Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M009912200 on March 23, 2001

J. Biol. Chem., Vol. 276, Issue 25, 23120-23126, June 22, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/23120    most recent
M009912200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koch, M.
Right arrow Articles by Gordon, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koch, M.
Right arrow Articles by Gordon, M. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

alpha 1(XX) Collagen, a New Member of the Collagen Subfamily, Fibril-associated Collagens with Interrupted Triple Helices*

Manuel KochDagger , Jessica E. Foley§, Rita Hahn, Peihong Zhou, Robert E. BurgesonDagger , Donald R. Gerecke, and Marion K. Gordon||

From the Dagger  Cutaneous Biology Research Center, Massachusetts General Hospital East, Harvard Medical School, Charlestown, Massachusetts 02129, the § School of Nursing, University of Pennsylvania, Philadelphia, Pennsylvania 19104, and the  Department of Pharmacology and Toxicology, School of Pharmacy and Environmental and Occupational Health Sciences Institute, Rutgers University, Piscataway, New Jersey 08854

Received for publication, October 31, 2000, and in revised form, March 22, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Chick cDNA clones for a new member of the FACIT (fibril-associated collagens with interrupted triple helices) subfamily have been isolated and sequenced. The collagen chain encoded by these cDNAs was assigned the next consecutive number, making it the alpha 1(XX) collagen chain. Assignment of type XX collagen to the FACIT family was based on sequence similarities to types XII and XIV collagen. Type XX collagen mRNA is not abundant in the chick embryo. It is most prevalent in corneal epithelium. It is also detectable by reverse transcription polymerase chain reaction in embryonic skin, sternal cartilage, and tendon, but is barely detectable in calvaria, notochord, or neural retina at select stages of development, suggesting that it is not expressed in these tissues. The cDNA predicts that the alpha 1(XX) collagen polypeptide is smaller than the short forms of collagen XII and XIV. A polyclonal antibody against a synthetic alpha 1(XX) peptide reacts with polypeptide bands of 185, 170, and 135 kDa by Western blot analysis. From its similarity to types XII and XIV collagen, type XX is expected to bind to collagen fibrils, projecting the amino-terminal domains away from the fibrillar surface. The projecting NC 3 domains are predicted to be about half the length of those of collagen XIV.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

The fibril-associated collagens with interrupted triple helices (FACITs)1 are a subgroup within the collagen family containing types IX, XII, and XIV collagen (1). Characteristics shared by the alpha  chains in this class are a carboxyl triple helical domain (Col 1) of about 103-115 amino acid residues containing two imperfections in the Gly-X-Y triplet structure; two cysteinyl residues, one at the end of Col 1 and another five residues into the adjacent noncollagenous (NC) 1 domain; and conservation of the sequences of the NC1 and NC2 domains (1). The alpha 1(XII), alpha 1(XIV), and the long splice variant of the alpha 1(IX) collagen chain each also have a thrombospondin amino-terminal-like (Tsp) module (also called the PARP domain) (2). Although all the possible supramolecular structures of types IX, XII, and XIV collagen are not yet elucidated, each has been shown to be capable of associating with fibrillar surfaces (3-6). Presented in this report are cDNAs for a new collagen that has characteristics very similar to types XII and XIV collagen. The polypeptide encoded by the cDNA has been assigned the next Roman numeral, alpha 1(XX).

We demonstrate here that type XX collagen mRNA is not abundant in any embryonic chick tissue. It is, however, a minor component of several connective tissues, such as sternal cartilage, cornea, and tendon. The embryonic tissue of highest abundance is the corneal epithelium, which makes large amounts of fibrillar collagens, as well as epithelial specific products. alpha 1(XX) collagen polypeptides of 185, 170, and 135 kDa are detected by Western analysis, suggestive of alternative splicing.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Isolation of alpha 1(XX) cDNAs-- To obtain a human type XIV collagen cDNA, a BLAST search (7) of the data base of expressed sequence tags was performed. A glycerol stock of IMAGE Consortium clone identification number 34933 (8) was purchased. The clone was expanded for DNA isolation and sequence analysis. Automated DNA sequencing was performed by the Department of Physiology core facility at Tufts Medical School. Upon aligning the new human cDNA sequence with the sequence of chick and human types XII and XIV collagen, it became clear that clone 34933 was not a human alpha 1(XIV) clone, but, instead, a close relative. The aligned sequences were used to select two conserved areas in the Tsp domain for making degenerate nucleotide primers that would amplify, by RT-PCR (conditions described below), chick and human alpha 1(XII) and alpha 1(XIV) mRNAs, as well as mRNA for the new collagen, designated alpha 1(XX). Degenerate primers (dXX-1 and dXX-2rc) were synthesized corresponding to conserved regions GSFHK(V/L) H(/V)I and D(R/K)CC(D/E)(I/L)P in the Tsp domain. The primer sequences are: dXX-1, GG(A/G)AG(C/T)TT(C/T)CA(C/T)AAGGT(T/G)CA(T/C)(A/G)T and dXX-2rc, GG(G/A)A(T/G)(A/C)TCACA(A/G)CA(T/C)(T/C)(T/G)GTC. As described below, 13-day chick corneal mRNA was amplified with these primers and the product was inserted into the PCRII vector (Invitrogen, Carlsbad, CA), following the manufacturer's protocol. Transformed colonies were expanded and DNA was isolated using Qiagen's (Valencia, CA) Miniprep DNA isolation kit. Of the clones resulting from this procedure, sequence analysis demonstrated that chick alpha 1(XII), alpha 1(XIV), and alpha 1(XX) cDNAs were obtained. The chick alpha 1(XX) cDNAs were designated clones 2001, with a, b, c, etc. to distinguish individual selected colonies. All were identical.

Tissue Collection and RNA Isolation-- Embryonated eggs were purchased from Spafas (Norwich, CT) and Avian Services (Frenchtown, NJ). The following embryonic tissues were dissected from White Leghorn chick embryos, frozen immediately in liquid nitrogen, and then stored at -80 °C until used: 5.5-day notochord and neural retina, 7- and 12-day back skin, 7- and 13-day cornea, 14.5-day sterna, and 17-day lung, calvaria, and tendon. Total RNA was isolated from each using the Trizol reagent (Life Technologies, Inc.) following the manufacturer's instructions. Poly(A)+ mRNA was isolated using Qiagen Oligotex beads. In other dissections, corneas without surrounding scleral tissue were removed from day 13 embryos and placed into a dish containing 50 mM EDTA, 0.25% dispase (Roche Molecular Biochemicals) in phosphate-buffered saline, pH 7.4, at 37 °C. After 5 min of incubation, the epithelia were gently removed from the underlying stroma. Separated corneal epithelial and stromal/endothelial layers were immediately frozen in liquid nitrogen and then used to isolate poly(A)+ mRNA as described above.

Primer Extension Analysis-- A primer, TTACCCGCACTTTGTAGCCATTGA, corresponding to the reverse complement of bases 63-86 of clone 2015 (see Fig. 1), was labeled using the Kinase MaxTM 5' end-labeling kit from Ambion (Austin, TX), following the protocol of the kit. 50,000 cpm of labeled primer was added to 20 µg of embryonic chick day 13 total RNA and the mixture was ethanol-precipitated. The pellet was taken up in 30 µl of hybridization buffer (80% deionized formamide, 100 mM sodium citrate, pH 6.4, 300 mM sodium acetate, pH 6.4, 1 mM EDTA), incubated at 37 °C overnight, and then ethanol-precipitated again. The pellet was resuspended in 22 µl of water, and then to it was added 8 µl of 5× RT buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 4 µl of 0.1 M DTT, 4 µl of containing 10 mM of each dNTP, and 2 µl (400 units) of Superscript II RNase H-minus reverse transcriptase. After incubating for 37 °C for 1 h, 1 µl of a mix of 40 µg/ml RNase A and 2 units/ml RNase T1 were added, and incubation at 37 °C was continued for 30 min. Loading buffer (4 µl of 95% formamide, 60 mM EDTA, pH 8.0, 0.025% xylene cyanol, 0.25% bromphenol blue) was added to the sample, the temperature was raised to 95 °C for 3 min, and then an aliquot was applied to a 10% denaturing acrylamide gel. After electrophoresis at 40 W, the gel was dried and exposed to film. A 10-day exposure was required to visualize the alpha 1(XX) primer extended product.

To obtain the 5' untranslated region sequence, unlabeled RNase digested primer-extended product was generated. The ~330-nucleotide product was adapted for amplification using the Life Technologies, Inc. 5' RACE system kit and subjected to two rounds of polymerase chain reaction using the nested primer of the kit and the collagen XX-specific extension primer. After agarose gel purification, the excised product was sequenced using the USB (Cleveland, OH) Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit, following the manufacturer's instructions.

Reverse Transcription and PCR Conditions-- First strand cDNA synthesis from mRNA was performed as previously described (9, 10) and used as template in PCR. For RT-PCR, competitive PCR or routine DNA amplifications, the following conditions were used: a 20 µl of final reaction volume mixture was assembled consisting of template DNA, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200 µM each dNTP, 1 µM each 5' and 3' specific primers, and 2.5 units Amplitaq (PE Applied Biosystems, Foster City, CA). The templates were amplified for one cycle of 94 °C for 1 min; 35 cycles of 94 °C for 1 min, 56 °C for 1.5 min, 72 °C for 2.5 min; and a final cycle of 72 °C for 10 min in a Perkin-Elmer 9600 thermocycler.

Chick Marathon Library-- Using a kit from CLONTECH (Palo Alto, CA), 13-day chick cornea mRNA was made into a cDNA library and adaptor primers were ligated to both the 5' and 3' ends, as previously described (11). The cDNA 2001 (see Fig. 1) sequence was used to design chick alpha 1(XX) collagen-specific primers for 5' and 3' rapid amplification of cDNA ends. A specific primer was paired with a nested adaptor primer to amplify longer alpha 1(XX) cDNAs from the library. Essential to the success of this method is the running of accompanying PCRs, amplified with nested adaptor primer alone. After agarose gel electrophoresis, products uniquely amplified with a specific alpha 1(XX) collagen primer in conjunction with the nested adaptor primer were stabbed from the gel and reamplified with a nested alpha 1(XX) primer and the nested adaptor primer. Unique products of this reamplification were isolated from agarose gels and ligated into PCRII for transformation. Isolated transformants were checked for insert size and sequenced. These new sequence data were used to generate additional specific primers for repeating the process, expanding the overlapping clones in each direction from the Tsp domain. These continuous rounds of marathon library screening resulted in 18 overlapping clones, shown in Fig. 1. The sequence derived from the clones is available in GenBankTM accession number AF312825. Listing the sense strand primer first and the reverse complement antisense primer second, the pairs used to obtain these clones from the marathon library are as follows: for 2002, AP2 (the CLONTECH Marathon kit nested adaptor primer) and TCCCAGCATGATGAAGCCAGCGGT; for 2003, AGGTTGTGTGCAACAGCTTA and AP2; for 2004, AP2 and AGCTCCCCTCATCCCTCAATG; for 2005, 2006, 2007, and 2008, CAAAGGAGAAAAAGGCATGGC and AP2; for 2009, AP2 and GAATGTCTCTGAACAGGGTGAAGGTGCGGG; for 2010, AP2 and TGAACAGGGTGAAGGTGCGGGAGCCACTGA; for 2013, AP2 and TCTGCTAGACATGTAGGTGACGCGATGAC; for 2014, AP2 and GGCATCTTCCCCATACAACGCATAC; for 2015 and 2016, AP2 and GCCACCTGCTTCAGCTCAGCCTCATCCGCG.

Other cDNA clones were derived by RT-PCR directly from 13-day cornea mRNA using the following primers: for clone 2011, primers GGGGAAGATGCCAGTGAT and TGAACAGGGTGAAGGTGCGGGAGCCACTGA; for 2012, ATCAAGCTCTATCTGGACTGTAAA and CAGAAGTGCAGGAGCAGGCAG; for 2017, AGGAGAGAAAGGAGACACTGG and CACATCGGCCATCAGGGAATGA; for 2018, CAGGAGGTCCAGGAGGTCCCT and a modified oligo dT primer, (N)(N)(N)(N)(T)25.

Competitor Construction-- The alpha 1(XX) collagen competitor was a deletion construct, produced as previously reported (9, 10, 12). The G3PDH competitor and primers were those previously reported (9, 10, 12). The template for making the alpha 1(XX) collagen deletion construct was clone 2001. Base numbers correspond to those found in GenBankTM accession number AF312825. Primers used to amplify the fragments on each side of the deletion were as follows: (a) the "extreme" end sense primer ATCAAGCTCTATCTGGACTGTAAA (bases 3355-3378) in conjunction with CTCCTCCTCCGCCCC-TCGTGATCCACTCCT (the reverse complement of bases 3470-3483 linked to bases 3525-3540), and (b) sense primer AGGAGTGGATCACGA-GGGGCGGAGGAGGAC (bases 3470-3483 linked to bases 3525-3540) in conjunction with CAGAAGTGCAGGAGCAGGCAG (reverse complement of bases 3596-3616). Products were isolated from agarose gels, mixed together, and fused by overlap extension (13) with both primers referred to as extreme end primers: ATCAAGCTCTATCTGGACTGTAAA (sense primer, same as given above in a) and GGAAGATCACAGCATCGGTC (reverse complement 3438-3557). The overlap extension product, spanning bases 3355 to 3557 with bases 3484-3524 deleted, was ligated into PCRII and used to transform bacteria. Isolated colonies were sequenced. Several competitor clones had the correct sequence with the desired deletion. One was grown in large scale and plasmid DNA was isolated with Qiagen's maxiprep kit. After linearizing the plasmid by XhoI digestion, the competitor was quantitated on agarose gels by comparison to known standards.

To perform the competitive PCR, 400 ng of 7-day and 13-day corneal mRNA and 13-day corneal epithelial and stromal/endothelial mRNA were made into cDNA in a 20-µl volume. A set of seven PCRs was done for each tissue, varying the amount of competitor added to each reaction. In each tube, buffer, dNTPs, extreme end primers and enzyme components for a 20-µl PCR were brought up to a volume of 18 µl so that 1 µl of tissue cDNA (representing 20 ng of mRNA starting material) and 1 µl of a serial dilution of competitor DNA could be added as previously described (9, 10). In the series of seven tubes, the 1 µl of competitor DNA corresponded to the following 3-fold dilutions: 0.67, 0.33, 0.10, 0.067, 0.033, 0.01, and 0.0067 amol/µl. G3PDH was quantitated using competitor and primers that were previously described (9, 10).

Ten microliters of each competitive PCR was applied to 3% MetaPhor agarose gels (FMC, Rockland, ME) made with TBE buffer and 0.5 µg/ml ethidium bromide. The endogenous alpha 1(XX) collagen product was 202 base pairs; the competitor was 159 base pairs. The G3PDH endogenous product was 101 base pairs; its competitor was 60 base pairs. Gels were photographed with an Eagle Eye II (Stratagene, La Jolla, CA) digital camera. Photograph exposure times were chosen that ensured no band exceeded 256 pixels. The images were stored on disks for later analysis. The optical density of the bands was analyzed by Scanalytics (Billerica, MA) DNA One Scan software, and the ratio of the endogenous to the competitor band was converted to a number of amol. Because the endogenous and competitor PCR products differed in size, a correction factor was applied to adjust for molar differences in the binding of ethidium bromide. The calculated amol of cDNA synthesized from endogenous G3PDH mRNA was multiplied by 60/101, or 0.594, and the amol of endogenous alpha 1(XX) collagen cDNA made from mRNA was multiplied by 159/202, or 0.787. The data were then plotted as amol endogenous alpha 1(XX) collagen product/amol alpha 1(XX) competitor on the y axis versus amol alpha 1(XX) competitor added on the x axis. The point on the graph at which endogenous/competitor equals 1 is the equivalence point, and represents the amount of target mRNA in the starting sample. To represent the amount of mRNA present in an equal number of cells, the amol alpha 1(XX) collagen mRNA was normalized by dividing it by the corresponding amol G3PDH mRNA value.

Relative PCR-- All relative PCRs were performed in 20 µl containing the following: 1 µl of cDNA (representing 0.014 ng of poly(A)+ RNA), 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.4 µM each primer (either the pair for type XX collagen or for the experimental normalizer, G3PDH, as in the competitive PCR above), 0.1 mM each dNTP, 0.2 µl of [alpha -32P]dCTP (10 µCi/µl; >3000 Ci per mmol) and 0.025 units of Amplitaq (PE Applied Biosystems, Foster City, CA). For consistency, multiple PCRs were set up from master mixes made with all reagents except the cDNA; 19-µl aliquots of the master mix were put in thin-walled 250-µl tubes, and 1 µl of the appropriate cDNA was added. Conditions for cycling were as follows: 1 premelt step at 94 °C for 1 min, followed by the linear range number of cycles, experimentally determined to be 21 (see below), each consisting of a 94 °C melting step for 15 s, a 56 °C annealing incubation for 25 s, and a 72 °C elongation step for 90 s.

Reactions were terminated in the linear range of amplification to ensure that the amount of product amplified reflects the quantity of starting mRNA. To determine this range, eight identical 20-µl PCRs were performed using the type XX collagen extreme end primers or G3PDH primers for each embryonic tissue cDNA tested. These were 5.5-day notochord and neural retina, 7- and 12-day back skin, 7- and 13-day cornea, 14.5-day sterna, and 17-day lung, calvaria, and tendon. The samples were loaded into a Perkin-Elmer 9600 thermocycler, and one tube of each was removed after 15 cycles, one after 17 cycles, and one each after completing cycles 19, 21, 23, 25, 27, and 35. After adding 10 µl of loading buffer (95% formamide, 10 mM EDTA, pH 7.6, 0.1% xylene cyanol, 0.1% bromphenol blue) to each tube, 5 µl of each sample was applied to 5% denaturing polyacrylamide gels (containing 7.7 M urea) (14). The gel was run at 2000 V until the dye ran to the bottom, and then it was fixed in 10% methanol, 10% acetic acid; dried; and exposed to film. Bands were excised from the dried gel and counted by the Cerenkov method in a scintillation counter. The cpm (y axis) were plotted versus the cycle number (x axis). The linear range of amplification for all tissues with the G3PDH primers and for the tissues most abundant in collagen XX was between 19 and 23 cycles. All subsequent relative PCRs were performed for 21 cycles. Relative PCRs were performed for all tissue samples at the same time, using a master mix of components, and run on one gel for consistency. Bands were excised from the gel and counted as described above.

Anti-chick Collagen XX Antibody and Western Blot Analysis-- The sequence of the translated alpha 1(XX) collagen polypeptide was computer analyzed to determine an optimal antigenic site. The services of Alpha Diagnostics (San Antonio, TX) were used to synthesize the selected peptide and to generate a monospecific polyclonal antibody against the alpha 1(XX) collagen chain. The alpha 1(XX) peptide sequence chosen was KADLQEVSFDQQEC, a region in the Tsp domain. (The carboxyl-terminal cysteine is not in the alpha 1(XX) collagen sequence but is needed for coupling the peptide before injection into rabbits.) The enzyme-linked immunosorbent assay titer of the 10-week bleed, diluted 1:100,000, showed that the anti-chick anti-collagen XX antibody was more than 6 times greater than the preimmune serum. Synthetic peptides were made for the analogous regions of the Tsp domain in alpha 1(XIV) collagen (KGDFQTVTFEGPE) and alpha 1(XII) collagen (RGEVQTVTFDNDE) and were used to check for cross-reactivity with the anti-collagen XX antibody. By enzyme-linked immunosorbent assay, no cross-reaction was detected.

To isolate corneal proteins for Western analysis, central corneas were isolated from 13-day chick embryos and stored at -80 °C until use. Prior to extraction, tissue was weighed. For each gram, 5 ml of low salt extraction buffer (200 mM NaCl, 25 mM Tris, 10 mM EDTA, 10 mM benzamidine-HCl, 0.1 mM N-ethylmaleimide, 1 µg/ml leupeptin, 1 µg/ml pepstatin, pH 7.8) was added. The tissue was homogenized in a polytron. An equal volume of buffer was added to reduce viscosity, and the sample was rehomogenized. Following centrifugation at 20,000 × g for 30 min at 4 °C, the supernatant was collected. The protein concentration was determined to be 0.45 mg/ml by a dye binding assay (Bio-Rad) using IgG as a standard. Samples (40 µg of total protein) were run in reducing (1% mercapoethanol) sample buffer (14), heated to 95 °C, 10 min, and loaded on a 5% SDS-polyacrylamide gel (with a 4% stacking gel). After electrophoresis, proteins were transferred to nitrocellulose membrane (Bio-Rad). The blot was blocked with 5% nonfat dry milk in phosphate-buffered saline, washed with phosphate-buffered saline/Tween 20, and incubated with primary antibody (1:10,000 in phosphate-buffered saline/Tween 20/1% bovine serum albumin) at room temperature for 1 h. (In addition to the anti-chick alpha 1(XX) collagen antibody, anti-chick anti-alpha 1(XIV) collagen (10), anti-bovine anti-collagen XII antibody 1851 (15). and anti-chick anti-alpha 1(XII) collagen antibody 522 (5, 9) were used as control primary antibodies.) Membranes were washed and incubated with horseradish peroxidase-conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch, West Grove, PA) (1:20,000) for 1 h. Chemiluminescence (Pierce) was recorded on x-ray films.

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Isolation of cDNAs for Type XX Collagen-- The data base of expressed sequence tag cDNAs was searched for human type XIV collagen cDNAs. Four candidate cDNAs were found. One expressed sequence tag had been placed in the data base with about 70 bases sequenced, encoding 23 amino acid residues of a Tsp domain, and on the basis of sequence similarity, it was tentatively identified as an alpha 1(XIV) collagen cDNA. Although this region was highly homologous to type XIV collagen, it was not identical to the known human sequence: 16 of the 23 amino acid residues were identical, but 7 were conservative changes. A glycerol stock of this clone was purchased (IMAGE Consortium clone identification number 34933 (8)) and expanded for DNA isolation. Sequence analysis demonstrated that the cDNA encoded 233 amino acid residues of a Tsp domain and 12 amino acids (four triplets) of a collagenous domain (Col 2), suggesting that it was indeed a member of the collagen family.

BLAST searches (7) indicated that the Tsp domain of the new collagen alpha  chain was closest in identity to type XIV collagen and second closest to type XII collagen. Within the Tsp domains found in collagens (2), localized areas are unique to collagens XII and XIV of avian and mammalian species. The new human cDNA shared these subfamily similarities, allowing us to design degenerate primers that would theoretically amplify mRNAs of any subfamily member, type XII, XIV, or the new chain, from chick or human, by RT-PCR. Because of our interest in development, particularly of the cornea, our goal was to obtain the chick cDNA corresponding to the new human collagen alpha  chain. As expected, by amplifying chick cornea cDNA with this degenerate primer pair, cDNA clones were obtained for the known Tsp domains of chick types XII and XIV, as well as for a new cDNA (clone 2001, shown in Fig. 1), almost identical in sequence to the human cDNA (data not shown). Using this chick alpha  chain sequence, unique primers were designed from regions where the sequence diverged from collagens XII and XIV. These primers amplified only the new chick collagen alpha  chain, and not alpha 1(XII) or alpha 1(XIV) collagens in RT-PCR.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1.   Schematic of the chicken alpha 1(XX) collagen mRNA (top line). The domain structure of the encoded protein is indicated on the mRNA. Overlapping cDNAs are shown below. Clone 2001 was the first chick cDNA obtained by RT-PCR using degenerate primers to amplify a portion of the Tsp domain. (The primer extension product encoding the 5' untranslated region and the signal peptide was not ligated into vector and cloned. Therefore, these domains are not included in the figure.) nts, nucleotides.

A Marathon cDNA library was made from day 13 embryonic chick corneal mRNA, and the specific primers were used to extend the sequence of chick cDNA by 5' and 3' rapid amplification of cDNA ends. The resulting overlapping clones are shown in Fig. 1. The divergence of the domain structure from alpha 1(XII) and alpha 1(XIV) collagen chain sequences in the NC3 domain suggested that the cDNA represented a new member of the FACIT family and not a new alpha  chain of an already described collagen. Assigning the translated cDNA sequence the next available Roman numeral, the clone was designated the alpha 1(XX) collagen chain. The nucleotide sequence of the composite cDNA is found under GenBankTM accession number AF312825. It is believed that the entire 3' end of the mRNA is represented in this composite because two clones, isolated by different methods, yielded identical 3' end products, each with a poly(A) tail. One cDNA was isolated by 3' rapid amplification of cDNA ends of the marathon library using a primer in the Col 1 domain and the adaptor primer; the other was isolated by RT-PCR, using a specific forward Col 1 primer and a modified oligo dT primer, (N)(N)(N)(N)(T)25, with total RNA isolated from 13-day chick embryo corneal epithelium as template.

We attempted to estimate how much of the 5' end of the mRNA was missing from our cDNAs by comparing the number of sequenced nucleotides with the size of the mRNA on Northern blots. However, no signal was ever detected on Northern blots of cornea mRNA. Ultimately, it became clear from competitive PCR quantitations that this analysis failed because the alpha 1(XX) collagen mRNA is a nonabundant species.

Primer extension was used as an alternative method to determine how much of the mRNA was not represented in the composite cDNA. As can be seen in Fig. 2, the major primer extended band, visible after a 10-day exposure, was about 330 bases. The primer used was 86 nucleotides into clone 2015; therefore, about 245 nucleotides of the mRNA had yet to be cloned. The primer extension film also shows minor bands of 200 and 370 nucleotides, suggesting potential minor alternative transcription start sites. An aliquot of unlabeled primer extension product was adapted for amplification and the amplified product was subjected to cycle sequencing. This method revealed that the product was 331 nucleotides in length.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2.   Primer extension analysis of type XX collagen mRNA. The major band is ~330 bases, using a primer that was located 86 nucleotides into clone 2015. Therefore, what is not represented in Fig. 1 is 245 bases of the 5' end of the alpha 1(XX) collagen mRNA. The sequence of the 245 nucleotides was determined and is included in GenBankTM accession number AF312825. Bands of 200 and 370 bases are also discernible. bp, base pairs.

It is likely that the 4985 nucleotides reported in GenBankTM accession number AF312825, which includes the primer extended sequence, represent the entire alpha 1(XX) collagen mRNA. Nucleotides 157-159 encode an in-frame methionine residue; therefore, 156 bases are 5' untranslated region. The methionine codon and the following 81 bases encode a putative 28-amino acid residue signal sequence when analyzed by the method of von Heijne (16). The remainder of the mRNA encodes a polypeptide of 1444 amino acid residues with characteristics typical of a FACIT collagen, and 410 nucleotides of 3' untranslated region, 67 of which are adenosine residues of the poly(A) tail.

Structure of Chick alpha 1(XX) Collagen-- The protein encoded by the type XX collagen cDNA sequence can be divided into discrete motifs, as indicated in Fig. 3. These motifs predict that type XX collagen is a family member of the FACIT group. In keeping with other members of this family, the NC and triple helical (Col) domains are numbered starting at the carboxyl-terminal end. The alpha 1(XX) collagen chain contains fewer modules in its amino-terminal NC3 domain than alpha 1(XII) and alpha 1(XIV) collagens. The mature type XX collagen polypeptide contains only one von Willebrand factor domain and six fibronectin type III repeats. The amino-terminal NC3 domain begins with a fibronectin type III repeat (FN1, amino acid residues 30-102 in Fig. 3), which most resembles the amino-terminal FNIII repeat of collagen XIV (21). This domain is followed by a unique region of 129 residues, which computer analyses did not recognize as any known protein module. Next is a von Willebrand factor A domain (amino acids 231-420). The subsequent five fibronectin type III repeats (FN2-FN6: amino acids 447-526, 537-612, 627-702, 717-795, and 810-888) resemble the first five of the seven consecutive repeats in collagen XIV. (The remaining FNIII repeats as well as the downstream von Willebrand factor A module in collagen XIV are not found in the collagen XX polypeptide.) The Tsp repeat (amino acids 910-1154) represents the carboxyl end of the alpha 1(XX) collagen NC3 domain.


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 3.   Conceptual translation product of the alpha 1(XX) collagen polypeptide chain. Amino acid residues included in the structural motifs are indicated on the right. vWA, von Willebrand factor A module; FN, fibronectin type III module.

The Col 2 domain (amino acid residues 1155-1309) consists of 50 triplets and one GITIQ imperfection, totaling 155 residues. The NC2 domain (amino acids 1310-1355) is 46 residues, 3 residues longer than the analogous domain in type XIV collagen. The Col 1 domain (residues 1356-1458) consists of 103 residues, ending in a cysteinyl residue, and has two imperfections in the triple helix, as do type XII and type XIV collagen. The alpha 1(XX) collagen NC1 domain is a mere 15 residues (amino acids 1459-1473 in Fig. 3) and contains the expected cysteinyl residue in the fifth position. Prior to this report, the shortest NC1 domain known in the FACIT subclass was 19 amino acid residues, belonging to a splice variant of type XII collagen (17) Our two carboxyl-terminal alpha 1(XX) collagen cDNAs that include the NC1 sequence were both isolated from corneal epithelium RNA. It is possible that alpha 1(XX) collagen chains found in connective tissues other than cornea will have alternative splice variants of NC1 that are longer. As in other FACITs, the amino-terminal portion of the NC1 domain is highly conserved. In types XII, XIV, and XX, the first residue of this domain is an aspartic acid, the third is a serine, and the fifth is a cysteine. Six of the first 9 NC1 residues are identical between chick alpha 1(XX) and alpha 1(XIV). It is of interest to note that mini-chains composed of three triplets of Gly-Pro-Hyp linked to the first 7 residues of the collagen XIV NC1 domain sequence are able to assemble with high yield into stable disulfide bonded trimers (18). The conservation between types XIV and XX in the Col 1-NC1 junction suggest that this region will also be instrumental in the trimeric assembly of the collagen XX molecule.

The calculated percent identity and similarity between the collagen XIV and XX sequence modules are presented in Table I. For comparison, the identity between collagen types XII and XIV is also shown. It is clear that type XX collagen belongs in the subgroup within the FACIT collagens that includes types XII and XIV collagen.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Comparison of alpha 1(XIV) to alpha 1(XX) and alpha 1(XII) collagen chains

Assessing the Abundance of alpha 1(XX) Collagen mRNA-- Using 20 ng of mRNA isolated from several tissues, 25- and 35-cycle RT-PCRs were used to amplify and detect the presence of alpha 1(XX) collagen product. All 35-cycle RT-PCRs amplified the expected size product. The absence of product in some 25-cycle RT-PCRs suggested that only trace amounts of type XX collagen mRNA are present in a selection of the connective tissues tested (data not shown). The greatest amount of amplification product was obtained from cornea.

We have previously reported that type XIV collagen plays a developmental role in the corneal stroma at the time of condensation, when the maturing cornea is becoming transparent (9). Because of the similarity between collagens XX and XIV, we examined whether type XX collagen was present at developmental times that would suggest that it, too, was a player in structural maintenance of the corneal stroma. The amount of alpha 1(XX) collagen mRNA in the chick cornea was therefore determined at two important developmental time points. The first was at embryonic day 7, after fibroblasts have invaded the acellular corneal stroma, differentiated into keratocytes, and begun to synthesize the components of the secondary stroma. This synthesis causes rapid growth of the immature cornea. The second time point was at 13 days of development, when the opaque cornea is undergoing deturgescence, compacting into a tighter structure while becoming transparent. Therefore, 7- and 13-day embryonic cornea RNAs were used as template in quantitative competitive RT-PCR. The resulting values were normalized to G3PDH mRNA levels (9, 10) to represent the amount of alpha 1(XX) collagen mRNA from equal numbers of cells (Fig. 4A, histograms A and B). In both stages of development, the number of attomoles of alpha 1(XX) collagen mRNA was less than that of G3PDH mRNA. In the cornea, each cell contains ~1500 copies of G3PDH mRNA (12). The ratio of alpha 1(XX) to G3PDH mRNA in both 7- and 13-day embryonic corneas is about 0.025 and represents about 35 copies of alpha 1(XX) collagen mRNA per corneal cell.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 4.   A, quantitative competitive PCR analysis. Results are given as a ratio of type XX collagen mRNA to G3PDH mRNA (enumerated on the y axis). Histogram A, 7-day whole cornea mRNA as template; histogram B, 13-day whole cornea mRNA; histogram C, 13-day corneal epithelial mRNA; histogram D, 13-day corneal stromal/endothelial mRNA. Experiments were repeated a minimum of three times to allow for statistical analysis. B, tissue distribution of type XX collagen mRNA by relative quantitative PCR. The bottom panel shows the film from the 10% denaturing acrylamide gel used to separate the radiolabeled products. The top panel shows the ratio of the alpha 1(XX) collagen product cpm divided by the G3PDH cpm. The relative PCR cpm ratio for the corneal epithelial template (lane 7) was multiplied by a factor to make it equivalent to the competitive PCR value for that tissue (i.e. 0.07). This calculated adjustment factor was then applied to each relative PCR ratio to make the two methods have comparable values. Relative RT-PCR was performed on the following embryonic tissue mRNAs: lane 1, 5.5-day neural retina; lane 2, 5.5-day notochord; lane 3, 7-day skin; lane 4, 12-day skin; lane 5, 7-day whole cornea; lane 6, 13-day whole cornea; lane 7, 13-day corneal epithelial; lane 8, 13-day corneal stroma; lane 9, 14.5-day sternal cartilage; lane 10, 17-day lung; lane 11, 17-day calvaria; lane 12, 17-day tendon.

We wished to determine whether one particular cell type within the cornea was the major source of type XX collagen. Corneas are composed of three cell layers: an outer epithelial layer, a central stromal layer composed of keratocytes embedded in a rich fibrillar matrix, and a posterior endothelial cell layer. These cell layers synthesize at least four unique extracellular matrices. Corneas were separated into two components: the epithelial layer and the combined stromal and endothelial layers. RNA was isolated from the epithelial and the stromal-endothelial components of 13-day corneas and assayed by competitive RT-PCR for the quantity of alpha 1(XX) collagen mRNA. To our surprise, type XX collagen proved to be a corneal epithelial product (Fig. 4A, histogram C) rather than a stromal product (histogram D). The 0.07 ratio of alpha 1(XX) collagen to G3PDH mRNA in 13-day corneal epithelium translates into ~100 copies of type XX mRNA per cell. The ratio of 0.009 for the corneal stroma-endothelial value to G3PDH translates into about 14 copies of alpha 1(XX) collagen mRNA per cell. The stromal and endothelial layers were not separated further to analyze mRNA expression.

This pattern of expression in the chick cornea is more like that of type XII than type XIV collagen (9). Bowman's layer, a fibrillar matrix synthesized at least in part by the epithelium, is located between the epithelial basement membrane and the corneal stroma. In the stroma, the fibrils are uniformly 25 nm in diameter and are arranged in highly organized orthogonal lamellae. The fibrils of Bowman's layer are not of uniform diameter but are rather variable; many are of smaller diameter than those in the stroma, and many appear haphazard in organization, unlike the stroma (12). The high quantity of type V collagen in Bowman's layer fibrils accounts for the small diameters; however, factors that facilitate fibril organization are unknown. FACIT collagens are good candidates for such organizers. The interface between Bowman's layer and the stroma, where type XII collagen is found, is an area of enhanced fibril stability (19, 20). Whether type XX collagen plays a role in this stabilization, as is postulated for type XII collagen (9), requires future examination.

Tissue Distribution of alpha 1(XX) Collagen-- Because Northern blots yielded no alpha 1(XX) collagen mRNA signal, the distribution and relative quantity of the mRNA in various tissues was evaluated by relative RT-PCR. This technique, which gives relative ratios, and not concrete values, was carried out starting with the same amount of RNA from each tissue and was performed in the linear range of amplification, incorporating [32P]dCTP into the product. The cpm of alpha 1(XX) collagen product from each tissue was normalized to the cpm of the G3PDH product. The normalized relative RT-PCR value of the corneal epithelial product was multiplied by a correction factor to set it to equal 0.07, because this was the ratio of alpha 1(XX) collagen mRNA to G3PDH mRNA determined by the competitive PCR, a technique that yields exact values. The cpm ratios of all other products were then adjusted by this correction factor and plotted in Fig. 4B. As seen in lane 7 of the figure, alpha 1(XX) collagen mRNA is most abundant in embryonic day 13 chick corneal epithelium. Products were well amplified from 7- and 13-day whole corneas (Fig. 4B, lanes 5 and 6), 13-day corneal stroma (lane 8), 14.5-day sterna (lane 9), and 17-day lung (lane 10). A significant amplification was also seen with 17-day tendon (lane 12). Minor amounts of product were observed when 7- and 13-day skin mRNA was used as template (lanes 3 and 4). Type XX collagen is not appreciably expressed by 17-day calvaria (lane 11), 5.5-day neural retina (lane 1), or 5.5-day notochord (lane 2) mRNA.

alpha 1(XX) Collagen Polypeptide Chain-- A synthetic peptide to the Tsp domain was used to generate a polyclonal antibody against type XX collagen. The antibody did not cross-react with synthetic peptides made from the analogous regions in collagens XII and XIV. Western blots were prepared from 13-day corneal extracts run on reducing denaturing polyacrylamide gels to determine the size of the alpha 1(XX) polypeptide chain. As seen in lane 1 of Fig. 5, three bands, 185, 170, and 135 kDa, react with the alpha 1(XX) collagen antibody, all smaller than alpha 1(XII) and alpha 1(XIV) polypeptide chains. This suggests that the alpha 1(XX) collagen mRNA may be alternatively spliced, yielding different forms of the polypeptide chain. This would be consistent with other members of the FACIT family, in which NC3 alternative splicing yields different sized polypeptide chains.


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 5.   Western blot of a 5% acrylamide gel run under reducing conditions in the presence of SDS. 13-day embryonic corneal protein extracts were applied to the lanes and reacted with various antibodies. Lane 1, anti-chick anti-collagen XX antibody; lane 2, anti-bovine anti-collagen XII antibody 1851 (15); lane 3, anti-chick anti-collagen XIV peptide antibody (9); lane 4, anti-chick anti-collagen XII antibody 522 (5, 9). The avidity of the anti-chick anti-collagen XII is very intense. To detect the type XII alpha  chains at an intensity more in line with that of the type XX and XIV collagen polypeptide bands, the anti-bovine antibody was routinely used. (Type XII collagen is highly conserved across species; the antibody reactivity with the type XII collagen of many species reflects this fact).

The sequence in Fig. 3 encodes a mature, processed (i.e. without the signal peptide) polypeptide of about 184 kDa. Therefore, the overlapping cDNAs in Fig. 1 presumably encode the slowest migrating band seen on the Western blot. In support of the idea of alternative splicing, the human alpha 1(XX) collagen cDNA sequence is lacking the unique domain and a fibronectin type III repeat that are encoded by the chick cDNA composite (data not shown).2 In Fig. 5, lanes 2 and 4 were reacted with type XII collagen antibodies and lane 3 with collagen XIV antibody to show the 220-kDa short forms of these polypeptides for comparison. The alpha 1(XX) collagen antibody does not cross-react with alpha 1(XII) or alpha 1(XIV) collagen.

Fig. 6A compares diagrammatically the long form of alpha 1(XIV) with the alpha 1(XX) collagen chain. The conservation of domains in alpha 1(XII), alpha 1(XIV), and alpha 1(XX) suggests that type XX may interact with the surface of fibrils, as collagens XII and XIV do (4-6). A model of a type XX collagen trimer associated with a fibril surface and projecting the NC3 domains into the perifibrillar space, in a position to interact with other collagen fibrils or other molecules, is shown in Fig. 6B. It is estimated that the size of the NC3 finger-like domains will be about 25 nm each in length. This is based on the fact that type XX collagen is smaller than the short forms of types XII and XIV on Western blots and on the fact that the NC3 domain of alpha 1(XX) contains about half as many residues as the ~45 nm alpha 1(XIV) NC3 domain (15). Immunoelectron microscopy will be necessary to confirm this proposed structure.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   A, schematic diagram of the structural motifs in alpha 1(XIV) and alpha 1(XX) collagen polypeptide chains. FN III repeats are indicated by solid black circles. Lines show which of these are conserved between types XIV and XX collagen. Although not indicated with adjoining lines, the amino-terminal von Willebrand factor A domain of type XIV collagen, as well as the Tsp, Col 2, NC2, Col 1, and NC1 domains are also conserved with those of collagen XX (see Table I). B, hypothetical type XX collagen trimeric molecule and its potential association with a collagen fibril.


    ACKNOWLEDGEMENTS

We thank Dr. Thomas Linsenmayer for helpful discussions and for providing space for Jessica Foley to work in his laboratory. We also thank Dr. John Fitch for providing chick 5.5-day notochord and neural retinal tissues.

    FOOTNOTES

* This study was supported in part by National Institutes of Health Grant EY09056 (to M. K. G.) and by the Cutaneous Biology Research Center, Massachusetts General Hospital, which receives a research grant from Shisiedo Co., Ltd., Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF312825.

|| To whom correspondence should be addressed: Dept. of Pharmacology and Toxicology, EOHSI, School of Pharmacy, Rutgers University, 170 Frelinghuysen Rd., Piscataway, NJ 08854. Tel.: 732-445-3751; Fax: 732-445-0119; E-mail: magordon@eohsi.rutgers.edu.

Published, JBC Papers in Press, March 23, 2001, DOI 10.1074/jbc.M009912200

2 M. Koch, J. E. Foley, R. Hahn, P. Zhou, R. E. Burgeson, D. R. Gerecke, and M. K. Gordon, manuscript in preparation.

    ABBREVIATIONS

The abbreviations used are: FACIT, fibril-associated collagens with interrupted triple helices; PCR, polymerase chain reaction; Tsp, thrombospondin amino-terminal-like; NC, noncollagenous; Col, collagenous; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; RT, reverse transcription; FNIII, fibronectin type III module.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Shaw, L. M., and Olsen, B. R. (1991) Trends. Biochem. Sci. 16, 191-194
2. Moradi-Ameli, M., Deleage, G., Geourjon, C., and van der Rest, M. (1994) Matrix Biol. 14, 233-239
3. van der Rest, M., and Mayne, R. (1988) J. Biol. Chem. 263, 1615-1618
4. Keene, D. R., Lunstrum, G. P., Morris, N. P., Stoddard, D. W., and Burgeson, R. E. (1991) J. Cell Biol. 113, 971-978
5. Koch, M., Bohrmann, B., Matthison, M., Hagios, C., Trueb, B., and Chiquet, M. (1995) J. Cell Biol. 130, 1005-1014
6. Young, B. B., Gordon, M. K., and Birk, D. E. (2000) Dev. Dyn. 217, 430-439
7. Altschul, S. F., Gish, W., Miller, W., Meyer, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410
8. Lennon, G. G., Auffray, C., Polymeropoulos, M., and Soares, M. B. (1996) Genomics 33, 151-152
9. Gordon, M. K., Foley, J. W., Linsenmayer, T. F., and Fitch, J. M. (1996) Dev. Dyn. 206, 49-58
10. Gordon, M. K., Fitch, J. M., Foley, J. W., Gerecke, D. R., Linsenmayer, C., Birk, D. E., and Linsenmayer, T. F. (1997) Invest. Ophthalmol. Vis. Sci. 38, 153-166
11. Koch, M., Olson, P. F., Albus, A., Jin, W., Hunter, D. D., Brunken, W. J., Burgeson, R. E., and Champliaud, M. F. (1999) J. Cell Biol. 145, 605-618
12. Gordon, M. K., Foley, J. W., Birk, D. E., Fitch, J. M., and Linsenmayer, T. F. (1994) J. Biol. Chem. 269, 24959-24966
13. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 51-59
14. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
15. Lunstrum, G. P., Morris, N. P., McDonough, A. M., Keene, D. R., and Burgeson, R. E. (1991) J. Cell Biol. 113, 963-969
16. von Heijne, G. (1983) Eur. J. Biochem. 133, 17-21
17. Kania, A. M., Reichenberger, E., Baur, S. T., Karimbux, N. Y., Taylor, R. W., Olsen, B. R., and Nishimura, I. (1999) J. Biol. Chem. 274, 22053-22059
18. Lesage, A., Penin, F., Geourjon, C., Marion, D., and van der Rest, M. (1996) Biochemistry 35, 9647-9660
19. Linsenmayer, T. F., Gibney, E. P., and Fitch, J. M. (1986) J. Cell Biol. 103, 1587-1593
20. Fitch, J. M., Birk, D. E., Mentzer, A., Hasty, K. A., Mainardi, C., and Linsenmayer, T. F. (1988) Invest. Ophthalmol. Vis. Sci. 29, 1125-1136
21. Walchli, C., Trueb, J., Kessler, B., Winterhalter, K. H., and Trueb, B. (1993) Eur. J. Biochem. 212, 1125-1136


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Koch, G. Veit, S. Stricker, P. Bhatt, S. Kutsch, P. Zhou, E. Reinders, R. A. Hahn, R. Song, R. E. Burgeson, et al.
Expression of Type XXIII Collagen mRNA and Protein
J. Biol. Chem., July 28, 2006; 281(30): 21546 - 21557.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. G. Canty and K. E. Kadler
Procollagen trafficking, processing and fibrillogenesis
J. Cell Sci., April 1, 2005; 118(7): 1341 - 1353.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Koch, J. Schulze, U. Hansen, T. Ashwodt, D. R. Keene, W. J. Brunken, R. E. Burgeson, P. Bruckner, and L. Bruckner-Tuderman
A Novel Marker of Tissue Junctions, Collagen XXII
J. Biol. Chem., May 21, 2004; 279(21): 22514 - 22521.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Koch, F. Laub, P. Zhou, R. A. Hahn, S. Tanaka, R. E. Burgeson, D. R. Gerecke, F. Ramirez, and M. K. Gordon
Collagen XXIV, a Vertebrate Fibrillar Collagen with Structural Features of Invertebrate Collagens: SELECTIVE EXPRESSION IN DEVELOPING CORNEA AND BONE
J. Biol. Chem., October 31, 2003; 278(44): 43236 - 43244.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. C. Myers, D. Li, P. S. Amenta, C. C. Clark, C. Nagaswami, and J. W. Weisel
Type XIX Collagen Purified from Human Umbilical Cord Is Characterized by Multiple Sharp Kinks Delineating Collagenous Subdomains and by Intermolecular Aggregates via Globular, Disulfide-linked, and Heparin-binding Amino Termini
J. Biol. Chem., August 22, 2003; 278(34): 32047 - 32057.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. P. Boot-Handford, D. S. Tuckwell, D. A. Plumb, C. F. Rock, and R. Poulsom
A Novel and Highly Conserved Collagen (pro{alpha}1(XXVII)) with a Unique Expression Pattern and Unusual Molecular Characteristics Establishes a New Clade within the Vertebrate Fibrillar Collagen Family
J. Biol. Chem., August 15, 2003; 278(33): 31067 - 31077.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. Kato, J.-H. Chang, and D. T. Azar
Expression of Type XVIII Collagen during Healing of Corneal Incisions and Keratectomy Wounds
Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 78 - 85.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Sato, K. Yomogida, T. Wada, T. Yorihuzi, Y. Nishimune, N. Hosokawa, and K. Nagata
Type XXVI Collagen, a New Member of the Collagen Family, Is Specifically Expressed in the Testis and Ovary
J. Biol. Chem., September 27, 2002; 277(40): 37678 - 37684.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/25/23120    most recent
M009912200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koch, M.
Right arrow Articles by Gordon, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koch, M.
Right arrow Articles by Gordon, M. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement