bacterial vector on a cesium chloride gradient using the intercalating agent ethidium bromide (24) or, more effectively, propidium iodide. Removal of cesium chloride was achieved by dilution in 3 volumes of water, ethanol precipitation, and two washes in 70% ethanol (25). Minicircle DNA was run through cation exchange columns AG50W-X8 (Bio-Rad) to remove ethidium bromide or propidium iodide according to the manufacturer's instructions to achieve maximal DNA yield from the columns.

Transfection of Mammalian Cells with Minicircles and Control Plasmids

2 × 105 cells were seeded into a 24-well tissue culture plate in 1 ml of growth medium (DMEM (Life Technologies) + 10% (v/v) fetal calf serum (FCS)) and incubated at 37 °C until 50-80% confluent (~16 h). 0.24-0.5 µg of DNA in 100 µl of OPTIMEM media (Life Technologies) was complexed to LipofectAMINE (Life Technologies, Inc.) in 100 µl of OPTIMEM media (2 mg/ml) in the ratio of 10 µl of LipofectAMINE/µg of DNA, according to the manufacturer's instructions. To obtain six replicates per treatment, this reaction was appropriately scaled-up and the DNA-liposome complex was allowed to form at 37 °C for 20 min. Cells were washed once in OPTIMEM, and a 200-µl reaction volume of complexed DNA in OPTIMEM was then overlaid onto the cells in each well. 4 h later 1 ml of DMEM containing 10% (v/v) FCS was added and the incubation continued at 37 °C. 24 h after the start of transfection, the media was exchanged (DMEM + FCS) and 24 h following this, cells were harvested and transgene activity was measured.

Measurement of Relative Luciferase Activity and Statistical Analysis

Luciferase activity was measured using the Luciferase Reporter Gene Assay kit (Roche Molecular Biochemicals) on a Lucy1 luminometer (Anthos, Life Technologies, Inc., UK) according to the manufacturer's instructions. The total protein per measurement was determined in a colorimetric assay using the Micro BCA Protein Assay Reagent kit (Pierce, Rockford, IL) according to the manufacturer's instructions. Relative light units of luciferase activity per minute per measurement were then adjusted to that obtained for 1 mg of total protein per measurement.

Significance tests were based on the mean from six replicates for each assay. To satisfy requirements for analysis of variance, raw data was transformed by taking the Log10 of each figure. This results in data that are relatively normally distributed (Shapiro-Wilk test) within treatments, with more equal treatment variances.

We have used the analysis of variance to determine the pooled variance for the 9 treatments and subsequently used a method for multiple comparisons based on the Studentized range (Q) between means, which is considerably more stringent than either 95% confidence intervals based on 1.96 (standard error) or the least significant difference test. Given that all sample sizes are equal between compared treatments (six replicates each), this determines a critical value (omega ) for the difference between the largest and the smallest sample means and applies this to the whole experimental set to obtain a 95% confidence interval between any pair of means. The value of the Q method is such that, when comparing all of the differences between means in this manner over a large number of treatments, the probability that no erroneous claims of significance are made is >= 95%.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Creation of a Bacterial Strain Expressing cre Recombinase under the Control of the Arabinose Regulon-- We modified the vector pBAD33Cre, a direct derivative of the pBAD33 expression vector (26) containing the arabinose control regulon (araC), to create a new cre recombinase-expressing bacterial strain (Fig. 1).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1.   Insertion of cre/araC into the chromosomal lacZ locus of MM294 bacteria. a, the plasmid pBAD75Cre contains the cre/ara expression cassette flanked by areas of homology to the bacterial lacZ gene (Delta lacZ1 and Delta lacZ2). The chromosomal lacZ gene has been represented here by five regions for simplicity of reference: lacZ start region, Delta lacZ1 region, lacZ Mid region, Delta lacZ2 region and finally lacZ end region, all of which make up the complete lacZ gene. Use of the temperature-sensitive plasmid replicon, pSC101ts, permits selection for integration of the entire plasmid into the lacZ locus, by using conditions non-permissive for plasmid growth (44 °C) and selection for white chloramphenicol-resistant (Cmr) colonies (loss of function of pSC101ts as shown by X). A second recombination (excision) event, removing the bacterial vector sequences, is selected for by propagation at 30 °C permissive for plasmid replication, and selection of white Cmr colonies. The excised plasmid is not capable of lacZ expression, because it still lacks the start and end of the lacZ gene. Cmr selection may be dropped for 3 days, resulting in loss of the Cmr plasmid, giving white chloramphenicol-sensitive colonies containing the integrated cre/ara cassette. b, targeted insertion of the cre/ara cassette was tested by PCR amplification of a 1.9-kb fragment using one primer in the cre gene and another in the chromosomal part of the lacZ gene. Colony 442 was the result of the first recombination event to insert the entire pBAD75Cre plasmid into the lacZ gene and serves here as a positive control. Colonies 218 and 219 are the result of a second recombination (excision) event leaving solely the cre/ara cassette in the chromosome at lacZ. Colony 252blue has resulted in the excision of the entire plasmid and serves as a negative control.

The plasmid, p705Cre, which also expresses cre recombinase, has a leaky lambda PR-based expression cassette flanked by regions of homology to the bacterial lacZ gene, permitting targeted insertion into the bacterial genome by homologous recombination.

Replacement of the cre expression cassette in p705Cre with the cre/araC expression cassette from pBAD33Cre resulted in the creation of a targeting plasmid pBAD75Cre.

Controlled cre expression from this new plasmid was tested by co-transforming bacteria with pBAD75Cre and the Cre reporter construct pSVpaX1, which uses a convenient lacZ-based assay for Cre activity (27). Growth on LB media containing arabinose led to Cre-mediated excision of a 1.1-kb segment from this plasmid and lacZ inactivation giving white colonies. Growth on media containing glucose led to no Cre-mediated excision, thus leaving the lacZ gene intact and resulting solely in blue colonies (not shown). This provides good evidence that plasmid-based cre expression from the arabinose regulon is absent on growth in glucose-containing media, whereas growth in arabinose-containing media (in the absence of glucose) results in successful cre expression.

Targeted cre/araC insertion into the recA+ bacterial strain MM294 using pBAD75Cre was achieved by successive rounds of targeted recombination and excision at the lacZ chromosomal locus and the use of the temperature-sensitive plasmid replicon pSC101ts (22) (Fig. 1).

A PCR-based assay was used to determine successful targeted cre/araC insertion into the lacZ gene (Fig. 1, inset) thus creating strain MM219Cre (F- lambda  · supE44 endA1 thi-1 hsdR17 lacZ::araC-Cre).

Construction of Minicircle Producer Constructs-- To expedite the process of construct manufacture for both nuclear and mitochondrial expression, a multicloning plasmid containing dual loxP sites flanking a polylinker (pDlox3) was created from the basic vector pBCSK(+). This plasmid permits easy insertion of expression cassettes or mitochondrial sequences into the polylinker region, to create minicircle producer plasmids.

The initial construct for nuclear expression was generated by cloning of the luciferase reporter gene and CMV promoter from the high expression plasmid pCIKluc, into the loxP flanked polylinker of pDlox3. The resulting plasmid, pNIXluc, contains a luciferase expression cassette of minimal size flanked by loxP sites to permit removal of bacterial sequences by Cre recombination to create mNIXluc minicircle (Fig. 2a).


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 2.   Minicircle producer constructs. a, plasmid pNIXluc for constitutive mammalian luciferase expression was constructed by insertion of the CMV/luc cassette from pCIKluc into pDlox3. This construct will form minicircles by the Cre-directed excision of bacterial vector sequences at loxP sites. Differential digestion of the resulting products with an enzyme that cuts only in the bacterial vector, and not in the expression minicircle, permits purification of supercoiled minicircle from unwanted linearized producer plasmid and excised bacterial vector using cesium chloride density separation gradients. In the case of mitochondrial constructs, NotI was used to digest the bacterial vector, while PvuII was used to digest bacterial vector from luciferase constructs for nuclear gene delivery. b, plasmid pMEV8 was constructed as described under "Experimental Procedures." To further reduce the size of mitochondrial constructs, regions of mitochondrial DNA were PCR-amplified and cloned (three regions shown by blue arrows), to create pMEV46 (8.7 kb), including the D loop, the 12 S and 16 S rRNA regions, the sOTC gene, and the origin of light-chain replication.

We have previously created a 22-kb construct designed for mitochondrial expression based on the insertion of a modified OTC gene between two tRNA sites within the entire mouse mtDNA (19-21). This expression construct is difficult to modify due to its instability (21) and presents problems for introduction into mitochondria by electroporation, due to its large size (28).3 In addition, the bacterial vector falls within the mitochondrial gene COXIII, is not easily removable, and is likely to abolish mitochondrial gene function.

To ameliorate this situation, the loxP-flanked pDlox1 vector was inserted into pRSmtOTCAPr at XhoI, and the pRS316 vector was removed to create the mitochondrial minicircle producer plasmid pMEV8. This XhoI site in mouse mtDNA is situated in a 14-bp area where the ND5 gene coded on the heavy strand overlaps the terminal coding region of the ND6 gene, oriented in the opposite direction on the light strand. The terminal regions of the ND5 and ND6 genes were reconstructed between the loxP sites of the insertion vector pDlox1 to ensure complete transcription from these genes within pMEV8 (Fig. 2b).

The mitochondrial minicircle resulting from Cre-mediated excision of pDlox1Delta from pMEV8 (mMEV8), contains a single 34-bp loxP site flanked by the reconstructed ND5 and ND6 genes. This should minimize the impact of incorrect splicing resulting from the presence of a foreign sequence on transcribed mitochondrial minicircle DNA.

Smaller mitochondrial constructs were also made to permit more efficient DNA transfer into mitochondria, by PCR amplification of key regions of the mitochondrial genome and the sOTC gene (21). Construct pMEV46 consists of the mitochondrial D loop, 12 S, 16 S rRNA, the origin of light chain replication and several tRNAs, with the loxP-flanked pDlox3 inserted at the already artificial Thr/Ser tRNA gene junction (Fig. 2b). An even smaller 6.8-kb derivative, pMEV88 (not shown), lacks most of the 12 S and 16 S rRNA regions of pMEV46.

Because tRNAs are believed to act as cleavage signals within polycistronic mtRNA transcripts (29, 30) we anticipate that the 34-bp loxP site will have minimal impact on mitochondrial transcription in these constructs.

All of these minicircle producer constructs are designed to permit excision of the bacterial vector (pDlox1Delta or pDlox3Delta ) by Cre recombination to leave solely a 34-bp loxP site within the resulting minicircle constructs (Fig. 2).

Cre Recombinase Activity and Minicircle Production in MM Bacterial Strains-- Our novel Escherichia coli strain, MM219Cre, expresses cre recombinase under tight control of the araC regulon. The AraC protein acts as both a positive and negative regulator of Cre activity. In the presence of arabinose in growth media, transcription from the BAD promoter is turned on; in its absence, transcription proceeds at a very low level. The addition of glucose to growth media, which lowers levels of 3',5'-cAMP, further down-regulates the catabolite-repressed BAD promoter (13-15).

MM219Cre cells transformed with different minicircle producer plasmids showed effective repression of cre recombinase over a range of media types using varying levels of glucose. We used minicircle production and the presence of excised bacterial vector as indicators of leaky cre recombinase expression. The three media types used for bacterial growth in decreasing order of richness were: LB, modified M9 minimal media (containing 0.2% yeast extract) and M9 minimal media, incorporating a range of glucose concentrations from 0.2% to 2%. Rich media (LB) leads to the most rapid growth of both bacteria and plasmid but also results in the exhaustion of glucose. Bacterial growth in M9 minimal media gives comparatively poor bacterial and hence plasmid yields. Initial glucose concentrations higher than about 1% also lead to significant inhibition of bacterial growth, as a result of the Crabtree effect (16, 31, 32), although cre induction is still effectively repressed.

The best growth conditions were obtained using levels of 0.2-0.5% glucose with any of the media types, striking a balance between bacterial and thus plasmid replication and down-regulated cre expression.

However, growth of MM219Cre cells containing the largest plasmid, pMEV8 (20.7 kb), in LB 0.2-0.5% glucose leads to a slight induction of cre, minicircle production, and subsequent loss of minicircle during growth. Assuming that there is slight cre expression during bacterial growth using low glucose levels, the potential toxicity of the largest mitochondrial construct may help to induce loss of replication-deficient minicircle during plasmid replication under chloramphenicol selection.

We do not observe significant minicircle production (and subsequent loss) using the same low glucose media growth conditions in the case of any other minicircle producer constructs. This is in accordance with data on pBAD expression plasmids for which no significant gene induction effects have been observed under similar low glucose conditions (26). By changing media type to modified M9 minimal media, glucose levels could be kept low (0.2%) and still effectively down-regulate cre expression using pMEV8, although this richer media type permitted increased plasmid yields over that of minimal media alone.

Following bacterial and plasmid growth, induction of cre recombinase and thus minicircle production used LB, modified M9 minimal media, or M9 minimal media, containing levels of arabinose from 0.2 to 2%. Arabinose levels had little effect on overall minicircle yields, whereas incubation times of 4-6 h produced the greatest yields of minicircle from smaller plasmids (Fig. 3a), and shorter incubation times of 2-4 h resulted in the largest mitochondrial minicircle mMEV8 (Fig. 3b).


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3.   Time courses of minicircle production from nuclear and mitochondrial constructs. a, MM219Cre cells containing construct pNIXluc (6.5 kb) were grown overnight in LB + 0.5% glucose before induction of cre recombinase expression by media exchange to M9 minimal media + 0.5% arabinose for 2-24 h. This results in the appearance of two new supercoiled excision products; bacterial vector pDlox3Delta (3.4 kb) and luciferase minicircle mNIXluc (3.1 kb). The additional bands above 6.5 kb supercoiled probably represent various alternate concatenations (linear, open circular) of the original plasmid pNIXluc, as well as supercoiled concatamers of both pDlox3Delta and mNIXluc (induced lanes only). The best induction times for effective production of minicircle were between 4 and 6 h. b, MM219Cre cells containing mitochondrial producer construct pMEV8 were grown overnight in LB + 2% glucose, prior to cre recombinase induction in M9 minimal media + 0.5% arabinose for 10-150 min. All products were digested with EcoRI. Induction of cre was evident from the appearance of bands corresponding to mitochondrial minicircle mMEV8 (15, 2, and 0.2 kb) in addition to those of pMEV8 (13.9, 4.5, 2, and 0.2 kb) as well as a linear-excised vector (pDlox1Delta ) band at 3.4 kb. Cre induction appears to initiate as soon as 10 min after initial media change, is obvious after 60 min, and reaches equilibrium at 120-150 min.

The two best techniques for minicircle production were as follows. Technique 1: Growth in modified minimal media, 0.2% glucose overnight, washing in modified minimal media and induction for 2-6 h in modified minimal medium containing 0.5% arabinose. Technique 2: Growth in LB, 0.5% glucose overnight, washing in minimal media, and induction for 4-6 h in minimal media containing 0.5% arabinose.

Following cre recombinase induction, the supercoiled minicircle could be purified away from producer plasmid and excised bacterial vector by restriction enzyme digestion of the latter two forms and purification of supercoiled minicircle using a cesium chloride gradient.

Technique 1 was effective for minicircle production from smaller plasmids, with a purified minicircle yield of up to 200 µg/liter culture, as well as being the only effective method for producing yields of 40 µg/liter culture of minicircle from the large mitochondrial construct pMEV8.

Interestingly, technique 2 produced slightly higher yields of minicircle using smaller plasmids but was very ineffective for minicircle production from the larger pMEV8 construct, presumably due to minicircle loss during bacterial growth.

Media step-down from rich to minimal medium as observed in technique 2 did not seem to reduce cre expression as might be expected but, in contrast, led to a small increase in yields of supercoiled minicircle.

Creation and Testing of a Mutant loxP Containing Construct-- Cre recombination may occur between and within minicircle constructs, producer plasmids, and bacterial vectors resulting in double, triple, etc. concatamers as a result of the equilibrium kinetics exhibited by the reaction. Although a significant proportion of the minicircle produced is in the monomeric-supercoiled form, reduction of the formation of minicircle concatamers as well as the ability to drive the Cre reaction toward minicircle production should permit increased yields of minicircle.

Modification of the terminal 5 nucleotides on one side of the loxP site to create left element (LE) loxP sites, or vice versa to create right element (RE) loxP sites, results in a slightly reduced Cre interaction at these sites (17). Modification of both sides of the loxP site to produce LE/RE double mutant loxP sites results in a severely reduced Cre interaction (17, 18). Recombination between two partially mutant loxP sites, one LE and one RE, leads to the production of a double mutant loxP site (LE/RE) and an unmutated wild type loxP site (WT) in the two products (Fig. 4).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4.   Driving the Cre recombinase reaction to completion by the use of mutant loxP sites. We constructed a new luciferase expression construct, identical to pNIXluc but containing mutant loxP sites, with, respectively, a left element (LE) (bracketed text in shaded box) and right element (RE) (mutation in lowercased text) mutation in the last 5 bp of each site -(pFIXluc). Recombination between a LE loxP and a RE loxP site results in an excised bacterial vector product containing a wild type loxP site (pMlox3Delta ) and a minicircle product (pFIXluc) containing a double mutant LE/RE loxP site. Cre recombinase has a slightly reduced affinity for either an LE site or an RE site; however, it has a severely compromised recognition of an LE/RE site, which results in a shift in the equilibrium toward minicircle production. In addition, because LE/RE double-mutant sites do not easily recombine with each other, the formation of minicircle concatamers should be reduced.

Reverse kinetics in this reaction are extremely poor, due to the reduced affinity of Cre for the LE/RE double mutant loxP site. Thus there is a directed drive toward production of an LE/RE site (17, 18).

Following this concept we created a producer plasmid to contain a mutant LE loxP site and a mutant RE loxP site flanking the polylinker region (pFIX). The CMV/luciferase cassette from pCIKluc was inserted between the LE and RE loxP sites to create a new minicircle producer vector pFIXluc. Growth and induction of this producer plasmid pFIXluc using technique 2 resulted in increased levels of monomeric minicircle compared with excised bacterial vector (Fig. 5). Because the construct has been designed such that the minicircle mFIXluc always contains the LE/RE double mutant loxP site, this is probably a result of reduced minicircle concatamerization and a shift in equilibrium toward minicircle production. This results in a significant increase in overall yield of mFIXluc minicircle over pFIXluc to 300 µg per liter of bacterial culture.


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 5.   Comparison of the dynamics of the Cre/loxP interaction for normal or mutant loxP sites. MM219 cells were transformed with either pNIXluc (normal loxP sites) or pFIXluc (mutant loxP sites) and grown overnight in LB + 0.5% glucose. Cre induction was carried out in M9 minimal media + 0.5% arabinose for 4 h. All plasmids are undigested. Cre recombination of either producer plasmid (pNIXluc or pFIXluc, each 6.4 kb) produces the respective supercoiled minicircle (mNIXluc or mFIXluc, 3.1 kb) as shown, including excised bacterial vector (pDlox3Delta /pMlox3Delta , 3.4 kb). Cre recombination of pNIXluc resulted in roughly equal quantities of the three major reaction components, producer plasmid, minicircle, and excised vector (6.5, 3.1, and 3.4 kb, respectively). However, recombination of pFIXluc (6.4 kb), although not complete, produces a greater quantity of minicircle mFIXluc (3.1 kb) compared with excised bacterial vector (3.4 kb). This is probably due to a reduced ability of Cre to recombine minicircle mFIXluc products with either themselves or the producer plasmid, because of the double mutant loxP site in the minicircle. Cesium chloride-purified minicircle mFIXluc does show some concatamerization (6.2 kb, minicircle X2; 9.3 kb, minicircle X3, etc.), probably as a result of general recombination from the MM219Cre recA+ strain, but most of the minicircle DNA was in the single 3.1-kb supercoiled concatamer form. Supercoiled mFIXluc minicircle yields from 1 liter of bacterial culture of 0.35 mg were, however, considerably higher than those of pNIXluc (0.25 mg) from the same culture volume.

Although maximal obtainable yields of luciferase minicircle measured by spectrophotometry with 260/280 ratios approaching 1.8 were in the region of 5-600 µg/liter of bacterial culture, gel quantification of DNA did not support this data, giving levels ~30% lower. Further RNase treatment and phenol/chloroform purification was performed in these cases to obtain agreement between spectrophotometry and gel data. This may have been the result of residual ethidium bromide/propidium iodide skewing spectrophotometry readings, thus emphasizing the importance of cross-checking measurement data within batches using gel quantification methods.

The MM219Cre strain is recA+, which probably explains the continued occurrence of supercoiled concatamers of mFIXluc minicircle (Fig. 5), despite the severely compromised Cre interaction at the double mutant loxP sites. Despite this, all mFIXluc concatamer forms could be resolved to the same size (3.1 kb) by enzymatic digestion (not shown), suggesting simple concatamerization rather than rearrangements. The possibility of large-scale rearrangements and plasmid deletions using MM219Cre seems unlikely, because the large mitochondrial clones pMEV8 and pRSmtOTCAPr can be stably maintained with no observable rearrangements. In further support of this, it has been possible to clone and stably maintain a 150-kb bacterial artificial chromosome in MM219Cre cells.4 An recA+ strain may actually encourage stable maintenance of some large constructs by permitting repair of damaged constructs.

Gene Expression in Vitro Using Luciferase Minicircle Constructs-- To test the versatility of luciferase expression from our latest nuclear minicircle within mammalian cells, we chose to perform three comparative tests using LipofectAMINE complexed to DNA to obtain cellular transfection. In each test we compared luciferase minicircle mFIXluc with its parent plasmid pFIXluc, as well as with the original plasmid from which pFIXluc was derived (pCIKluc), all of which contain a luciferase cassette driven by a CMV promoter. Treatment regimes over six replicates for each construct are summarized in Table I and Fig. 6.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Summary of the three treatment regimes used to transfect HeLa cells with DNA constructs using the same ratio of LipofectAMINE to DNA in each case (20:1 µg)


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Comparisons of luciferase activity from HeLa cells transfected with liposome/DNA complexes using different minicircle and plasmid constructs. a, means of six replicates of luciferase activity following transfection with DNA/LipofectAMINE complexes (ratio at 20 µg of LipofectAMINE/µg of DNA). Treatment regimes of mole:mole ratios with stuffer DNA and weight:weight and mole:mole without stuffer comparisons are given in Table I. Plasmids pFIXluc and pCIKluc gave roughly similar levels of luciferase activity in mole:mole ratios with stuffer, demonstrating similar gene expression and transfection abilities. Minicircle luciferase activity was increased over pFIXluc by 4.5-fold in mole:mole ratios with stuffer DNA, 8.8-fold in weight:weight ratios and 152-fold in mole:mole ratios without stuffer. The first increase demonstrates an intrinsic increase in minicircle transfection ability or gene expression, probably as a result of multimeric concatamers of minicircle. The second shows that the increased (2.1-fold) number of transcriptional units gives a concomitant increase in transgene activity without changing LipofectAMINE quantities. The final figure demonstrates the cytotoxicity of LipofectAMINE, because reduced quantities of this reagent with minicircle result in vastly increased transfection efficiency. Although these figures are adjusted for total protein quantities per measurement, cell cytotoxicity will still result in reduced gene expression from the surviving cells. b, log10 transforming data from luciferase activity provide a method for satisfying the conditions required to perform analysis of variance (normality of data and equal variances). In this case F is extremely significant at p <=  1.7 × 10-18. We then used the Studentized values of Q to perform a multiple comparisons test between any two pairs of means from these values. The resulting bar shows the minimum distance required between any two means for at least 95% confidence in a significant difference. We can see that comparative increases in luciferase activity from minicircle over either pFIXluc or pCIKluc within each treatment are significant at this level (p <=  0.05) in all cases.

The initial treatment of mole:mole with stuffer DNA compares equal molar ratios of each construct, with the total weight of DNA adjusted to 0.5 µg per well using pDlox2 plasmid. This permits equal levels of LipofectAMINE to be used for transfection in each case, thus minimizing differences resulting from the cytotoxicity of LipofectAMINE. It should therefore result in equal numbers of transcriptional luciferase units being delivered to cells in each case and is thus the most unbiased comparison of minicircle function. The weight:weight treatment compares equal weights of DNA from each construct. LipofectAMINE levels are again equal throughout the treatment, but 2.1 times the amount of minicircle luciferase cassettes should be transfected over pFIXluc. Finally the mole:mole without stuffer treatment allows comparison of molar ratios of constructs with variable LipofectAMINE quantities, while keeping the same ratio of LipofectAMINE to DNA (20:1 µg). Although this permits the transfection of equal numbers of transcriptional luciferase units, the variable LipofectAMINE will give varying results depending on the cytotoxicity of LipofectAMINE.

Fig. 6 demonstrates the results of these three treatments using three plasmids over six replicates in two different graphical representations: (a) first, the means of raw data are presented for each plasmid on a semi-log scale; (b) second, the means of log-transformed data with 95% confidence limits between any pair of means are presented. The Studentized Q test for multiple comparisons, as shown in this case, gives a single bar representing the minimum distance required between any two means to provide 95% confidence in a significant difference. This is in contrast to a 95% confidence interval calculated for an individual mean (1.96 × standard error), given by two opposite bars flanking the mean.

Basic luciferase expression from pFIXluc was roughly comparable to that of pCIKluc (its precursor) in the mole:mole + stuffer comparison, suggesting that gene expression and transfection efficiency from the adapted construct pFIXluc is undiminished. In the weight:weight comparison there was a slight but insignificant increase in luciferase activity by pCIKluc over pFIXluc as expected given the increased number of luciferase cassettes theoretically delivered (1.1-fold). Finally, there was a significant increase of pCIKluc luciferase activity over pFIXluc in the mole:mole without stuffer treatment. Despite equal molar quantities of luciferase cassettes transfected per construct, the difference is probably due to reduced LipofectAMINE in the case of pCIKluc producing less cytotoxicity.

Comparisons between the luciferase expression from pFIXluc and mFIXluc were quite conclusive in demonstrating increased minicircle luciferase expression over pFIXluc in all treatments.

Surprisingly, the mole:mole with stuffer treatment produced a 4.5-fold increase in luciferase activity for minicircle over pFIXluc, which was statistically significant (p <=  0.05) within the treatment. Theoretically, these transfection conditions represent those most likely to give equal levels of transfection in the case of each construct. It should be noted however that, although all constructs were produced in the same way, minicircle production involved cre recombination, which produces multimeric concatamers of minicircle, as well as the predominant monomeric form. Multimeric plasmid forms have previously been shown to increase marker gene activity following transfection in vitro (33), perhaps because they provide a more efficient template for nuclear transcription.

Not surprisingly, weight:weight comparisons showed an 8.8-fold increase of minicircle transgene activity over parent plasmid (pFIXluc) (significant at p < 0.05), as expected given that 2.1 times more luciferase cassettes were transfected over the mFIXluc mole:mole with stuffer treatment.

Finally, minicircle luciferase activity over pFIXluc for mole:mole comparisons with no stuffer DNA was vastly increased (152-fold) (significant at p < 0.05). This increase should be treated with caution, because it serves to highlight the limitations of LipofectAMINE as a transfection reagent, where reduced LipofectAMINE quantities in the case of minicircle transfection cause a huge increase in transgene activity despite equimolar transfection. Indeed, transfection of 0.5 µg of DNA into HeLa cells using this reagent at the applied ratio 20:1 is already becoming toxic to these cells. This is also supported by the transfection of pCIKluc using the same treatment and only slightly less LipofectAMINE, giving a 4.5-fold increase over pFIXluc. Interestingly, transfection comparisons on HeLa cells using either mole:mole with stuffer or weight:weight ratios of 0.25 µg of DNA (at LipofectAMINE levels not toxic to HeLa cells) still show increased minicircle luciferase activity over parental plasmid (not shown).

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We describe the creation of a bacterial strain expressing cre recombinase under the tight control of the araC regulon, which can be used to produce large quantities of DNA minicircle in vivo. We have also developed a range of minicircle constructs for both mitochondrial expression of sOTC and for nuclear luciferase expression. In addition, we demonstrate both effective and substantially increased luciferase expression from nuclear minicircle constructs over both parental plasmids.

Previous techniques for minicircle production (34-36), have used bacterial phage lambda  integrase-mediated recombination to produce minicircle DNA. This system results in attL or attR excision sites of 100-165 bp, following recombination (37). By contrast, the Cre-mediated recombination system employed here results in a recognition site of only 34 bp (9-11), thus producing a minimal construct size.

Yields of over 300 µg of purified minicircle per liter of culture are sufficient for most in vitro and in vivo applications, whereas further scale-up and optimization of the process seems likely to be relatively straightforward.

The mitochondrial minicircles eliminate bacterial sequences that may be able to act specifically as potential mitochondrial origins of replication (38), or break-points for transcription. However, we cannot be sure that even a 34-bp loxP site insertion into gene junction sites will not disrupt transcription and maintenance of these constructs in mitochondria.

Although the reduced-size mitochondrial constructs pMEV46 and pMEV88, made by gene deletion, present additional concerns for stability in organello, the minicircle constructs resulting from these producer plasmids (mMEV46, mMEV88) are now of a size that should enable their electroporation into mitochondria (28). We are currently investigating the internalization and functionality of these mitochondrial constructs.

The nuclear minicircle vectors mNIXluc and mFIXluc clearly possess the advantage of being approximately half the size of their plasmid counterparts. As such, these small constructs demonstrate 4.5-fold increased luciferase activity over their parental plasmid counterparts when transfected on a mole:mole basis (with stuffer DNA) and 8.8-fold increase on a weight:weight basis. The huge increase seen in the mole:mole without stuffer comparison (152-fold) only serves to highlight the versatility of these vectors in reducing the cytotoxic load of DNA/liposome complexes to cells while maximizing the number of transcriptional units transfected. Indeed by the simple expedient of removing the entire bacterial DNA complement, we have also reduced the CpG content of most of these expression vectors by more than 60%. As such, minicircle expression vectors are likely to provide a useful tool for reducing inflammatory responses in non-viral vector delivery in vivo as well as the increased transgene activity already demonstrated in vitro.

    ACKNOWLEDGEMENTS

We thank Drs. F. Buchholz and A. F. Stewart (EMBL) for the kind gifts of plasmids p705Cre, pBAD33Cre, and pSVpAX1, as well as bacterial strain MM294. Also Drs. D. Gill and S. Hyde (Oxford University) generously provided us with the high luciferase expression plasmid pCIKluc prior to publication.

    FOOTNOTES

* This work was supported by the Medical Research Council, The March of Dimes Birth Defects Foundation, and the Association Française de Lutte Centre la Mucoviscidose.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Fax: 0207-594-3015; E-mail: b.bigger@ic.ac.uk.

Published, JBC Papers in Press, April 13, 2001, DOI 10.1074/jbc.M010873200

2 B. W. Bigger, unpublished.

3 J.-M. Collombet, unpublished.

4 S. Howe, personal communication.

    ABBREVIATIONS

The abbreviations used are: bp, base pair(s); sOTC, synthetic ornithine transcarbamylase gene; kb, kilobase(s); DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; PCR, polymerase chain reaction; CMV, cytomegalovirus; LE, left element loxP site; RE, right element loxP site; WT, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Krieg, A. M. (1996) J. Lab. Clin. Med. 128, 128-133
2. Yew, N. S., Wang, K. X., Przybylska, M., Bagley, R. G., Stedman, M., Marshall, J., Scheule, R. K., and Cheng, S. H. (1999) Hum. Gene Ther. 10, 223-234
3. Norman, J., Denham, W., Denham, D., Yang, J., Carter, G., Abouhamze, A., Tannahill, C. L., MacKay, S. L., and Moldawer, L. L. (2000) Gene Ther. 7, 1425-1430
4. McLachlan, G., Stevenson, B. J., Davidson, D. J., and Porteous, D. J. (2000) Gene Ther. 7, 384-392
5. Krieg, A. M. (1999) J. Gene Med. 1, 56-63
6. Krieg, A. M. (2000) Mol. Ther. 1, 209-210
7. Yew, N. S., Zhao, H., Wu, I. H., Song, A., Tousignant, J. D., Przybylska, M., and Cheng, S. H. (2000) Mol. Ther. 1, 255-262
8. Swartz, M. N. T., T. A., and Kornberg, A. (1962) J. Biol. Chem. 237, 1961-1967
9. Abremski, K., Hoess, R., and Sternberg, N. (1983) Cell 32, 1301-1311
10. Abremski, K., and Hoess, R. (1984) J. Biol. Chem. 259, 1509-1514
11. Sternberg, N., Sauer, B., Hoess, R., and Abremski, K. (1986) J. Mol. Biol. 187, 197-212
12. Buchholz, F., Ringrose, L., Angrand, P. O., Rossi, F., and Stewart, A. F. (1996) Nucleic Acids Res. 24, 4256-4262
13. Hirsh, J., and Schleif, R. (1973) J. Mol. Biol. 80, 433-444
14. Hahn, S., Dunn, T., and Schleif, R. (1984) J. Mol. Biol. 180, 61-72
15. Kosiba, B. E., and Schleif, R. (1982) J. Mol. Biol. 156, 53-66
16. Neidhardt, F. C. (1987) in Escherichia coli and Salmonella typhimurium, Cellular and Molecular Biology (Ingraham, J. L. , Brooks-Low, K. , Magasanik, B. , Schaechter, M. , and Umbarger, H. E., eds), Vol. 2 , American Society for Microbiology, Washington, DC
17. Albert, H., Dale, E. C., Lee, E., and Ow, D. W. (1995) Plant J. 7, 649-659
18. Araki, K., Araki, M., and Yamamura, K. (1997) Nucleic Acids Res. 25, 868-872
19. Wheeler, V. C., Prodromou, C., Pearl, L. H., Williamson, R., and Coutelle, C. (1996) Gene 169, 251-255
20. Wheeler, V. C., Aitken, M., and Coutelle, C. (1997) Gene 198, 203-209
21. Bigger, B., Tolmachov, O., Collombet, J. M., and Coutelle, C. (2000) Anal. Biochem. 277, 236-242
22. Hamilton, C. M., Aldea, M., Washburn, B. K., Babitzke, P., and Kushner, S. R. (1989) J. Bacteriol. 171, 4617-4622
23. Tolmachov, O. E. (1990) Biotekhnologiya 1, 25
24. Radloff, R., Bauer, W., and Vinograd, J. (1967) Biochemistry 57, 1514-1521
25. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
26. Guzman, L. M., Belin, D., Carson, M. J., and Beckwith, J. (1995) J. Bacteriol. 177, 4121-4130
27. Buchholz, F., Angrand, P. O., and Stewart, A. F. (1996) Nucleic Acids Res. 24, 3118-3119
28. Collombet, J.-M., Wheeler, V. C., Vogel, F., and Coutelle, C. (1997) J. Biol. Chem. 272, 5342-5347
29. Ojala, D., Merkel, C., Gelfand, R., and Attardi, G. (1980) Cell 22, 393-403
30. Ojala, D., Montoya, J., and Attardi, G. (1981) Nature 290, 470-474
31. Aristidou, A. A., San, K. Y., and Bennett, G. N. (1999) Biotechnol. Prog. 15, 140-145
32. Gschaedler, A., Robas, N., Boudrant, J., and Branlant, C. (1999) Biotechnol. Bioeng. 63, 712-720
33. Leahy, P., Carmichael, G. G., and Rossomando, E. F. (1997) Nucleic Acids Res. 25, 449-450
34. Darquet, A. M., Cameron, B., Wils, P., Scherman, D., and Crouzet, J. (1997) Gene Ther. 4, 1341-1349
35. Darquet, A. M., Rangara, R., Kreiss, P., Schwartz, B., Naimi, S., Delaere, P., Crouzet, J., and Scherman, D. (1999) Gene Ther. 6, 209-218
36. Kreiss, P., Cameron, B., Darquet, A. M., Scherman, D., and Crouzet, J. (1998) Appl. Microbiol. Biotechnol. 49, 560-567
37. Landy, A. (1989) Annu. Rev. Biochem. 58, 913-949
38. Kazakova, T. B. M., Babich, S. G., Golovina, G. I., Mel'nikova, M. P., and Tsymbalenko, N. V. (1983) Genetika 19, 381-387


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
J. Wu, X. Xiao, P. Zhao, G. Xue, Y. Zhu, X. Zhu, L. Zheng, Y. Zeng, and W. Huang
Minicircle-IFN{gamma} Induces Antiproliferative and Antitumoral Effects in Human Nasopharyngeal Carcinoma
Clin. Cancer Res., August 1, 2006; 12(15): 4702 - 4713.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. J. Farrow, L. B. Barrett, M. Stevenson, K. D. Fisher, J. Finn, R. Spice, M. A. Allan, M. Berry, A. Logan, L. W. Seymour, et al.
Cytoplasmic expression systems triggered by mRNA yield increased gene expression in post-mitotic neurons
Nucleic Acids Res., July 11, 2006; 34(11): e80 - e80.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Vaysse, R. Harbottle, B. Bigger, A. Bergau, O. Tolmachov, and C. Coutelle
Development of a Self-assembling Nuclear Targeting Vector System Based on the Tetracycline Repressor Protein
J. Biol. Chem., February 13, 2004; 279(7): 5555 - 5564.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
T. Tolmachova, R. Anders, J. Stinchcombe, G. Bossi, G. M. Griffiths, C. Huxley, and M. C. Seabra
A General Role for Rab27a in Secretory Cells
Mol. Biol. Cell, January 1, 2004; 15(1): 332 - 344.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/23018    most recent
M010873200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bigger, B. W.
Right arrow Articles by Coutelle, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bigger, B. W.
Right arrow Articles by Coutelle, C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement