![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 27, 24490-24497, July 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
,From the Department of Biological Regulation, The Weizmann Institute of Science, Rehovot 76100, Israel
Received for publication, April 16, 2001
| |
ABSTRACT |
|---|
|
|
|---|
The Extracellular signal-regulated kinases (ERKs)
are translocated into the nucleus in response to mitogenic stimulation. The mechanism of translocation and the residues in ERKs that govern this process are not clear as yet. Here we studied the involvement of
residues in the activation loop of ERK2 in determining its subcellular
localization. Substitution of residues in the activation loop to
alanines indicated that residues 173-181 do not play a significant
role in the phosphorylation and activation of ERK2. However, residues
176-181 are responsible for the detachment of ERK2 from MEK1 upon
mitogenic stimulation. This dissociation can be mimicked by
substitution of residues 176-178 to alanines and is prevented by
deletion of these residues or by substitution of residues 179-181 to
alanines. On the other hand, residues 176-181, as well as residues
essential for ERK2 dimerization, do not play a role in the shuttle of
ERK2 through nuclear pores. Thus, phosphorylation-induced conformational rearrangement of residues in the activation loop of ERK2
plays a major role in the control of subcellular localization of this protein.
Among the key steps in the signaling mechanism of
mitogen-activated protein kinase
(MAPK)1 cascades are the
changes in subcellular localization of their components upon
extracellular stimulation (reviewed in Refs. 1-4). These
relocalization processes are best characterized for protein kinases in
the extracellular signal-regulated kinase (ERK) cascade, which seem to
be localized primarily in the cytosol of resting cells. Upon mitogenic
stimulation, Raf1 is recruited to the plasma membrane (5) where it is
activated by a mechanism that is not fully understood (6). On the other
hand, most of the protein kinases downstream of Raf-1 in the cascade,
namely MEK1/2 (7), ERK1/2 (ERKs), and RSK1-3 (8) translocate into the
nucleus upon stimulation. Although it is still controversial whether
the translocation of MEKs requires an active process (7, 9), it is
clear that MEKs are rapidly exported from the nucleus soon after their
translocation. This rapid export from the nucleus is mediated by a
CRM1-dependent nuclear export signal (10), which results in
an apparent cytosolic localization of MEKs before and after stimulation
(11). ERKs and RSK1-3, on the other hand, are retained in the nucleus
for longer times after stimulation. Interestingly, the proper
subcellular localization of the various components has been shown to
play an important role in regulating the physiological functions of the
ERK cascade. Thus, prevention of nuclear localization of constitutively
active MEK1/2 reduced its oncogenic potential (12), and nuclear
localization of ERKs has been correlated with mitogenesis and neurite
outgrowth in PC12 cells (13). Moreover, prevention of the nuclear
translocation of ERKs strongly inhibited gene transcription (14), and
RSK2 activity in the nucleus was found necessary for EGF-induced
transcription of c-fos gene (15).
In resting cells, both ERK1 and ERK2 are localized in the cytosol due
to interaction with various anchoring proteins, including microtubules,
phosphatases, and a MEK-dependent retention (14, 16-18).
The association with some of these proteins such as inactive MKP3 (14)
or microtubules (16) is not reversible upon activation. However, most
of the ERK molecules (70-85%) appear to dissociate from their
cytosolic anchors upon stimulation and translocate into the nucleus.
This translocation, is rapid (seen in 5 min), reversible (19), and may
involve two distinct mechanisms of nuclear import (20). One is a
passive, non-regulated mechanism, and the other is a faster, active
process that may involve ERK dimerization (21). The active
translocation of ERKs seems to require phosphorylation of at least one
molecule of the translocating dimer on its regulatory Tyr residue (11,
20, 21). The translocated ERKs accumulate in the nucleus, where a large
amount of ERKs can be observed even after their activity has declined
(22, 23). This observation may suggest that the nucleus is a major site for phosphatase-mediated down-regulation of ERKs shortly after translocation. It has recently been suggested that the inactive ERK is
circulated back to the cytosol by a mechanism that involves nuclear
shuttling of MEKs (9).
We have previously identified a primary sequence important for
MEK1-induced cytoplasmic retention of ERKs in resting cells that we
termed cytosolic retention sequence (CRS), comprising amino acids
312-320 of ERK2 (18). This region contains residue Asp-319, which is known to play a role in interaction with
phosphatases (24, 25), and, recently, residues in this region were
identified as a common docking (CD) domain for other MAPK-interacting
proteins as well (26). However, the wide variety of functions assigned to this region and its high degree of similarity with other MAPKs suggest that other sequences should be involved in the association of
ERKs with cytosolic-anchoring proteins. Moreover, the residues and the
mechanism responsible for the stimulation-induced dissociation of ERKs
from the anchoring proteins are not clear as yet. Here we studied the
involvement of residues in the activation loop of ERK2 in the
determination of its subcellular localization. We found that this
dissociation is dependent on residues 176-181 of ERK2, although these
residues do not play a significant role in the phosphorylation and
activation of ERK2 upon stimulation. The dissociation was also
dependent on the regulatory phosphorylation of ERK2 in its activation
loop. However, substitution of residues in this region to alanines did
not alter either the stimulated or non-regulated shuttle of ERK2
through nuclear pores. These results indicate that the translocation of
ERK2 is mainly regulated through a stimulation-induced dissociation
from its cytosolic anchoring due to conformational change in the
activation loop.
Constructs
GFP-ERK2--
The cDNA of rat ERK2 (bases 22-1096) was
ligated into ApaI and BamHI sites downstream to
the GFP gene of pEGFP-C1 (CLONTECH), thus forming a
GFP-ERK2 construct in which the N terminus of ERK2 is modified (18).
All the subsequent modifications were performed by PCR mutagenesis
(27), incorporated into the GFP-ERK2 construct, and fully sequenced to
confirm the mutations.
GFP-173A--
Residues 173-175 of ERK2 were modified to
alanines using the 3'-primer,
TACCAACGCGTGGCTACATACTCTGTCAAGAACCCTGTATGATCATGGGCTGCAGCTGCAACACGGGC (containing a PflMI site), and a 5'-PCR primer
containing the ApaI site of ERK2.
GFP-176A--
Residues 176-178 of ERK2 were modified to
alanines using the 3'-primer,
TACCAACGCGTGGCTACATACTCTGTCAAGAACCCTGTAGCAGCAGCGTCTGGATCTGCAAC (containing a PflMI site), and a 5'-PCR primer containing
the ApaI site of ERK2.
GFP- GFP-179A--
Residues 179-181 of ERK2 were modified to
alanines using the 3'-primer,
TACCAACGCGTGGCTACATACTCTGTCAACGCCGCTGCATGATCATGGTCTGG (containing a
PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.
GFP-183A--
Residues 183-185 of ERK2 were modified to
alanines using the 3'-primer, TACCAACGCGTGGCTACAGCCGCTGCCAAGAACCCTGT
(containing a PflMI site), and a 5'-PCR primer containing
the ApaI site of ERK2.
GFP-ALC--
Residues 170-190 of ERK2 were replaced with
residues 213-228 of MEK1 using the 3'-primer,
TCTGGAGCTCTGTACGAACGCGTACCTACGAAGGAGTTTGCCATTGAATCGATTAGCTGACCGGCAAGGCCAAAGT (containing a SacI site) and a 5'-PCR primer containing the
SacI site of pEGFP-C1. The PCR product was ligated into
SacI sites of GFP-ERK2.
GFP-HL--
Leucines 333, 336, 341, and 344 of ERK2 were
modified to alanines using overlapping PCR (i) a 5'-PCR primer,
GCACCTAAGGAGAAGGCCAAAGAAGCCATTTTTGAA, with a 3'-primer containing
HpaI and (ii) a 3'-PCR primer,
GGCCTTCTCCTTAGGTGCGTCGTCCGCCTCCATGTC, with 5'-primer containing a
PflMI site. The overlapping PCR product was ligated into
HpaI and PflMI sites of GFP-ERK2. Histidine 176 in this construct was modified to alanine using the 3'-primer, GTACCAAGTACCAATGGCTACATACTCTGTCAAGAACCCTGTATGATCAGCGTCTGGATCTGC (containing a PflMI site), and a 5'-PCR primer containing
the ApaI site of ERK2.
WT-MEK--
MEK1 was prepared as previously described (18).
MKP3-C/S--
WT-MKP-3 was cloned by reverse
transcriptase-PCR with primers TACGCTAGCATAGATACGCTCAGACCCGTG
and TCGAGCGGCCGCTCACGTAGATTGCAGAGAGTC. The PCR product was ligated into
NheI and NotI sites of pcDNA3-HA vector
(Invitrogen). The C293S mutant was constructed by PCR with the primer CTTGGTACATTCCTTGGCTGGC.
Buffers
Buffer A consisted of 50 mM Transfection and Localization Studies
The various GFP-ERKs plasmids were transfected into CHO cells
using LipofectAMINE (Life Technologies, Inc.). When plasmid-expressing MEK1 was cotransfected with the various GFP-ERKs, ratio of 2:1 in the
amount of DNA transfected was kept, respectively. When plasmid-expressing MKP-3 C/S was cotransfected with the various GFP-ERKs, a ratio of 4:1 in the amount of DNA transfected was kept,
respectively. Visualization was performed essentially as described
previously (7). Cells were stimulated with tetradecanoyl phorbol
acetate (TPA; 250 nM, 5 min), fixed (3% paraformaldehyde), and visualized either by fluorescence microscopy (Zeiss Axioscop microscope, HBO 100 W/2; 400× magnification) or by confocal microscopy (Bio-Rad).
Western Blotting
Transfected cells were serum-starved (0.1% fetal calf serum)
for 16 h. After stimulation, the cells were washed twice with ice-cold phosphate-buffered saline and once with ice-cold buffer A. Cells were harvested with buffer H followed by sonication (2 × 7 s, 40 watts) and centrifugation (15,000 × g, 15 min, 4 °C). The supernatants, which contained cytosolic proteins,
were collected, and aliquots from each sample (20 µg) were separated
on 10% SDS-PAGE followed by Western blotting. Activated ERK was
detected by probing blots with anti-activated ERK monoclonal antibody
(DP-ERK, Sigma, Israel) or antibody PT/DP-ERK (Sigma, Israel, clone
115). Total ERK protein was detected by anti-MAPK antibody (Sigma,
Israel). MEK1 was detected with anti-MEK1 monoclonal antibody
(Transduction Laboratories).
Immunoprecipitation
Transfected CHO cells were serum-starved (16 h), stimulated
(TPA, 5 min), and harvested as described above. The cell extracts were
then subjected to immunoprecipitation with anti-GFP monoclonal antibody
(Roche Molecular Biochemicals). For MEK1 coimmunoprecipitation studies,
the beads were washed as described (10) with low stringency buffer (20 mM HEPES, pH 8.0, 2 mM MgCl2, 2 mM EGTA) and then subjected to immunoblotting with
monoclonal anti-MEK and anti-GFP antibodies. For the determination of
ERK activity, the beads were washed once with radioimmune precipitation
buffer, twice with 0.5 M LiCl, and twice with buffer A as
described (27). The immunoprecipitates were subjected to myelin basic
protein (MBP) phosphorylation assay as described below.
Determination of ERK Activity
The immunoprecipitates of GFP-ERKs proteins obtained from the
stimulated transfected CHO cells were mixed with MBP (8.4 µg) and
buffer R that contained 100 µM [ Subcellular Localization of ERK2 and Its Inactive Mutant--
In
response to mitogenic stimulation, ERKs are translocated from the
cytosol into the nucleus (8). To characterize this dynamic change in
subcellular localization we have previously (18) fused green
fluorescence protein (GFP) to the N-terminal end of ERK2 (GFP-ERK2).
We showed that overexpression of GFP-ERK2 in CHO cells results in a
nuclear accumulation of the protein both before and after stimulation.
Coexpression with MEK1 results in a cytosolic retention of the GFP-ERK2
in resting cells, and this is mediated by residues 312-320 of ERK2
(CRS). This localization is rapidly changed upon mitogenic stimulation
of the cells, which causes a dissociation of ERK2 from its cytosolic
anchor, and enables its translocation into the nucleus. To further
study the molecular mechanisms that govern the subcellular
localization of ERK2, we followed the changes in the subcellular
localization of GFP-ERK2 shortly after transfection (6 h after the
beginning of the transfection procedure and 1 h after its end).
Under these conditions, GFP-ERK2 was equally distributed all over the
resting cells (Fig. 1A), and
TPA stimulation induced a rapid nuclear translocation of the majority
of GFP-ERK2 molecules. In later time points after transfection (12-48
h after transfection) the total amount of GFP-ERK2 was increased, and
the vast majority of it was detected in the nucleus both before and
after TPA stimulation. These results can be explained by saturation of
a limited number of endogenous cytosolic-anchoring proteins by newly
synthesized GFP-ERK2 molecules. A slow rate nuclear translocation of an
excess of synthesized GFP-ERK2 into the nucleus is probably responsible
for the gradual accumulation of protein in the nucleus. However,
stimulation is able to cause the detachment of the ERKs from their
endogenous cytosolic anchor and induce a fast rate translocation that
is completed within 5 min after stimulation (Fig. 1A). This
system enabled us to follow interactions with endogenous anchoring
proteins as well as the two rates of ERK2 translocation into the
nucleus, which were reported to be a fast,
stimulation-dependent rate and a non-regulated passive one
(20).
Construction and Biochemical Analysis of Activation Loop Mutants of
ERK2--
As previously reported (17, 18), coexpression of GFP-ERK2
and MEK1 resulted in a cytosolic distribution of the GFP-ERK2 (Fig.
1B), and this was reversed by TPA stimulation. When the inactive mutant of ERK2, in which the regulatory Thr and Tyr residues were replaced by alanines, was coexpressed with MEK1, TPA failed to
induce nuclear translocation of the mutated ERK2, indicating that
phosphorylation of ERK2 is essential for its nuclear translocation. Therefore, we undertook to analyze the role of the activation loop of
ERK2 in both its stimulated and passive nuclear translocation processes. To do so we constructed sequential mutations in the activation loop, and as previously described for ERK2 (18), the
constructs were fused to GFP to enable their easy detection. The
mutations introduced (Fig. 2) were: (i)
substitution of amino acids 173-175 to alanines (GFP-173A); (ii)
substitution of amino acids 176-178 to alanines (GFP-176A); (iii)
substitution of amino acids 179-181 to alanines (GFP-179A); (iv)
substitution of amino acids 183-185 to alanines (GFP-183A). Other
mutations introduced (Fig. 2) were (i) deletion of amino acids 176-178
(GFP-
We examined the activation and catalytic activity of the above mutants
by transfecting them into CHO cells. Thirty-two hours after
transfection, the cells were serum-starved (0.1% serum) for 16 h
and then were either stimulated with TPA or left untreated. All the
mutants were expressed to a similar level, as judged by their detection
with anti-general ERK antibody at the expected size of ~70 kDa (Fig.
3). Western blot with anti-diphospho-ERK antibody revealed that 173A, 176A,
The catalytic activity of the constructs was then examined by
immunoprecipitation of the proteins expressed in CHO cells with anti-GFP antibody followed by an in vitro kinase assay
toward MBP. The specific catalytic activity observed with GFP-ERK2 upon TPA stimulation was comparable to that of endogenous ERKs (~150 nmol/min/mg, data not shown). This activity was not significantly changed when overexpressed GFP-HL or GFP-179A constructs were examined
and was slightly elevated (25 ± 7%) with GFP- Subcellular Localization of the Activation Loop Mutants of
ERK2--
We then undertook to study the subcellular localization of
the various activation loop-mutated proteins in the presence of MEK1.
Thus, each of the GFP-conjugated ERK2 constructs was
cotransfected into CHO cells together with MEK1 and visualized 48 h after transfection. As expected, GFP-ERK2 was localized in the
cytosol of resting cells and translocated into the nucleus shortly
after TPA stimulation (see Fig. 1). However, the only mutant that
behaved similarly to GFP-ERK2 was GFP-173A (Fig.
5). As expected, the inactive GFP-183A and GFP-ALC were unable to leave the cytosolic compartment of the CHO
cells (Fig. 1 and Ref. 20). Interestingly, GFP-176A was localized in
the nucleus both before and after TPA stimulation (Fig. 5), whereas
GFP-
As previously reported (18), overexpression of GFP-ERK2 without MEK1
for 48 h resulted in nuclear accumulation of most expressed molecules (Fig. 6). Similar to GFP-ERK2,
all the GFP-conjugated mutants of ERK2 tested here were detected in the
nuclei of resting CHO cells both before (Fig. 6) and after (data not
shown) stimulation. These results may indicate that all mutants have
the capability to enter into the nucleus of resting cells, probably due
to a non-regulated mechanism (20). Their accumulation in the nucleus can be explained by the fact that they attach to nuclear-anchoring proteins (11), because endogenous MEK1, which can serve as a nuclear
export vehicle for ERK2 (9), was not able to induce any appreciable
nuclear export of the overexpressed ERK2.
To examine whether the interaction of the ERK2 mutants with endogenous
anchoring proteins is similar to their interaction with overexpressed
MEK1, we examined the subcellular localization of the ERK2 mutants
6 h after the beginning of transfection without the MEK1
construct. The results obtained with this system correlated nicely with
those obtained when the mutants were cotransfected with MEK1 above.
Thus, as much as the GFP-ERK2, also GFP173A, GFP- Coimmunoprecipitation of Activation Loop Mutants with MEK1--
We
then assayed the activation loop mutants for their ability to interact
with MEK1 in a coimmunoprecipitation assay. Thus, GFP-ERK2 and the
various mutants were cotransfected into CHO cells together with MEK1,
serum-starved for 16 h, and then either left untreated or
stimulated with TPA for 5 min. At this stage, the cells were gently
lysed, and GFP-ERKs were immunoprecipitated with anti-GFP antibodies.
The washes of the immunocomplexes were extremely mild (17), and those
were subjected to SDS-PAGE and Western blot analysis with both
anti-MEK1 and anti-GFP antibodies. As expected, immunoprecipitation of
GFP-ERK2 was able to pull-down some amount of MEK1, which was reduced
upon treatment with TPA (Fig. 8). As
detected in the subcellular localization studies above, the only
construct that behaved in a similar way to the GFP-ERK2 was GFP-173A.
On the other hand, GFP- Interaction of the Activation Loop Mutants with MKP3--
Several
proteins have recently been shown to act as irreversible cytosolic
anchors for ERKs, including cytoskeletal elements (16), and protein Tyr
phosphatases (14). We studied the ability of the various ERK2
constructs to associate with the inactive form of MAPK phosphatase 3 (MKP3-C/S (14)). Cytosolic localization of GFP-ERK2 was detected when
it was coexpressed with MKP3 in CHO cells, and this localization was
not reversed by TPA stimulation. MKP3 failed to anchor GFP-312A
(substitution of residues 312-319 of ERK2 to alanines (18)) in the
cytosol, indicating that, similar to MEKs, the main binding of ERK2 to
MKP3 occurs at residues 316-319 (26). However, unlike the
results with MEK1 above, when coexpressed with MKP3, all the activation
loop mutants of ERK2 behaved in a similar manner to the GFP-ERK2 and
localized to the cytosol both before and after TPA stimulation (Fig.
9). These results indicate that, although the activation loop plays a
role in the association of ERK2 with MEK1, it does not contribute to
the association of ERK2 to MKP3-C/S. Moreover, in light of the
inability of ERK2 to dissociate from MKP3-C/S upon TPA
stimulation, these results support our suggestion that the activation
loop is responsible for the stimulation-induced dissociation of ERK2
from its cytosolic anchor.
The requirement of catalytic activation for the nuclear
translocation of ERKs prompted our studies on the importance of
residues in the activation loop of ERK2 for its activation,
dissociation from MEK, and translocation into the nucleus. Here we
designed a series of mutations that covered the activation loop of
ERK2. To our surprise, mutations in residues 173-181, which are very close to the regulatory Thr-183 and Tyr-185 had only a small effect on
the phosphorylation and activation of ERK2 (Figs. 3 and 4). The only
constructs that were inactive were GFP-183A and GFP-ALC, which lacked
the regulatory Tyr and Thr residues and thus served as an inactive
control in our study.
We then studied the MEK1-dependent subcellular localization
of the various activation loop mutants of ERK2. It has previously been
reported (17) that MEKs may directly interact with ERKs and thus retain
them in the cytosol. However, because of the weak nature of the
association between the two proteins (18), it is possible that this
association is not direct but mediated via a scaffold protein (28). Our
results revealed that, as reported (20), non-phosphorylatable mutants
(183A, ALC) did not dissociate from MEK1 (Fig. 8) and did not
translocate into the nucleus after stimulation (Fig. 5). Beside the
inactive constructs, also changes in residues 176-181 modified the
MEK1-dependent subcellular localization of ERK2. Thus, when
residues 176-178 were substituted to alanines, there was no
interaction with MEK1, and this correlated with a nuclear accumulation
of the ERK2 construct. However, deletion of the same residues resulted
in an irreversible association with MEK1, which caused a cytoplasmic
localization both before and after TPA stimulation. These results are
best explained by assuming that these residues are important for the
dissociation of ERK2 from MEK1. Thus, as for GFP-ERK2, the association
of GFP-
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
176--
Residues 176-178 of ERK2 were deleted
using the 3'-PCR primer,
TACCAACGCGTGGCTACATACTCTGTCAAGAACCCTGTGTCTGGATCTGCAAC (containing a
PflMI site), and a 5'-PCR primer containing the
ApaI site of ERK2.
-glycerophosphate, pH
7.3, 1.5 mM EGTA, 1 mM EDTA, 1 mM
DTT, and 0.1 mM sodium vanadate. Buffer H (homogenization
buffer) contained 50 mM
-glycerophosphate, pH 7.3, 1.5 mM EGTA, 1 mM EDTA, 1 mM DTT, 0.1 mM sodium vanadate, 1 mM benzamidine, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 2 µg/ml pepstatin-A.
Buffer R (a reaction mixture at 3-fold final concentration) consisted
of 30 mM MgCl2, 4.5 mM DTT, 75 mM
-glycerophosphate, pH 7.3, 0.15 mM sodium
vanadate, 3.75 mM EGTA, 30 µM
calmidazolium, and 2.5 mg/ml bovine serum albumin.
-32P]ATP
(1-2 cpm/fmol) in a final volume of 30 µl. The phosphorylation reaction was allowed to proceed at 30 °C for 20 min, after which it
was terminated by sample buffer and boiling for 5 min. Phosphorylation of MBP was assessed by 15% SDS-PAGE and autoradiography.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (34K):
[in a new window]
Fig. 1.
Localization of GFP-ERK2 and its inactive
mutant in CHO cells. CHO cells were transfected (5 h with
LipofectAMINE) with either GFP-ERK2 or GFP-ERK2 in which residues
183-185 were replaced with alanine (TEY/AAA) either without
(A) or with (B) MEK1. After the end of
transfection, the cells were either transferred into a starvation
medium (A) for 1 h (total of 6 h) and for 7 h
(12 h), or transferred to a growing medium for 32 h followed by
serum starvation for an additional 16 h (A, 48 h
and B). The cells were then either left untreated
(
TPA, 0) or stimulated with TPA (+TPA; 250 nM) for 5 min (A, B) and 15 min
(B), after which the cells were washed, fixed, and
visualized as described under "Materials and Methods."
176) to further study the role of these residues in the
subcellular localization; (ii) replacement of the residues required for
homodimerization of ERK2 (His-176, Leu-333, Leu-336, Leu-341, and
Leu-344 (21)) termed GFP-HL; and (iii) replacement of the whole
activation loop of ERK2 (residues 170-190) with the activation loop of
MEK1, thus forming an activation loop chimera (GFP-ALC).

View larger version (14K):
[in a new window]
Fig. 2.
Schematic representation of the activation
loop mutants of ERK2. Site of mutation of GFP-173A, GFP-176A,
GFP-
176, GFP-179A, and GFP-183A is indicated. The phosphorylated
residues 183 and 185 are indicated with P. GFP-ALC was prepared by
substitution of residues 170-190 with the homologous residues from
MEK. The residues that were substituted to alanines in HL-GFP are
indicated by asterisks.
176, and HL were phosphorylated as much as the wild type ERK2, whereas no phosphorylation was detected
with 179A, 183A, and ALC. Staining of the GFP-ALC with anti-phospho-MEK
antibody did not yield any appreciable staining, indicating that it
could not be activated under the conditions used. However, staining
with another anti-diphospho-ERK antibody detected a TPA-induced
phosphorylation on GFP-179A (Fig. 3B) but not on GFP-183A or
GFP-ALC, and similar detection was obtained with anti-phospho-Tyr
antibody (data not shown). These results indicate that the GFP-179A
construct is phosphorylated in response to TPA on both regulatory Thr
and Tyr, and the lack of recognition by the initial anti-diphospho-ERK
antibody was probably due to the specificity of the antibody.

View larger version (35K):
[in a new window]
Fig. 3.
Phosphorylation state of GFP-ERK2 and its
activation loop mutants. CHO cells were transfected with the
indicated constructs. Thirty-two hours after transfection the cells
were serum-starved for 16 h and then were either left untreated
(
) or stimulated with TPA (+; 250 nM, 5 min).
A, cell lysates were prepared as described under
"Materials and Methods" and analyzed with anti-diphosphorylated ERK
antibody (
-DP-ERK, upper panel) or
anti-GFP antibody (
-GFP, lower
panel). B, cell lysates of GFP-ERK2 and GFP-179A were
prepared and analyzed with
anti-diphosphorylated/threonine-phosphorylated ERK antibody (clone 115, Sigma). G-ERKs indicates the position of GFP-ERK2, and
ERK1 and ERK2 indicate the positions of the
endogenous ERK1 and ERK2. The results are taken from three distinct
gels that were simultaneously developed. These results were reproduced
five times.
176 (Fig. 4). On the other hand, the activity of
GFP-173A and GFP-176A was lower than that of GFP-ERK2 (35 ± 12%
and 50 ± 10%, respectively), and GFP-183A, as well as GFP-ALC,
did not display any detectable catalytic activity.

View larger version (12K):
[in a new window]
Fig. 4.
Activity of GFP-ERK2 and its activation loop
mutants. CHO cells were transfected with the indicated constructs.
Thirty-two hours after transfection, the cells were serum-starved for
16 h and then were either left untreated (
) or stimulated with
TPA (+; 250 nM, 5 min). Cell lysates were prepared as
described under "Materials and Methods" and subjected to
immunoprecipitation with monoclonal anti-GFP antibody. The catalytic
activity of the different GFP-ERKs was assayed by an in
vitro kinase assay using MBP as a substrate, as described under
"Materials and Methods." Samples were separated by SDS-PAGE and
blotted onto nitrocellulose. Blots were probed with monoclonal anti-GFP
antibody (lower panel). Radioactivity was determined by 24-h
exposure to x-ray film (MBP Phos.; upper panel).
MBP indicates the place of phosphorylated MBP, and
G-ERKs indicates the position of the immunoprecipitated
GFP-ERKs. The results are taken from two distinct gels that were
simultaneously developed. These results were reproduced four
times.
176 was restricted to the cytosol. Other residues that appear to
be important in the subcellular localization of ERK2 are residues
179-181, because GFP-179A, which could be phosphorylated and activated
upon TPA treatment, failed to translocate into the nucleus after this
stimulation. Finally, the dimerization-deficient GFP-HL was equally
distributed throughout the resting cells and very rapidly
translocated into the nucleus upon stimulation, indicating that His-176
and possibly also the four C-terminal Leu residues are important for
the association of ERK2 with MEK1 and are probably not essential for
TPA-induced translocation.

View larger version (31K):
[in a new window]
Fig. 5.
Localization of GFP-ERK2 and its activation
loop mutants in CHO cells upon cotransfection with MEK1. CHO cells
were transfected with each of the indicated constructs together with
plasmid containing MEK1. Thirty-two hours after transfection, the cells
were serum starved for 16 h and then were either left untreated
(basal) or stimulated with TPA (250 nM, 5 min), after which
the cells were fixed and visualized using conventional and confocal
fluorescence microscopy. Each of the experiments was reproduced at
least five times.

View larger version (46K):
[in a new window]
Fig. 6.
Localization of GFP-ERK2 and its activation
loop mutants in CHO cells 48 h after transfection without
MEK1. CHO cells were transfected with each of the indicated
constructs. After transfection the cells were transferred into a
growing medium for 32 h and then to starvation medium for 16 h. The cells were then washed, fixed, and visualized as described. Each
of the experiments was reproduced at least five times.
176, GFP-179A,
GFP-183A, and GFP-ALC were equally distributed throughout the resting
cells, indicating that retention of part of the synthesized molecules
occurs (Fig. 7). On the other hand, GFP-176A and the GFP-HL, which were not retained in the cytosol by
MEK1, were also localized primarily in the nucleus in this system,
indicating that they lost their ability to interact with endogenous
retention proteins. We then treated the cells with TPA and found that
this induced nuclear translocation of GFP-ERK2 and GFP-173A, whereas
GFP-176A and GFP-HL remained localized in the nucleus. Again, in
agreement with the results obtained with the MEK1 cotransfection system
(Fig. 5), GFP-
176, GFP-179A, GFP-183A, and GFP-ALC remained spread
over all of the cell and were unable to translocate into the nucleus
even in the absence of overexpressed MEK1. Thus, our results indicate
that the endogenous retention proteins behave similarly to MEK1. The
detachment from these proteins, like that from MEK1, was dependent on
residues 176-181, and the substitution of residues 176-178 to
alanines mimics this detachment. The subcellular localization of the
various ERK mutants was also examined after stimulation with
peroxovanadate and gave similar results to those obtained after TPA
stimulation (data not shown). Therefore, the mechanisms that govern ERK
dissociation from the cytosolic anchor are probably general and are
independent on the type of cellular stimulation.

View larger version (27K):
[in a new window]
Fig. 7.
Localization of GFP-ERK2 and its activation
loop mutants in CHO cells 6 h after the beginning of transfection
without MEK1. CHO cells were transfected for 5 h using
LipofectAMINE, with each of the indicated constructs. After the end of
transfection the cells were transferred into a starvation medium for
1 h. The cells were then either left untreated (basal) or
stimulated with TPA (250 nM) for 5 min, after which the
cells were washed, fixed, and visualized as described. Each of the
experiments was reproduced at least four times.
176, 179A, 183A, and GFP-ALC did not seem to
dissociate from MEK1 upon stimulation, whereas GFP-176A as well as
GFP-HL did not associate with MEK1 to any appreciable level even under
basal conditions. The correlation between the association with MEK1
(Fig. 8) and the nuclear translocation of the ERK constructs (Figs. 5
and 7) indicates that the cytosolic interaction with MEK1 is the main
parameter that determines the subcellular localization of the ERK2.

View larger version (20K):
[in a new window]
Fig. 8.
Coimmunoprecipitation of ERK2 and its
activation loop mutants with MEK1. CHO cells were transfected with
each of the indicated constructs together with plasmid-expressing MEK1.
Thirty-two hours after transfection the cells were serum-starved for
16 h and then were either left untreated (
) or stimulated with
TPA (+, 250 nM, 5 min). Lysates from all conditions were
subjected to immunoprecipitation with monoclonal anti-GFP antibody.
After SDS-PAGE, samples were immunoblotted with monoclonal anti-MEK
(
-MEK) and monoclonal anti-GFP antibodies
(
-GFP). GFP-ERK2 and
MEKs represent their respective positions. The amount of MEK
in each of the extracts used for coimmunoprecipitation was roughly
equal (data not shown). The two panels represent two independent
experiments. Each of the experiments was reproduced at least four
times.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
176 with MEK1 is mediated by the CRS at residues 312-320 of
ERK2 (18). Hence, the inability of GFP-
176 to dissociate from MEK1
in response to stimulation can be explained by an ability of residues
176-178 to serve as a lever that allows dissociation from MEK1.
Substitution of the 176-178 residues to alanine probably mimics the
activated conformation of ERK2 and therefore does not allow association between the two proteins even though the CRS region was intact. This
suggestion is supported by the fact that substitution of these residues
with Gly residues gave a similar response as GFP-
176 and not as
GFP-176A (data not shown). Moreover, GFP-176A could interact with
MKP3-C/S (through CRS Fig. 9), without
interference of the alanines at position 176-178. As the association
with MKP3-C/S is not reversible, there is no influence of residues that
prompt dissociation and therefore no dissociation of the construct
(GFP-176A) that mimics the MEK1-dissociated form of ERK2 was observed.
Interestingly, substitution of residues 179-181 to alanines also
demonstrated an irreversible association with MEK1 and it is likely
therefore that residues 176-181 are all involved in the stimulated
dissociation.

View larger version (28K):
[in a new window]
Fig. 9.
The subcellular localization of GFP-ERK2 and
its activation loop mutants upon cotransfection with MKP3 C/S. CHO
cells were transfected with each of the indicated constructs together
with plasmid containing MKP3-C/S. Thirty-two hours after transfection,
the cells were serum-starved for 16 h and then were either left
untreated (basal) or stimulated with TPA (250 nM, 5 min),
after which the cells were fixed and visualized using conventional and
confocal fluorescence microscopy. Each of the experiments was
reproduced at least five times.
In addition to the involvement of residues 176-181 in the dissociation of ERK2 from MEK1, these residues play a role in determining the specificity of interaction between the proteins. Since CD domain of ERKs seems to be similar to the same region in other MAPKs, it was predicted (26) that other regions will be responsible for the specificity of binding of the MAPKs to the particular MAPKKs. Thus, our findings that residues 176-181 are important for the dissociation from MEK1 but not from MKP3-C/S may indicate that these residues participate also in the determination of specificity of ERKs to MEKs.
The region of the activation loop identified here joins a list of other regions of ERKs that were postulated to be important for the association between ERK and MEKs. These are residues in subdomain III of ERKs (29), multiple regions in the N and C termini of ERKs (30), amino acids 19-25 of ERK2 (31), and residues 312-320 (18), among which residues 316 and 319 (26) seem to play the most important role in the interaction with MEKs. It is clear that all these residues cannot interact with one molecule of MEK1 at the same time, because they are located in completely different areas of the ERK2 molecule. It is possible, however, that two types of interactions between ERK2 and MEK1 exist. One of these interactions is probably required for the immediate activation of ERK2 by MEK1 and could involve the regions in the same plane of the activation loop (30). The other interaction may involve the CRS (CD), which does not seem to play a significant role in the activation process of ERK2 (18, 26) but rather in its subcellular localization and sensitivity to phosphatases. Although there is accumulating evidence that ERK2 and MEK1 can directly interact with each other (17, 32), it is still possible that this interaction occurs via a third protein such as MP1 for ERK1 (33). In this case the stimulation-dependent dissociation observed in our experiments would not be from MEK1 itself but from this putative scaffolding protein.
The mechanism of ERK2 translocation into the nucleus can be divided
into two stages. In the first step the enzyme is detached from its
cytosolic anchor, whereas the second step consists of a shuttle through
the nuclear envelope. The process of nuclear import is usually
accomplished through nuclear pores that are easily accessible to
proteins with molecular masses smaller than 40 kDa. Molecules with
higher molecular masses usually shuttle through the nuclear envelope by
an active mechanism that requires a complex network of proteins (34).
Similar to previous findings (20), we show here that the 70-kDa
GFP-ERK2 can translocate into the nucleus in two rates: a basal,
non-regulated rate (Figs. 6 and Fig. 7,
TPA) and a
TPA-stimulated fast rate (Figs. 5 and 7, +TPA). We believe
that the molecular mass of the GFP-ERK2 proteins requires that both
rates of translocation would be mediated by an active mechanism. All
mutants used in the current study showed equal nuclear accumulation in
resting cells (Fig. 6), indicating that the activation loop of ERK2
does not play a role in its slow rate nuclear translocation. It is
therefore possible that the machinery responsible for the basal state
of translocation operates in a low rate in resting cells and is
activated by mitogenic stimulation of the cells. However, the
stimulated translocation correlated with dissociation of the ERK2
constructs from MEK1. Although we cannot exclude a role of
phosphorylation in the nuclear shuttling, our results suggest that the
translocation of ERK2 into the nucleus is regulated primarily by its
dissociation from MEK1 (20). Thus, once ERK2 detaches from MEK1, no
additional signal is required for the translocation to occur.
It has previously been proposed that dimerization of ERK2 is required for its active nuclear transport and that phosphorylated ERK2 can form dimers with either phosphorylated or unphosphorylated ERK2 partners (21). Based on crystal structure of phosphorylated ERK2, mutants were constructed at the predicted interface shared by the two monomers. The mutant, H176E,L333A,L336A,L341A,L344A of ERK2, was identified, which lacked the ability to dimerize upon stimulation, and when microinjected into the cytosol of cells, could not translocate into the nucleus. Therefore, it has been suggested that these residues participate in homodimerization formation and are critical for the translocation process of ERK2. However, in our system the HL mutant in which these five residues were substituted to alanines accumulated in the nucleus, without overexpression of MEK1 (Figs. 6 and 7). When coexpressed with MEK1 the mutant was equally distributed throughout the transfected cells, and TPA stimulation induced its rapid nuclear translocation (Fig. 5). Thus, our results indicate that these residues or at least the His-176 participate neither in the non-regulated nor in the stimulated translocation of ERK2 into the nucleus. Although we cannot exclude the possibility that these residues are important for the homodimerization of ERK2, our results clearly demonstrate that these residues do not participate in the stimulated GFP-ERK2 nuclear translocation in our system. Rather, it appears that His-176, probably in conjunction with other residues, is important for the interaction of ERK2 with MEK1, and its conformational rearrangement upon stimulation is essential for the dissociation of these proteins.
In summary, we identified here six amino acids in the activation loop
of ERK1, which appear to be important for the stimulation-induced dissociation of ERK2 from MEK1. Conformational change of these residues
upon phosphorylation seems to be involved in the mechanism of release
of ERK2 from its cytosolic anchor, and this can be mimicked by
substitution of residues 176-178 to alanines. Surprisingly, residues
173-181 did not seem to play a significant role in the activatory
phosphorylation of ERK2 by TPA. We also show here that ERK2
translocates into the nucleus in two rates, a non-regulated rate in
resting cells and a fast rate upon mitogenic stimulation. The residues
of the activation loop of ERK2, including the dimerization-promoting His-176, do not play a role in these two types of translocations. Therefore, our results suggest that the translocation of ERK2 into the
nucleus is mainly regulated through the dissociation of ERK2 from
cytosolic anchoring proteins, and this is mediated by residues in the
activation loop of ERK2.
| |
FOOTNOTES |
|---|
* This work was supported by grants from the Moross Institute for Cancer Research at the Weizmann Institute of Science, the Benozyio Institute for Molecular Medicine at the Weizmann Institute of Science, the Estate of Siegmund Landau, the Israel Academy of Sciences, and by grant 4949 from the Chief Scientists Office of the Ministry of Health, Israel (to I. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Both authors contributed equally to this work.
§ On leave from the Dept. of Internal Medicine E, Sheba Medical Center, Tel Hashomer, Israel.
¶ To whom correspondence should be addressed: Dept. of Biological Regulation, The Weizmann Institute of Science, Rehovot 76100, Israel. Tel.: 972-8-9343602; Fax: 972-8-9344116; E-mail: rony.seger@weizmann.ac.il.
Published, JBC Papers in Press, April 27, 2001, DOI 10.1074/jbc.M103352200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: MAPK, mitogen-activated protein kinase; CD, common docking domain; CRS, cytosolic retention sequence; ERK, extracellular signal-regulated kinase; GFP, green fluorescence protein; MBP, myelin basic protein; MEK, MAPK/ERK kinase, MKP3, MAPK phosphatase-3; TPA, tetradecanoyl phorbol acetate; EGF, epidermal growth factor; PCR, polymerase chain reaction; DTT, dithiothreitol; CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Seger, R., and Krebs, E. G. (1995) FASEB J. 9, 726-735 |
| 2. | Ferrell, J. E., Jr. (1998) Trends Biochem. Sci. 23, 461-465 |
| 3. | Lewis, T. S., Shapiro, P. S., and Ahn, N. G. (1998) Adv. Cancer Res. 74, 49-139 |
| 4. | Cobb, M. (1999) Prog. Biophys. Mol. Biol. 71, 479-500 |
| 5. | Leevers, S. J., Paterson, H. F., and Marshall, C. J. (1994) Nature 369, 411-414 |
| 6. | Sternberg, P. W., and Alberola-Ila, J. (1998) Cell 95, 447-450 |
| 7. | Jaaro, H., Rubinfeld, H., Hanoch, T., and Seger, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3742-3747 |
| 8. | Chen, R. H., Sarnecki, C., and Blenis, J. (1992) Mol. Cell. Biol. 12, 915-927 |
| 9. | Adachi, M., Fukuda, M., and Nishida, E. (2000) J. Cell Biol. 148, 849-856 |
| 10. | Fukuda, M., Gotoh, I., Gotoh, Y., and Nishida, E. (1996) J. Biol. Chem. 271, 20024-20028 |
| 11. | Lenormand, P., Brondello, J. M., Brunet, A., and Pouyssegur, J. (1998) J. Cell Biol. 142, 625-633 |
| 12. | Fukuda, M., Gotoh, I., Adachi, M., Gotoh, Y., and Nishida, E. (1997) J. Biol. Chem. 272, 32642-32648 |
| 13. | Traverse, S., Gomez, N., Paterson, H., Marshall, C., and Cohen, P. (1992) Biochem. J. 288, 351-355 |
| 14. | Brunet, A., Roux, D., Lenormand, P., Dowd, S., Keyse, S., and Pouyssegur, J. (1999) EMBO J. 18, 664-674 |
| 15. | Swanson, K. D., Taylor, L. K., Haung, L., Burlingame, A. L., and Landreth, G. E. (1999) J. Biol. Chem. 274, 3385-3395 |
| 16. | Reszka, A. A., Seger, R., Diltz, C. D., Krebs, E. G., and Fischer, E. H. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8881-8885 |
| 17. | Fukuda, M., Gotoh, Y., and Nishida, E. (1997) EMBO J. 16, 1901-1908 |
| 18. | Rubinfeld, H., Hanoch, T., and Seger, R. (1999) J. Biol. Chem. 274, 30349-30352 |
| 19. | Lenormand, P., Sardet, C., Pages, G., L'Allemain, G., Brunet, A., and Pouyssegur, J. (1993) J. Cell Biol. 122, 1079-1088 |
| 20. | Adachi, M., Fukuda, M., and Nishida, E. (1999) EMBO J. 18, 5347-5358 |
| 21. | Khokhlatchev, A. V., Canagarajah, B., Wilsbacher, J., Robinson, M., Atkinson, M., Goldsmith, E., and Cobb, M. H. (1998) Cell 93, 605-615 |
| 22. | Yao, Z., Dolginov, Y., Hanoch, T., Yung, Y., Ridner, G., Lando, Z., Zharhary, D., and Seger, R. (2000) FEBS Lett. 468, 37-42 |
| 23. | Yung, Y., Dolginov, Y., Yao, Z., Rubinfeld, H., Michael, D., Hanoch, T., Roubini, E., Lando, Z., Zharhary, D., and Seger, R. (1997) FEBS Lett. 408, 292-296 |
| 24. | Bott, C. M., Thorneycroft, S. G., and Marshall, C. J. (1994) FEBS Lett. 352, 201-205 |
| 25. | Camps, M., Nichols, A., Gillieron, C., Antonsson, B., Muda, M., Chabert, C., Boschert, U., and Arkinstall, S. (1998) Science 280, 1262-1265 |
| 26. | Tanoue, T., Adachi, M., Moriguchi, T., and Nishida, E. (2000) Nat. Cell Biol. 2, 110-116 |
| 27. | Silverman, M. A., Benard, O., Jaaro, H., Rattner, A., Citri, Y., and Seger, R. (1999) J. Biol. Chem. 274, 2631-2636 |
| 28. | Whitmarsh, A. J., Cavanagh, J., Tournier, C., Yasuda, J., and Davis, R. J. (1998) Science 281, 1671-1674 |
| 29. | Brunet, A., and Pouyssegur, J. (1996) Science 272, 1652-1655 |
| 30. | Wilsbacher, J. L., Goldsmith, E. J., and Cobb, M. H. (1999) J. Biol. Chem. 274, 16988-16994 |
| 31. | Eblen, S. T., Catling, A. D., Assanah, M. C., and Weber, M. J. (2001) Mol. Cell. Biol. 21, 249-259 |
| 32. | Bardwell, A. J., Flatauer, L. J., Matsukuma, K., Thorner, J., and Bardwell, L. (2001) J. Biol. Chem. 276, 10374-10386 |
| 33. | Schaeffer, H. J., Catling, A. D., Eblen, S. T., Collier, L. S., Krauss, A., and Weber, M. J. (1998) Science 281, 1668-1671 |
| 34. | Moore, M. S., and Blobel, G. (1994) Trends Biochem. Sci. 19, 211-216 |
This article has been cited by other articles:
![]() |
D. Chuderland, G. Marmor, A. Shainskaya, and R. Seger Calcium-mediated Interactions Regulate the Subcellular Localization of Extracellular Signal-regulated Kinases J. Biol. Chem., April 25, 2008; 283(17): 11176 - 11188. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bendetz-Nezer and R. Seger Role of Non-phosphorylated Activation Loop Residues in Determining ERK2 Dephosphorylation, Activity, and Subcellular Localization J. Biol. Chem., August 24, 2007; 282(34): 25114 - 25122. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Burgermeister, D. Chuderland, T. Hanoch, M. Meyer, M. Liscovitch, and R. Seger Interaction with MEK Causes Nuclear Export and Downregulation of Peroxisome Proliferator-Activated Receptor {gamma} Mol. Cell. Biol., February 1, 2007; 27(3): 803 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Burza, I. Pekala, J. Sikora, P. Siedlecki, P. Malagocki, M. Bucholc, L. Koper, P. Zielenkiewicz, M. Dadlez, and G. Dobrowolska Nicotiana tabacum Osmotic Stress-activated Kinase Is Regulated by Phosphorylation on Ser-154 and Ser-158 in the Kinase Activation Loop J. Biol. Chem., November 10, 2006; 281(45): 34299 - 34311. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tarrega, P. Rios, R. Cejudo-Marin, C. Blanco-Aparicio, L. van den Berk, J. Schepens, W. Hendriks, L. Tabernero, and R. Pulido ERK2 Shows a Restrictive and Locally Selective Mechanism of Recognition by Its Tyrosine Phosphatase Inactivators Not Shared by Its Activator MEK1 J. Biol. Chem., November 11, 2005; 280(45): 37885 - 37894. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tang, X. Qi, D. Mercola, J. Han, and G. Chen Essential Role of p38{gamma} in K-Ras Transformation Independent of Phosphorylation J. Biol. Chem., June 24, 2005; 280(25): 23910 - 23917. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Azriel-Tamir, H. Sharir, B. Schwartz, and M. Hershfinkel Extracellular Zinc Triggers ERK-dependent Activation of Na+/H+ Exchange in Colonocytes Mediated by the Zinc-sensing Receptor J. Biol. Chem., December 10, 2004; 279(50): 51804 - 51816. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Aebersold, Y. D. Shaul, Y. Yung, N. Yarom, Z. Yao, T. Hanoch, and R. Seger Extracellular Signal-Regulated Kinase 1c (ERK1c), a Novel 42-Kilodalton ERK, Demonstrates Unique Modes of Regulation, Localization, and Function Mol. Cell. Biol., November 15, 2004; 24(22): 10000 - 10015. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Raviv, E. Kalie, and R. Seger MEK5 and ERK5 are localized in the nuclei of resting as well as stimulated cells, while MEKK2 translocates from the cytosol to the nucleus upon stimulation J. Cell Sci., May 1, 2004; 117(9): 1773 - 1784. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Tu and F. S. Lee Subdomain VIII Is a Specificity-determining Region in MEKK1 J. Biol. Chem., November 28, 2003; 278(48): 48498 - 48505. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Robinson, A. W. Whitehurst, M. Raman, and M. H. Cobb Identification of Novel Point Mutations in ERK2 That Selectively Disrupt Binding to MEK1 J. Biol. Chem., April 19, 2002; 277(17): 14844 - 14852. [Abstract] [Full Text] [PDF] |
||||
![]() |
|