JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M101162200 on April 19, 2001

J. Biol. Chem., Vol. 276, Issue 27, 24466-24472, July 6, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/27/24466    most recent
M101162200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kang, Q.
Right arrow Articles by Zolkiewska, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, Q.
Right arrow Articles by Zolkiewska, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Direct Interaction between the Cytoplasmic Tail of ADAM 12 and the Src Homology 3 Domain of p85alpha Activates Phosphatidylinositol 3-Kinase in C2C12 Cells*

Qing Kang, Yi Cao, and Anna ZolkiewskaDagger

From the Department of Biochemistry, Kansas Sate University, Manhattan, Kansas 66506

Received for publication, February 6, 2001, and in revised form, March 30, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

ADAM 12, a member of the ADAM family of transmembrane metalloprotease-disintegrins, has been implicated previously in the differentiation of skeletal myoblasts. In the present study, we show that the cytoplasmic tail of mouse ADAM 12 interacts in vitro and in vivo with the Src homology 3 domain of the p85alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase. By site-directed mutagenesis, we have identified three p85alpha -binding sites in ADAM 12 involving PXXP motifs located at amino acids 825-828, 833-836, and 884-887. Using green fluorescent protein (GFP)-pleckstrin homology (PH) domain fusion protein as a probe for PI 3-kinase lipid products, we have further demonstrated that expression of ADAM 12 in C2C12 cells resulted in translocation of GFP-PH to the plasma membrane. This suggests that transmembrane ADAM 12, by providing docking sites for the Src homology 3 domain of p85alpha , activates PI 3-kinase by mediating its recruitment to the membrane. Because PI 3-kinase is critical for terminal differentiation of myoblasts, and because expression of ADAM 12 is up-regulated at the onset of the differentiation process, ADAM 12-mediated activation may constitute one of the regulatory mechanisms for PI 3-kinase during myoblast differentiation.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

ADAMs1 (proteins containing a disintegrin and metalloprotease) are a family of transmembrane or secreted glycoproteins that have been implicated in cell surface proteolysis, adhesion, and cell-cell communication (1-3). A typical ADAM protein contains an N-terminal pro-domain, a metalloprotease domain, a disintegrin-like domain, a cysteine-rich region, and usually an EGF-like repeat, a single transmembrane domain, and a cytoplasmic tail. ADAM 12 has been implicated in differentiation of skeletal muscle precursor cells (myoblasts) in vitro (4) and in vivo (5-8). ADAM 12 expression has been shown to be dramatically up-regulated during embryonic muscle development (6) and in regeneration of adult muscle following injury (7, 8). The extracellular portion of ADAM 12 contains a zinc-dependent metalloprotease (9) that is negatively regulated by the presence of the pro-domain (10). The cysteine-rich domain (11, 12), disintegrin-like domain (13), or the two domains together (14) have been demonstrated to mediate cell-cell adhesion and communication. The intracellular domain of ADAM 12 has recently been shown to interact with actin cytoskeleton via alpha -actinin-2 (7) and alpha -actinin-1.2 Moreover, the cytoplasmic tail of ADAM 12 contains several Src homology 3 (SH3) binding motifs, and therefore it has been anticipated to interact with SH3 domain-containing proteins. Indeed, it has been recently demonstrated that ADAM 12 binds to the SH3 domain of non-receptor protein kinase Src (15, 16) and to an adaptor protein, Grb2 (15). Moreover, interaction with ADAM 12 led to stimulation of the enzymatic activity of Src (16).

Phosphatidylinositol 3-kinase (PI 3-kinase) is essential for terminal differentiation of skeletal muscle cells. Two specific and structurally unrelated inhibitors of PI 3-kinase, LY294002 and wortmannin, block myoblast exit from the cell cycle, inhibit expression of muscle specific genes, and abolish the capacity of myoblasts to form myotubes (17, 18). Expression of dominant-negative mutants of PI 3-kinase inhibits myoblast fusion and biochemical differentiation (18, 19). Moreover, expression of a constitutively active form of PI 3-kinase encoded by a viral oncogene, v-p3k, strongly enhances differentiation and fusion of cultured myoblasts, suggesting that the cellular PI 3-kinase constitutes a rate-limiting step of myogenesis in vitro (18). Insulin growth factors, the well known inducers of myogenic differentiation (20-22) and potent stimulators of myoblast survival (23), have recently been shown to exert their function through activation of the PI 3-kinase-dependent signaling pathways (24, 25). Finally, NF-kappa B and nitric-oxide synthase, identified as downstream effectors of PI 3-kinase in myoblasts, were shown to be critical for myogenic differentiation (26).

Based on their structures, lipid specificity, and modes of regulation, PI 3-kinases can be divided into three classes (27-29). Class I enzymes are heterodimers composed of an ~110-kDa catalytic subunit and a regulatory subunit. Class I can be further divided into subclasses IA and IB, which are regulated by tyrosine kinases and G protein-coupled receptors, respectively. Each of the class IA regulatory subunits contains two SH2 domains that bind to phosphotyrosine residues in activated tyrosine kinase receptors or adaptor proteins and play critical roles in translocation of the cytosolic PI 3-kinases to the plasma membrane. In addition, two of the class IA regulatory subunits, p85alpha and p85beta , contain a single SH3 domain. Importantly, a p85alpha -associated PI 3-kinase appears to be indispensable for myogenesis (18, 19).

In the present study, we show that the cytoplasmic tail of ADAM 12 interacts with the SH3 domain of the p85alpha regulatory subunit of PI 3-kinase in vitro and in vivo. By site-directed mutagenesis, we mapped the p85alpha -binding sites to three different regions in ADAM 12 cytoplasmic tail. Using green fluorescent protein-pleckstrin homology (GFP-PH) domain fusion protein as a probe for PI 3-kinase lipid products in the plasma membrane of intact cells, we further demonstrate that the expression of ADAM 12 in C2C12 cells leads to activation of PI 3-kinase. Therefore, interaction of the SH3 domain of p85alpha with the cytoplasmic domain of ADAM 12 could be a novel mechanism of activation of PI 3-kinase in myoblasts.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Antibodies-- Anti-ADAM 12 antibody has been described previously (16). Mouse monoclonal and rabbit polyclonal anti-p85alpha antibodies were purchased from Transduction Laboratories (Lexington, KY) and Upstate Biotechnology (Lake Placid, NY), respectively.

Expression Constructs-- Bacterial expression constructs encoding GST-P1-5, -P1-4, -P3-5, -P12, -P5, calmodulin-binding peptide (CBP)-tagged P1-5, and the cytoplasmic tail of integrin beta 1A were described previously (16). DNA fragments encoding the P34 region of ADAM 12 (aa 846-870) and the SH3 domain of mouse p85alpha (aa 1-86) were amplified by polymerase chain reaction (PCR) using mouse skeletal muscle cDNA (CLONTECH, Palo alto, CA) as template, Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA), and appropriate sets of primers. PCR products were cloned into the pGEX-2T vector (Amersham Pharmacia Biotech) between the BamHI and EcoRI sites for expression of glutathione S-transferase (GST) fusion proteins in Eschrichia coli. The construction of the full-length ADAM 12 plasmid and ADAM 12-(Delta 1-424), which encodes a truncated form of mouse ADAM 12 (aa 425-903) lacking the pro- and metalloprotease domains and containing an exogenous Igkappa secretion signal, has been described previously (16). To engineer a membrane-targeted ADAM 12 cytoplasmic tail, a myristoylation motif corresponding to the first 7 amino acids of mouse c-Src (ATGGGCAGCAACAAGAGCAAG) was added in-frame to the 5'-end of the DNA fragment encoding the ADAM 12 cytoplasmic tail (aa 732-903). The amplification product was cloned into the pIRESpuro vector (CLONTECH) between the NotI and ClaI sites. The PH domain of mouse ARNO, comprising amino acids 262-400, was amplified using primers 5'-CTCGCTGGATCCCGAGAGGGCTGGCTCCTAAA-3' and 5'-CTCGCTGAATTCTCAGGGTTGTTCTTGCTTCT-3' and mouse skeletal muscle cDNA as template. The PCR product was cloned into the pEGFP-C1 vector (CLONTECH) between the BglII and EcoRI sites.

Cell Culture and Transfections-- C2C12 and COS-7 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 2 mM glutamine at 37 °C in the presence of 5% CO2 under humidified atmosphere. Transfection of C2C12 cells (5 × 105 cells/100-mm plate) or COS-7 cells (2 × 106 cells/100-mm plate) was performed using LipofectAMINE Plus (Life Technologies, Inc.) according to the manufacturer's instructions. Expression of the recombinant proteins was analyzed 38 h after transfection.

Mutagenesis-- Site-directed mutagenesis was performed to introduce alanine substitutions for Pro825, Pro828, Pro833, Pro836, Pro884, or Pro887 of ADAM 12. Mutants were generated by annealing mutagenic primers to a double-stranded plasmid containing ADAM 12-(Delta 1-424) insert. Pfx Platinum DNA polymerase (Life Technologies, Inc.) was used during PCR to extend the appropriate mutagenic primers. PCR products were digested twice with DpnI (Promega, Madison, WI) and then transformed into E. coli XL1 Epicurian-Blue Supercompetent cells (Stratagene). Plasmids were purified using the EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA). The identity of all of the mutants was verified by DNA sequencing (Iowa State University, Ames, Iowa).

Protein Expression and Purification-- All of the GST fusion proteins and CBP-tagged proteins were expressed as soluble forms and purified on glutathione-Sepharose columns (Amersham Pharmacia Biotech) or calmodulin affinity resin (Stratagene), respectively, according to the manufacturers' instructions.

Protein Binding under Native Conditions-- Binding of CBP-P1-5 or CBP-beta 1A to GST-SH3 or GST was examined as described earlier (16). To study the interaction of the endogenous p85alpha with ADAM 12 cytoplasmic tail, C2C12 cells were lysed with buffer A (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% (v/v) Triton X-100, 1 mM 4-(2-aminoethyl)-benzenesulfonylfluoride hydrochloride (AEBSF), 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 10 µg/ml pepstatin A) using 2 ml buffer/100-mm plate. The cell extract was subjected to centrifugation (15,000 × g, 20 min), and the supernatant was incubated with glutathione-Sepharose (50 µl/ml lysate) for 1 h. Pre-cleared cell lysate (6 ml) was applied onto columns (0.2 ml bed volume) containing GST fusion proteins (0.6 mg). The columns were washed with buffer B (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 1% Triton X-100) and eluted with buffer containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 20 mM glutathione, and 0.1% Triton X-100 (buffer C). To study the interaction of ADAM 12, ADAM 12-(Delta 1-424), and ADAM 12-(Delta 1-424) mutants with the SH3 domain of p85alpha , precleared lysate from transfected COS-7 (1 ml) was applied onto columns (0.1 ml of resin) containing GST-SH3 or GST (0.2 mg). The columns were washed with buffer B and eluted with buffer C.

Biotinylation of GST-SH3 and Blot Overlays-- Purified GST-SH3 was biotinylated using EZ-Link Sulfo-NHS-biotin (Pierce), according to the manufacturer's instructions. Briefly, after dialysis against DPBS buffer, GST-SH3 was incubated at a molar ratio of 1:20 with Sulfo-NHS-biotin on ice for 3 h. The biotinylated GST-SH3 was then dialyzed against DPBS overnight and stored at 4 °C until use. Purified GST-P1-5, -P1-4, -P3-5, -P12, -P34, and -P5 proteins (1-2 µg) were resolved in 14% SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was first incubated in blocking buffer (50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM EDTA, 1% Triton X-100, 2% (w/v) bovine serum albumin, and 0.1% (v/v) beta -mercaptoethanol) at room temperature for 1 h and then with biotinylated GST-SH3 in blocking buffer (2 µg protein/ml) for 16 h at 4 °C. The membrane was washed with buffer containing 50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1% Triton X-100, and 1% (w/v) I-Block (Tropix, Bedford, MA), followed by incubation with streptavidin-horseradish peroxidase (HRP, 1 µg/ml, Pierce).

Immunoprecipitation-- Transfected COS-7 cells were solubilized with buffer A (2 ml of buffer/100-mm plate). Cell extracts were subjected to centrifugation (15,000 × g, 20 min), and the supernatant (1 ml) was mixed with protein G-Sepharose (20 µl; Amersham Pharmacia Biotech) and incubated for 1 h at 4 °C (pre-clearing). After removal of protein G-Sepharose, the cell lysate was incubated with anti-ADAM 12 antibody (1.5 µg/ml lysate) or anti-p85alpha monoclonal antibody (2.5 µg/ml lysate) for 4 h at 4 °C and then with protein G-Sepharose (20 µl) for 30 min at 4 °C. The immunoprecipitates were washed four times with buffer B and eluted with SDS-gel loading buffer. Eluates were analyzed in 8% SDS-PAGE followed by immunoblotting first with anti-p85alpha polyclonal antibody or anti-ADAM 12 antibody and then with HRP-coupled secondary antibody.

Immunoblotting-- Protein samples were separated by 8% SDS-PAGE and transferred onto nitrocellulose membranes. The membranes were first washed in blocking buffer (DPBS, 3% (w/v) dry milk, and 0.3% (v/v) Tween 20) for 1 h and then incubated with blocking buffer supplemented with a primary antibody followed by a HRP-conjugated secondary antibody. The antigen-antibody complexes were visualized by chemiluminescent detection (SuperSignal West Pico, Pierce). The following concentrations of primary antibodies were used: polyclonal anti-ADAM 12 antibody, 0.3 µg/ml; monoclonal anti-p85alpha antibody, 0.25 µg/ml; polyclonal anti-p85alpha antibody, 1 µg/ml.

Immunostaining-- C2C12 cells were seeded on glass coverslips and transfected with expression vectors. Two days after transfection, cells were fixed with 3.7% paraformaldehyde in DPBS. After permeabilizing cells with 0.1% Triton X-100 in DPBS for 5 min, cells were incubated with anti-ADAM 12 antibody (1:500 dilution) for 1 h and then with rhodamine-conjugated anti-rabbit IgG antibody (1:500 dilution) for 30 min. The coverslips were rinsed with DPBS, mounted onto slides with 20 µl of 10% (w/v) Mowiol 4-88 (Calbiochem) in 25% glycerol, and viewed on a Zeiss LSM410 laser scanning confocal microscope. In the experiment in which PI 3-kinase inhibitors were used, 6 h before fixation, cells were treated with growth medium containing 1 µM wortmannin or 50 µM LY294002 (Calbiochem) dissolved in dimethyl sulfoxide (Me2SO). Control cells were treated with Me2SO only.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The minimal motifs required for binding to the Src homology 3 (SH3) domains have been determined as (R/K)XXPXXP (class I ligands, binding to SH3 domains in the N right-arrow C orientation) or PXXPX(R/K) (class II ligands, binding in the C right-arrow N orientation) (31, 32). The cytoplasmic domain of ADAM 12 contains three class I and two class II SH3 binding motifs that are conserved between mouse and human (Fig. 1, A and B).


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 1.   Localization of the SH3 binding motifs in the cytoplasmic domain of ADAM 12. A, alignment of the amino acid sequences of mouse and human ADAM 12 cytoplasmic domains. The positions of five potential SH3-binding sites are indicated. Sites 2, 4, and 5 contain the consensus sequence of class I ligands for SH3 domains ((R/K)XXPXXP), and sites 1 and 3 match the consensus sequence of class II SH3 ligands (PXXPX(R/K)). B, schematic representation of the constructs used in this study spanning different fragments of the cytoplasmic domain (CD) of mouse ADAM 12. The positions of the SH3-binding sites (1-5) are indicated by the symbol *.

To examine whether the SH3 binding motifs in ADAM 12 can mediate interaction with the p85alpha regulatory subunit of PI 3-kinase, we expressed and affinity-purified a fragment of mouse ADAM 12 that spans all five SH3 binding motifs, P1-5 (residues 794-903, Fig. 1B), and is fused to CBP. The SH3 domain of mouse p85alpha was expressed as a GST fusion protein and purified on glutathione affinity resin. As shown in Fig. 2, the GST-SH3 fusion protein bound directly to CBP-P1-5 but not to a control protein composed of CBP and the cytoplasmic domain of mouse integrin beta 1A.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2.   Direct interaction between the cytoplasmic domain of ADAM 12 and the SH3 domain of p85alpha . A, Coomassie Blue-stained gel containing purified GST-SH3 fusion protein (lane 1) and GST alone (lane 2). B, binding of the GST-SH3 fusion protein to the cytoplasmic domain of ADAM 12. The P1-5 fragment of ADAM 12 fused to calmodulin-binding peptide (CBP-P1-5, lanes 2 and 4) or the cytoplasmic domain of mouse integrin beta 1A fused to CBP (CBP-beta 1A, lanes 1 and 3) was immobilized on calmodulin affinity columns. Purified GST-SH3 (lanes 1 and 2) or GST protein (lanes 3 and 4) was loaded on the columns, the columns were washed and eluted with gel loading buffer, and the eluates were subjected to SDS-PAGE and Coomassie Blue staining.

Next, we investigated whether the full-length p85alpha protein and full-length ADAM 12 could participate in the binding. The GST-P1-5 fusion protein was immobilized on a glutathione column, and the lysate from C2C12 mouse myoblasts containing the endogenous p85alpha was passed through the column. As shown in Fig. 3A, p85alpha was retained on the GST-P1-5 but not on the GST column, demonstrating that the full-size p85alpha was capable of interaction with the cytoplasmic domain of ADAM 12. Similarly, the full-length ADAM 12 expressed in COS-7 cells was retained on the GST-SH3 but not on the GST column, consistent with the notion that the full-length transmembrane form of ADAM 12 bound to the SH3 domain of p85alpha (Fig. 3B). Moreover, a truncated form ADAM 12, ADAM 12-(Delta 1-424), lacking the N-terminal pro- and metalloprotease domains, containing an exogenous secretion signal, and corresponding to a biologically active form of ADAM 12 described previously (4, 16), bound equally well to GST-SH3 protein (Fig. 3B), suggesting that the pro- and metalloprotease domains are not required for binding. Multiple forms of recombinant ADAM 12 (ranging from ~115 to ~120 kDa; predicted molecular mass, 95 kDa) and ADAM 12-(Delta 1-424) (~60-70 kDa; predicted molecular mass, 52 kDa) were the result of the variable extent of protein glycosylation (14, 16).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 3.   Interaction between the cytoplasmic domain of ADAM 12 and the full-length p85alpha (A) and between the SH3 domain of p85alpha and the full-length ADAM 12 (B). A, the P1-5 fragment of ADAM 12 expressed as a GST fusion protein or GST alone was immobilized on glutathione affinity columns. C2C12 cell lysate (6 ml) was loaded on the columns, the columns were washed and eluted with glutathione-containing buffer (300 µl), and the eluates were subjected to SDS-PAGE and Western blotting with anti-p85alpha monoclonal antibody. Lane 1 contains 20 µl of the C2C12 cell lysate, and lanes 2 and 3 contain 20 µl of the column eluates. B, left, COS-7 cells were transfected with an expression vector encoding the full-length ADAM 12 (lane 1), ADAM 12 lacking the pro- and metalloprotease domains and containing an exogenous secretion signal (ADAM 12(Delta 1-424), lane 2), or with the same vector without insert (Control, lane 3). The lysate from transfected cells was subjected to SDS-PAGE and Western blotting with anti-ADAM 12 antibody. Right, The GST-SH3 fusion protein (lanes 1, 3, and 6) or GST alone (lanes 2, 4, and 6) was immobilized on glutathione affinity columns. The extract from ADAM 12-transfected (lanes 1 and 2), ADAM 12-(Delta 1-424)-transfected (lanes 3 and 4), or control cells (lanes 5 and 6) was passed through the columns, the columns were washed and eluted with glutathione-containing buffer, and the eluates were subjected to SDS-PAGE and Western blotting with anti-ADAM 12 antibody.

To gain insight into the localization of p85alpha -binding sites in ADAM 12, we expressed GST fusion proteins containing the following fragments of the ADAM 12 cytoplasmic domain: P1-4 (aa 794-870, spanning the first four SH3 binding motifs), P3-5 (aa 846-903, spanning SH3 binding motifs 3-5), P12 (aa 794-845, containing sites 1 and 2), P34 (aa 846-870, containing sites 3 and 4), and P5 (aa 871-903, containing site 5 only) (see Fig. 1B). The recombinant GST fusion proteins were purified, electrophoresed, transferred to a nitrocellulose membrane, and subjected to an overlay binding assay using purified, biotinylated GST-SH3 protein. As shown in Fig. 4, GST-SH3 bound to all ADAM 12 fragments except P34, suggesting the presence of at least two different binding sites located in the P12 and P5 regions, respectively.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Localization of the p85alpha SH3-binding sites in ADAM 12 cytoplasmic tail. A, Coomassie Blue-stained gel containing GST fusion proteins comprising different fragments of ADAM 12 cytoplasmic domain (lanes 1-6), or GST alone (lane 7). B, direct binding of GST-SH3 to ADAM 12 fragments. The GST fusion proteins containing ADAM 12 fragments (lanes 1-6) or GST alone (lane 7) were electrophoresed, transferred to a nitrocellulose membrane, and incubated with biotinylated GST-SH3 protein, followed by incubation with HRP-conjugated streptavidin and visualization by a chemiluminescence detection method.

To further determine which of the SH3 binding motifs was responsible for the interaction with p85alpha , we used site-directed mutagenesis to disable individual SH3-binding sites in ADAM 12. In each mutant, PXXP motifs, which constitute the core of SH3-binding sites, were replaced with sequences AXXA, leading to a full disruption of any potential interactions involving the mutated sites. Mutants M1, M2, and M5 had a single SH3-binding site disabled (1, 2, or 5, respectively). Double mutants M1M2, M1M5, and M2M5, had only one binding site that remained functional (site 5, 2, or 1, respectively). The triple mutant M1M2M5 had all three SH3-binding sites disabled. The sequences of the regions in ADAM 12 that were subjected to mutagenesis are shown in Fig. 5A.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5.   The effect of disruption of SH3-binding sites 1, 2, or 5 on the interaction of ADAM 12 with the SH3 domain of p85alpha . A, amino acid sequences of the wild type (WT) and mutated SH3-binding sites 1, 2, and 5 in ADAM 12 cytoplasmic domain. In each mutant, PXXP motifs constituting the core of the individual SH3-binding sites were replaced with the sequences AXXA. The alanine residues introduced in each mutant are shown in bold. B, expression of the wild type and mutant forms of ADAM 12-(Delta 1-424) in COS-7 cells. Cells were transfected with an expression vector encoding the wild type ADAM 12-(Delta 1-424) (WT) or ADAM 12-(Delta 1-424)-containing mutations disrupting individual SH3-binding sites. Cell lysates (20 µl of each) were subjected to SDS-PAGE and Western blotting with anti-ADAM 12 antibody. C, binding of the wild type and mutated forms of ADAM 12-(Delta 1-424) to the SH3 domain of p85alpha . GST-SH3 fusion protein or GST alone was immobilized on glutathione columns. Cell lysates (1 ml of each) from COS-7 cells transfected with the wild type ADAM 12-(Delta 1-424) or the mutants were loaded on the columns, which was followed by washing of the columns, elution with glutathione-containing buffer (0.2 ml), and analysis of the eluates (20 µl) by Western blotting with anti-ADAM 12 antibody.

COS-7 cells were transfected with a vector encoding ADAM 12-(Delta 1-424) or the same construct containing M1, M2, M5, M1M2, M1M5, M2M5, or M1M2M5 mutations, as described above. Expression of the recombinant proteins was analyzed by Western blotting using anti-ADAM 12 antibody. As shown in Fig. 5B, the mutations did not affect the stability of the recombinant proteins or the levels of protein expression. As shown further in Fig. 5C, the elimination of a single SH3-binding site in the M1, M2, or M5 mutants did not inhibit binding of ADAM 12-(Delta 1-424) to the SH3 domain of p85alpha . Moreover, simultaneous mutations in any two of the three SH3-binding sites did not abolish the binding. To efficiently inhibit the interaction between ADAM 12-(Delta 1-424) and the SH3 domain of p85alpha , it was necessary to eliminate all three SH3-binding sites.

To examine whether p85alpha and the cytoplasmic domain of ADAM 12 interact in vivo, C2C12 cells were transfected with a vector encoding ADAM 12-(Delta 1-424), ADAM 12-(Delta 1-424) triple mutant M1M2M5, or a vector without insert, followed by immunoprecipitation of ADAM 12-(Delta 1-424) or p85alpha and Western blot analysis of the co-imunoprecipitating proteins. The co-immunoprecipitation experiment employed the truncated rather than the full-length version of ADAM 12, because the truncated form, lacking the pro- and metalloprotease domains, is transported to the cell surface much more efficiently than the full-length protein (16, 33). As shown in Fig. 6, p85alpha was detected in the anti-ADAM 12 immunoprecipitate obtained from ADAM 12 (Delta 1-424)-transfected and not from cells transfected with ADAM 12-(Delta 1-424) mutant M1M2M5 or from control cells. Reciprocally, ADAM 12-(Delta 1-424) was co-immunoprecipitated with anti-p85alpha antibody, suggesting that the two proteins formed a complex in intact cells.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   Interaction between ADAM 12 (Delta 1-424) and p85alpha in intact cells. C2C12 cells were transfected with a vector encoding ADAM 12-(Delta 1-424), ADAM 12-(Delta 1-424) triple mutant M1M2M5, or with the same vector without insert (Control). A, the lysate from transfected cells was subjected to SDS-PAGE and Western blotting with anti-p85alpha polyclonal antibody (left) or anti-ADAM 12 antibody (right). B, co-immunoprecipitation of ADAM 12-(Delta 1-424) and p85alpha . The lysate from ADAM 12-(Delta 1-424) (lanes 1 and 2)-, ADAM 12-(Delta 1-424) mutant M1M2M5 (lanes 3 and 4)-, or vector (lanes 5 and 6)-transfected cells was incubated with (lanes 1, 3, and 5) or without (lanes 2, 4, and 6) anti-ADAM 12 antibody (top) or anti-p85alpha monoclonal antibody (bottom) followed by incubation with protein G-Sepharose. The anti-ADAM 12 immunoprecipitates were subjected to Western blotting with anti-p85alpha polyclonal antibody (top); the anti-p85alpha immunoprecipitates were analyzed by Western blotting with anti-ADAM 12 antibody (bottom).

Finally, we addressed the question of the effect of the interaction with ADAM 12 on PI 3-kinase activity. We reasoned that the interaction of p85alpha with the cytoplasmic domain of ADAM 12 could recruit PI 3-kinase to the plasma membrane, where the enzyme could get direct access to its lipid substrates. Because the occupancy of the SH3 domain of p85alpha with proline-rich ligands has not been reported to increase the specific activity of PI 3-kinase (27-29), we decided to measure the activation status of PI 3-kinase by monitoring the amount of PI 3-kinase lipid products in intact cells using a GFP-PH domain fusion protein as a probe. The PH domain in the fusion protein was derived from ARNO (Arf nucleotide binding site opener) and was previously shown to bind with a high affinity to PI(3,4,5)P3, one of the major products of PI 3-kinase (30), and to translocate from the cytoplasm to the plasma membrane in insulin-stimulated adipocytes (34). Co-transfection of C2C12 cells with ADAM 12-(Delta 1-424) and GFP-PH resulted in the accumulation of GFP-PH at the plasma membrane in the regions of strong ADAM 12-(Delta 1-424) staining (Fig. 7, A-D). Similarly, GFP-PH localized to the plasma membrane in cells that have been co-transfected with myristoylated, membrane-anchored cytoplasmic domain of ADAM 12 (Fig. 7, E and F). On the contrary, GFP-PH was poorly recruited to the plasma membrane in cells that were transfected with GFP-PH only (Fig. 7, G and H) or in cells co-transfected with GFP-PH and ADAM 12-(Delta 1-424) triple mutant M1M2M5, which was unable to bind to p85alpha (Fig. 7, I and J). Finally, incubation of ADAM 12-(Delta 1-424)- and GFP-PH-cotransfected cells with LY294002 (Fig. 7, K and L) or wortmannin (not shown), two specific inhibitors of PI 3-kinase, greatly diminished the amount of GFP-PH at the membrane. This indicated that the translocation of GFP-PH to the membrane was PI 3-kinase-dependent and was not a result of direct interaction between GFP-PH and ADAM 12. 


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 7.   Activation of PI 3-kinase by ADAM 12. C2C12 cells were co-transfected with expression vectors encoding ADAM 12-(Delta 1-424) and the pleckstrin homology domain of ARNO fused to GFP (A-D, K, and L), the myristoylated cytoplasmic domain of ADAM 12, and GFP-PH (E and F), GFP-PH alone (G and H), or ADAM 12-(Delta 1-424) triple mutant M1M2M5 and GFP-PH (I and J). In K and L, cells were incubated with the PI 3-kinase inhibitor LY294002. Transfected cells were stained with anti-ADAM 12 rabbit antibody and rhodamine-conjugated anti-rabbit IgG antibody (A, C, E, G, I, and K). GFP-PH was visualized by direct fluorescence microscopy (B, D, F, H, J, and L). Note the presence of GFP-PH at the plasma membrane in ADAM 12-(Delta 1-424)- or myristoylated cytoplasmic domain-transfected cells (arrows in B, D, and F) and the lack of such localization in cells transfected with GFP-PH only (H) or in cells transfected with mutant ADAM 12-(Delta 1-424) or incubated with LY294002 (arrowheads in J and L). M, Western blot analysis of the myristoylated cytoplasmic domain of ADAM 12 (myr-CD) and GFP-PH in C2C12 cells.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this work, we have demonstrated that the cytoplasmic domain of ADAM 12 interacts with the SH3 domain of p85alpha , a regulatory subunit of PI 3-kinase, both in vitro and in vivo. We have identified three p85alpha -binding sites in ADAM 12 involving PXXP motifs located at amino acids 825-828, 833-836, and 884-887. Site-directed mutagenesis established that any one of these sites is sufficient to mediate interaction with p85alpha in vitro. Moreover, there was very little synergy between the three sites, and the interaction with p85alpha of ADAM 12 containing three, two, or just one binding site intact was essentially the same. No single site seemed to be critical for the binding, as disruption of any of the three sites did not affect the interaction with p85alpha .

ADAM 12 is the first member of the ADAM family reported to interact with PI 3-kinase. Importantly, several other members of the family contain proline-rich sequences in their cytoplasmic domains and, potentially, they may interact with SH3-containg proteins, including p85alpha . It has to be stressed, however, that the presence of SH3 binding motifs does not necessarily warrant productive SH3-mediated protein-protein interactions. Specifically, although ADAM 12 contains five legitimate SH3 binding motifs, only three of them (motifs 1, 2, and 5) mediated interactions with p85alpha , and sites 3 and 4 were nonfunctional. Similarly, we have recently demonstrated that the interaction of ADAM 12 with the SH3 domain of protein tyrosine kinase Src required binding sites 1 or 2, whereas sites 3-5 were not active (16).

Activation of PI 3-kinase requires its translocation to the plasma membrane, where the enzyme is positioned in the proximity of its lipid substrates. The most common mechanism of the translocation to the membrane involves the interaction of SH2 domains in the regulatory subunit of PI 3-kinase with activated, tyrosine-phosphorylated growth factor receptors or adaptor molecules (27-29). In addition to mediating recruitment to the membrane, interaction of SH2 domains with phosphopeptides further increases the specific activity of the catalytic subunit of PI 3-kinase, leading to full activation of the enzyme (35, 36). It has to be stressed, however, that translocation to the plasma membrane alone is sufficient to activate PI 3-kinase, as demonstrated by targeting of the p110 catalytic subunit to the membrane by either N-terminal myristoylation or C-terminal farnesylation (37). These membrane-bound forms of p110 produced constitutively active PI 3-kinases and induced PI 3-kinase-dependent responses in the absence of growth factor stimulation. Transmembrane ADAM 12, by providing docking sites for the SH3 domain of p85alpha , could therefore play an important role in the activation of PI 3-kinase by directly recruiting it to the membrane. At the present moment, it is not clear whether other mechanisms contribute further to the activation of PI 3-kinase at the membrane. Nevertheless, because PI 3-kinase is critical for terminal differentiation of myoblasts (17-19), and because expression of ADAM 12 is dramatically up-regulated at the onset of myoblast differentiation (4, 6, 8), ADAM 12-mediated recruitment to the membrane may constitute one of the regulatory mechanisms for PI 3-kinase during the differentiation process.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant AR45787. This is contribution 01-316-J from the Kansas Agricultural Experimental Station.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Biochemistry, Kansas State University, 104 Willard Hall, Manhattan, KS 66506. Tel.: 785-532-3082; Fax: 785-532-7278; E-mail: zolkiea@ksu.edu.

Published, JBC Papers in Press, April 19, 2001, DOI 10.1074/jbc.M101162200

2 Y. Cao and A. Zolkiewska, unpublished observation.

    ABBREVIATIONS

The abbreviations used are: ADAM, protein containing a disintegrin and metalloprotease; aa, amino acid; ARNO, Arf nucleotide binding site opener; SH3, Src homology 3 domain; SH2, Src homology 2 domain; GST, glutathione-S-transferase; CBP, calmodulin-binding peptide; GFP, green fluorescent protein; PH, pleckstrin homology domain; DPBS, Dulbecco's phosphate-buffered saline; GST, glutathione S-transferase; HRP, horseradish peroxidase; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Black, R. A., and White, J. M. (1998) Curr. Opin. Cell Biol. 10, 564-659
2. Schlöndorff, J., and Blobel, C. P. (1999) J. Cell Sci. 112, 3603-3617
3. Stone, A. L., Kroeger, M., and Sang, Q. X. A. (1999) J. Protein Chem. 18, 447-465
4. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y., and Fujisawa-Sehara, A. (1995) Nature 377, 652-656
5. Gilpin, B. J., Loechel, F., Mattei, M.-G., Engvall, E., Albrechtsen, R., and Wewer, U. M. (1998) J. Biol. Chem. 273, 157-166
6. Kurisaki, T., Masud, A., Osumi, N., Nabeshima, Y., and Fujisawa-Sehara, A. (1998) Mech. Dev. 73, 211-215
7. Galliano, M. F., Huet, C., Frygelius, J., Polgren, A., Wewer, U. M., and Engvall, E. (2000) J. Biol. Chem. 275, 13933-13939
8. Bornemann, A., Kuschel, R., and Fujisawa-Sehara, A. (2000) J. Muscle Res. Cell Motil. 21, 475-480
9. Loechel, F., Gilpin, B. J., Engvall, E., Albrechtsen, R., and Wewer, U. M. (1998) J. Biol. Chem. 273, 16993-169997
10. Loechel, F., Overgaard, M. T., Oxvig, C., Albrechtsen, R., and Wewer, U. M. (1999) J. Biol. Chem. 274, 13427-13433
11. Iba, K., Albrechtsen, R., Gilpin, B. J., Loechel, F., and Wewer, U. M. (1999) Am J. Pathol. 154, 1489-1501
12. Iba, K., Albrechtsen, R., Gilpin, B., Fröhlich, C., Loechel, F., Zolkiewska, A., Ishihuro, K., Kojima, T., Liu, W., Langford, J. K., Sanderson, R. D., Brakebusch, C., Fässler, R., and Wewer, U. M. (2000) J. Cell Biol. 149, 1143-1155
13. Eto, K., Puzon-McLaughlin, W., Sheppard, D., Sehara-Fujisawa, A., Zhang, X. P., and Takada, Y. (2000) J. Biol. Chem. 275, 34922-34930
14. Zolkiewska, A. (1999) Exp. Cell Res. 252, 423-431
15. Suzuki, A., Kadota, N., Hara, T., Nakagami, Y., Izumi, T., Takenawa, T, Sabe, H., and Endo, T. (2000) Oncogene 19, 5842-5850
16. Kang, Q., Cao, Y., and Zolkiewska, A. (2000) Biochem. J. 352, 883-892
17. Kaliman, P., Viñals, F., Testar, X., Palacin, M., and Zorzano, A. (1996) J. Biol. Chem. 271, 19146-19151
18. Jiang, B.-H., Zheng, J. Z., and Vogt, P. K. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14179-14183
19. Kaliman, P., Canicio, J., Shepherd, P. R., Beeton, C. A., Testar, X., Palacin, M., and Zorzano, A. (1998) Mol Endocrinol. 12, 66-77
20. Florini, J. R., Ewton, D. Z., and Coolican, S. A. (1996) Endocr. Rev. 17, 481-517
21. Florini, J. R., Magri, K. A., Ewton, D. Z., James, P. L., Grindstaff, K., and Rotwein, P. S. (1991) J. Biol. Chem. 266, 15917-15923
22. Engert, J. C., Berglund, E. B., and Rosenthal, N. (1996) J. Cell Biol. 135, 431-440
23. Stewart, C. E., and Rotwein, P. (1996) J. Biol. Chem. 271, 11330-11338
24. Lawlor, M. A., Peng, X., Everding, D. R., Sieger, K., Stewart, C. E. H., and Rotwein, P. (2000) Mol. Cell. Biol. 20, 3256-3265
25. Lawlor, M. A., and Rotwein, P. (2000) J. Cell Biol. 151, 1131-1140
26. Kaliman, P., Canicio, J., Testar, X., Palacin, M., and Zorzano, A. (1999) J. Biol. Chem. 274, 17437-17444
27. Vanhaesebroeck, B., and Waterfield, M. D. (1999) Exp. Cell Res. 253, 239-254
28. Wymann, M. P., and Pirola, L. (1998) Biochim. Biophys. Acta 1436, 127-150
29. Fruman, D. A., Meyers, R. E., and Cantley, L. C. (1998) Annu. Rev. Biochem. 67, 481-507
30. Leevers, S. J., Vanhaesebroeck, B., and Waterfield, M. D. (1999) Curr. Opin. Cell Biol. 11, 219-225
31. Feng, S., Chen, J. K., Yu, H., Simon, J. A., and Schreiber, S. L. (1994) Science 266, 1241-1247
32. Rickles, R. J., Botfield, M. C., Zhou, X.-M., Henry, P. A., Brugge, J. S., and Zoller, M. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10909-10913
33. Hougaard, S., Loechel, F., Xu, X., Tajima, R., Albrechtsen, R., and Wewer, U. M. (2000) Biochem. Biophys. Res. Commun. 275, 261-267
34. Venkateswarlu, K., Oatey, P. B., Tavare, J. M., and Cullen, P. J. (1998) Curr. Biol. 8, 463-466
35. Holt, K. H., Olson, L., Moye-Rowley, W. S., and Pessin, J. E. (1994) Mol. Cell. Biol. 14, 42-49
36. Rordorf-Nikolic, T., Van Horn, D. J., Chen, D., White, M. F., and Backer, J. M. (1995) J. Biol. Chem. 270, 3662-3666
37. Klippel, A., Reinhard, C., Kavanaugh, W. M., Apell, G., Escobedo, M. A., and Williams, L. T. (1996) Mol. Cell. Biol. 16, 4117-4127


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol Cancer ResHome page
J. L. Zhong, Z. Poghosyan, C. J. Pennington, X. Scott, M. M. Handsley, A. Warn, J. Gavrilovic, K. Honert, A. Kruger, P. N. Span, et al.
Distinct Functions of Natural ADAM-15 Cytoplasmic Domain Variants in Human Mammary Carcinoma
Mol. Cancer Res., March 1, 2008; 6(3): 383 - 394.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Furuya, J. A. Hanover, and S.-y. Cheng
Activation of phosphatidylinositol 3-kinase signaling by a mutant thyroid hormone beta receptor
PNAS, February 7, 2006; 103(6): 1780 - 1785.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
P. Lafuste, C. Sonnet, B. Chazaud, P. A. Dreyfus, R. K. Gherardi, U. M. Wewer, and F.-J. Authier
ADAM12 and {alpha}9{beta}1 Integrin Are Instrumental in Human Myogenic Cell Differentiation
Mol. Biol. Cell, February 1, 2005; 16(2): 861 - 870.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
X. Cao, F. Kambe, L. C. Moeller, S. Refetoff, and H. Seo
Thyroid Hormone Induces Rapid Activation of Akt/Protein Kinase B-Mammalian Target of Rapamycin-p70S6K Cascade through Phosphatidylinositol 3-Kinase in Human Fibroblasts
Mol. Endocrinol., January 1, 2005; 19(1): 102 - 112.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Sundberg, C. K. Thodeti, M. Kveiborg, C. Larsson, P. Parker, R. Albrechtsen, and U. M. Wewer
Regulation of ADAM12 Cell-surface Expression by Protein Kinase C {epsilon}
J. Biol. Chem., December 3, 2004; 279(49): 51601 - 51611.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tanaka, D. Nanba, S. Mori, F. Shiba, H. Ishiguro, K. Yoshino, N. Matsuura, and S. Higashiyama
ADAM Binding Protein Eve-1 Is Required for Ectodomain Shedding of Epidermal Growth Factor Receptor Ligands
J. Biol. Chem., October 1, 2004; 279(40): 41950 - 41959.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. V. Bax, A. J. Messent, J. Tart, M. van Hoang, J. Kott, R. A. Maciewicz, and M. J. Humphries
Integrin {alpha}5{beta}1 and ADAM-17 Interact in Vitro and Co-localize in Migrating HeLa Cells
J. Biol. Chem., May 21, 2004; 279(21): 22377 - 22386.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Mori, M. Tanaka, D. Nanba, E. Nishiwaki, H. Ishiguro, S. Higashiyama, and N. Matsuura
PACSIN3 Binds ADAM12/Meltrin {alpha} and Up-regulates Ectodomain Shedding of Heparin-binding Epidermal Growth Factor-like Growth Factor
J. Biol. Chem., November 14, 2003; 278(46): 46029 - 46034.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Cao, Z. Zhao, J. Gruszczynska-Biegala, and A. Zolkiewska
Role of Metalloprotease Disintegrin ADAM12 in Determination of Quiescent Reserve Cells during Myogenic Differentiation In Vitro
Mol. Cell. Biol., October 1, 2003; 23(19): 6725 - 6738.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. L. Abram, D. F. Seals, I. Pass, D. Salinsky, L. Maurer, T. M. Roth, and S. A. Courtneidge
The Adaptor Protein Fish Associates with Members of the ADAMs Family and Localizes to Podosomes of Src-transformed Cells
J. Biol. Chem., May 2, 2003; 278(19): 16844 - 16851.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. F. Seals and S. A. Courtneidge
The ADAMs family of metalloproteases: multidomain proteins with multiple functions
Genes & Dev., January 1, 2003; 17(1): 7 - 30.
[Full Text] [PDF]


Home page
J. Cell Biol.Home page
K. M. Smith, A. Gaultier, H. Cousin, D. Alfandari, J. M. White, and D. W. DeSimone
The cysteine-rich domain regulates ADAM protease function in vivo
J. Cell Biol., December 9, 2002; 159(5): 893 - 902.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Cao, Q. Kang, Z. Zhao, and A. Zolkiewska
Intracellular Processing of Metalloprotease Disintegrin ADAM12
J. Biol. Chem., July 12, 2002; 277(29): 26403 - 26411.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Poghosyan, S. M. Robbins, M. D. Houslay, A. Webster, G. Murphy, and D. R. Edwards
Phosphorylation-dependent Interactions between ADAM15 Cytoplasmic Domain and Src Family Protein-tyrosine Kinases
J. Biol. Chem., February 8, 2002; 277(7): 4999 - 5007.
[Abstract] [Full Text] [PDF]