|
Originally published In Press as doi:10.1074/jbc.M009912200 on March 23, 2001
J. Biol. Chem., Vol. 276, Issue 25, 23120-23126, June 22, 2001
1(XX) Collagen, a New Member of the Collagen Subfamily,
Fibril-associated Collagens with Interrupted Triple
Helices*
Manuel
Koch ,
Jessica E.
Foley§,
Rita
Hahn¶,
Peihong
Zhou¶,
Robert E.
Burgeson ,
Donald R.
Gerecke¶, and
Marion K.
Gordon¶
From the Cutaneous Biology Research Center,
Massachusetts General Hospital East, Harvard Medical School,
Charlestown, Massachusetts 02129, the § School of Nursing,
University of Pennsylvania, Philadelphia, Pennsylvania 19104, and the
¶ Department of Pharmacology and Toxicology, School of Pharmacy
and Environmental and Occupational Health Sciences Institute, Rutgers
University, Piscataway, New Jersey 08854
Received for publication, October 31, 2000, and in revised form, March 22, 2001
 |
ABSTRACT |
Chick cDNA clones for a new member of the FACIT
(fibril-associated collagens with interrupted triple helices) subfamily
have been isolated and sequenced. The collagen chain encoded by these cDNAs was assigned the next consecutive number, making it the 1(XX) collagen chain. Assignment of type XX collagen to the FACIT family was based on sequence similarities to types XII and XIV collagen. Type XX collagen mRNA is not abundant in the chick
embryo. It is most prevalent in corneal epithelium. It is also
detectable by reverse transcription polymerase chain reaction in
embryonic skin, sternal cartilage, and tendon, but is barely detectable in calvaria, notochord, or neural retina at select stages of
development, suggesting that it is not expressed in these tissues. The
cDNA predicts that the 1(XX) collagen polypeptide is smaller
than the short forms of collagen XII and XIV. A polyclonal antibody against a synthetic 1(XX) peptide reacts with polypeptide bands of
185, 170, and 135 kDa by Western blot analysis. From its similarity to
types XII and XIV collagen, type XX is expected to bind to collagen
fibrils, projecting the amino-terminal domains away from the fibrillar
surface. The projecting NC 3 domains are predicted to
be about half the length of those of collagen XIV.
 |
INTRODUCTION |
The fibril-associated collagens with interrupted triple helices
(FACITs)1 are a subgroup
within the collagen family containing types IX, XII, and XIV collagen
(1). Characteristics shared by the chains in this class are a
carboxyl triple helical domain (Col 1) of about 103-115 amino acid
residues containing two imperfections in the
Gly-X-Y triplet structure; two cysteinyl
residues, one at the end of Col 1 and another five residues into the
adjacent noncollagenous (NC) 1 domain; and conservation of the
sequences of the NC1 and NC2 domains (1). The 1(XII), 1(XIV), and
the long splice variant of the 1(IX) collagen chain each also have a
thrombospondin amino-terminal-like (Tsp) module (also called the
PARP domain) (2). Although all the possible supramolecular structures
of types IX, XII, and XIV collagen are not yet elucidated, each has
been shown to be capable of associating with fibrillar surfaces (3-6).
Presented in this report are cDNAs for a new collagen that has
characteristics very similar to types XII and XIV collagen. The
polypeptide encoded by the cDNA has been assigned the next Roman
numeral, 1(XX).
We demonstrate here that type XX collagen mRNA is not abundant in
any embryonic chick tissue. It is, however, a minor component of
several connective tissues, such as sternal cartilage, cornea, and
tendon. The embryonic tissue of highest abundance is the corneal epithelium, which makes large amounts of fibrillar collagens, as well
as epithelial specific products. 1(XX) collagen polypeptides of 185, 170, and 135 kDa are detected by Western analysis, suggestive of
alternative splicing.
 |
EXPERIMENTAL PROCEDURES |
Isolation of 1(XX) cDNAs--
To obtain a human type XIV
collagen cDNA, a BLAST search (7) of the data base of expressed
sequence tags was performed. A glycerol stock of IMAGE Consortium clone
identification number 34933 (8) was purchased. The clone was
expanded for DNA isolation and sequence analysis. Automated DNA
sequencing was performed by the Department of Physiology core facility
at Tufts Medical School. Upon aligning the new human cDNA sequence
with the sequence of chick and human types XII and XIV collagen, it
became clear that clone 34933 was not a human 1(XIV) clone, but,
instead, a close relative. The aligned sequences were used to select
two conserved areas in the Tsp domain for making degenerate nucleotide primers that would amplify, by RT-PCR (conditions described below), chick and human 1(XII) and 1(XIV) mRNAs, as well as mRNA
for the new collagen, designated 1(XX). Degenerate primers (dXX-1 and dXX-2rc) were synthesized corresponding to conserved regions GSFHK(V/L) H(/V)I and D(R/K)CC(D/E)(I/L)P in the Tsp domain. The primer sequences are: dXX-1,
GG(A/G)AG(C/T)TT(C/T)CA(C/T)AAGGT(T/G)CA(T/C)(A/G)T and dXX-2rc,
GG(G/A)A(T/G)(A/C)TCACA(A/G)CA(T/C)(T/C)(T/G)GTC. As described below,
13-day chick corneal mRNA was amplified with these primers and the
product was inserted into the PCRII vector (Invitrogen, Carlsbad, CA),
following the manufacturer's protocol. Transformed colonies were
expanded and DNA was isolated using Qiagen's (Valencia, CA)
Miniprep DNA isolation kit. Of the clones resulting from this
procedure, sequence analysis demonstrated that chick 1(XII),
1(XIV), and 1(XX) cDNAs were obtained. The chick 1(XX)
cDNAs were designated clones 2001, with a, b, c, etc. to
distinguish individual selected colonies. All were identical.
Tissue Collection and RNA Isolation--
Embryonated eggs were
purchased from Spafas (Norwich, CT) and Avian Services (Frenchtown,
NJ). The following embryonic tissues were dissected from White Leghorn
chick embryos, frozen immediately in liquid nitrogen, and then stored
at 80 °C until used: 5.5-day notochord and neural retina, 7- and
12-day back skin, 7- and 13-day cornea, 14.5-day sterna, and 17-day
lung, calvaria, and tendon. Total RNA was isolated from each using the
Trizol reagent (Life Technologies, Inc.) following the
manufacturer's instructions. Poly(A)+ mRNA was
isolated using Qiagen Oligotex beads. In other dissections, corneas
without surrounding scleral tissue were removed from day 13 embryos and
placed into a dish containing 50 mM EDTA, 0.25% dispase
(Roche Molecular Biochemicals) in phosphate-buffered saline, pH 7.4, at
37 °C. After 5 min of incubation, the epithelia were gently removed
from the underlying stroma. Separated corneal epithelial and
stromal/endothelial layers were immediately frozen in liquid nitrogen
and then used to isolate poly(A)+ mRNA as described above.
Primer Extension Analysis--
A primer,
TTACCCGCACTTTGTAGCCATTGA, corresponding to the reverse complement of
bases 63-86 of clone 2015 (see Fig. 1), was labeled using the Kinase
MaxTM 5' end-labeling kit from Ambion (Austin, TX),
following the protocol of the kit. 50,000 cpm of labeled primer was
added to 20 µg of embryonic chick day 13 total RNA and the mixture
was ethanol-precipitated. The pellet was taken up in 30 µl of
hybridization buffer (80% deionized formamide, 100 mM
sodium citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, 1 mM EDTA), incubated at 37 °C overnight, and then
ethanol-precipitated again. The pellet was resuspended in 22 µl of
water, and then to it was added 8 µl of 5× RT buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 4 µl of 0.1 M DTT, 4 µl of containing 10 mM of each dNTP, and 2 µl (400 units) of Superscript II RNase H-minus reverse transcriptase. After
incubating for 37 °C for 1 h, 1 µl of a mix of 40 µg/ml
RNase A and 2 units/ml RNase T1 were added, and incubation at 37 °C
was continued for 30 min. Loading buffer (4 µl of 95% formamide, 60 mM EDTA, pH 8.0, 0.025% xylene cyanol, 0.25% bromphenol
blue) was added to the sample, the temperature was raised to 95 °C
for 3 min, and then an aliquot was applied to a 10% denaturing
acrylamide gel. After electrophoresis at 40 W, the gel was dried and
exposed to film. A 10-day exposure was required to visualize the
1(XX) primer extended product.
To obtain the 5' untranslated region sequence, unlabeled RNase
digested primer-extended product was generated. The ~330-nucleotide product was adapted for amplification using the Life Technologies, Inc.
5' RACE system kit and subjected to two rounds of polymerase chain reaction using the nested primer of the kit and the collagen XX-specific extension primer. After agarose gel purification, the
excised product was sequenced using the USB (Cleveland, OH) Thermo
Sequenase Radiolabeled Terminator Cycle Sequencing kit, following the manufacturer's instructions.
Reverse Transcription and PCR Conditions--
First strand
cDNA synthesis from mRNA was performed as previously described
(9, 10) and used as template in PCR. For RT-PCR, competitive PCR or
routine DNA amplifications, the following conditions were used: a 20 µl of final reaction volume mixture was assembled consisting of
template DNA, 10 mM Tris-HCl, pH 8.3, 50 mM
KCl, 1.5 mM MgCl2, 200 µM each
dNTP, 1 µM each 5' and 3' specific primers, and 2.5 units
Amplitaq (PE Applied Biosystems, Foster City, CA). The templates were
amplified for one cycle of 94 °C for 1 min; 35 cycles of 94 °C
for 1 min, 56 °C for 1.5 min, 72 °C for 2.5 min; and a final
cycle of 72 °C for 10 min in a Perkin-Elmer 9600 thermocycler.
Chick Marathon Library--
Using a kit from
CLONTECH (Palo Alto, CA), 13-day chick cornea
mRNA was made into a cDNA library and adaptor primers were ligated to both the 5' and 3' ends, as previously described (11). The
cDNA 2001 (see Fig. 1) sequence was used to design chick 1(XX) collagen-specific primers for 5' and 3' rapid amplification of cDNA
ends. A specific primer was paired with a nested adaptor primer to
amplify longer 1(XX) cDNAs from the library. Essential to the
success of this method is the running of accompanying PCRs, amplified
with nested adaptor primer alone. After agarose gel electrophoresis,
products uniquely amplified with a specific 1(XX) collagen primer in
conjunction with the nested adaptor primer were stabbed from the gel
and reamplified with a nested 1(XX) primer and the nested adaptor
primer. Unique products of this reamplification were isolated from
agarose gels and ligated into PCRII for transformation. Isolated
transformants were checked for insert size and sequenced. These new
sequence data were used to generate additional specific primers for
repeating the process, expanding the overlapping clones in each
direction from the Tsp domain. These continuous rounds of marathon
library screening resulted in 18 overlapping clones, shown in Fig. 1.
The sequence derived from the clones is available in
GenBankTM accession number AF312825. Listing the sense
strand primer first and the reverse complement antisense primer second,
the pairs used to obtain these clones from the marathon library are as
follows: for 2002, AP2 (the CLONTECH
Marathon kit nested adaptor primer) and TCCCAGCATGATGAAGCCAGCGGT; for
2003, AGGTTGTGTGCAACAGCTTA and AP2; for 2004, AP2 and
AGCTCCCCTCATCCCTCAATG; for 2005, 2006, 2007, and 2008, CAAAGGAGAAAAAGGCATGGC and AP2; for 2009, AP2 and GAATGTCTCTGAACAGGGTGAAGGTGCGGG; for 2010, AP2 and
TGAACAGGGTGAAGGTGCGGGAGCCACTGA; for 2013, AP2 and
TCTGCTAGACATGTAGGTGACGCGATGAC; for 2014, AP2 and
GGCATCTTCCCCATACAACGCATAC; for 2015 and 2016, AP2 and GCCACCTGCTTCAGCTCAGCCTCATCCGCG.
Other cDNA clones were derived by RT-PCR directly from
13-day cornea mRNA using the following primers: for clone
2011, primers GGGGAAGATGCCAGTGAT and TGAACAGGGTGAAGGTGCGGGAGCCACTGA;
for 2012, ATCAAGCTCTATCTGGACTGTAAA and CAGAAGTGCAGGAGCAGGCAG; for 2017, AGGAGAGAAAGGAGACACTGG and CACATCGGCCATCAGGGAATGA; for 2018, CAGGAGGTCCAGGAGGTCCCT and a modified oligo dT primer,
(N)(N)(N)(N)(T)25.
Competitor Construction--
The 1(XX) collagen competitor
was a deletion construct, produced as previously reported (9, 10, 12).
The G3PDH competitor and primers were those previously reported (9, 10,
12). The template for making the 1(XX) collagen deletion construct was clone 2001. Base numbers correspond to those found in
GenBankTM accession number AF312825. Primers used to
amplify the fragments on each side of the deletion were as follows:
(a) the "extreme" end sense primer
ATCAAGCTCTATCTGGACTGTAAA (bases 3355-3378) in conjunction with
CTCCTCCTCCGCCCC-TCGTGATCCACTCCT (the reverse complement of bases
3470-3483 linked to bases 3525-3540), and (b) sense primer
AGGAGTGGATCACGA-GGGGCGGAGGAGGAC (bases 3470-3483 linked to bases
3525-3540) in conjunction with CAGAAGTGCAGGAGCAGGCAG (reverse
complement of bases 3596-3616). Products were isolated from agarose
gels, mixed together, and fused by overlap extension (13) with both
primers referred to as extreme end primers:
ATCAAGCTCTATCTGGACTGTAAA (sense primer, same as given above in
a) and GGAAGATCACAGCATCGGTC (reverse complement 3438-3557).
The overlap extension product, spanning bases 3355 to 3557 with bases
3484-3524 deleted, was ligated into PCRII and used to transform
bacteria. Isolated colonies were sequenced. Several competitor clones
had the correct sequence with the desired deletion. One was grown in
large scale and plasmid DNA was isolated with Qiagen's maxiprep
kit. After linearizing the plasmid by XhoI digestion, the
competitor was quantitated on agarose gels by comparison to known standards.
To perform the competitive PCR, 400 ng of 7-day and 13-day corneal
mRNA and 13-day corneal epithelial and stromal/endothelial mRNA
were made into cDNA in a 20-µl volume. A set of seven PCRs was
done for each tissue, varying the amount of competitor added to each
reaction. In each tube, buffer, dNTPs, extreme end primers and enzyme
components for a 20-µl PCR were brought up to a volume of 18 µl so that 1 µl of tissue cDNA (representing 20 ng of mRNA starting material) and 1 µl of a serial dilution of competitor DNA
could be added as previously described (9, 10). In the series of seven
tubes, the 1 µl of competitor DNA corresponded to the following
3-fold dilutions: 0.67, 0.33, 0.10, 0.067, 0.033, 0.01, and 0.0067 amol/µl. G3PDH was quantitated using competitor and primers
that were previously described (9, 10).
Ten microliters of each competitive PCR was applied to 3% MetaPhor
agarose gels (FMC, Rockland, ME) made with TBE buffer and 0.5 µg/ml
ethidium bromide. The endogenous 1(XX) collagen product was 202 base
pairs; the competitor was 159 base pairs. The G3PDH endogenous product
was 101 base pairs; its competitor was 60 base pairs. Gels were
photographed with an Eagle Eye II (Stratagene, La Jolla, CA) digital
camera. Photograph exposure times were chosen that ensured no band
exceeded 256 pixels. The images were stored on disks for later
analysis. The optical density of the bands was analyzed by
Scanalytics (Billerica, MA) DNA One Scan software, and the ratio
of the endogenous to the competitor band was converted to a number of
amol. Because the endogenous and competitor PCR products
differed in size, a correction factor was applied to adjust for molar
differences in the binding of ethidium bromide. The calculated amol of
cDNA synthesized from endogenous G3PDH mRNA was multiplied by
60/101, or 0.594, and the amol of endogenous 1(XX) collagen cDNA
made from mRNA was multiplied by 159/202, or 0.787. The data were
then plotted as amol endogenous 1(XX) collagen product/amol 1(XX)
competitor on the y axis versus amol 1(XX)
competitor added on the x axis. The point on the graph at
which endogenous/competitor equals 1 is the equivalence point, and
represents the amount of target mRNA in the starting sample. To
represent the amount of mRNA present in an equal number of cells,
the amol 1(XX) collagen mRNA was normalized by dividing it by
the corresponding amol G3PDH mRNA value.
Relative PCR--
All relative PCRs were performed in 20 µl
containing the following: 1 µl of cDNA (representing 0.014 ng of
poly(A)+ RNA), 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.4 µM each primer (either the pair for type XX collagen or
for the experimental normalizer, G3PDH, as in the competitive PCR
above), 0.1 mM each dNTP, 0.2 µl of
[ -32P]dCTP (10 µCi/µl; >3000 Ci per mmol) and
0.025 units of Amplitaq (PE Applied Biosystems, Foster City, CA). For
consistency, multiple PCRs were set up from master mixes made with all
reagents except the cDNA; 19-µl aliquots of the master mix were
put in thin-walled 250-µl tubes, and 1 µl of the appropriate
cDNA was added. Conditions for cycling were as follows: 1 premelt
step at 94 °C for 1 min, followed by the linear range number of
cycles, experimentally determined to be 21 (see below), each consisting
of a 94 °C melting step for 15 s, a 56 °C annealing
incubation for 25 s, and a 72 °C elongation step for 90 s.
Reactions were terminated in the linear range of amplification to
ensure that the amount of product amplified reflects the quantity of
starting mRNA. To determine this range, eight identical 20-µl
PCRs were performed using the type XX collagen extreme end primers or
G3PDH primers for each embryonic tissue cDNA tested. These were
5.5-day notochord and neural retina, 7- and 12-day back skin, 7- and
13-day cornea, 14.5-day sterna, and 17-day lung, calvaria, and tendon.
The samples were loaded into a Perkin-Elmer 9600 thermocycler, and one
tube of each was removed after 15 cycles, one after 17 cycles, and one
each after completing cycles 19, 21, 23, 25, 27, and 35. After adding
10 µl of loading buffer (95% formamide, 10 mM EDTA, pH
7.6, 0.1% xylene cyanol, 0.1% bromphenol blue) to each tube, 5 µl
of each sample was applied to 5% denaturing polyacrylamide gels
(containing 7.7 M urea) (14). The gel was run at 2000 V
until the dye ran to the bottom, and then it was fixed in 10%
methanol, 10% acetic acid; dried; and exposed to film. Bands were
excised from the dried gel and counted by the Cerenkov method in a
scintillation counter. The cpm (y axis) were plotted
versus the cycle number (x axis). The linear
range of amplification for all tissues with the G3PDH primers and for
the tissues most abundant in collagen XX was between 19 and 23 cycles. All subsequent relative PCRs were performed for 21 cycles. Relative PCRs were performed for all tissue samples at the same time, using a
master mix of components, and run on one gel for consistency. Bands
were excised from the gel and counted as described above.
Anti-chick Collagen XX Antibody and Western Blot
Analysis--
The sequence of the translated 1(XX) collagen
polypeptide was computer analyzed to determine an optimal antigenic
site. The services of Alpha Diagnostics (San Antonio, TX) were used to
synthesize the selected peptide and to generate a monospecific
polyclonal antibody against the 1(XX) collagen chain. The 1(XX)
peptide sequence chosen was KADLQEVSFDQQEC, a region in the Tsp domain. (The carboxyl-terminal cysteine is not in the 1(XX) collagen sequence but is needed for coupling the peptide before injection into
rabbits.) The enzyme-linked immunosorbent assay titer of the 10-week
bleed, diluted 1:100,000, showed that the anti-chick anti-collagen XX
antibody was more than 6 times greater than the preimmune serum.
Synthetic peptides were made for the analogous regions of the Tsp
domain in 1(XIV) collagen (KGDFQTVTFEGPE) and 1(XII) collagen
(RGEVQTVTFDNDE) and were used to check for cross-reactivity with the
anti-collagen XX antibody. By enzyme-linked immunosorbent assay, no
cross-reaction was detected.
To isolate corneal proteins for Western analysis, central corneas were
isolated from 13-day chick embryos and stored at 80 °C until use.
Prior to extraction, tissue was weighed. For each gram, 5 ml of low
salt extraction buffer (200 mM NaCl, 25 mM
Tris, 10 mM EDTA, 10 mM benzamidine-HCl, 0.1 mM N-ethylmaleimide, 1 µg/ml leupeptin, 1 µg/ml pepstatin, pH 7.8) was added. The tissue was homogenized in a
polytron. An equal volume of buffer was added to reduce viscosity, and
the sample was rehomogenized. Following centrifugation at 20,000 × g for 30 min at 4 °C, the supernatant was collected.
The protein concentration was determined to be 0.45 mg/ml by a dye
binding assay (Bio-Rad) using IgG as a standard. Samples (40 µg of
total protein) were run in reducing (1% mercapoethanol) sample buffer
(14), heated to 95 °C, 10 min, and loaded on a 5%
SDS-polyacrylamide gel (with a 4% stacking gel). After
electrophoresis, proteins were transferred to nitrocellulose membrane
(Bio-Rad). The blot was blocked with 5% nonfat dry milk in
phosphate-buffered saline, washed with phosphate-buffered saline/Tween
20, and incubated with primary antibody (1:10,000 in phosphate-buffered
saline/Tween 20/1% bovine serum albumin) at room temperature
for 1 h. (In addition to the anti-chick 1(XX) collagen
antibody, anti-chick anti- 1(XIV) collagen (10), anti-bovine
anti-collagen XII antibody 1851 (15). and anti-chick anti- 1(XII)
collagen antibody 522 (5, 9) were used as control primary antibodies.)
Membranes were washed and incubated with horseradish
peroxidase-conjugated anti-rabbit secondary antibody (Jackson
ImmunoResearch, West Grove, PA) (1:20,000) for 1 h.
Chemiluminescence (Pierce) was recorded on x-ray films.
 |
RESULTS AND DISCUSSION |
Isolation of cDNAs for Type XX Collagen--
The data base of
expressed sequence tag cDNAs was searched for human type XIV
collagen cDNAs. Four candidate cDNAs were found. One expressed
sequence tag had been placed in the data base with about 70 bases
sequenced, encoding 23 amino acid residues of a Tsp domain, and on the
basis of sequence similarity, it was tentatively identified as an
1(XIV) collagen cDNA. Although this region was highly homologous
to type XIV collagen, it was not identical to the known human sequence:
16 of the 23 amino acid residues were identical, but 7 were
conservative changes. A glycerol stock of this clone was purchased
(IMAGE Consortium clone identification number 34933 (8)) and
expanded for DNA isolation. Sequence analysis demonstrated that the
cDNA encoded 233 amino acid residues of a Tsp domain and 12 amino
acids (four triplets) of a collagenous domain (Col 2), suggesting that
it was indeed a member of the collagen family.
BLAST searches (7) indicated that the Tsp domain of the new collagen
chain was closest in identity to type XIV collagen and second
closest to type XII collagen. Within the Tsp domains found in collagens
(2), localized areas are unique to collagens XII and XIV of avian and
mammalian species. The new human cDNA shared these subfamily
similarities, allowing us to design degenerate primers that would
theoretically amplify mRNAs of any subfamily member, type XII, XIV,
or the new chain, from chick or human, by RT-PCR. Because of our
interest in development, particularly of the cornea, our goal was to
obtain the chick cDNA corresponding to the new human collagen chain. As expected, by amplifying chick cornea cDNA with this
degenerate primer pair, cDNA clones were obtained for the known Tsp
domains of chick types XII and XIV, as well as for a new cDNA
(clone 2001, shown in Fig. 1), almost
identical in sequence to the human cDNA (data not shown). Using
this chick chain sequence, unique primers were designed from
regions where the sequence diverged from collagens XII and XIV. These
primers amplified only the new chick collagen chain, and not
1(XII) or 1(XIV) collagens in RT-PCR.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic of the chicken
1(XX) collagen mRNA (top
line). The domain structure of the encoded protein is
indicated on the mRNA. Overlapping cDNAs are shown
below. Clone 2001 was the first chick cDNA obtained by
RT-PCR using degenerate primers to amplify a portion of the Tsp domain.
(The primer extension product encoding the 5' untranslated region and
the signal peptide was not ligated into vector and cloned. Therefore,
these domains are not included in the figure.) nts,
nucleotides.
|
|
A Marathon cDNA library was made from day 13 embryonic chick
corneal mRNA, and the specific primers were used to extend the sequence of chick cDNA by 5' and 3' rapid amplification of cDNA ends. The resulting overlapping clones are shown in Fig. 1. The divergence of the domain structure from 1(XII) and 1(XIV)
collagen chain sequences in the NC3 domain suggested that the cDNA
represented a new member of the FACIT family and not a new chain of
an already described collagen. Assigning the translated cDNA
sequence the next available Roman numeral, the clone was designated the
1(XX) collagen chain. The nucleotide sequence of the composite
cDNA is found under GenBankTM accession number
AF312825. It is believed that the entire 3' end of the mRNA is
represented in this composite because two clones, isolated by different
methods, yielded identical 3' end products, each with a poly(A) tail.
One cDNA was isolated by 3' rapid amplification of cDNA ends of
the marathon library using a primer in the Col 1 domain and the adaptor
primer; the other was isolated by RT-PCR, using a specific forward Col
1 primer and a modified oligo dT primer, (N)(N)(N)(N)(T)25,
with total RNA isolated from 13-day chick embryo corneal epithelium as template.
We attempted to estimate how much of the 5' end of the mRNA was
missing from our cDNAs by comparing the number of sequenced nucleotides with the size of the mRNA on Northern blots. However, no signal was ever detected on Northern blots of cornea mRNA. Ultimately, it became clear from competitive PCR quantitations that
this analysis failed because the 1(XX) collagen mRNA is a
nonabundant species.
Primer extension was used as an alternative method to determine how
much of the mRNA was not represented in the composite cDNA. As
can be seen in Fig. 2, the major primer
extended band, visible after a 10-day exposure, was about 330 bases.
The primer used was 86 nucleotides into clone 2015; therefore, about
245 nucleotides of the mRNA had yet to be cloned. The primer
extension film also shows minor bands of 200 and 370 nucleotides,
suggesting potential minor alternative transcription start sites. An
aliquot of unlabeled primer extension product was adapted for
amplification and the amplified product was subjected to cycle
sequencing. This method revealed that the product was 331 nucleotides
in length.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2.
Primer extension analysis of type XX collagen
mRNA. The major band is ~330 bases, using a primer that was
located 86 nucleotides into clone 2015. Therefore, what is not
represented in Fig. 1 is 245 bases of the 5' end of the 1(XX)
collagen mRNA. The sequence of the 245 nucleotides was determined
and is included in GenBankTM accession number AF312825.
Bands of 200 and 370 bases are also discernible. bp, base
pairs.
|
|
It is likely that the 4985 nucleotides reported in
GenBankTM accession number AF312825, which includes the
primer extended sequence, represent the entire 1(XX) collagen
mRNA. Nucleotides 157-159 encode an in-frame methionine residue;
therefore, 156 bases are 5' untranslated region. The methionine codon
and the following 81 bases encode a putative 28-amino acid residue
signal sequence when analyzed by the method of von Heijne (16). The remainder of the mRNA encodes a polypeptide of 1444 amino acid residues with characteristics typical of a FACIT collagen, and 410 nucleotides of 3' untranslated region, 67 of which are adenosine residues of the poly(A) tail.
Structure of Chick 1(XX) Collagen--
The protein encoded by
the type XX collagen cDNA sequence can be divided into discrete
motifs, as indicated in Fig. 3. These motifs predict that type XX collagen is a family member of the FACIT
group. In keeping with other members of this family, the NC and triple
helical (Col) domains are numbered starting at the carboxyl-terminal
end. The 1(XX) collagen chain contains fewer modules in its
amino-terminal NC3 domain than 1(XII) and 1(XIV) collagens. The
mature type XX collagen polypeptide contains only one von Willebrand
factor domain and six fibronectin type III repeats. The amino-terminal
NC3 domain begins with a fibronectin type III repeat (FN1, amino
acid residues 30-102 in Fig. 3), which most resembles the
amino-terminal FNIII repeat of collagen XIV (21). This domain is
followed by a unique region of 129 residues, which computer analyses
did not recognize as any known protein module. Next is a von Willebrand
factor A domain (amino acids 231-420). The subsequent five fibronectin
type III repeats (FN2-FN6: amino acids 447-526, 537-612, 627-702,
717-795, and 810-888) resemble the first five of the seven
consecutive repeats in collagen XIV. (The remaining FNIII repeats as
well as the downstream von Willebrand factor A module in collagen XIV
are not found in the collagen XX polypeptide.) The Tsp repeat (amino
acids 910-1154) represents the carboxyl end of the 1(XX) collagen
NC3 domain.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 3.
Conceptual translation product of the
1(XX) collagen polypeptide chain. Amino acid
residues included in the structural motifs are indicated on the
right. vWA, von Willebrand factor A module; FN,
fibronectin type III module.
|
|
The Col 2 domain (amino acid residues 1155-1309) consists of 50 triplets and one GITIQ imperfection, totaling 155 residues. The NC2
domain (amino acids 1310-1355) is 46 residues, 3 residues longer than
the analogous domain in type XIV collagen. The Col 1 domain (residues
1356-1458) consists of 103 residues, ending in a cysteinyl residue,
and has two imperfections in the triple helix, as do type XII and type
XIV collagen. The 1(XX) collagen NC1 domain is a mere 15 residues
(amino acids 1459-1473 in Fig. 3) and contains the expected cysteinyl
residue in the fifth position. Prior to this report, the shortest NC1
domain known in the FACIT subclass was 19 amino acid residues,
belonging to a splice variant of type XII collagen (17) Our two
carboxyl-terminal 1(XX) collagen cDNAs that include the NC1
sequence were both isolated from corneal epithelium RNA. It is possible
that 1(XX) collagen chains found in connective tissues other than
cornea will have alternative splice variants of NC1 that are longer. As
in other FACITs, the amino-terminal portion of the NC1 domain is highly
conserved. In types XII, XIV, and XX, the first residue of this domain
is an aspartic acid, the third is a serine, and the fifth is a
cysteine. Six of the first 9 NC1 residues are identical between chick
1(XX) and 1(XIV). It is of interest to note that mini-chains
composed of three triplets of Gly-Pro-Hyp linked to the first 7 residues of the collagen XIV NC1 domain sequence are able to assemble
with high yield into stable disulfide bonded trimers (18). The
conservation between types XIV and XX in the Col 1-NC1 junction suggest
that this region will also be instrumental in the trimeric assembly of
the collagen XX molecule.
The calculated percent identity and similarity between the collagen XIV
and XX sequence modules are presented in Table
I. For comparison, the identity between
collagen types XII and XIV is also shown. It is clear that type XX
collagen belongs in the subgroup within the FACIT collagens that
includes types XII and XIV collagen.
Assessing the Abundance of 1(XX) Collagen mRNA--
Using
20 ng of mRNA isolated from several tissues, 25- and 35-cycle
RT-PCRs were used to amplify and detect the presence of 1(XX)
collagen product. All 35-cycle RT-PCRs amplified the expected size
product. The absence of product in some 25-cycle RT-PCRs suggested that
only trace amounts of type XX collagen mRNA are present in a
selection of the connective tissues tested (data not shown). The
greatest amount of amplification product was obtained from cornea.
We have previously reported that type XIV collagen plays a
developmental role in the corneal stroma at the time of condensation, when the maturing cornea is becoming transparent (9). Because of the
similarity between collagens XX and XIV, we examined whether type XX
collagen was present at developmental times that would suggest that it,
too, was a player in structural maintenance of the corneal stroma. The
amount of 1(XX) collagen mRNA in the chick cornea was therefore
determined at two important developmental time points. The first was at
embryonic day 7, after fibroblasts have invaded the acellular corneal
stroma, differentiated into keratocytes, and begun to synthesize the
components of the secondary stroma. This synthesis causes rapid growth
of the immature cornea. The second time point was at 13 days of
development, when the opaque cornea is undergoing deturgescence,
compacting into a tighter structure while becoming transparent.
Therefore, 7- and 13-day embryonic cornea RNAs were used as template in
quantitative competitive RT-PCR. The resulting values were normalized
to G3PDH mRNA levels (9, 10) to represent the amount of 1(XX)
collagen mRNA from equal numbers of cells (Fig.
4A, histograms A and
B). In both stages of development, the number of attomoles
of 1(XX) collagen mRNA was less than that of G3PDH mRNA. In
the cornea, each cell contains ~1500 copies of G3PDH mRNA (12).
The ratio of 1(XX) to G3PDH mRNA in both 7- and 13-day embryonic
corneas is about 0.025 and represents about 35 copies of 1(XX)
collagen mRNA per corneal cell.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4.
A, quantitative competitive PCR
analysis. Results are given as a ratio of type XX collagen mRNA to
G3PDH mRNA (enumerated on the y axis). Histogram
A, 7-day whole cornea mRNA as template; histogram
B, 13-day whole cornea mRNA; histogram C, 13-day
corneal epithelial mRNA; histogram D, 13-day corneal
stromal/endothelial mRNA. Experiments were repeated a minimum of
three times to allow for statistical analysis. B, tissue
distribution of type XX collagen mRNA by relative quantitative PCR.
The bottom panel shows the film from the 10% denaturing
acrylamide gel used to separate the radiolabeled products. The
top panel shows the ratio of the 1(XX) collagen product
cpm divided by the G3PDH cpm. The relative PCR cpm ratio for the
corneal epithelial template (lane 7) was multiplied by a
factor to make it equivalent to the competitive PCR value for that
tissue (i.e. 0.07). This calculated adjustment factor was
then applied to each relative PCR ratio to make the two methods have
comparable values. Relative RT-PCR was performed on the following
embryonic tissue mRNAs: lane 1, 5.5-day neural retina;
lane 2, 5.5-day notochord; lane 3, 7-day skin;
lane 4, 12-day skin; lane 5, 7-day whole cornea;
lane 6, 13-day whole cornea; lane 7, 13-day
corneal epithelial; lane 8, 13-day corneal stroma;
lane 9, 14.5-day sternal cartilage; lane 10, 17-day lung; lane 11, 17-day calvaria; lane 12, 17-day tendon.
|
|
We wished to determine whether one particular cell type within the
cornea was the major source of type XX collagen. Corneas are composed
of three cell layers: an outer epithelial layer, a central stromal
layer composed of keratocytes embedded in a rich fibrillar matrix, and
a posterior endothelial cell layer. These cell layers synthesize at
least four unique extracellular matrices. Corneas were separated into
two components: the epithelial layer and the combined stromal and
endothelial layers. RNA was isolated from the epithelial and the
stromal-endothelial components of 13-day corneas and assayed by
competitive RT-PCR for the quantity of 1(XX) collagen mRNA. To
our surprise, type XX collagen proved to be a corneal epithelial
product (Fig. 4A, histogram C) rather than a stromal product
(histogram D). The 0.07 ratio of 1(XX) collagen to G3PDH
mRNA in 13-day corneal epithelium translates into ~100 copies of
type XX mRNA per cell. The ratio of 0.009 for the corneal
stroma-endothelial value to G3PDH translates into about 14 copies of
1(XX) collagen mRNA per cell. The stromal and endothelial layers
were not separated further to analyze mRNA expression.
This pattern of expression in the chick cornea is more like that of
type XII than type XIV collagen (9). Bowman's layer, a fibrillar
matrix synthesized at least in part by the epithelium, is located
between the epithelial basement membrane and the corneal stroma. In the
stroma, the fibrils are uniformly 25 nm in diameter and are arranged in
highly organized orthogonal lamellae. The fibrils of Bowman's layer
are not of uniform diameter but are rather variable; many are of
smaller diameter than those in the stroma, and many appear haphazard in
organization, unlike the stroma (12). The high quantity of type V
collagen in Bowman's layer fibrils accounts for the small diameters;
however, factors that facilitate fibril organization are unknown. FACIT
collagens are good candidates for such organizers. The interface
between Bowman's layer and the stroma, where type XII collagen is
found, is an area of enhanced fibril stability (19, 20). Whether type
XX collagen plays a role in this stabilization, as is postulated for
type XII collagen (9), requires future examination.
Tissue Distribution of 1(XX) Collagen--
Because Northern
blots yielded no 1(XX) collagen mRNA signal, the distribution
and relative quantity of the mRNA in various tissues was evaluated
by relative RT-PCR. This technique, which gives relative ratios, and
not concrete values, was carried out starting with the same amount of
RNA from each tissue and was performed in the linear range of
amplification, incorporating [32P]dCTP into the product.
The cpm of 1(XX) collagen product from each tissue was normalized to
the cpm of the G3PDH product. The normalized relative RT-PCR value of
the corneal epithelial product was multiplied by a correction factor to
set it to equal 0.07, because this was the ratio of 1(XX) collagen
mRNA to G3PDH mRNA determined by the competitive PCR, a
technique that yields exact values. The cpm ratios of all other
products were then adjusted by this correction factor and plotted in
Fig. 4B. As seen in lane 7 of the figure,
1(XX) collagen mRNA is most abundant in embryonic day 13 chick
corneal epithelium. Products were well amplified from 7- and 13-day
whole corneas (Fig. 4B, lanes 5 and 6), 13-day corneal stroma (lane 8), 14.5-day sterna (lane
9), and 17-day lung (lane 10). A significant
amplification was also seen with 17-day tendon (lane 12).
Minor amounts of product were observed when 7- and 13-day skin mRNA
was used as template (lanes 3 and 4). Type XX
collagen is not appreciably expressed by 17-day calvaria (lane
11), 5.5-day neural retina (lane 1), or 5.5-day
notochord (lane 2) mRNA.
1(XX) Collagen Polypeptide Chain--
A synthetic peptide
to the Tsp domain was used to generate a polyclonal antibody against
type XX collagen. The antibody did not cross-react with synthetic
peptides made from the analogous regions in collagens XII and XIV.
Western blots were prepared from 13-day corneal extracts run on
reducing denaturing polyacrylamide gels to determine the size of the
1(XX) polypeptide chain. As seen in lane 1 of Fig.
5, three bands, 185, 170, and 135 kDa, react with the 1(XX) collagen antibody, all smaller than 1(XII) and 1(XIV) polypeptide chains. This suggests that the 1(XX) collagen mRNA may be alternatively spliced, yielding different forms of the polypeptide chain. This would be consistent with other
members of the FACIT family, in which NC3 alternative splicing yields
different sized polypeptide chains.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 5.
Western blot of a 5% acrylamide gel run
under reducing conditions in the presence of SDS. 13-day embryonic
corneal protein extracts were applied to the lanes and reacted with
various antibodies. Lane 1, anti-chick anti-collagen XX
antibody; lane 2, anti-bovine anti-collagen XII antibody
1851 (15); lane 3, anti-chick anti-collagen XIV peptide
antibody (9); lane 4, anti-chick anti-collagen XII antibody
522 (5, 9). The avidity of the anti-chick anti-collagen XII is very
intense. To detect the type XII chains at an intensity more in line
with that of the type XX and XIV collagen polypeptide bands, the
anti-bovine antibody was routinely used. (Type XII collagen is highly
conserved across species; the antibody reactivity with the type XII
collagen of many species reflects this fact).
|
|
The sequence in Fig. 3 encodes a mature, processed (i.e.
without the signal peptide) polypeptide of about 184 kDa. Therefore, the overlapping cDNAs in Fig. 1 presumably encode the slowest migrating band seen on the Western blot. In support of the idea of
alternative splicing, the human 1(XX) collagen cDNA sequence is
lacking the unique domain and a fibronectin type III repeat that are
encoded by the chick cDNA composite (data not
shown).2 In Fig. 5,
lanes 2 and 4 were reacted with type XII collagen antibodies and lane 3 with collagen XIV antibody to show the
220-kDa short forms of these polypeptides for comparison. The 1(XX)
collagen antibody does not cross-react with 1(XII) or 1(XIV) collagen.
Fig. 6A compares
diagrammatically the long form of 1(XIV) with the 1(XX) collagen
chain. The conservation of domains in 1(XII), 1(XIV), and
1(XX) suggests that type XX may interact with the surface of
fibrils, as collagens XII and XIV do (4-6). A model of a type XX
collagen trimer associated with a fibril surface and projecting the NC3
domains into the perifibrillar space, in a position to interact with
other collagen fibrils or other molecules, is shown in Fig.
6B. It is estimated that the size of the NC3 finger-like
domains will be about 25 nm each in length. This is based on the fact
that type XX collagen is smaller than the short forms of types XII and
XIV on Western blots and on the fact that the NC3 domain of 1(XX)
contains about half as many residues as the ~45 nm 1(XIV) NC3
domain (15). Immunoelectron microscopy will be necessary to confirm
this proposed structure.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
A, schematic diagram of the structural
motifs in 1(XIV) and 1(XX) collagen polypeptide chains. FN III
repeats are indicated by solid black circles.
Lines show which of these are conserved between types XIV
and XX collagen. Although not indicated with adjoining lines, the
amino-terminal von Willebrand factor A domain of type XIV collagen, as
well as the Tsp, Col 2, NC2, Col 1, and NC1 domains are also conserved
with those of collagen XX (see Table I). B, hypothetical
type XX collagen trimeric molecule and its potential association with a
collagen fibril.
|
|
 |
ACKNOWLEDGEMENTS |
We thank Dr. Thomas Linsenmayer for helpful
discussions and for providing space for Jessica Foley to work in his
laboratory. We also thank Dr. John Fitch for providing chick 5.5-day
notochord and neural retinal tissues.
 |
FOOTNOTES |
*
This study was supported in part by National Institutes of
Health Grant EY09056 (to M. K. G.) and by the Cutaneous Biology Research Center, Massachusetts General Hospital, which receives a
research grant from Shisiedo Co., Ltd., Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF312825.
To whom correspondence should be addressed: Dept. of
Pharmacology and Toxicology, EOHSI, School of Pharmacy, Rutgers
University, 170 Frelinghuysen Rd., Piscataway, NJ 08854. Tel.:
732-445-3751; Fax: 732-445-0119; E-mail:
magordon@eohsi.rutgers.edu.
Published, JBC Papers in Press, March 23, 2001, DOI 10.1074/jbc.M009912200
2
M. Koch, J. E. Foley, R. Hahn, P. Zhou,
R. E. Burgeson, D. R. Gerecke, and M. K. Gordon,
manuscript in preparation.
 |
ABBREVIATIONS |
The abbreviations used are:
FACIT, fibril-associated collagens with interrupted triple helices;
PCR, polymerase chain reaction;
Tsp, thrombospondin amino-terminal-like;
NC, noncollagenous;
Col, collagenous;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase;
RT, reverse transcription;
FNIII, fibronectin type III module.
 |
REFERENCES |
| 1.
|
Shaw, L. M.,
and Olsen, B. R.
(1991)
Trends. Biochem. Sci.
16,
191-194
|
| 2.
|
Moradi-Ameli, M.,
Deleage, G.,
Geourjon, C.,
and van der Rest, M.
(1994)
Matrix Biol.
14,
233-239
|
| 3.
|
van der Rest, M.,
and Mayne, R.
(1988)
J. Biol. Chem.
263,
1615-1618
|
| 4.
|
Keene, D. R.,
Lunstrum, G. P.,
Morris, N. P.,
Stoddard, D. W.,
and Burgeson, R. E.
(1991)
J. Cell Biol.
113,
971-978
|
| 5.
|
Koch, M.,
Bohrmann, B.,
Matthison, M.,
Hagios, C.,
Trueb, B.,
and Chiquet, M.
(1995)
J. Cell Biol.
130,
1005-1014
|
| 6.
|
Young, B. B.,
Gordon, M. K.,
and Birk, D. E.
(2000)
Dev. Dyn.
217,
430-439
|
| 7.
|
Altschul, S. F.,
Gish, W.,
Miller, W.,
Meyer, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410
|
| 8.
|
Lennon, G. G.,
Auffray, C.,
Polymeropoulos, M.,
and Soares, M. B.
(1996)
Genomics
33,
151-152
|
| 9.
|
Gordon, M. K.,
Foley, J. W.,
Linsenmayer, T. F.,
and Fitch, J. M.
(1996)
Dev. Dyn.
206,
49-58
|
| 10.
|
Gordon, M. K.,
Fitch, J. M.,
Foley, J. W.,
Gerecke, D. R.,
Linsenmayer, C.,
Birk, D. E.,
and Linsenmayer, T. F.
(1997)
Invest. Ophthalmol. Vis. Sci.
38,
153-166
|
| 11.
|
Koch, M.,
Olson, P. F.,
Albus, A.,
Jin, W.,
Hunter, D. D.,
Brunken, W. J.,
Burgeson, R. E.,
and Champliaud, M. F.
(1999)
J. Cell Biol.
145,
605-618
|
| 12.
|
Gordon, M. K.,
Foley, J. W.,
Birk, D. E.,
Fitch, J. M.,
and Linsenmayer, T. F.
(1994)
J. Biol. Chem.
269,
24959-24966
|
| 13.
|
Ho, S. N.,
Hunt, H. D.,
Horton, R. M.,
Pullen, J. K.,
and Pease, L. R.
(1989)
Gene
77,
51-59
|
| 14.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 15.
|
Lunstrum, G. P.,
Morris, N. P.,
McDonough, A. M.,
Keene, D. R.,
and Burgeson, R. E.
(1991)
J. Cell Biol.
113,
963-969
|
| 16.
|
von Heijne, G.
(1983)
Eur. J. Biochem.
133,
17-21
|
| 17.
|
Kania, A. M.,
Reichenberger, E.,
Baur, S. T.,
Karimbux, N. Y.,
Taylor, R. W.,
Olsen, B. R.,
and Nishimura, I.
(1999)
J. Biol. Chem.
274,
22053-22059
|
| 18.
|
Lesage, A.,
Penin, F.,
Geourjon, C.,
Marion, D.,
and van der Rest, M.
(1996)
Biochemistry
35,
9647-9660
|
| 19.
|
Linsenmayer, T. F.,
Gibney, E. P.,
and Fitch, J. M.
(1986)
J. Cell Biol.
103,
1587-1593
|
| 20.
|
Fitch, J. M.,
Birk, D. E.,
Mentzer, A.,
Hasty, K. A.,
Mainardi, C.,
and Linsenmayer, T. F.
(1988)
Invest. Ophthalmol. Vis. Sci.
29,
1125-1136
|
| 21.
|
Walchli, C.,
Trueb, J.,
Kessler, B.,
Winterhalter, K. H.,
and Trueb, B.
(1993)
Eur. J. Biochem.
212,
1125-1136
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Koch, G. Veit, S. Stricker, P. Bhatt, S. Kutsch, P. Zhou, E. Reinders, R. A. Hahn, R. Song, R. E. Burgeson, et al.
Expression of Type XXIII Collagen mRNA and Protein
J. Biol. Chem.,
July 28, 2006;
281(30):
21546 - 21557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. G. Canty and K. E. Kadler
Procollagen trafficking, processing and fibrillogenesis
J. Cell Sci.,
April 1, 2005;
118(7):
1341 - 1353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koch, J. Schulze, U. Hansen, T. Ashwodt, D. R. Keene, W. J. Brunken, R. E. Burgeson, P. Bruckner, and L. Bruckner-Tuderman
A Novel Marker of Tissue Junctions, Collagen XXII
J. Biol. Chem.,
May 21, 2004;
279(21):
22514 - 22521.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Koch, F. Laub, P. Zhou, R. A. Hahn, S. Tanaka, R. E. Burgeson, D. R. Gerecke, F. Ramirez, and M. K. Gordon
Collagen XXIV, a Vertebrate Fibrillar Collagen with Structural Features of Invertebrate Collagens: SELECTIVE EXPRESSION IN DEVELOPING CORNEA AND BONE
J. Biol. Chem.,
October 31, 2003;
278(44):
43236 - 43244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Myers, D. Li, P. S. Amenta, C. C. Clark, C. Nagaswami, and J. W. Weisel
Type XIX Collagen Purified from Human Umbilical Cord Is Characterized by Multiple Sharp Kinks Delineating Collagenous Subdomains and by Intermolecular Aggregates via Globular, Disulfide-linked, and Heparin-binding Amino Termini
J. Biol. Chem.,
August 22, 2003;
278(34):
32047 - 32057.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. P. Boot-Handford, D. S. Tuckwell, D. A. Plumb, C. F. Rock, and R. Poulsom
A Novel and Highly Conserved Collagen (pro{alpha}1(XXVII)) with a Unique Expression Pattern and Unusual Molecular Characteristics Establishes a New Clade within the Vertebrate Fibrillar Collagen Family
J. Biol. Chem.,
August 15, 2003;
278(33):
31067 - 31077.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kato, J.-H. Chang, and D. T. Azar
Expression of Type XVIII Collagen during Healing of Corneal Incisions and Keratectomy Wounds
Invest. Ophthalmol. Vis. Sci.,
January 1, 2003;
44(1):
78 - 85.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sato, K. Yomogida, T. Wada, T. Yorihuzi, Y. Nishimune, N. Hosokawa, and K. Nagata
Type XXVI Collagen, a New Member of the Collagen Family, Is Specifically Expressed in the Testis and Ovary
J. Biol. Chem.,
September 27, 2002;
277(40):
37678 - 37684.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|