JBC Ideal method for primary cell transfection

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M010544200 on April 17, 2001

J. Biol. Chem., Vol. 276, Issue 26, 24323-24330, June 29, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/26/24323    most recent
M010544200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, S.
Right arrow Articles by Povirk, L. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, S.
Right arrow Articles by Povirk, L. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Accurate in Vitro End Joining of a DNA Double Strand Break with Partially Cohesive 3'-Overhangs and 3'-Phosphoglycolate Termini

EFFECT OF Ku ON REPAIR FIDELITY*

Shuang Chen, Kedar V. Inamdar, Petra PfeifferDagger , Elke FeldmannDagger , Michele F. Hannah, Yin Yu, Jae-Wan Lee, Tong Zhou, Susan P. Lees-Miller§, and Lawrence F. Povirk

From the Department of Pharmacology and Toxicology, Virginia Commonwealth University, Richmond, Virginia 23298, the Dagger  Institut für Zellbiologie, Universitätsklinikum Essen, D-45122 Essen, Federal Republic of Germany, and the § Department of Biological Sciences, University of Calgary, Calgary, Alberta T2N 1N4, Canada

Received for publication, November 21, 2000, and in revised form, April 12, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To examine determinants of fidelity in DNA end joining, a substrate containing a model of a staggered free radical-mediated double-strand break, with cohesive phosphoglycolate-terminated 3'-overhangs and a one-base gap in each strand, was constructed. In extracts of Xenopus eggs, human lymphoblastoid cells, hamster CHO-K1 cells, and a Chinese hamster ovary (CHO) derivative lacking the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), the predominant end joining product was that corresponding to accurate restoration of the original sequence. In extracts of the Ku-deficient CHO derivative xrs6, a shorter product, consistent with 3' right-arrow 5' resection before ligation, was formed. Similar results were seen for a substrate with 5'-overhangs and recessed 3'-phosphoglycolate ends. Supplementation of the xrs6 extracts with purified Ku restored accurate end joining. In Xenopus and human extracts, but not in hamster extracts, gap filling and ligation were blocked by wortmannin, consistent with a requirement for DNA-PKcs activity. The results suggest a Ku-dependent pathway, regulated by DNA-PKcs, that can accurately restore the original DNA sequence at sites of free radical-mediated double-strand breaks, by protecting DNA termini from degradation and maintaining the alignment of short partial complementarities during gap filling and ligation.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cells deficient in any of the three components of DNA-dependent protein kinase DNA-PK1 (i.e. the catalytic subunit DNA-PKcs or either subunit of the DNA end binding heterodimer Ku) are partially deficient in the rejoining of double strand breaks (DSBs) (1-4). The precise roles of the individual subunits in the repair process are not known, but possible functions have been suggested based on their known biochemical properties. Ku has been proposed to align DNA ends and thus promote ligation (5-7), to protect the ends from degradation (8), and/or to unwind duplex DNA ends and thus expose microhomologies that could be used for splicing the ends together (1, 9). DNA-PKcs has been proposed to regulate accessibility of DNA ends to processing (10), perhaps by promoting its own dissociation following autophosphorylation (11) and/or by allowing translocation of Ku from the ends into the interior of the DNA (10, 12, 13).

Ionizing radiation is a major environmental source of DSBs (14-16). Radiation-induced DSBs are formed by fragmentation of deoxyribose, typically leaving in each strand a one-base gap with 5'-phosphate and either 3'-phosphate or 3'-phosphoglycolate (PG) termini (14, 15, 17). Such DSBs present to repair systems a more complex substrate than simple restriction enzyme cuts, potentially increasing the possibility of errors during rejoining. In this report, we describe how synthetic substrates containing mimics of radiation-induced breaks, with defined geometry and chemical structure (see Figs. 1 and 2), are processed in several in vitro end joining systems. The results suggest a Ku-dependent repair process that can accurately restore the original DNA sequence at sites of these complex DSBs, through the use of very short residual complementarities at the ends of the break.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- Hamster CHO and derivative cell lines were from the European Collection of Cell Culture (Wiltshire, United Kingdom), except for XR-C1 cells (18), which were obtained from M. Z. Zdzienicka (Leiden University). Extracts of Xenopus eggs (19), Chinese hamster fibroblasts (20), and human GM00558B lymphoblastoid cells (ATCC) (21) were prepared according to procedures described previously, except that for Xenopus egg extracts, the extraction buffer was 30 mM Tris-HCl, pH 7.9, 90 mM KCl, 10 mM sodium-beta -glycerophosphate, 2 mM EGTA, 1 mM DTT, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, 1 µg/ml pepstatin, 1 µg/ml leupeptin, 100 nM N-acetyl-DEVD-aldehyde, the latter peptide added as a caspase inhibitor (22).

A plasmid substrate containing a site-specific DNA double strand break with 2-base cohesive 5'-overhangs and recessed 3'-PG termini (Fig. 2C) was prepared by ligation of 3'-PG oligomers into larger 5'-overhangs formed by controlled digestion of plasmid pSV56 with the 3'right-arrow5' exonuclease activity of T4 polynucleotide kinase, as described (10, 23). A similar construct, but bearing a PG-terminated -ACG 3'-overhang was similarly constructed by ligation of slightly longer oligomers (pGCCGGACGCGACG* and 5'-32P-labeled pCGAGGAACGCGACG*, where the asterisk indicates a 3'-PG) into the same prepared vector (Fig. 1). The structure of the 3'-PG oligomers was verified by Fourier transform electrospray ionization mass spectrometry; all species detected could be ascribed to isotopes or salts of the oligomer or to the internal standard, with no detectable contaminants (24).

As described previously (23), the 5'-overhang construct was purged of any residual molecules having 3'-hydroxyl termini by treatment with T7 DNA polymerase in the absence of dNTPs. However, in the case of the substrate with a 3'-overhang, repeated attempts to digest residual 3'-hydroxyl species using T7 polymerase unexpectedly resulted in apparent formation of a substrate with a 3'-hydroxyl blunt end. Therefore, this digestion step was eliminated from the construction, and in order to show that particular repair products were derived from constructs that had incorporated 3'-overhangs into both ends, parallel experiments were performed with a construct into which a 3'-PG oligonucleotide had been ligated at one end only (Fig. 2B). Ku protein was purified as described previously (25).

End Joining Reactions-- Reactions with whole-cell extracts of CHO-K1 cells and various CHO derivatives contained 8 µl of extract (briefly dialyzed against 50 mM morpholinoethanesulfonate-NaOH, pH 7.5, 40 mM KCl, 10 mM MgCl2, 5 mM beta -mercaptoethanol and with a protein concentration of 12.5 mg/ml) plus 10 ng of substrate in a total volume of 10 µl. Samples were incubated at 25 °C, usually for 6 h (8). For experiments with Xenopus egg extract, 20-µl reactions contained 16 µl of extract (in extraction buffer) and 10 ng of DNA substrate; reactions were incubated at 13 °C, usually for 6 h (26). Reactions with whole-cell extracts of human GM00558B cells contained 50 mM triethanolamine-HCl, pH 7.5, 0.5 mM magnesium acetate, 60 mM potassium acetate, 2 mM ATP, 1 mM DTT, 100 µg/ml bovine serum albumin plus 10 ng substrate and whole-cell extract at a final protein concentration of 3 mg/ml and were incubated at 37 °C for 6 h (21). Wortmannin in Me2SO was added to some samples to a final concentration of 10 µM. Some samples also contained various dNTPs and/or ddNTPs (50 µM each), as indicated.

Analysis of Repair Intermediates and Products-- Following the end joining reaction, all samples were deproteinized with proteinase K and phenol, and nucleic acids were precipitated, treated with BstXI and XhoI, denatured, and subjected to electrophoresis on 20% polyacrylamide gels as described previously (27). Wet gels were frozen and exposed on PhosphorImager screens for 1-2 days at -20 °C. Phosphor images were analyzed with ImageQuant 3.3 software (Molecular Dynamics). Poorly resolved peaks were quantitated using the Gaussian deconvolution algorithm of PeakFit 4.06 (AISN Software).

For analysis of topological forms, deproteinized DNA samples were electrophoresed on 0.6% agarose gels at 6 V/cm, affording clear separation of the nicked circular and linear dimer end joining products. Gels were dried under vacuum for phosphorimaging.

Aliquots of some deproteinized samples (one-twentieth of the total sample) were transfected into DH5alpha -competent cells (Max Efficiency, Life Technologies, Inc.) as prescribed by the vendor. Individual colonies were expanded in liquid culture, and isolated plasmid was sequenced in the region corresponding to the rejoined DSB by the fluorescent-dideoxy method using an ABI Prism automated sequencer. The sequencing primer was TATGCTTGCTGTGCTTACTG, which lies 80 base pairs from the DSB site.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Extracts of CHO-K1 Cells Accurately Rejoin DSBs with Terminally Modified 3'-Overhangs and 1-Base Gaps-- Radiation-induced DNA DSBs are formed when multiple radicals, emanating from a single ionization track, attack and fragment closely opposed deoxyribose moieties in both strands (28). To examine the repair of such lesions by end joining, a model DSB was constructed (Fig. 1). Each end of the break had a PG-terminated 3-base 3'-overhang with the sequence -ACG*. Thus, this substrate mimics the break that would result from free radical-mediated cleavage at each T in the self-complementary sequence ACGT. Accurate repair of such a break (Fig. 2A) would require annealing of the CG sequences in each overhang, removal of PG, fill-in of the 1-base gap in each strand (presumably using the 3'-overhang from the other end of the break as a template), and finally ligation. In order that processing of the break could be followed, it was labeled with 32P 14 bases from one of the 3' termini.


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 1.   Construction of 3'-terminally blocked DSB substrates. Oligomers bearing 3'-PG(bullet ) termini were successively ligated onto the ends of a suitably prepared plasmid.


View larger version (36K):
[in this window]
[in a new window]
  		Fig. 2.   End joining substrates and repair products. A, the 3'-PG(bullet ) 3'-overhang substrate mimics the DSB that would result from free radical-mediated deoxyribose fragmentation on a 3-base 3' stagger. Accurate repair (43-base product) would require alignment-based fill-in prior to ligation. B, the one-sided 3'-overhang substrate was included as a control to assess the effect of incomplete ligation in construction of the 3'-overhang substrate. In theory, it cannot form any 43-base product, but it could form a 42-base product by fill-in of the 10-base 5'-overhang, abutting of the ends, and continuation of fill-in using the 3'-overhang as a template; 41-, 40-, and 39-base products would result from removal of 1, 2, and 3 bases, respectively, from the 3'-overhang prior to fill-in. C, the 5'-overhang substrate lacks the 1-base gaps but is otherwise similar to a 2-base-5'-staggered free radical-mediated DSB. All three substrates can, by various degrees of 3'-resection and/or fill-in, be converted to an intermediate with self-complementary CGCG 5'-overhangs, the alignment of which would result in the 35-base repair product.

This substrate was incubated in CHO-K1 whole-cell extracts and then cut with restriction enzymes on each end to release short fragments, which were then analyzed on sequencing gels. As shown in Fig. 3A, the CHO-K1 extracts were able to rejoin such breaks, and the predominant end-joined product was a 43-base fragment, corresponding to accurate rejoining by annealing, gap filling, and ligation, as described above (Fig. 2). Analysis of repair joints in individual plasmid clones recovered from the repair reaction confirmed the sequence of this repair joint as well as its predominance among repair products (Table I). In theory, such a product could only be formed from the head-to-tail joining of two ends, each of which had the -ACG* overhang. To test this requirement, parallel experiments were performed with a substrate having an -ACG* overhang ligated into the XhoI side of the substrate only (Fig. 2B). The opposite end of this plasmid would have a 10-base 5'-overhang, formed as an intermediate in the construction (see Fig. 1) (23). As predicted, this "one-sided" construct did not yield any 43-base repair product, but instead yielded a mixture of end-joined products with fragment lengths of 42, 41, 40, 39, 37, and 35 bases (Fig. 3B). The 39-base product would correspond to removal of the 3'-overhang and fill-in of the 10-base 5'-overhang, followed by direct ligation of the resulting blunt ends. The 40-, 41-, and 42-base products would correspond to retention of 1, 2, and 3 bases of the single 3'-overhang, plus all bases of the 5'-overhang (Fig. 2B), as was confirmed by sequencing clones of repaired plasmid (Table I). The 37- and 35-base products would correspond to annealing of 2 and 4 bases, respectively, of the CGCG sequences on opposite sides of the break, presumably preceded by a 5- or 7-base 3' resection of the end with a 3'-overhang (Fig. 2B). Since the 3'-overhang construct will necessarily contain some one-sided construct due to incomplete ligation of the PG oligomers into the vector, some or all of the inaccurate joins may be derived from those contaminants; thus, the proportion of accurate joins for the full 3'-overhang construct is probably even higher than is experimentally observed (as much as 70% is some experiments) and may approach 100%. The higher apparent incidence of inaccurate repair events indicated by the sequencing data (Table I) is expected, since these data will include repair products from plasmids into which only the unlabeled oligomer had been ligated, but such products will not be visible in the gel assays (Fig. 3).


View larger version (68K):
[in this window]
[in a new window]
  		Fig. 3.   End joining in hamster cell extracts and the effect of Ku deficiency. A-C, the internally labeled (*) 3'-PG-terminated (bullet ) 3'-overhang (A), one-sided 3'-overhang (B), and 5'-overhang (C) substrates described in the legend to Fig. 2 were incubated for 6 h (A and B) or for 1, 6, or 16 h (C) with extracts of CHO-K1, Ku-deficient xrs6, or Ku-transfected xrs6-Ku80 (xrs-Ku) cells and then cut near each end with XhoI and BstXI (see Fig. 2) for analysis of end processing and end joining. The 43- and 37-base products reflect accurate head-to-tail end joining (recircularization) of the 3'-overhang and 5'-overhang substrates, respectively; the analogous head-to-head end joining products would be 24 and 18 bases. In some cases, purified Ku protein (0.1 or 0.4 µg) was added as indicated, with incubation for 6 h. All reactions contained a 50 µM concentration of each dNTP, except as indicated. In A and B, the 15PG band corresponds to the initial 3'-PG-terminated substrate. PG removal yields the 15-mer, and 3' resection yields shorter species, with the 12-mer corresponding to a blunt end. In A, a portion of the gel is reproduced at 10× contrast to show weak bands, and above that, a replicate experiment is shown in which the gel was exposed to x-ray film to improve resolution of closely spaced bands. (The dTTP-depleted sample was lost from the first experiment.) In C, the 10PG band represents the unprocessed recessed 3'-PG terminus, and the 12-mer represents fill-in to a blunt end. D, effect of 10 µM wortmannin on end joining; conditions and substrates are the same as in A and C. E, the 3'-PG-terminated 3'-overhang substrate was incubated for 6 h in extracts of CHO-K1 cells or of DNA-PKcs-deficient XR-C1 cells and analyzed as in A. The size markers (M) are 5'-end-labeled oligomers of the indicated lengths and with the same sequence as the expected end joining products or processing intermediates. DMSO, Me2SO.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Sequences of repair joints formed in hamster cell extracts from the 3'-overhang and one-sided 3'-overhang substrates

As a further verification that the 43-base product was indeed the result of single-base gap filling, the reactions were performed with various combinations of dNTPs (Fig. 3A). As expected, only dTTP was essential for generation of the 43-base product, supporting the proposal that it was formed by gap filling opposite the template adenine in each -ACG overhang. The absence of dATP had little effect on the product distribution but, curiously, reduced overall end joining efficiency. The complete absence of any dNTPs appeared to accelerate 3' resection in extracts from all of the cell lines. Replacement of dTTP with ddTTP promoted formation of a 16-base species consistent with the expected trapping of an intermediate in which the one-base gap had been filled in with ddTTP, preventing the final ligation (Fig. 3E).

Thus, the presence of overhangs with a partial complementarity of as little as 2 bases was sufficient to permit accurate end joining with restoration of the original sequence, while lack of such complementarity led to multiple repair products corresponding to various degrees of 3'-resection.

Accurate End Joining Requires Ku but Not DNA-PKcs-- Ku is a heterodimeric DNA-binding protein that has been implicated in DSB repair in vivo (1-4) and has been found to promote end-to-end DNA association (5, 7, 29) and to stimulate DSB rejoining by mammalian DNA ligases in vitro (29, 30). To assess the possible effects of Ku on the efficiency and accuracy of end joining, parallel experiments were carried out using extracts of the Ku-defective CHO derivative xrs6 (31, 32). As shown in Fig. 3A and Table I, there was no detectable formation of the accurately joined, 43-base repair product in xrs6 extracts. Instead, the predominant product was the 35-base product, consistent with 7-base 3' resection in each strand and annealing of the CGCG microhomology (see Fig. 2). In addition, there appeared to be more extensive 3' processing in the xrs6 than in the CHO-K1 extract. For xrs6 extracts, no unprocessed 3'-PG ends remained, and more than half of the radiolabel had been lost entirely, presumably due to resection at least several bases into the duplex region of the DNA. Likewise, sequencing revealed formation, in the xrs6 extracts, of several repair joints with even larger deletions at the break site (Table I). Sequencing also confirmed the predominance of the product with apparent splicing at the CGCG microhomology as well as the absence of any accurate repair joints.

To assess whether the differences between CHO-K1 and xrs6 extracts were due to presence or absence of Ku or to some ancillary difference between the cell lines, extracts were also prepared from an xrs6 derivative cell line that had been stably transfected with a hamster Ku80 gene (33). Unlike xrs6 extracts, these xrs6-Ku80 extracts were competent to form the accurately joined 43-base repair product (Fig. 3A and Table I). Moreover, the addition of purified human Ku also restored accurate repair in the xrs6 extracts, promoting formation of the 43-base product while suppressing formation of the 35-base product (Fig. 3A). However, whereas the accuracy of end joining was restored to near that of CHO-K1 extracts, the efficiency was much lower, with only 0.2% joining in the Ku-supplemented xrs6 extracts versus 7% joining in CHO-K1. The reason for this lower efficiency is not known, but it could reflect differences in Ku phosphorylation state, differences between the human and hamster proteins, or secondary effects of Ku deficiency on other proteins in the cell. Nevertheless, taken together, the results strongly suggest a specific and apparently absolute requirement for Ku in the accurate end joining of 3'-staggered, free radical-mediated DSBs.

Similar experiments were performed with a substrate having 2-base-recessed 3'-PG ends and cohesive 2-base 5'-overhangs. With this substrate (which, unlike an actual free radical-mediated DSB, would not have a 1-base gap in each strand when the ends were annealed), the presence of Ku likewise suppressed 3' right-arrow 5' resection and promoted accurate end joining, although the requirement was not absolute (Fig. 3C). For CHO-K1 and xrs6-Ku80 extracts, 89 and 88% of the head-to-tail joins at 6 h incubation resulted in the accurate, 37-base product, consistent with annealing of the existing 2-base 5'-overhangs. The xrs6 extract yielded primarily the 35-base product (80%), consistent with a 2-base 3' resection followed by annealing of the CGCG microhomology (see Fig. 2), but it did yield some 37-base product (20%). The addition of purified human Ku to the xrs6 extracts restored accurate end joining (85% 37-base product), although the extent of end joining was only about half that seen with the CHO-K1 extract. All of the extracts yielded only very small amounts of the 18-base (simple annealing) and 16-base (2-base resection) head-to-head joining products, suggesting that recircularization was preferred over intermolecular dimerization. Again, there was more end processing (PG removal, fill-in, and, at longer times, loss of radiolabel) in xrs6 than in CHO-K1 extracts. Thus, either Ku transfection or direct Ku addition restored accurate end joining of the 5'-overhang substrate to the xrs6 extracts.

To assess whether end joining required DNA-PKcs, effects of the DNA-PKcs inhibitor wortmannin were examined. Me2SO solvent (2%) alone reduced both the efficiency and the accuracy of end joining. Wortmannin, at a concentration sufficient to completely suppress DNA-PK activity (10, 27, 34), had no additional effect on formation of the 35- and 37-base end joining products and produced only a modest reduction (less than 2-fold) in the formation of the 43-base product (Fig. 3D). To assess whether DNA-PKcs might play an essential role independent of its kinase activity, experiments were also performed with extracts of the CHO derivative XR-C1, which lacks detectable DNA-PKcs protein (18). Unlike xrs6 extracts, these extracts produced significant amounts of the 43-base end joining product (Fig. 3E), confirming that DNA-PKcs is not essential for accurate end joining in this system.

End Joining in Extracts of Human Cells and Xenopus Eggs Shows Similar Specificity-- In extracts of Xenopus eggs, end joining of both simple restriction cuts and 3'-PG-terminated DSB constructs can be completely blocked by DNA-PK inhibitors such as wortmannin and LY294002 (10, 27); end joining is also wortmannin-sensitive in at least some types of human cell extracts (21). However, wortmannin had little or no effect on end joining of PG-terminated substrates in CHO or xrs6 extracts. In an attempt to determine the basis for these differences and examine the possible role of DNA-PK in joining of the 3'-overhang PG substrate, similar experiments were performed in Xenopus egg extracts and in whole-cell extracts of human lymphoblastoid cells.

In the Xenopus extracts, the product distribution was nearly identical to that seen in CHO-K1 extracts (Fig. 4A). The 43-base product was most prominent, but there was also significant formation of the 42-base and several shorter products. As in CHO-K1 extracts, the one-sided 3'-overhang construct yielded only the 42-base and shorter products, confirming that the 43-base product was formed by annealing of two -ACG overhangs. Unlike the mammalian extracts, Xenopus extracts also yielded small quantities of 29-34-base products, which would correspond to partial or complete loss of the 10-base 5'-overhang (see Fig. 2B).


View larger version (55K):
[in this window]
[in a new window]
  		Fig. 4.   End joining in Xenopus egg extracts. A, the various substrates were incubated in extracts at 13 °C for 6 h and then cut with XhoI and BstXI. B, same as A, except that wortmannin (10 µM) and various ddNTPs were present, all samples contained 2% Me2SO (DMSO), and some samples were cut with XhoI alone so that end processing intermediates and head-to-head joining products, but not head-to-tail recircularization products, were detected. See Fig. 2 and the legend to Fig. 3 for description of labeled products and processing intermediates.

In Xenopus egg extracts, formation of all end-joined products was efficiently blocked by 10 µM wortmannin (>20-fold reduction in end-joined products; Fig. 4), a concentration sufficient to completely suppress DNA-PK activity (27). Because joining was less sensitive to Me2SO in Xenopus extracts than in the mammalian extracts (possibly due to the lower temperature), the wortmannin effect was unambiguous. In addition, wortmannin prevented the formation of a species migrating in the position expected for a 3'-hydroxyl 16-mer (Fig. 4, A and B). This species could be an intermediate corresponding to fill-in of the expected 1-base gap in the labeled strand of the annealed ends, prior to ligation. However, as noted above, a 16-base resection-dependent head-to-head joining product could also be formed. To distinguish between these possibilities, ddNTPs were added in an attempt to trap the extension product prior to the final ligation step (Fig. 4B). The addition of either ddTTP or all four ddNTPs largely prevented formation of the 43-base end joining product and increased the intensity of the 16-base fragment, while ddATP had little effect. These results strongly suggest that the 16-base species was indeed the filled-in but unligated intermediate and that fill-in was blocked by wortmannin, presumably as a result of inhibition of the kinase activity of DNA-PK (27), which can regulate accessibility of DNA ends to enzymatic processing (12). In contrast to a recessed 3'-PG terminus (10), there was significant removal of PG from the 3'-overhang despite the presence of wortmannin.

In human cell extracts, a slightly different pattern of end joining was seen (Fig. 5). The 3'-overhang substrate yielded primarily the accurate 43-base end joining product, along with variable amounts of the 35- and 37-base products, but none of the 39-42-base products. The 5'-overhang substrate yielded exclusively the accurately joined 37-base product and none of the 35-base resection-dependent product (not shown). In addition, human extracts yielded much more of the 24-, 18-, and 16-base head-to-head end joining products than did hamster and Xenopus extracts, suggesting that there was little or no preference for recircularization over intermolecular end-to-end dimerization. Indeed, analysis on agarose gels indicated that, as reported previously (21), the human cell extracts yielded exclusively intermolecular products, with no detectable recircularization (Fig. 5C). As in the Xenopus extracts, formation of all end joining products was blocked by wortmannin, while substitution of ddTTP for dTTP prevented formation of the accurate 43- and 24-base end joining products and trapped the filled-in but unligated intermediate (16-base fragment in Fig. 5B). Although end joining in human cell extracts was significantly inhibited (about 2-fold) by Me2SO, the inhibition by wortmannin was much greater, ~20-fold.


View larger version (53K):
[in this window]
[in a new window]
  		Fig. 5.   End joining in human cell extracts. A, the various substrates were incubated at 37 °C for 6 h, in the presence of 10 µM wortmannin and/or 2.5% Me2SO (DMSO) and then cut with XhoI and BstXI. B, same as A, except that certain dNTPs were replaced with ddNTPs as indicated. C, same as A except that substrates and products were analyzed on an agarose gel without restriction cleavage; for clarity, the top portion of the marker lane is shown at 5× reduced contrast.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The capacity of mammalian cells to join mismatched DNA ends based on short partial complementarities in single strand overhangs was first noticed in the repair joints formed when linearized plasmids with mismatched restriction ends were recircularized upon transfection into monkey CV-1 cells (35). In some of these repair joints, partial complementarities in 3'-overhangs had apparently been used for alignment, despite the fact that such alignment would initially leave single strand gaps in the aligned ends. This phenomenon implied a quite remarkable process, termed "postrepair ligation" (Fig. 2A), wherein the putative repair complex must have held the two ends in juxtaposition and maintained base pairing of a 2- or 3-base complementarity in the overhangs while at the same time allowing a polymerase to fill in the gaps to produce a ligatable substrate. Later in vitro experiments using Xenopus egg extracts (36, 37) confirmed that such processing was indeed possible, and thus an "alignment factor" was proposed but not identified.

While such an alignment mechanism has been invoked primarily to explain the microhomologies typically found at sequence junctions of various illegitimate recombination events (38, 39), the same mechanism would be ideally suited for the accurate repair of DSBs induced by ionizing radiation and other free radical-based genotoxins. Radiation-induced breaks are the result of clustered free radical-mediated sugar fragmentation (28), and therefore are likely to be randomly staggered and to have cohesive overhangs of one to several bases, along with blocked 3' termini (14, 15, 17), a one-base gap in each strand, and possible ancillary base damage in the overhangs (40). Thus, the use of partial complementarities for alignment of the overhangs during gap filling and ligation would be essential for accurate restoration of the original sequence (Fig. 2). The same requirement would apply to repair of breaks induced by enediyne antibiotics, which involve similar sugar fragmentation on a defined 2- or 3-base 3' stagger (41, 42).

The possibility that Ku might be the long sought "alignment factor" was suggested by its capacity to promote DNA end-to-end association (5-7) and to enhance the joining of either blunt or cohesive DSBs by mammalian DNA ligases (29, 30). The strongest evidence, however, comes from recent analysis of repair joints formed in CHO-K1 and xrs6 extracts during the recircularization of substrates with mismatched restriction ends (8). These data imply a critical role for Ku in preserving 3'-overhangs during end joining. Repair joints requiring alignment-based fill-in (see Fig. 2) prior to ligation, in particular, were only formed in extracts from cells expressing functional Ku.

The present results imply a role for Ku in the accurate end joining of staggered free radical-mediated DSBs. For a break formed on a 3-base 3' stagger (giving a 2-base complementarity and a 1-base gap in each strand), a majority, perhaps nearly all, of the end joining events in CHO-K1 extracts reflected complete restoration of the original sequence, whereas in Ku-deficient xrs6 extracts, no accurate joins were detected. Accurate end joining could be restored by the addition of highly purified (25) human Ku to the xrs6 extracts, clearly implicating Ku (rather than, for example, other proteins that might have become either destabilized or overexpressed in Ku-deficient cells) as the critical factor in enforcing the fidelity of end joining. Analogous experiments implicate Ku in preserving the accuracy of joining of a substrate with cohesive 5'-overhangs as well, although in this case the requirement for Ku was not absolute. Intriguingly, however, whereas for the 5'-overhang substrate both the accuracy and the efficiency of joining in the Ku-supplemented extract was comparable with that seen in CHO-K1 extract, for the 3'-overhang substrate the efficiency was reduced by more than 30-fold. These results suggest qualitative differences in the precise function of Ku in the joining of the two types of breaks, such that one process is more sensitive to as yet undefined differences between the endogenous hamster and exogenous human Ku.

The internal labeling of the 3'-PG substrates allows intermediate processing of the DNA ends to be analyzed at single-nucleotide resolution, directly demonstrating that, as inferred from analysis of repair joints (8), 3'-end processing and resection are more extensive in Ku-deficient extracts. Nevertheless, the amount of free 3'-hydroxyl-terminated -ACG overhangs available for fill-in and ligation, particularly at short incubation times (data not shown), was comparable in xrs6 and CHO-K1 extracts, yet formation of accurately joined 43-base products in the xrs6 extracts was undetectable, at least 50-fold lower than in CHO-K1 (Fig. 3A). This result implies a specific requirement for Ku in alignment during gap filling and/or ligation, in addition to its apparent role in protecting ends from 3' resection. The enzyme that initiates processing by removing the 3'-PG is not known, but it is probably not the apurinic/apyrimidinic endonuclease Ape1/Hap1; although Ape1 is the only mammalian enzyme thus far identified that is capable of removing 3'-PGs, it has no detectable activity toward PGs on 3'-overhangs (43, 44). Other activities for removing blocking groups from 3' termini have been detected in cell extracts but have not been identified or cloned (45, 46).

Our data, like those derived from substrates with mismatched restriction ends (8), do not support models in which Ku or DNA-PK catalyzes melting of DNA ends, resulting in exposure and annealing of microhomologies within double strand regions (1, 9). On the contrary, end joining events consistent with such annealing were much more frequent in Ku-deficient xrs6 extracts and were completely suppressed by the addition of purified Ku (Fig. 3A). Moreover, in the Xenopus system, it has been shown that such joining is efficiently catalyzed by extract fractions devoid of Ku and DNA-PKcs (47). Recent in vitro studies (48) suggest that the Mre11 complex is a much more likely candidate for catalyzing end joining based on microhomologies within duplex regions near DNA ends.

DNA-PKcs-deficient XR-C1 extracts, unlike Ku-deficient xrs6 extracts, yielded substantial quantities of accurate 43-base repair products. Moreover, the DNA-PK inhibitor wortmannin had little effect on end joining in CHO-K1 extracts. These results suggest that only Ku and not DNA-PKcs is essential for accurate end joining in vitro. However, in human and Xenopus extracts, end joining of the same substrates is qualitatively similar but is wortmannin-sensitive. Although the wortmannin data are to some extent complicated by the effects of Me2SO alone (a finding that emphasizes the need for concurrent solvent controls whenever this inhibitor is used), we consistently find nearly complete suppression of end joining by wortmannin and other DNA-PK inhibitors in these extracts. While the disparity in wortmannin sensitivity could be due to technical factors such as the differences in preparation of the various extracts, it could reflect the levels of DNA-PKcs. DNA-PK activity is typically 50-100-fold lower in hamster and other rodent cell extracts than in human cell or Xenopus egg extracts (49-52), and electrophoresis mobility shift assays as well as Western blot assays are consistent with this difference being due to a much lower level of DNA-PKcs protein in rodent cells (53), including CHO cells.2 Thus, a hypothesis consistent with all of the available data is that although DNA-PKcs is not required for accurate end joining in vitro, sufficient quantities of it produce an inhibitory effect that can be alleviated by activation of its kinase activity.

Recent chemical cross-linking studies (54), as well as physical-chemical data on the binding and activation of Ku and DNA-PKcs (55, 56), suggest that when Ku recruits DNA-PKcs to a DNA end, DNA-PKcs then occupies the extreme end of the DNA and displaces Ku ~10 base pairs into the interior. The DNA end is probably threaded into a channel in DNA-PKcs (revealed by electron crystallography (57)) that is open at both ends and can accommodate ~12 base pairs of duplex DNA. It is also known that Ku can promote DNA end-to-end association and that both Ku and DNA-PKcs, when present, often remain bound at the end-to-end junction (5, 7). Thus, the present data could be explained by a model of in vitro end joining wherein there is an absolute requirement for proper positioning of Ku such that it bridges the two DNA ends being joined, in order for PG removal, alignment-based fill-in, and ligation to proceed (see Fig. 2A). In the Xenopus and human extracts, Ku may be temporarily displaced from the ends and into the interior of DNA by DNA-PKcs, which may still maintain end-to-end association but not permit end processing. As has been proposed previously (12), DNA-PK-catalyzed phosphorylation (of DNA-PKcs, Ku, or some other protein in the complex) might then promote either DNA-PKcs dissociation or sliding of the whole complex along the aligned DNA ends, thus allowing Ku to move to its proper position bridging the ends. Phosphorylation of both Ku70 and Ku80 during end joining has been detected in Xenopus egg extracts (52), although in similar experiments we have detected only Ku80 phosphorylation.3 Thus, in this model, the role of DNA-PKcs is primarily regulatory, initially displacing Ku and thus controlling the timing of end processing through specific phosphorylations, the details of which remain to be defined.

The apparent dispensability of DNA-PKcs in accurate end joining in CHO-K1 extracts does not necessarily imply that it plays no important role in end joining in intact rodent cells. Indeed, at least some rodent cells lacking DNA-PKcs exhibit the same radiosensitivity and DSB repair deficiency as those lacking Ku (4). One possible explanation for this disparity is that DNA-PKcs may play a role in bringing broken DNA ends together, a task that might be much more difficult and complex in intact cells than in in vitro assays, where free ends are relatively abundant. Consistent with this proposal, DNA-PKcs has been reported to promote intermolecular ligation by ligase IV plus XRCC4, while inhibiting intramolecular ligation (58). However, the fact that intramolecular recircularization dominates end joining in Xenopus extracts but does not occur at all in human extracts, despite an apparent abundance of DNA-PKcs in both (49-52), remains to be explained.

Alternatively, recent in situ fluorescence labeling studies suggest that DNA-PK may be largely or at least partly responsible for the phosphorylation of histone H2AX, an event that occurs within minutes of irradiation (59). Localization of phosphorylated H2AX at putative DSB repair foci precedes the colocalization of Brca1, hRad51, and/or the hMre11-hRad50-NBS complex at the same foci, suggesting that H2AX may recruit these DSB repair factors to sites of multiple or difficult-to-repair breaks. Thus, DNA-PK holoenzyme may play a critical role in initiating a complex choreography that serves to optimize repair by assigning broken ends to specific repair pathways (60-62), some of which probably do not utilize Ku for end alignment. Indeed, a defect in DNA-PK activation rather than in end alignment could be the primary reason for the radiosensitivity of Ku-defective cells. The availability of a stringent reconstitution assay (Fig. 3A) may facilitate the identification of Ku mutants differentially defective in each of these two functions and thus allow assessment of their relative importance in DSB repair efficiency, repair fidelity, and radiosensitivity. The assay might also be useful in determining what domains and biochemical properties of Ku70 and Ku80 are required for particular steps in the alignment-based end joining pathway.

    ACKNOWLEDGEMENTS

We thank Malgorzata Zdzienicka for providing XR-C1 cells and Richard Moran for a critical reading of the manuscript.

    FOOTNOTES

* Supported by National Cancer Institute Grant CA40615 (to S. C., K. V. I., M. F. H., Y. Y., J. W. L., T. Z., and L. F. P.), by Wilhelm Sander Foundation for Cancer Research Grant 98.053.1/2 (to P. P. and E. F.), and by a fellowship of the Heisenberg program of the Deutsche Forschungsgemeinschaft (to P. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Virginia Commonwealth University, P. O. Box 980230, Richmond, VA 23298-0230. Tel.: 804-828-9640; Fax: 804-828-8079; E-mail: LPOVIRK@hsc.vcu.edu.

Published, JBC Papers in Press, April 17, 2001, DOI 10.1074/jbc.M010544200

2 S. P. Lees-Miller, unpublished results.

3 S. Chen and L. F. Povirk, unpublished results.

    ABBREVIATIONS

The abbreviations used are: DNA-PK, DNA-dependent protein kinase; DNA-PKcs, catalytic subunit of DNA-PK; DSB, double strand break; PG, phosphoglycolate; CHO, Chinese hamster ovary; DTT, dithiothreitol; bp, base pair(s).

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Chu, G. (1997) J. Biol. Chem. 272, 24097-24100
2. Lieber, M. R., Grawunder, U., Wu, X., and Yaneva, M. (1997) Curr. Opin. Genet. Dev. 7, 99-104
3. Lees-Miller, S. P. (1996) Biochem. Cell Biol. 74, 503-512
4. Jeggo, P. A. (1997) Mutat. Res. 384, 1-14
5. Yaneva, M., Kowalewski, T., and Lieber, M. R. (1997) EMBO J. 16, 5098-5112
6. Cary, R. B., Peterson, S. R., Wang, J., Bear, D. G., Bradbury, E. M., and Chen, D. J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 4267-4272
7. Pang, D., Yoo, S., Dynan, W. S., Jung, M., and Dritschilo, A. (1997) Cancer Res. 57, 1412-1415
8. Feldmann, E., Schmiemann, V., Goedecke, W., Reichenberger, S., and Pfeiffer, P. (2000) Nucleic Acids Res. 28, 2585-2596
9. Featherstone, C., and Jackson, S. P. (1999) Mutat. Res. 434, 3-15
10. Gu, X.-Y., Bennett, R. A. O., and Povirk, L. F. (1996) J. Biol. Chem. 271, 19660-19663
11. Chan, D. W., and Lees-Miller, S. P. (1996) J. Biol. Chem. 271, 8936-8941
12. Calsou, P., Frit, P., Humbert, O., Muller, C., Chen, D. J., and Salles, B. (1999) J. Biol. Chem. 274, 7848-7856
13. Smith, G. C., Divecha, N., Lakin, N. D., and Jackson, S. P. (1999) Biochem. Soc. Symp. 64, 91-104
14. Ward, J. F. (1988) Prog. Nucleic Acids Res. Mol. Biol. 35, 95-125
15. Hutchinson, F. (1985) Prog. Nucleic Acids Res. Mol. Biol. 32, 115-154
16. Obe, G., Johannes, C., and Schulte-Frohlinde, D. (1992) Mutagenesis 7, 3-12
17. Henner, W. D., Rodriguez, L. O., Hecht, S. M., and Haseltine, W. A. (1983) J. Biol. Chem. 258, 711-713
18. Errami, A., He, D. M., Friedl, A. A., Overkamp, W. J., Morolli, B., Hendrickson, E. A., Eckardt-Schupp, F., Oshimura, M., Lohman, P. H., Jackson, S. P., and Zdzienicka, M. Z. (1998) Nucleic Acids Res. 26, 3146-3153
19. Schaal, H., Pfeiffer, P., Klein, M., Gehrmann, P., and Scheid, A. (1993) Gene (Amst.) 124, 275-280
20. Daza, P., Reichenberger, S., Göttlich, B., Hagmann, M., Feldmann, E., and Pfeiffer, P. (1996) Biol. Chem. 377, 775-786
21. Baumann, P., and West, S. C. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14066-14070
22. Le Romancer, M., Cosulich, S. C., Jackson, S. P., and Clarke, P. R. (1996) J. Cell Sci. 109, 3121-3127
23. Bennett, R. A. O., Gu, X.-Y., and Povirk, L. F. (1996) Intl. J. Radiat. Biol. 70, 623-636
24. Chen, S., Hannis, J. C., Flora, J. W., Muddiman, D. C., Charles, K., Yu, Y., and Povirk, L. F. (2000) Anal. Biochem. 289, 274-280
25. Chan, D. W., Mody, C. H., Ting, N. S., and Lees-Miller, S. P. (1996) Biochem. Cell Biol. 74, 67-73
26. Pfeiffer, P., and Vielmetter, W. (1988) Nucleic Acids Res. 16, 907-924
27. Gu, X. Y., Weinfeld, M., and Povirk, L. F. (1998) Biochemistry 37, 9827-9835
28. Ward, J. F. (1981) Radiat. Res. 86, 185-195
29. Ramsden, D. A., and Gellert, M. (1998) EMBO J. 17, 609-614
30. Nick McElhinny, S. A., Snowden, C. M., McCarville, J., and Ramsden, D. A. (2000) Mol. Cell. Biol. 20, 2996-3003
31. Jeggo, P. A., and Kemp, L. M. (1983) Mutat. Res. 112, 313-327
32. Getts, C. G., and Stamato, T. D. (1994) J. Biol. Chem. 269, 15981-15984
33. Whitmore, G. F., Varghese, A. J., and Gulyas, S. (1989) Int. J. Radiat. Biol. 56, 657-665
34. Hartley, K. O., Gell, D., Smith, G. C. M., Zhang, H., Divecha, N., Connelly, M. A., Admon, A., Less-Miller, S. P., Anderson, C. W., and Jackson, S. P. (1995) Cell 82, 849-856
35. Roth, D. B., and Wilson, J. H. (1986) Mol. Cell. Biol. 6, 4295-4304
36. Thode, S., Schafer, A., Pfeiffer, P., and Vielmetter, W. (1990) Cell 60, 921-928
37. Pfeiffer, P., Thode, S., Hancke, J., and Vielmetter, W. (1994) Mol. Cell. Biol. 14, 888-895
38. Roth, D. B., and Wilson, J. H. (1988) in Genetic Recombination (Kucherlapati, R. , and Smith, G. R., eds) , pp. 621-653, American Society for Microbiology, Washington, D. C.
39. Meuth, M. (1989) in Mobile DNA (Berg, D. , and Howe, M., eds) , pp. 833-853, American Society for Microbiology, Washington, D. C.
40. Sutherland, B. M., Bennett, P. V., Sidorkina, O., and Laval, J. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 103-108
41. Dedon, P. C., and Goldberg, I. H. (1992) Chem. Res. Toxicol. 5, 311-332
42. Povirk, L. F. (1996) Mutat. Res. 355, 71-89
43. Suh, D., Wilson, D. M., III, and Povirk, L. F. (1997) Nucleic Acids Res. 25, 2495-2500
44. Chaudhry, M. A., Dedon, P. C., Wilson, D. M., Demple, B., and Weinfeld, M. (1999) Biochem. Pharmacol. 57, 531-538
45. Winters, T. A., Weinfeld, M., and Jorgensen, T. J. (1992) Nucleic Acids Res. 20, 2573-2580
46. Chen, D. S., Herman, T., and Demple, B. (1991) Nucleic Acids Res. 19, 5907-5914
47. Göttlich, B., Reichenberger, S., Feldmann, E., and Pfeiffer, P. (1998) Eur. J. Biochem. 258, 387-395
48. Paull, T. T., and Gellert, M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6409-6414
49. Walker, A. I., Hunt, T., Jackson, R. J., and Anderson, C. W. (1985) EMBO J. 4, 139-145
50. Anderson, C. W., and Lees-Miller, S. P. (1992) Crit. Rev. Eukaryotic Gene Expression 2, 283-314
51. Finnie, N. J., Gottlieb, T. M., Blunt, T., Jeggo, P. A., and Jackson, S. P. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 320-324
52. Labhart, P. (1999) Mol. Cell. Biol. 19, 2585-2593
53. Ting, N. S., Chan, D. W., Lintott, L. G., Allalunis-Turner, J., and Lees-Miller, S. P. (1999) Radiat. Res. 151, 414-422
54. Yoo, S., and Dynan, W. S. (1999) Nucleic Acids Res. 27, 4679-4686
55. West, R. B., Yaneva, M., and Lieber, M. R. (1998) Mol. Cell. Biol. 18, 5908-5920
56. Hammarsten, O., and Chu, G. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 525-530
57. Leuther, K. K., Hammarsten, O., Kornberg, R. D., and Chu, G. (1999) EMBO J. 18, 1114-1123
58. Chen, L., Trujillo, K., Sung, P., and Tomkinson, A. E. (2000) J. Biol. Chem. 275, 26196-26205
59. Paull, T. T., Rogakou, E. P., Yamazaki, V., Kirchgessner, C. U., Gellert, M., and Bonner, W. M. (2000) Curr. Biol. 10, 886-895
60. Petrini, J. H. (1999) Am. J. Hum. Genet. 64, 1264-1269
61. Nelms, B. E., Maser, R. S., MacKay, J. F., Lagally, M. G., and Petrini, J. H. (1998) Science 280, 590-592
62. Maser, R. S., Monsen, K. J., Nelms, B. E., and Petrini, J. H. (1997) Mol. Cell. Biol. 17, 6087-6096

Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
L. Liang, L. Deng, S. C. Nguyen, X. Zhao, C. D. Maulion, C. Shao, and J. A. Tischfield
Human DNA ligases I and III, but not ligase IV, are required for microhomology-mediated end joining of DNA double-strand breaks
Nucleic Acids Res., June 1, 2008; 36(10): 3297 - 3310.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. M. Yannone, I. S. Khan, R.-Z. Zhou, T. Zhou, K. Valerie, and L. F. Povirk
Coordinate 5' and 3' endonucleolytic trimming of terminally blocked blunt DNA double-strand break ends by Artemis nuclease and DNA-dependent protein kinase
Nucleic Acids Res., June 1, 2008; 36(10): 3354 - 3365.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
L. Schulte-Uentrop, R. A. El-Awady, L. Schliecker, H. Willers, and J. Dahm-Daphi
Distinct roles of XRCC4 and Ku80 in non-homologous end-joining of endonuclease- and ionizing radiation-induced DNA double-strand breaks
Nucleic Acids Res., May 1, 2008; 36(8): 2561 - 2569.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
R.-Z. Zhou, L. Blanco, M. Garcia-Diaz, K. Bebenek, T. A. Kunkel, and L. F. Povirk
Tolerance for 8-oxoguanine but not thymine glycol in alignment-based gap filling of partially complementary double-strand break ends by DNA polymerase {lambda} in human nuclear extracts
Nucleic Acids Res., May 1, 2008; 36(9): 2895 - 2905.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
P. Burton, D. J. McBride, J. M. Wilkes, J. D. Barry, and R. McCulloch
Ku Heterodimer-Independent End Joining in Trypanosoma brucei Cell Extracts Relies upon Sequence Microhomology
Eukaryot. Cell, October 1, 2007; 6(10): 1773 - 1781.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
L. F. Povirk, R.-Z. Zhou, D. A. Ramsden, S. P. Lees-Miller, and K. Valerie
Phosphorylation in the serine/threonine 2609-2647 cluster promotes but is not essential for DNA-dependent protein kinase-mediated nonhomologous end joining in human whole-cell extracts
Nucleic Acids Res., June 9, 2007; 35(12): 3869 - 3878.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Nabatiyan, D. Szuts, and T. Krude
Induction of CAF-1 Expression in Response to DNA Strand Breaks in Quiescent Human Cells.
Mol. Cell. Biol., March 1, 2006; 26(5): 1839 - 1849.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. Liang, L. Deng, Y. Chen, G. C. Li, C. Shao, and J. A. Tischfield
Modulation of DNA End Joining by Nuclear Proteins
J. Biol. Chem., September 9, 2005; 280(36): 31442 - 31449.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
H. Wang, B. Rosidi, R. Perrault, M. Wang, L. Zhang, F. Windhofer, and G. Iliakis
DNA Ligase III as a Candidate Component of Backup Pathways of Nonhomologous End Joining
Cancer Res., May 15, 2005; 65(10): 4020 - 4030.
[Abstract] [Full Text] [PDF]