![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 27, 24466-24472, July 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry, Kansas Sate University,
Manhattan, Kansas 66506
Received for publication, February 6, 2001, and in revised form, March 30, 2001
ADAM 12, a member of the ADAM family of
transmembrane metalloprotease-disintegrins, has been implicated
previously in the differentiation of skeletal myoblasts. In the present
study, we show that the cytoplasmic tail of mouse ADAM 12 interacts
in vitro and in vivo with the Src homology
3 domain of the p85 ADAMs1 (proteins
containing a disintegrin and
metalloprotease) are a family of transmembrane or secreted
glycoproteins that have been implicated in cell surface proteolysis,
adhesion, and cell-cell communication (1-3). A typical ADAM protein
contains an N-terminal pro-domain, a metalloprotease domain, a
disintegrin-like domain, a cysteine-rich region, and usually an
EGF-like repeat, a single transmembrane domain, and a cytoplasmic tail.
ADAM 12 has been implicated in differentiation of skeletal muscle
precursor cells (myoblasts) in vitro (4) and in
vivo (5-8). ADAM 12 expression has been shown to be dramatically
up-regulated during embryonic muscle development (6) and in
regeneration of adult muscle following injury (7, 8). The extracellular
portion of ADAM 12 contains a zinc-dependent
metalloprotease (9) that is negatively regulated by the presence of the
pro-domain (10). The cysteine-rich domain (11, 12), disintegrin-like
domain (13), or the two domains together (14) have been demonstrated to
mediate cell-cell adhesion and communication. The intracellular domain
of ADAM 12 has recently been shown to interact with actin cytoskeleton
via Phosphatidylinositol 3-kinase (PI 3-kinase) is essential for terminal
differentiation of skeletal muscle cells. Two specific and structurally
unrelated inhibitors of PI 3-kinase, LY294002 and wortmannin, block
myoblast exit from the cell cycle, inhibit expression of muscle
specific genes, and abolish the capacity of myoblasts to form myotubes
(17, 18). Expression of dominant-negative mutants of PI 3-kinase
inhibits myoblast fusion and biochemical differentiation (18, 19).
Moreover, expression of a constitutively active form of PI 3-kinase
encoded by a viral oncogene, v-p3k, strongly enhances
differentiation and fusion of cultured myoblasts, suggesting that the
cellular PI 3-kinase constitutes a rate-limiting step of myogenesis
in vitro (18). Insulin growth factors, the well known
inducers of myogenic differentiation (20-22) and potent stimulators of
myoblast survival (23), have recently been shown to exert their
function through activation of the PI 3-kinase-dependent signaling pathways (24, 25). Finally, NF- Based on their structures, lipid specificity, and modes of regulation,
PI 3-kinases can be divided into three classes (27-29). Class I
enzymes are heterodimers composed of an ~110-kDa catalytic subunit
and a regulatory subunit. Class I can be further divided into
subclasses IA and IB, which are regulated by tyrosine kinases and G
protein-coupled receptors, respectively. Each of the class IA
regulatory subunits contains two SH2 domains that bind to
phosphotyrosine residues in activated tyrosine kinase receptors or
adaptor proteins and play critical roles in translocation of the
cytosolic PI 3-kinases to the plasma membrane. In addition, two of the
class IA regulatory subunits, p85 In the present study, we show that the cytoplasmic tail of ADAM 12 interacts with the SH3 domain of the p85 Antibodies--
Anti-ADAM 12 antibody has been described
previously (16). Mouse monoclonal and rabbit polyclonal anti-p85 Expression Constructs--
Bacterial expression constructs
encoding GST-P1-5, -P1-4, -P3-5, -P12, -P5, calmodulin-binding
peptide (CBP)-tagged P1-5, and the cytoplasmic tail of integrin
Cell Culture and Transfections--
C2C12 and COS-7 cells were
grown in Dulbecco's modified Eagle's medium supplemented with 10%
fetal bovine serum and 2 mM glutamine at 37 °C in the
presence of 5% CO2 under humidified atmosphere. Transfection of C2C12 cells (5 × 105 cells/100-mm
plate) or COS-7 cells (2 × 106 cells/100-mm plate)
was performed using LipofectAMINE Plus (Life Technologies, Inc.)
according to the manufacturer's instructions. Expression of the
recombinant proteins was analyzed 38 h after transfection.
Mutagenesis--
Site-directed mutagenesis was performed to
introduce alanine substitutions for Pro825,
Pro828, Pro833, Pro836,
Pro884, or Pro887 of ADAM 12. Mutants were
generated by annealing mutagenic primers to a double-stranded plasmid
containing ADAM 12-( Protein Expression and Purification--
All of the GST fusion
proteins and CBP-tagged proteins were expressed as soluble forms and
purified on glutathione-Sepharose columns (Amersham Pharmacia Biotech)
or calmodulin affinity resin (Stratagene), respectively, according to
the manufacturers' instructions.
Protein Binding under Native Conditions--
Binding of
CBP-P1-5 or CBP- Biotinylation of GST-SH3 and Blot Overlays--
Purified GST-SH3
was biotinylated using EZ-Link Sulfo-NHS-biotin (Pierce), according to
the manufacturer's instructions. Briefly, after dialysis against DPBS
buffer, GST-SH3 was incubated at a molar ratio of 1:20 with
Sulfo-NHS-biotin on ice for 3 h. The biotinylated GST-SH3 was then
dialyzed against DPBS overnight and stored at 4 °C until use.
Purified GST-P1-5, -P1-4, -P3-5, -P12, -P34, and -P5 proteins (1-2
µg) were resolved in 14% SDS-PAGE and transferred to a
nitrocellulose membrane. The membrane was first incubated in blocking
buffer (50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1 mM EDTA, 1% Triton X-100, 2% (w/v) bovine serum albumin, and 0.1% (v/v) Immunoprecipitation--
Transfected COS-7 cells were
solubilized with buffer A (2 ml of buffer/100-mm plate). Cell extracts
were subjected to centrifugation (15,000 × g, 20 min),
and the supernatant (1 ml) was mixed with protein G-Sepharose (20 µl;
Amersham Pharmacia Biotech) and incubated for 1 h at 4 °C
(pre-clearing). After removal of protein G-Sepharose, the cell lysate
was incubated with anti-ADAM 12 antibody (1.5 µg/ml lysate) or
anti-p85 Immunoblotting--
Protein samples were separated by 8%
SDS-PAGE and transferred onto nitrocellulose membranes. The
membranes were first washed in blocking buffer (DPBS, 3% (w/v) dry
milk, and 0.3% (v/v) Tween 20) for 1 h and then incubated with
blocking buffer supplemented with a primary antibody followed by a
HRP-conjugated secondary antibody. The antigen-antibody complexes were
visualized by chemiluminescent detection (SuperSignal West Pico,
Pierce). The following concentrations of primary antibodies were used:
polyclonal anti-ADAM 12 antibody, 0.3 µg/ml; monoclonal anti-p85 Immunostaining--
C2C12 cells were seeded on glass coverslips
and transfected with expression vectors. Two days after transfection,
cells were fixed with 3.7% paraformaldehyde in DPBS. After
permeabilizing cells with 0.1% Triton X-100 in DPBS for 5 min, cells
were incubated with anti-ADAM 12 antibody (1:500 dilution) for 1 h
and then with rhodamine-conjugated anti-rabbit IgG antibody (1:500
dilution) for 30 min. The coverslips were rinsed with DPBS, mounted
onto slides with 20 µl of 10% (w/v) Mowiol 4-88 (Calbiochem) in 25% glycerol, and viewed on a Zeiss LSM410 laser scanning confocal microscope. In the experiment in which PI 3-kinase inhibitors were
used, 6 h before fixation, cells were treated with growth medium
containing 1 µM wortmannin or 50 µM
LY294002 (Calbiochem) dissolved in dimethyl sulfoxide
(Me2SO). Control cells were treated with
Me2SO only.
The minimal motifs required for binding to the Src homology 3 (SH3) domains have been determined as
(R/K)XXPXXP (class I ligands, binding to
SH3 domains in the N To examine whether the SH3 binding motifs in ADAM 12 can mediate
interaction with the p85
Direct Interaction between the Cytoplasmic Tail of ADAM 12 and
the Src Homology 3 Domain of p85
Activates Phosphatidylinositol
3-Kinase in C2C12 Cells*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
regulatory subunit of
phosphatidylinositol (PI) 3-kinase. By site-directed mutagenesis, we
have identified three p85
-binding sites in ADAM 12 involving
PXXP motifs located at amino acids 825-828, 833-836, and
884-887. Using green fluorescent protein (GFP)-pleckstrin homology
(PH) domain fusion protein as a probe for PI 3-kinase lipid products,
we have further demonstrated that expression of ADAM 12 in C2C12 cells
resulted in translocation of GFP-PH to the plasma membrane. This
suggests that transmembrane ADAM 12, by providing docking sites for the
Src homology 3 domain of p85
, activates PI 3-kinase by mediating its
recruitment to the membrane. Because PI 3-kinase is critical for
terminal differentiation of myoblasts, and because expression of ADAM
12 is up-regulated at the onset of the differentiation process, ADAM
12-mediated activation may constitute one of the regulatory mechanisms
for PI 3-kinase during myoblast differentiation.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-actinin-2 (7) and
-actinin-1.2 Moreover, the
cytoplasmic tail of ADAM 12 contains several Src homology 3 (SH3)
binding motifs, and therefore it has been anticipated to interact with
SH3 domain-containing proteins. Indeed, it has been recently
demonstrated that ADAM 12 binds to the SH3 domain of non-receptor
protein kinase Src (15, 16) and to an adaptor protein, Grb2 (15).
Moreover, interaction with ADAM 12 led to stimulation of the enzymatic
activity of Src (16).
B and nitric-oxide synthase, identified as downstream effectors of PI 3-kinase in myoblasts, were shown to be critical for myogenic differentiation (26).
and p85
, contain a single SH3
domain. Importantly, a p85
-associated PI 3-kinase appears to be
indispensable for myogenesis (18, 19).
regulatory subunit of PI
3-kinase in vitro and in vivo. By site-directed
mutagenesis, we mapped the p85
-binding sites to three different
regions in ADAM 12 cytoplasmic tail. Using green fluorescent
protein-pleckstrin homology (GFP-PH) domain fusion protein as a probe
for PI 3-kinase lipid products in the plasma membrane of intact cells,
we further demonstrate that the expression of ADAM 12 in C2C12 cells
leads to activation of PI 3-kinase. Therefore, interaction of the SH3 domain of p85
with the cytoplasmic domain of ADAM 12 could be a
novel mechanism of activation of PI 3-kinase in myoblasts.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
antibodies were purchased from Transduction Laboratories (Lexington,
KY) and Upstate Biotechnology (Lake Placid, NY), respectively.
1A were described previously (16). DNA fragments
encoding the P34 region of ADAM 12 (aa 846-870) and the SH3 domain of
mouse p85
(aa 1-86) were amplified by polymerase chain reaction
(PCR) using mouse skeletal muscle cDNA
(CLONTECH, Palo alto, CA) as template,
Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA), and
appropriate sets of primers. PCR products were cloned into the pGEX-2T
vector (Amersham Pharmacia Biotech) between the BamHI
and EcoRI sites for expression of glutathione
S-transferase (GST) fusion proteins in Eschrichia
coli. The construction of the full-length ADAM 12 plasmid and ADAM
12-(
1-424), which encodes a truncated form of mouse ADAM 12 (aa 425-903) lacking the pro- and metalloprotease domains and
containing an exogenous Ig
secretion signal, has been described
previously (16). To engineer a membrane-targeted ADAM 12 cytoplasmic
tail, a myristoylation motif corresponding to the first 7 amino acids
of mouse c-Src (ATGGGCAGCAACAAGAGCAAG) was added in-frame to the 5'-end
of the DNA fragment encoding the ADAM 12 cytoplasmic tail (aa
732-903). The amplification product was cloned into the pIRESpuro
vector (CLONTECH) between the NotI and
ClaI sites. The PH domain of mouse ARNO, comprising amino acids 262-400, was amplified using primers
5'-CTCGCTGGATCCCGAGAGGGCTGGCTCCTAAA-3' and
5'-CTCGCTGAATTCTCAGGGTTGTTCTTGCTTCT-3' and mouse skeletal muscle
cDNA as template. The PCR product was cloned into the pEGFP-C1 vector (CLONTECH) between the BglII and
EcoRI sites.
1-424) insert. Pfx Platinum DNA
polymerase (Life Technologies, Inc.) was used during PCR to extend the
appropriate mutagenic primers. PCR products were digested twice with
DpnI (Promega, Madison, WI) and then transformed into
E. coli XL1 Epicurian-Blue Supercompetent cells (Stratagene). Plasmids were purified using the EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA). The identity of all of the mutants was
verified by DNA sequencing (Iowa State University, Ames, Iowa).
1A to GST-SH3 or GST was examined as
described earlier (16). To study the interaction of the endogenous
p85
with ADAM 12 cytoplasmic tail, C2C12 cells were lysed with
buffer A (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% (v/v) Triton X-100, 1 mM
4-(2-aminoethyl)-benzenesulfonylfluoride hydrochloride (AEBSF), 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 10 µg/ml pepstatin A)
using 2 ml buffer/100-mm plate. The cell extract was subjected to
centrifugation (15,000 × g, 20 min), and the
supernatant was incubated with glutathione-Sepharose (50 µl/ml
lysate) for 1 h. Pre-cleared cell lysate (6 ml) was applied onto
columns (0.2 ml bed volume) containing GST fusion proteins (0.6 mg).
The columns were washed with buffer B (50 mM
Tris-HCl (pH 7.4), 150 mM NaCl, and 1% Triton X-100) and
eluted with buffer containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 20 mM glutathione, and 0.1% Triton
X-100 (buffer C). To study the interaction of ADAM 12, ADAM
12-(
1-424), and ADAM 12-(
1-424) mutants with the SH3 domain of
p85
, precleared lysate from transfected COS-7 (1 ml) was applied
onto columns (0.1 ml of resin) containing GST-SH3 or GST (0.2 mg). The
columns were washed with buffer B and eluted with buffer C.
-mercaptoethanol) at room temperature for 1 h and then with biotinylated GST-SH3 in blocking buffer (2 µg
protein/ml) for 16 h at 4 °C. The membrane was washed with
buffer containing 50 mM Tris-HCl (pH 8.0), 50 mM NaCl, 1% Triton X-100, and 1% (w/v) I-Block (Tropix,
Bedford, MA), followed by incubation with streptavidin-horseradish peroxidase (HRP, 1 µg/ml, Pierce).
monoclonal antibody (2.5 µg/ml lysate) for 4 h at
4 °C and then with protein G-Sepharose (20 µl) for 30 min at
4 °C. The immunoprecipitates were washed four times with buffer B
and eluted with SDS-gel loading buffer. Eluates were analyzed in 8%
SDS-PAGE followed by immunoblotting first with anti-p85
polyclonal
antibody or anti-ADAM 12 antibody and then with HRP-coupled secondary antibody.
antibody, 0.25 µg/ml; polyclonal anti-p85
antibody, 1 µg/ml.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
C orientation) or
PXXPX(R/K) (class II ligands, binding in the C
N orientation) (31, 32). The cytoplasmic domain of ADAM 12 contains
three class I and two class II SH3 binding motifs that are conserved
between mouse and human (Fig. 1,
A and B).

View larger version (33K):
[in a new window]
Fig. 1.
Localization of the SH3 binding motifs in the
cytoplasmic domain of ADAM 12. A, alignment of the
amino acid sequences of mouse and human ADAM 12 cytoplasmic domains.
The positions of five potential SH3-binding sites are indicated. Sites
2, 4, and 5 contain the consensus sequence of class I ligands for SH3
domains ((R/K)XXPXXP), and sites 1 and 3 match
the consensus sequence of class II SH3 ligands
(PXXPX(R/K)). B, schematic
representation of the constructs used in this study spanning different
fragments of the cytoplasmic domain (CD) of mouse ADAM 12. The positions of the SH3-binding sites (1-5) are indicated by the
symbol *.
regulatory subunit of PI 3-kinase, we
expressed and affinity-purified a fragment of mouse ADAM 12 that spans
all five SH3 binding motifs, P1-5 (residues 794-903, Fig.
1B), and is fused to CBP. The SH3 domain of mouse
p85
was expressed as a GST fusion protein and purified on
glutathione affinity resin. As shown in Fig.
2, the GST-SH3 fusion protein bound
directly to CBP-P1-5 but not to a control protein composed of CBP and
the cytoplasmic domain of mouse integrin
1A.

View larger version (11K):
[in a new window]
Fig. 2.
Direct interaction between the cytoplasmic
domain of ADAM 12 and the SH3 domain of
p85
. A, Coomassie Blue-stained
gel containing purified GST-SH3 fusion protein (lane 1) and
GST alone (lane 2). B, binding of the GST-SH3
fusion protein to the cytoplasmic domain of ADAM 12. The P1-5 fragment
of ADAM 12 fused to calmodulin-binding peptide (CBP-P1-5,
lanes 2 and 4) or the cytoplasmic domain of mouse
integrin
1A fused to CBP
(CBP-
1A, lanes 1 and 3)
was immobilized on calmodulin affinity columns. Purified GST-SH3
(lanes 1 and 2) or GST protein (lanes
3 and 4) was loaded on the columns, the columns were
washed and eluted with gel loading buffer, and the eluates were
subjected to SDS-PAGE and Coomassie Blue staining.
Next, we investigated whether the full-length p85
protein and
full-length ADAM 12 could participate in the binding. The GST-P1-5 fusion protein was immobilized on a glutathione column, and the lysate
from C2C12 mouse myoblasts containing the endogenous p85
was passed
through the column. As shown in Fig.
3A, p85
was retained on the
GST-P1-5 but not on the GST column, demonstrating that the full-size
p85
was capable of interaction with the cytoplasmic domain of ADAM
12. Similarly, the full-length ADAM 12 expressed in COS-7 cells was
retained on the GST-SH3 but not on the GST column, consistent with the
notion that the full-length transmembrane form of ADAM 12 bound to the
SH3 domain of p85
(Fig. 3B). Moreover, a truncated form
ADAM 12, ADAM 12-(
1-424), lacking the N-terminal pro- and
metalloprotease domains, containing an exogenous secretion signal, and
corresponding to a biologically active form of ADAM 12 described
previously (4, 16), bound equally well to GST-SH3 protein (Fig.
3B), suggesting that the pro- and metalloprotease domains
are not required for binding. Multiple forms of recombinant ADAM 12 (ranging from ~115 to ~120 kDa; predicted molecular mass, 95 kDa)
and ADAM 12-(
1-424) (~60-70 kDa; predicted molecular mass, 52 kDa) were the result of the variable extent of protein glycosylation
(14, 16).
|
To gain insight into the localization of p85
-binding sites in ADAM
12, we expressed GST fusion proteins containing the following fragments
of the ADAM 12 cytoplasmic domain: P1-4 (aa 794-870, spanning the
first four SH3 binding motifs), P3-5 (aa 846-903, spanning SH3
binding motifs 3-5), P12 (aa 794-845, containing sites 1 and 2), P34
(aa 846-870, containing sites 3 and 4), and P5 (aa 871-903,
containing site 5 only) (see Fig. 1B). The recombinant GST
fusion proteins were purified, electrophoresed, transferred to a
nitrocellulose membrane, and subjected to an overlay binding assay
using purified, biotinylated GST-SH3 protein. As shown in Fig.
4, GST-SH3 bound to all ADAM 12 fragments
except P34, suggesting the presence of at least two different binding
sites located in the P12 and P5 regions, respectively.
|
To further determine which of the SH3 binding motifs was responsible
for the interaction with p85
, we used site-directed mutagenesis to
disable individual SH3-binding sites in ADAM 12. In each mutant,
PXXP motifs, which constitute the core of SH3-binding sites,
were replaced with sequences AXXA, leading to a full
disruption of any potential interactions involving the mutated sites.
Mutants M1, M2, and M5 had a single SH3-binding site disabled (1, 2, or 5, respectively). Double mutants M1M2, M1M5, and M2M5, had only one
binding site that remained functional (site 5, 2, or 1, respectively). The triple mutant M1M2M5 had all three SH3-binding sites
disabled. The sequences of the regions in ADAM 12 that were subjected
to mutagenesis are shown in Fig.
5A.
|
COS-7 cells were transfected with a vector encoding ADAM 12-(
1-424)
or the same construct containing M1, M2, M5, M1M2, M1M5, M2M5, or
M1M2M5 mutations, as described above. Expression of the recombinant
proteins was analyzed by Western blotting using anti-ADAM 12 antibody.
As shown in Fig. 5B, the mutations did not affect the
stability of the recombinant proteins or the levels of protein expression. As shown further in Fig. 5C, the elimination of
a single SH3-binding site in the M1, M2, or M5 mutants did not inhibit binding of ADAM 12-(
1-424) to the SH3 domain of p85
. Moreover, simultaneous mutations in any two of the three SH3-binding sites did
not abolish the binding. To efficiently inhibit the interaction between
ADAM 12-(
1-424) and the SH3 domain of p85
, it was necessary to
eliminate all three SH3-binding sites.
To examine whether p85
and the cytoplasmic domain of ADAM 12 interact in vivo, C2C12 cells were transfected with a vector encoding ADAM 12-(
1-424), ADAM 12-(
1-424) triple mutant M1M2M5, or a vector without insert, followed by immunoprecipitation of ADAM
12-(
1-424) or p85
and Western blot analysis of the
co-imunoprecipitating proteins. The co-immunoprecipitation experiment
employed the truncated rather than the full-length version of ADAM 12, because the truncated form, lacking the pro- and metalloprotease
domains, is transported to the cell surface much more efficiently than
the full-length protein (16, 33). As shown in Fig.
6, p85
was detected in the anti-ADAM
12 immunoprecipitate obtained from ADAM 12 (
1-424)-transfected and
not from cells transfected with ADAM 12-(
1-424) mutant M1M2M5 or
from control cells. Reciprocally, ADAM 12-(
1-424) was
co-immunoprecipitated with anti-p85
antibody, suggesting that the
two proteins formed a complex in intact cells.
|
Finally, we addressed the question of the effect of the interaction
with ADAM 12 on PI 3-kinase activity. We reasoned that the interaction
of p85
with the cytoplasmic domain of ADAM 12 could recruit PI
3-kinase to the plasma membrane, where the enzyme could get direct
access to its lipid substrates. Because the occupancy of the SH3 domain
of p85
with proline-rich ligands has not been reported to increase
the specific activity of PI 3-kinase (27-29), we decided to measure
the activation status of PI 3-kinase by monitoring the amount of PI
3-kinase lipid products in intact cells using a GFP-PH domain fusion
protein as a probe. The PH domain in the fusion protein was derived
from ARNO (Arf nucleotide binding site opener) and was previously shown
to bind with a high affinity to PI(3,4,5)P3, one of the
major products of PI 3-kinase (30), and to translocate from the
cytoplasm to the plasma membrane in insulin-stimulated adipocytes (34).
Co-transfection of C2C12 cells with ADAM 12-(
1-424) and GFP-PH
resulted in the accumulation of GFP-PH at the plasma membrane in the
regions of strong ADAM 12-(
1-424) staining (Fig.
7, A-D). Similarly, GFP-PH
localized to the plasma membrane in cells that have been co-transfected with myristoylated, membrane-anchored cytoplasmic domain of ADAM 12 (Fig. 7, E and F). On the contrary, GFP-PH was
poorly recruited to the plasma membrane in cells that were transfected
with GFP-PH only (Fig. 7, G and H) or in cells
co-transfected with GFP-PH and ADAM 12-(
1-424) triple mutant
M1M2M5, which was unable to bind to p85
(Fig. 7, I and
J). Finally, incubation of ADAM 12-(
1-424)- and
GFP-PH-cotransfected cells with LY294002 (Fig. 7, K and
L) or wortmannin (not shown), two specific inhibitors of PI
3-kinase, greatly diminished the amount of GFP-PH at the membrane. This indicated that the translocation of GFP-PH to the membrane was PI
3-kinase-dependent and was not a result of direct
interaction between GFP-PH and ADAM 12.
|
| |
DISCUSSION |
|---|
|
|
|---|
In this work, we have demonstrated that the cytoplasmic domain of
ADAM 12 interacts with the SH3 domain of p85
, a regulatory subunit
of PI 3-kinase, both in vitro and in vivo. We
have identified three p85
-binding sites in ADAM 12 involving
PXXP motifs located at amino acids 825-828, 833-836, and
884-887. Site-directed mutagenesis established that any one of these
sites is sufficient to mediate interaction with p85
in
vitro. Moreover, there was very little synergy between the three
sites, and the interaction with p85
of ADAM 12 containing three,
two, or just one binding site intact was essentially the same. No
single site seemed to be critical for the binding, as disruption of any
of the three sites did not affect the interaction with p85
.
ADAM 12 is the first member of the ADAM family reported to interact
with PI 3-kinase. Importantly, several other members of the family
contain proline-rich sequences in their cytoplasmic domains and,
potentially, they may interact with SH3-containg proteins, including
p85
. It has to be stressed, however, that the presence of SH3
binding motifs does not necessarily warrant productive SH3-mediated
protein-protein interactions. Specifically, although ADAM 12 contains
five legitimate SH3 binding motifs, only three of them (motifs 1, 2, and 5) mediated interactions with p85
, and sites 3 and 4 were
nonfunctional. Similarly, we have recently demonstrated that the
interaction of ADAM 12 with the SH3 domain of protein tyrosine kinase
Src required binding sites 1 or 2, whereas sites 3-5 were not active
(16).
Activation of PI 3-kinase requires its translocation to the plasma
membrane, where the enzyme is positioned in the proximity of its lipid
substrates. The most common mechanism of the translocation to the
membrane involves the interaction of SH2 domains in the regulatory
subunit of PI 3-kinase with activated, tyrosine-phosphorylated growth
factor receptors or adaptor molecules (27-29). In addition to
mediating recruitment to the membrane, interaction of SH2 domains with
phosphopeptides further increases the specific activity of the
catalytic subunit of PI 3-kinase, leading to full activation of the
enzyme (35, 36). It has to be stressed, however, that translocation to
the plasma membrane alone is sufficient to activate PI 3-kinase, as
demonstrated by targeting of the p110 catalytic subunit to the membrane
by either N-terminal myristoylation or C-terminal farnesylation (37).
These membrane-bound forms of p110 produced constitutively active PI
3-kinases and induced PI 3-kinase-dependent responses in
the absence of growth factor stimulation. Transmembrane ADAM 12, by
providing docking sites for the SH3 domain of p85
, could therefore
play an important role in the activation of PI 3-kinase by directly
recruiting it to the membrane. At the present moment, it is not clear
whether other mechanisms contribute further to the activation of PI
3-kinase at the membrane. Nevertheless, because PI 3-kinase is critical
for terminal differentiation of myoblasts (17-19), and because
expression of ADAM 12 is dramatically up-regulated at the onset of
myoblast differentiation (4, 6, 8), ADAM 12-mediated recruitment to the
membrane may constitute one of the regulatory mechanisms for PI
3-kinase during the differentiation process.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant AR45787. This is contribution 01-316-J from the Kansas Agricultural Experimental Station.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biochemistry,
Kansas State University, 104 Willard Hall, Manhattan, KS 66506. Tel.:
785-532-3082; Fax: 785-532-7278; E-mail: zolkiea@ksu.edu.
Published, JBC Papers in Press, April 19, 2001, DOI 10.1074/jbc.M101162200
2 Y. Cao and A. Zolkiewska, unpublished observation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: ADAM, protein containing a disintegrin and metalloprotease; aa, amino acid; ARNO, Arf nucleotide binding site opener; SH3, Src homology 3 domain; SH2, Src homology 2 domain; GST, glutathione-S-transferase; CBP, calmodulin-binding peptide; GFP, green fluorescent protein; PH, pleckstrin homology domain; DPBS, Dulbecco's phosphate-buffered saline; GST, glutathione S-transferase; HRP, horseradish peroxidase; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Black, R. A., and White, J. M. (1998) Curr. Opin. Cell Biol. 10, 564-659 |
| 2. | Schlöndorff, J., and Blobel, C. P. (1999) J. Cell Sci. 112, 3603-3617 |
| 3. | Stone, A. L., Kroeger, M., and Sang, Q. X. A. (1999) J. Protein Chem. 18, 447-465 |
| 4. | Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y., and Fujisawa-Sehara, A. (1995) Nature 377, 652-656 |
| 5. | Gilpin, B. J., Loechel, F., Mattei, M.-G., Engvall, E., Albrechtsen, R., and Wewer, U. M. (1998) J. Biol. Chem. 273, 157-166 |
| 6. | Kurisaki, T., Masud, A., Osumi, N., Nabeshima, Y., and Fujisawa-Sehara, A. (1998) Mech. Dev. 73, 211-215 |
| 7. | Galliano, M. F., Huet, C., Frygelius, J., Polgren, A., Wewer, U. M., and Engvall, E. (2000) J. Biol. Chem. 275, 13933-13939 |
| 8. | Bornemann, A., Kuschel, R., and Fujisawa-Sehara, A. (2000) J. Muscle Res. Cell Motil. 21, 475-480 |
| 9. | Loechel, F., Gilpin, B. J., Engvall, E., Albrechtsen, R., and Wewer, U. M. (1998) J. Biol. Chem. 273, 16993-169997 |
| 10. | Loechel, F., Overgaard, M. T., Oxvig, C., Albrechtsen, R., and Wewer, U. M. (1999) J. Biol. Chem. 274, 13427-13433 |
| 11. | Iba, K., Albrechtsen, R., Gilpin, B. J., Loechel, F., and Wewer, U. M. (1999) Am J. Pathol. 154, 1489-1501 |
| 12. | Iba, K., Albrechtsen, R., Gilpin, B., Fröhlich, C., Loechel, F., Zolkiewska, A., Ishihuro, K., Kojima, T., Liu, W., Langford, J. K., Sanderson, R. D., Brakebusch, C., Fässler, R., and Wewer, U. M. (2000) J. Cell Biol. 149, 1143-1155 |
| 13. | Eto, K., Puzon-McLaughlin, W., Sheppard, D., Sehara-Fujisawa, A., Zhang, X. P., and Takada, Y. (2000) J. Biol. Chem. 275, 34922-34930 |
| 14. | Zolkiewska, A. (1999) Exp. Cell Res. 252, 423-431 |
| 15. | Suzuki, A., Kadota, N., Hara, T., Nakagami, Y., Izumi, T., Takenawa, T, Sabe, H., and Endo, T. (2000) Oncogene 19, 5842-5850 |
| 16. | Kang, Q., Cao, Y., and Zolkiewska, A. (2000) Biochem. J. 352, 883-892 |
| 17. | Kaliman, P., Viñals, F., Testar, X., Palacin, M., and Zorzano, A. (1996) J. Biol. Chem. 271, 19146-19151 |
| 18. | Jiang, B.-H., Zheng, J. Z., and Vogt, P. K. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14179-14183 |
| 19. | Kaliman, P., Canicio, J., Shepherd, P. R., Beeton, C. A., Testar, X., Palacin, M., and Zorzano, A. (1998) Mol Endocrinol. 12, 66-77 |
| 20. | Florini, J. R., Ewton, D. Z., and Coolican, S. A. (1996) Endocr. Rev. 17, 481-517 |
| 21. | Florini, J. R., Magri, K. A., Ewton, D. Z., James, P. L., Grindstaff, K., and Rotwein, P. S. (1991) J. Biol. Chem. 266, 15917-15923 |
| 22. | Engert, J. C., Berglund, E. B., and Rosenthal, N. (1996) J. Cell Biol. 135, 431-440 |
| 23. | Stewart, C. E., and Rotwein, P. (1996) J. Biol. Chem. 271, 11330-11338 |
| 24. | Lawlor, M. A., Peng, X., Everding, D. R., Sieger, K., Stewart, C. E. H., and Rotwein, P. (2000) Mol. Cell. Biol. 20, 3256-3265 |
| 25. | Lawlor, M. A., and Rotwein, P. (2000) J. Cell Biol. 151, 1131-1140 |
| 26. | Kaliman, P., Canicio, J., Testar, X., Palacin, M., and Zorzano, A. (1999) J. Biol. Chem. 274, 17437-17444 |
| 27. | Vanhaesebroeck, B., and Waterfield, M. D. (1999) Exp. Cell Res. 253, 239-254 |
| 28. | Wymann, M. P., and Pirola, L. (1998) Biochim. Biophys. Acta 1436, 127-150 |
| 29. | Fruman, D. A., Meyers, R. E., and Cantley, L. C. (1998) Annu. Rev. Biochem. 67, 481-507 |
| 30. | Leevers, S. J., Vanhaesebroeck, B., and Waterfield, M. D. (1999) Curr. Opin. Cell Biol. 11, 219-225 |
| 31. | Feng, S., Chen, J. K., Yu, H., Simon, J. A., and Schreiber, S. L. (1994) Science 266, 1241-1247 |
| 32. | Rickles, R. J., Botfield, M. C., Zhou, X.-M., Henry, P. A., Brugge, J. S., and Zoller, M. J. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 10909-10913 |
| 33. | Hougaard, S., Loechel, F., Xu, X., Tajima, R., Albrechtsen, R., and Wewer, U. M. (2000) Biochem. Biophys. Res. Commun. 275, 261-267 |
| 34. | Venkateswarlu, K., Oatey, P. B., Tavare, J. M., and Cullen, P. J. (1998) Curr. Biol. 8, 463-466 |
| 35. | Holt, K. H., Olson, L., Moye-Rowley, W. S., and Pessin, J. E. (1994) Mol. Cell. Biol. 14, 42-49 |
| 36. | Rordorf-Nikolic, T., Van Horn, D. J., Chen, D., White, M. F., and Backer, J. M. (1995) J. Biol. Chem. 270, 3662-3666 |
| 37. | Klippel, A., Reinhard, C., Kavanaugh, W. M., Apell, G., Escobedo, M. A., and Williams, L. T. (1996) Mol. Cell. Biol. 16, 4117-4127 |
This article has been cited by other articles:
![]() |
J. L. Zhong, Z. Poghosyan, C. J. Pennington, X. Scott, M. M. Handsley, A. Warn, J. Gavrilovic, K. Honert, A. Kruger, P. N. Span, et al. Distinct Functions of Natural ADAM-15 Cytoplasmic Domain Variants in Human Mammary Carcinoma Mol. Cancer Res., March 1, 2008; 6(3): 383 - 394. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, J. A. Hanover, and S.-y. Cheng Activation of phosphatidylinositol 3-kinase signaling by a mutant thyroid hormone beta receptor PNAS, February 7, 2006; 103(6): 1780 - 1785. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lafuste, C. Sonnet, B. Chazaud, P. A. Dreyfus, R. K. Gherardi, U. M. Wewer, and F.-J. Authier ADAM12 and {alpha}9{beta}1 Integrin Are Instrumental in Human Myogenic Cell Differentiation Mol. Biol. Cell, February 1, 2005; 16(2): 861 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cao, F. Kambe, L. C. Moeller, S. Refetoff, and H. Seo Thyroid Hormone Induces Rapid Activation of Akt/Protein Kinase B-Mammalian Target of Rapamycin-p70S6K Cascade through Phosphatidylinositol 3-Kinase in Human Fibroblasts Mol. Endocrinol., January 1, 2005; 19(1): 102 - 112. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sundberg, C. K. Thodeti, M. Kveiborg, C. Larsson, P. Parker, R. Albrechtsen, and U. M. Wewer Regulation of ADAM12 Cell-surface Expression by Protein Kinase C {epsilon} J. Biol. Chem., December 3, 2004; 279(49): 51601 - 51611. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanaka, D. Nanba, S. Mori, F. Shiba, H. Ishiguro, K. Yoshino, N. Matsuura, and S. Higashiyama ADAM Binding Protein Eve-1 Is Required for Ectodomain Shedding of Epidermal Growth Factor Receptor Ligands J. Biol. Chem., October 1, 2004; 279(40): 41950 - 41959. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. V. Bax, A. J. Messent, J. Tart, M. van Hoang, J. Kott, R. A. Maciewicz, and M. J. Humphries Integrin {alpha}5{beta}1 and ADAM-17 Interact in Vitro and Co-localize in Migrating HeLa Cells J. Biol. Chem., May 21, 2004; 279(21): 22377 - 22386. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mori, M. Tanaka, D. Nanba, E. Nishiwaki, H. Ishiguro, S. Higashiyama, and N. Matsuura PACSIN3 Binds ADAM12/Meltrin {alpha} and Up-regulates Ectodomain Shedding of Heparin-binding Epidermal Growth Factor-like Growth Factor J. Biol. Chem., November 14, 2003; 278(46): 46029 - 46034. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cao, Z. Zhao, J. Gruszczynska-Biegala, and A. Zolkiewska Role of Metalloprotease Disintegrin ADAM12 in Determination of Quiescent Reserve Cells during Myogenic Differentiation In Vitro Mol. Cell. Biol., October 1, 2003; 23(19): 6725 - 6738. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Abram, D. F. Seals, I. Pass, D. Salinsky, L. Maurer, T. M. Roth, and S. A. Courtneidge The Adaptor Protein Fish Associates with Members of the ADAMs Family and Localizes to Podosomes of Src-transformed Cells J. Biol. Chem., May 2, 2003; 278(19): 16844 - 16851. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Seals and S. A. Courtneidge The ADAMs family of metalloproteases: multidomain proteins with multiple functions Genes & Dev., January 1, 2003; 17(1): 7 - 30. [Full Text] [PDF] |
||||
![]() |
K. M. Smith, A. Gaultier, H. Cousin, D. Alfandari, J. M. White, and D. W. DeSimone The cysteine-rich domain regulates ADAM protease function in vivo J. Cell Biol., December 9, 2002; 159(5): 893 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Cao, Q. Kang, Z. Zhao, and A. Zolkiewska Intracellular Processing of Metalloprotease Disintegrin ADAM12 J. Biol. Chem., July 12, 2002; 277(29): 26403 - 26411. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Poghosyan, S. M. Robbins, M. D. Houslay, A. Webster, G. Murphy, and D. R. Edwards Phosphorylation-dependent Interactions between ADAM15 Cytoplasmic Domain and Src Family Protein-tyrosine Kinases J. Biol. Chem., February 8, 2002; 277(7): 4999 - 5007. [Abstract] [Full Text] [PDF] |
||||