JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M103352200 on April 27, 2001

J. Biol. Chem., Vol. 276, Issue 27, 24490-24497, July 6, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/27/24490    most recent
M103352200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolf, I.
Right arrow Articles by Seger, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolf, I.
Right arrow Articles by Seger, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Involvement of the Activation Loop of ERK in the Detachment from Cytosolic Anchoring*

Ido WolfDagger§, Hadara RubinfeldDagger, Seunghee Yoon, Goldie Marmor, Tamar Hanoch, and Rony Seger

From the Department of Biological Regulation, The Weizmann Institute of Science, Rehovot 76100, Israel

Received for publication, April 16, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The Extracellular signal-regulated kinases (ERKs) are translocated into the nucleus in response to mitogenic stimulation. The mechanism of translocation and the residues in ERKs that govern this process are not clear as yet. Here we studied the involvement of residues in the activation loop of ERK2 in determining its subcellular localization. Substitution of residues in the activation loop to alanines indicated that residues 173-181 do not play a significant role in the phosphorylation and activation of ERK2. However, residues 176-181 are responsible for the detachment of ERK2 from MEK1 upon mitogenic stimulation. This dissociation can be mimicked by substitution of residues 176-178 to alanines and is prevented by deletion of these residues or by substitution of residues 179-181 to alanines. On the other hand, residues 176-181, as well as residues essential for ERK2 dimerization, do not play a role in the shuttle of ERK2 through nuclear pores. Thus, phosphorylation-induced conformational rearrangement of residues in the activation loop of ERK2 plays a major role in the control of subcellular localization of this protein.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Among the key steps in the signaling mechanism of mitogen-activated protein kinase (MAPK)1 cascades are the changes in subcellular localization of their components upon extracellular stimulation (reviewed in Refs. 1-4). These relocalization processes are best characterized for protein kinases in the extracellular signal-regulated kinase (ERK) cascade, which seem to be localized primarily in the cytosol of resting cells. Upon mitogenic stimulation, Raf1 is recruited to the plasma membrane (5) where it is activated by a mechanism that is not fully understood (6). On the other hand, most of the protein kinases downstream of Raf-1 in the cascade, namely MEK1/2 (7), ERK1/2 (ERKs), and RSK1-3 (8) translocate into the nucleus upon stimulation. Although it is still controversial whether the translocation of MEKs requires an active process (7, 9), it is clear that MEKs are rapidly exported from the nucleus soon after their translocation. This rapid export from the nucleus is mediated by a CRM1-dependent nuclear export signal (10), which results in an apparent cytosolic localization of MEKs before and after stimulation (11). ERKs and RSK1-3, on the other hand, are retained in the nucleus for longer times after stimulation. Interestingly, the proper subcellular localization of the various components has been shown to play an important role in regulating the physiological functions of the ERK cascade. Thus, prevention of nuclear localization of constitutively active MEK1/2 reduced its oncogenic potential (12), and nuclear localization of ERKs has been correlated with mitogenesis and neurite outgrowth in PC12 cells (13). Moreover, prevention of the nuclear translocation of ERKs strongly inhibited gene transcription (14), and RSK2 activity in the nucleus was found necessary for EGF-induced transcription of c-fos gene (15).

In resting cells, both ERK1 and ERK2 are localized in the cytosol due to interaction with various anchoring proteins, including microtubules, phosphatases, and a MEK-dependent retention (14, 16-18). The association with some of these proteins such as inactive MKP3 (14) or microtubules (16) is not reversible upon activation. However, most of the ERK molecules (70-85%) appear to dissociate from their cytosolic anchors upon stimulation and translocate into the nucleus. This translocation, is rapid (seen in 5 min), reversible (19), and may involve two distinct mechanisms of nuclear import (20). One is a passive, non-regulated mechanism, and the other is a faster, active process that may involve ERK dimerization (21). The active translocation of ERKs seems to require phosphorylation of at least one molecule of the translocating dimer on its regulatory Tyr residue (11, 20, 21). The translocated ERKs accumulate in the nucleus, where a large amount of ERKs can be observed even after their activity has declined (22, 23). This observation may suggest that the nucleus is a major site for phosphatase-mediated down-regulation of ERKs shortly after translocation. It has recently been suggested that the inactive ERK is circulated back to the cytosol by a mechanism that involves nuclear shuttling of MEKs (9).

We have previously identified a primary sequence important for MEK1-induced cytoplasmic retention of ERKs in resting cells that we termed cytosolic retention sequence (CRS), comprising amino acids 312-320 of ERK2 (18). This region contains residue Asp-319, which is known to play a role in interaction with phosphatases (24, 25), and, recently, residues in this region were identified as a common docking (CD) domain for other MAPK-interacting proteins as well (26). However, the wide variety of functions assigned to this region and its high degree of similarity with other MAPKs suggest that other sequences should be involved in the association of ERKs with cytosolic-anchoring proteins. Moreover, the residues and the mechanism responsible for the stimulation-induced dissociation of ERKs from the anchoring proteins are not clear as yet. Here we studied the involvement of residues in the activation loop of ERK2 in the determination of its subcellular localization. We found that this dissociation is dependent on residues 176-181 of ERK2, although these residues do not play a significant role in the phosphorylation and activation of ERK2 upon stimulation. The dissociation was also dependent on the regulatory phosphorylation of ERK2 in its activation loop. However, substitution of residues in this region to alanines did not alter either the stimulated or non-regulated shuttle of ERK2 through nuclear pores. These results indicate that the translocation of ERK2 is mainly regulated through a stimulation-induced dissociation from its cytosolic anchoring due to conformational change in the activation loop.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Constructs

GFP-ERK2-- The cDNA of rat ERK2 (bases 22-1096) was ligated into ApaI and BamHI sites downstream to the GFP gene of pEGFP-C1 (CLONTECH), thus forming a GFP-ERK2 construct in which the N terminus of ERK2 is modified (18). All the subsequent modifications were performed by PCR mutagenesis (27), incorporated into the GFP-ERK2 construct, and fully sequenced to confirm the mutations.

GFP-173A-- Residues 173-175 of ERK2 were modified to alanines using the 3'-primer, TACCAACGCGTGGCTACATACTCTGTCAAGAACCCTGTATGATCATGGGCTGCAGCTGCAACACGGGC (containing a PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.

GFP-176A-- Residues 176-178 of ERK2 were modified to alanines using the 3'-primer, TACCAACGCGTGGCTACATACTCTGTCAAGAACCCTGTAGCAGCAGCGTCTGGATCTGCAAC (containing a PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.

GFP-Delta 176-- Residues 176-178 of ERK2 were deleted using the 3'-PCR primer, TACCAACGCGTGGCTACATACTCTGTCAAGAACCCTGTGTCTGGATCTGCAAC (containing a PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.

GFP-179A-- Residues 179-181 of ERK2 were modified to alanines using the 3'-primer, TACCAACGCGTGGCTACATACTCTGTCAACGCCGCTGCATGATCATGGTCTGG (containing a PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.

GFP-183A-- Residues 183-185 of ERK2 were modified to alanines using the 3'-primer, TACCAACGCGTGGCTACAGCCGCTGCCAAGAACCCTGT (containing a PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.

GFP-ALC-- Residues 170-190 of ERK2 were replaced with residues 213-228 of MEK1 using the 3'-primer, TCTGGAGCTCTGTACGAACGCGTACCTACGAAGGAGTTTGCCATTGAATCGATTAGCTGACCGGCAAGGCCAAAGT (containing a SacI site) and a 5'-PCR primer containing the SacI site of pEGFP-C1. The PCR product was ligated into SacI sites of GFP-ERK2.

GFP-HL-- Leucines 333, 336, 341, and 344 of ERK2 were modified to alanines using overlapping PCR (i) a 5'-PCR primer, GCACCTAAGGAGAAGGCCAAAGAAGCCATTTTTGAA, with a 3'-primer containing HpaI and (ii) a 3'-PCR primer, GGCCTTCTCCTTAGGTGCGTCGTCCGCCTCCATGTC, with 5'-primer containing a PflMI site. The overlapping PCR product was ligated into HpaI and PflMI sites of GFP-ERK2. Histidine 176 in this construct was modified to alanine using the 3'-primer, GTACCAAGTACCAATGGCTACATACTCTGTCAAGAACCCTGTATGATCAGCGTCTGGATCTGC (containing a PflMI site), and a 5'-PCR primer containing the ApaI site of ERK2.

WT-MEK-- MEK1 was prepared as previously described (18).

MKP3-C/S-- WT-MKP-3 was cloned by reverse transcriptase-PCR with primers TACGCTAGCATAGATACGCTCAGACCCGTG and TCGAGCGGCCGCTCACGTAGATTGCAGAGAGTC. The PCR product was ligated into NheI and NotI sites of pcDNA3-HA vector (Invitrogen). The C293S mutant was constructed by PCR with the primer CTTGGTACATTCCTTGGCTGGC.

Buffers

Buffer A consisted of 50 mM beta -glycerophosphate, pH 7.3, 1.5 mM EGTA, 1 mM EDTA, 1 mM DTT, and 0.1 mM sodium vanadate. Buffer H (homogenization buffer) contained 50 mM beta -glycerophosphate, pH 7.3, 1.5 mM EGTA, 1 mM EDTA, 1 mM DTT, 0.1 mM sodium vanadate, 1 mM benzamidine, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 2 µg/ml pepstatin-A. Buffer R (a reaction mixture at 3-fold final concentration) consisted of 30 mM MgCl2, 4.5 mM DTT, 75 mM beta -glycerophosphate, pH 7.3, 0.15 mM sodium vanadate, 3.75 mM EGTA, 30 µM calmidazolium, and 2.5 mg/ml bovine serum albumin.

Transfection and Localization Studies

The various GFP-ERKs plasmids were transfected into CHO cells using LipofectAMINE (Life Technologies, Inc.). When plasmid-expressing MEK1 was cotransfected with the various GFP-ERKs, ratio of 2:1 in the amount of DNA transfected was kept, respectively. When plasmid-expressing MKP-3 C/S was cotransfected with the various GFP-ERKs, a ratio of 4:1 in the amount of DNA transfected was kept, respectively. Visualization was performed essentially as described previously (7). Cells were stimulated with tetradecanoyl phorbol acetate (TPA; 250 nM, 5 min), fixed (3% paraformaldehyde), and visualized either by fluorescence microscopy (Zeiss Axioscop microscope, HBO 100 W/2; 400× magnification) or by confocal microscopy (Bio-Rad).

Western Blotting

Transfected cells were serum-starved (0.1% fetal calf serum) for 16 h. After stimulation, the cells were washed twice with ice-cold phosphate-buffered saline and once with ice-cold buffer A. Cells were harvested with buffer H followed by sonication (2 × 7 s, 40 watts) and centrifugation (15,000 × g, 15 min, 4 °C). The supernatants, which contained cytosolic proteins, were collected, and aliquots from each sample (20 µg) were separated on 10% SDS-PAGE followed by Western blotting. Activated ERK was detected by probing blots with anti-activated ERK monoclonal antibody (DP-ERK, Sigma, Israel) or antibody PT/DP-ERK (Sigma, Israel, clone 115). Total ERK protein was detected by anti-MAPK antibody (Sigma, Israel). MEK1 was detected with anti-MEK1 monoclonal antibody (Transduction Laboratories).

Immunoprecipitation

Transfected CHO cells were serum-starved (16 h), stimulated (TPA, 5 min), and harvested as described above. The cell extracts were then subjected to immunoprecipitation with anti-GFP monoclonal antibody (Roche Molecular Biochemicals). For MEK1 coimmunoprecipitation studies, the beads were washed as described (10) with low stringency buffer (20 mM HEPES, pH 8.0, 2 mM MgCl2, 2 mM EGTA) and then subjected to immunoblotting with monoclonal anti-MEK and anti-GFP antibodies. For the determination of ERK activity, the beads were washed once with radioimmune precipitation buffer, twice with 0.5 M LiCl, and twice with buffer A as described (27). The immunoprecipitates were subjected to myelin basic protein (MBP) phosphorylation assay as described below.

Determination of ERK Activity

The immunoprecipitates of GFP-ERKs proteins obtained from the stimulated transfected CHO cells were mixed with MBP (8.4 µg) and buffer R that contained 100 µM [gamma -32P]ATP (1-2 cpm/fmol) in a final volume of 30 µl. The phosphorylation reaction was allowed to proceed at 30 °C for 20 min, after which it was terminated by sample buffer and boiling for 5 min. Phosphorylation of MBP was assessed by 15% SDS-PAGE and autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Subcellular Localization of ERK2 and Its Inactive Mutant-- In response to mitogenic stimulation, ERKs are translocated from the cytosol into the nucleus (8). To characterize this dynamic change in subcellular localization we have previously (18) fused green fluorescence protein (GFP) to the N-terminal end of ERK2 (GFP-ERK2). We showed that overexpression of GFP-ERK2 in CHO cells results in a nuclear accumulation of the protein both before and after stimulation. Coexpression with MEK1 results in a cytosolic retention of the GFP-ERK2 in resting cells, and this is mediated by residues 312-320 of ERK2 (CRS). This localization is rapidly changed upon mitogenic stimulation of the cells, which causes a dissociation of ERK2 from its cytosolic anchor, and enables its translocation into the nucleus. To further study the molecular mechanisms that govern the subcellular localization of ERK2, we followed the changes in the subcellular localization of GFP-ERK2 shortly after transfection (6 h after the beginning of the transfection procedure and 1 h after its end). Under these conditions, GFP-ERK2 was equally distributed all over the resting cells (Fig. 1A), and TPA stimulation induced a rapid nuclear translocation of the majority of GFP-ERK2 molecules. In later time points after transfection (12-48 h after transfection) the total amount of GFP-ERK2 was increased, and the vast majority of it was detected in the nucleus both before and after TPA stimulation. These results can be explained by saturation of a limited number of endogenous cytosolic-anchoring proteins by newly synthesized GFP-ERK2 molecules. A slow rate nuclear translocation of an excess of synthesized GFP-ERK2 into the nucleus is probably responsible for the gradual accumulation of protein in the nucleus. However, stimulation is able to cause the detachment of the ERKs from their endogenous cytosolic anchor and induce a fast rate translocation that is completed within 5 min after stimulation (Fig. 1A). This system enabled us to follow interactions with endogenous anchoring proteins as well as the two rates of ERK2 translocation into the nucleus, which were reported to be a fast, stimulation-dependent rate and a non-regulated passive one (20).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1.   Localization of GFP-ERK2 and its inactive mutant in CHO cells. CHO cells were transfected (5 h with LipofectAMINE) with either GFP-ERK2 or GFP-ERK2 in which residues 183-185 were replaced with alanine (TEY/AAA) either without (A) or with (B) MEK1. After the end of transfection, the cells were either transferred into a starvation medium (A) for 1 h (total of 6 h) and for 7 h (12 h), or transferred to a growing medium for 32 h followed by serum starvation for an additional 16 h (A, 48 h and B). The cells were then either left untreated (-TPA, 0) or stimulated with TPA (+TPA; 250 nM) for 5 min (A, B) and 15 min (B), after which the cells were washed, fixed, and visualized as described under "Materials and Methods."

Construction and Biochemical Analysis of Activation Loop Mutants of ERK2-- As previously reported (17, 18), coexpression of GFP-ERK2 and MEK1 resulted in a cytosolic distribution of the GFP-ERK2 (Fig. 1B), and this was reversed by TPA stimulation. When the inactive mutant of ERK2, in which the regulatory Thr and Tyr residues were replaced by alanines, was coexpressed with MEK1, TPA failed to induce nuclear translocation of the mutated ERK2, indicating that phosphorylation of ERK2 is essential for its nuclear translocation. Therefore, we undertook to analyze the role of the activation loop of ERK2 in both its stimulated and passive nuclear translocation processes. To do so we constructed sequential mutations in the activation loop, and as previously described for ERK2 (18), the constructs were fused to GFP to enable their easy detection. The mutations introduced (Fig. 2) were: (i) substitution of amino acids 173-175 to alanines (GFP-173A); (ii) substitution of amino acids 176-178 to alanines (GFP-176A); (iii) substitution of amino acids 179-181 to alanines (GFP-179A); (iv) substitution of amino acids 183-185 to alanines (GFP-183A). Other mutations introduced (Fig. 2) were (i) deletion of amino acids 176-178 (GFP-Delta 176) to further study the role of these residues in the subcellular localization; (ii) replacement of the residues required for homodimerization of ERK2 (His-176, Leu-333, Leu-336, Leu-341, and Leu-344 (21)) termed GFP-HL; and (iii) replacement of the whole activation loop of ERK2 (residues 170-190) with the activation loop of MEK1, thus forming an activation loop chimera (GFP-ALC).


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2.   Schematic representation of the activation loop mutants of ERK2. Site of mutation of GFP-173A, GFP-176A, GFP-Delta 176, GFP-179A, and GFP-183A is indicated. The phosphorylated residues 183 and 185 are indicated with P. GFP-ALC was prepared by substitution of residues 170-190 with the homologous residues from MEK. The residues that were substituted to alanines in HL-GFP are indicated by asterisks.

We examined the activation and catalytic activity of the above mutants by transfecting them into CHO cells. Thirty-two hours after transfection, the cells were serum-starved (0.1% serum) for 16 h and then were either stimulated with TPA or left untreated. All the mutants were expressed to a similar level, as judged by their detection with anti-general ERK antibody at the expected size of ~70 kDa (Fig. 3). Western blot with anti-diphospho-ERK antibody revealed that 173A, 176A, Delta 176, and HL were phosphorylated as much as the wild type ERK2, whereas no phosphorylation was detected with 179A, 183A, and ALC. Staining of the GFP-ALC with anti-phospho-MEK antibody did not yield any appreciable staining, indicating that it could not be activated under the conditions used. However, staining with another anti-diphospho-ERK antibody detected a TPA-induced phosphorylation on GFP-179A (Fig. 3B) but not on GFP-183A or GFP-ALC, and similar detection was obtained with anti-phospho-Tyr antibody (data not shown). These results indicate that the GFP-179A construct is phosphorylated in response to TPA on both regulatory Thr and Tyr, and the lack of recognition by the initial anti-diphospho-ERK antibody was probably due to the specificity of the antibody.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 3.   Phosphorylation state of GFP-ERK2 and its activation loop mutants. CHO cells were transfected with the indicated constructs. Thirty-two hours after transfection the cells were serum-starved for 16 h and then were either left untreated (-) or stimulated with TPA (+; 250 nM, 5 min). A, cell lysates were prepared as described under "Materials and Methods" and analyzed with anti-diphosphorylated ERK antibody (alpha -DP-ERK, upper panel) or anti-GFP antibody (alpha -GFP, lower panel). B, cell lysates of GFP-ERK2 and GFP-179A were prepared and analyzed with anti-diphosphorylated/threonine-phosphorylated ERK antibody (clone 115, Sigma). G-ERKs indicates the position of GFP-ERK2, and ERK1 and ERK2 indicate the positions of the endogenous ERK1 and ERK2. The results are taken from three distinct gels that were simultaneously developed. These results were reproduced five times.

The catalytic activity of the constructs was then examined by immunoprecipitation of the proteins expressed in CHO cells with anti-GFP antibody followed by an in vitro kinase assay toward MBP. The specific catalytic activity observed with GFP-ERK2 upon TPA stimulation was comparable to that of endogenous ERKs (~150 nmol/min/mg, data not shown). This activity was not significantly changed when overexpressed GFP-HL or GFP-179A constructs were examined and was slightly elevated (25 ± 7%) with GFP-Delta 176 (Fig. 4). On the other hand, the activity of GFP-173A and GFP-176A was lower than that of GFP-ERK2 (35 ± 12% and 50 ± 10%, respectively), and GFP-183A, as well as GFP-ALC, did not display any detectable catalytic activity.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4.   Activity of GFP-ERK2 and its activation loop mutants. CHO cells were transfected with the indicated constructs. Thirty-two hours after transfection, the cells were serum-starved for 16 h and then were either left untreated (-) or stimulated with TPA (+; 250 nM, 5 min). Cell lysates were prepared as described under "Materials and Methods" and subjected to immunoprecipitation with monoclonal anti-GFP antibody. The catalytic activity of the different GFP-ERKs was assayed by an in vitro kinase assay using MBP as a substrate, as described under "Materials and Methods." Samples were separated by SDS-PAGE and blotted onto nitrocellulose. Blots were probed with monoclonal anti-GFP antibody (lower panel). Radioactivity was determined by 24-h exposure to x-ray film (MBP Phos.; upper panel). MBP indicates the place of phosphorylated MBP, and G-ERKs indicates the position of the immunoprecipitated GFP-ERKs. The results are taken from two distinct gels that were simultaneously developed. These results were reproduced four times.

Subcellular Localization of the Activation Loop Mutants of ERK2-- We then undertook to study the subcellular localization of the various activation loop-mutated proteins in the presence of MEK1. Thus, each of the GFP-conjugated ERK2 constructs was cotransfected into CHO cells together with MEK1 and visualized 48 h after transfection. As expected, GFP-ERK2 was localized in the cytosol of resting cells and translocated into the nucleus shortly after TPA stimulation (see Fig. 1). However, the only mutant that behaved similarly to GFP-ERK2 was GFP-173A (Fig. 5). As expected, the inactive GFP-183A and GFP-ALC were unable to leave the cytosolic compartment of the CHO cells (Fig. 1 and Ref. 20). Interestingly, GFP-176A was localized in the nucleus both before and after TPA stimulation (Fig. 5), whereas GFP-Delta 176 was restricted to the cytosol. Other residues that appear to be important in the subcellular localization of ERK2 are residues 179-181, because GFP-179A, which could be phosphorylated and activated upon TPA treatment, failed to translocate into the nucleus after this stimulation. Finally, the dimerization-deficient GFP-HL was equally distributed throughout the resting cells and very rapidly translocated into the nucleus upon stimulation, indicating that His-176 and possibly also the four C-terminal Leu residues are important for the association of ERK2 with MEK1 and are probably not essential for TPA-induced translocation.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 5.   Localization of GFP-ERK2 and its activation loop mutants in CHO cells upon cotransfection with MEK1. CHO cells were transfected with each of the indicated constructs together with plasmid containing MEK1. Thirty-two hours after transfection, the cells were serum starved for 16 h and then were either left untreated (basal) or stimulated with TPA (250 nM, 5 min), after which the cells were fixed and visualized using conventional and confocal fluorescence microscopy. Each of the experiments was reproduced at least five times.

As previously reported (18), overexpression of GFP-ERK2 without MEK1 for 48 h resulted in nuclear accumulation of most expressed molecules (Fig. 6). Similar to GFP-ERK2, all the GFP-conjugated mutants of ERK2 tested here were detected in the nuclei of resting CHO cells both before (Fig. 6) and after (data not shown) stimulation. These results may indicate that all mutants have the capability to enter into the nucleus of resting cells, probably due to a non-regulated mechanism (20). Their accumulation in the nucleus can be explained by the fact that they attach to nuclear-anchoring proteins (11), because endogenous MEK1, which can serve as a nuclear export vehicle for ERK2 (9), was not able to induce any appreciable nuclear export of the overexpressed ERK2.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6.   Localization of GFP-ERK2 and its activation loop mutants in CHO cells 48 h after transfection without MEK1. CHO cells were transfected with each of the indicated constructs. After transfection the cells were transferred into a growing medium for 32 h and then to starvation medium for 16 h. The cells were then washed, fixed, and visualized as described. Each of the experiments was reproduced at least five times.

To examine whether the interaction of the ERK2 mutants with endogenous anchoring proteins is similar to their interaction with overexpressed MEK1, we examined the subcellular localization of the ERK2 mutants 6 h after the beginning of transfection without the MEK1 construct. The results obtained with this system correlated nicely with those obtained when the mutants were cotransfected with MEK1 above. Thus, as much as the GFP-ERK2, also GFP173A, GFP-Delta 176, GFP-179A, GFP-183A, and GFP-ALC were equally distributed throughout the resting cells, indicating that retention of part of the synthesized molecules occurs (Fig. 7). On the other hand, GFP-176A and the GFP-HL, which were not retained in the cytosol by MEK1, were also localized primarily in the nucleus in this system, indicating that they lost their ability to interact with endogenous retention proteins. We then treated the cells with TPA and found that this induced nuclear translocation of GFP-ERK2 and GFP-173A, whereas GFP-176A and GFP-HL remained localized in the nucleus. Again, in agreement with the results obtained with the MEK1 cotransfection system (Fig. 5), GFP-Delta 176, GFP-179A, GFP-183A, and GFP-ALC remained spread over all of the cell and were unable to translocate into the nucleus even in the absence of overexpressed MEK1. Thus, our results indicate that the endogenous retention proteins behave similarly to MEK1. The detachment from these proteins, like that from MEK1, was dependent on residues 176-181, and the substitution of residues 176-178 to alanines mimics this detachment. The subcellular localization of the various ERK mutants was also examined after stimulation with peroxovanadate and gave similar results to those obtained after TPA stimulation (data not shown). Therefore, the mechanisms that govern ERK dissociation from the cytosolic anchor are probably general and are independent on the type of cellular stimulation.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 7.   Localization of GFP-ERK2 and its activation loop mutants in CHO cells 6 h after the beginning of transfection without MEK1. CHO cells were transfected for 5 h using LipofectAMINE, with each of the indicated constructs. After the end of transfection the cells were transferred into a starvation medium for 1 h. The cells were then either left untreated (basal) or stimulated with TPA (250 nM) for 5 min, after which the cells were washed, fixed, and visualized as described. Each of the experiments was reproduced at least four times.

Coimmunoprecipitation of Activation Loop Mutants with MEK1-- We then assayed the activation loop mutants for their ability to interact with MEK1 in a coimmunoprecipitation assay. Thus, GFP-ERK2 and the various mutants were cotransfected into CHO cells together with MEK1, serum-starved for 16 h, and then either left untreated or stimulated with TPA for 5 min. At this stage, the cells were gently lysed, and GFP-ERKs were immunoprecipitated with anti-GFP antibodies. The washes of the immunocomplexes were extremely mild (17), and those were subjected to SDS-PAGE and Western blot analysis with both anti-MEK1 and anti-GFP antibodies. As expected, immunoprecipitation of GFP-ERK2 was able to pull-down some amount of MEK1, which was reduced upon treatment with TPA (Fig. 8). As detected in the subcellular localization studies above, the only construct that behaved in a similar way to the GFP-ERK2 was GFP-173A. On the other hand, GFP-Delta 176, 179A, 183A, and GFP-ALC did not seem to dissociate from MEK1 upon stimulation, whereas GFP-176A as well as GFP-HL did not associate with MEK1 to any appreciable level even under basal conditions. The correlation between the association with MEK1 (Fig. 8) and the nuclear translocation of the ERK constructs (Figs. 5 and 7) indicates that the cytosolic interaction with MEK1 is the main parameter that determines the subcellular localization of the ERK2.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8.   Coimmunoprecipitation of ERK2 and its activation loop mutants with MEK1. CHO cells were transfected with each of the indicated constructs together with plasmid-expressing MEK1. Thirty-two hours after transfection the cells were serum-starved for 16 h and then were either left untreated (-) or stimulated with TPA (+, 250 nM, 5 min). Lysates from all conditions were subjected to immunoprecipitation with monoclonal anti-GFP antibody. After SDS-PAGE, samples were immunoblotted with monoclonal anti-MEK (alpha -MEK) and monoclonal anti-GFP antibodies (alpha -GFP). GFP-ERK2 and MEKs represent their respective positions. The amount of MEK in each of the extracts used for coimmunoprecipitation was roughly equal (data not shown). The two panels represent two independent experiments. Each of the experiments was reproduced at least four times.

Interaction of the Activation Loop Mutants with MKP3-- Several proteins have recently been shown to act as irreversible cytosolic anchors for ERKs, including cytoskeletal elements (16), and protein Tyr phosphatases (14). We studied the ability of the various ERK2 constructs to associate with the inactive form of MAPK phosphatase 3 (MKP3-C/S (14)). Cytosolic localization of GFP-ERK2 was detected when it was coexpressed with MKP3 in CHO cells, and this localization was not reversed by TPA stimulation. MKP3 failed to anchor GFP-312A (substitution of residues 312-319 of ERK2 to alanines (18)) in the cytosol, indicating that, similar to MEKs, the main binding of ERK2 to MKP3 occurs at residues 316-319 (26). However, unlike the results with MEK1 above, when coexpressed with MKP3, all the activation loop mutants of ERK2 behaved in a similar manner to the GFP-ERK2 and localized to the cytosol both before and after TPA stimulation (Fig. 9). These results indicate that, although the activation loop plays a role in the association of ERK2 with MEK1, it does not contribute to the association of ERK2 to MKP3-C/S. Moreover, in light of the inability of ERK2 to dissociate from MKP3-C/S upon TPA stimulation, these results support our suggestion that the activation loop is responsible for the stimulation-induced dissociation of ERK2 from its cytosolic anchor.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The requirement of catalytic activation for the nuclear translocation of ERKs prompted our studies on the importance of residues in the activation loop of ERK2 for its activation, dissociation from MEK, and translocation into the nucleus. Here we designed a series of mutations that covered the activation loop of ERK2. To our surprise, mutations in residues 173-181, which are very close to the regulatory Thr-183 and Tyr-185 had only a small effect on the phosphorylation and activation of ERK2 (Figs. 3 and 4). The only constructs that were inactive were GFP-183A and GFP-ALC, which lacked the regulatory Tyr and Thr residues and thus served as an inactive control in our study.

We then studied the MEK1-dependent subcellular localization of the various activation loop mutants of ERK2. It has previously been reported (17) that MEKs may directly interact with ERKs and thus retain them in the cytosol. However, because of the weak nature of the association between the two proteins (18), it is possible that this association is not direct but mediated via a scaffold protein (28). Our results revealed that, as reported (20), non-phosphorylatable mutants (183A, ALC) did not dissociate from MEK1 (Fig. 8) and did not translocate into the nucleus after stimulation (Fig. 5). Beside the inactive constructs, also changes in residues 176-181 modified the MEK1-dependent subcellular localization of ERK2. Thus, when residues 176-178 were substituted to alanines, there was no interaction with MEK1, and this correlated with a nuclear accumulation of the ERK2 construct. However, deletion of the same residues resulted in an irreversible association with MEK1, which caused a cytoplasmic localization both before and after TPA stimulation. These results are best explained by assuming that these residues are important for the dissociation of ERK2 from MEK1. Thus, as for GFP-ERK2, the association of GFP-Delta 176 with MEK1 is mediated by the CRS at residues 312-320 of ERK2 (18). Hence, the inability of GFP-Delta 176 to dissociate from MEK1 in response to stimulation can be explained by an ability of residues 176-178 to serve as a lever that allows dissociation from MEK1. Substitution of the 176-178 residues to alanine probably mimics the activated conformation of ERK2 and therefore does not allow association between the two proteins even though the CRS region was intact. This suggestion is supported by the fact that substitution of these residues with Gly residues gave a similar response as GFP-Delta 176 and not as GFP-176A (data not shown). Moreover, GFP-176A could interact with MKP3-C/S (through CRS Fig. 9), without interference of the alanines at position 176-178. As the association with MKP3-C/S is not reversible, there is no influence of residues that prompt dissociation and therefore no dissociation of the construct (GFP-176A) that mimics the MEK1-dissociated form of ERK2 was observed. Interestingly, substitution of residues 179-181 to alanines also demonstrated an irreversible association with MEK1 and it is likely therefore that residues 176-181 are all involved in the stimulated dissociation.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 9.   The subcellular localization of GFP-ERK2 and its activation loop mutants upon cotransfection with MKP3 C/S. CHO cells were transfected with each of the indicated constructs together with plasmid containing MKP3-C/S. Thirty-two hours after transfection, the cells were serum-starved for 16 h and then were either left untreated (basal) or stimulated with TPA (250 nM, 5 min), after which the cells were fixed and visualized using conventional and confocal fluorescence microscopy. Each of the experiments was reproduced at least five times.

In addition to the involvement of residues 176-181 in the dissociation of ERK2 from MEK1, these residues play a role in determining the specificity of interaction between the proteins. Since CD domain of ERKs seems to be similar to the same region in other MAPKs, it was predicted (26) that other regions will be responsible for the specificity of binding of the MAPKs to the particular MAPKKs. Thus, our findings that residues 176-181 are important for the dissociation from MEK1 but not from MKP3-C/S may indicate that these residues participate also in the determination of specificity of ERKs to MEKs.

The region of the activation loop identified here joins a list of other regions of ERKs that were postulated to be important for the association between ERK and MEKs. These are residues in subdomain III of ERKs (29), multiple regions in the N and C termini of ERKs (30), amino acids 19-25 of ERK2 (31), and residues 312-320 (18), among which residues 316 and 319 (26) seem to play the most important role in the interaction with MEKs. It is clear that all these residues cannot interact with one molecule of MEK1 at the same time, because they are located in completely different areas of the ERK2 molecule. It is possible, however, that two types of interactions between ERK2 and MEK1 exist. One of these interactions is probably required for the immediate activation of ERK2 by MEK1 and could involve the regions in the same plane of the activation loop (30). The other interaction may involve the CRS (CD), which does not seem to play a significant role in the activation process of ERK2 (18, 26) but rather in its subcellular localization and sensitivity to phosphatases. Although there is accumulating evidence that ERK2 and MEK1 can directly interact with each other (17, 32), it is still possible that this interaction occurs via a third protein such as MP1 for ERK1 (33). In this case the stimulation-dependent dissociation observed in our experiments would not be from MEK1 itself but from this putative scaffolding protein.

The mechanism of ERK2 translocation into the nucleus can be divided into two stages. In the first step the enzyme is detached from its cytosolic anchor, whereas the second step consists of a shuttle through the nuclear envelope. The process of nuclear import is usually accomplished through nuclear pores that are easily accessible to proteins with molecular masses smaller than 40 kDa. Molecules with higher molecular masses usually shuttle through the nuclear envelope by an active mechanism that requires a complex network of proteins (34). Similar to previous findings (20), we show here that the 70-kDa GFP-ERK2 can translocate into the nucleus in two rates: a basal, non-regulated rate (Figs. 6 and Fig. 7, -TPA) and a TPA-stimulated fast rate (Figs. 5 and 7, +TPA). We believe that the molecular mass of the GFP-ERK2 proteins requires that both rates of translocation would be mediated by an active mechanism. All mutants used in the current study showed equal nuclear accumulation in resting cells (Fig. 6), indicating that the activation loop of ERK2 does not play a role in its slow rate nuclear translocation. It is therefore possible that the machinery responsible for the basal state of translocation operates in a low rate in resting cells and is activated by mitogenic stimulation of the cells. However, the stimulated translocation correlated with dissociation of the ERK2 constructs from MEK1. Although we cannot exclude a role of phosphorylation in the nuclear shuttling, our results suggest that the translocation of ERK2 into the nucleus is regulated primarily by its dissociation from MEK1 (20). Thus, once ERK2 detaches from MEK1, no additional signal is required for the translocation to occur.

It has previously been proposed that dimerization of ERK2 is required for its active nuclear transport and that phosphorylated ERK2 can form dimers with either phosphorylated or unphosphorylated ERK2 partners (21). Based on crystal structure of phosphorylated ERK2, mutants were constructed at the predicted interface shared by the two monomers. The mutant, H176E,L333A,L336A,L341A,L344A of ERK2, was identified, which lacked the ability to dimerize upon stimulation, and when microinjected into the cytosol of cells, could not translocate into the nucleus. Therefore, it has been suggested that these residues participate in homodimerization formation and are critical for the translocation process of ERK2. However, in our system the HL mutant in which these five residues were substituted to alanines accumulated in the nucleus, without overexpression of MEK1 (Figs. 6 and 7). When coexpressed with MEK1 the mutant was equally distributed throughout the transfected cells, and TPA stimulation induced its rapid nuclear translocation (Fig. 5). Thus, our results indicate that these residues or at least the His-176 participate neither in the non-regulated nor in the stimulated translocation of ERK2 into the nucleus. Although we cannot exclude the possibility that these residues are important for the homodimerization of ERK2, our results clearly demonstrate that these residues do not participate in the stimulated GFP-ERK2 nuclear translocation in our system. Rather, it appears that His-176, probably in conjunction with other residues, is important for the interaction of ERK2 with MEK1, and its conformational rearrangement upon stimulation is essential for the dissociation of these proteins.

In summary, we identified here six amino acids in the activation loop of ERK1, which appear to be important for the stimulation-induced dissociation of ERK2 from MEK1. Conformational change of these residues upon phosphorylation seems to be involved in the mechanism of release of ERK2 from its cytosolic anchor, and this can be mimicked by substitution of residues 176-178 to alanines. Surprisingly, residues 173-181 did not seem to play a significant role in the activatory phosphorylation of ERK2 by TPA. We also show here that ERK2 translocates into the nucleus in two rates, a non-regulated rate in resting cells and a fast rate upon mitogenic stimulation. The residues of the activation loop of ERK2, including the dimerization-promoting His-176, do not play a role in these two types of translocations. Therefore, our results suggest that the translocation of ERK2 into the nucleus is mainly regulated through the dissociation of ERK2 from cytosolic anchoring proteins, and this is mediated by residues in the activation loop of ERK2.

    FOOTNOTES

* This work was supported by grants from the Moross Institute for Cancer Research at the Weizmann Institute of Science, the Benozyio Institute for Molecular Medicine at the Weizmann Institute of Science, the Estate of Siegmund Landau, the Israel Academy of Sciences, and by grant 4949 from the Chief Scientists Office of the Ministry of Health, Israel (to I. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Both authors contributed equally to this work.

§ On leave from the Dept. of Internal Medicine E, Sheba Medical Center, Tel Hashomer, Israel.

To whom correspondence should be addressed: Dept. of Biological Regulation, The Weizmann Institute of Science, Rehovot 76100, Israel. Tel.: 972-8-9343602; Fax: 972-8-9344116; E-mail: rony.seger@weizmann.ac.il.

Published, JBC Papers in Press, April 27, 2001, DOI 10.1074/jbc.M103352200

    ABBREVIATIONS

The abbreviations used are: MAPK, mitogen-activated protein kinase; CD, common docking domain; CRS, cytosolic retention sequence; ERK, extracellular signal-regulated kinase; GFP, green fluorescence protein; MBP, myelin basic protein; MEK, MAPK/ERK kinase, MKP3, MAPK phosphatase-3; TPA, tetradecanoyl phorbol acetate; EGF, epidermal growth factor; PCR, polymerase chain reaction; DTT, dithiothreitol; CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Seger, R., and Krebs, E. G. (1995) FASEB J. 9, 726-735
2. Ferrell, J. E., Jr. (1998) Trends Biochem. Sci. 23, 461-465
3. Lewis, T. S., Shapiro, P. S., and Ahn, N. G. (1998) Adv. Cancer Res. 74, 49-139
4. Cobb, M. (1999) Prog. Biophys. Mol. Biol. 71, 479-500
5. Leevers, S. J., Paterson, H. F., and Marshall, C. J. (1994) Nature 369, 411-414
6. Sternberg, P. W., and Alberola-Ila, J. (1998) Cell 95, 447-450
7. Jaaro, H., Rubinfeld, H., Hanoch, T., and Seger, R. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3742-3747
8. Chen, R. H., Sarnecki, C., and Blenis, J. (1992) Mol. Cell. Biol. 12, 915-927
9. Adachi, M., Fukuda, M., and Nishida, E. (2000) J. Cell Biol. 148, 849-856
10. Fukuda, M., Gotoh, I., Gotoh, Y., and Nishida, E. (1996) J. Biol. Chem. 271, 20024-20028
11. Lenormand, P., Brondello, J. M., Brunet, A., and Pouyssegur, J. (1998) J. Cell Biol. 142, 625-633
12. Fukuda, M., Gotoh, I., Adachi, M., Gotoh, Y., and Nishida, E. (1997) J. Biol. Chem. 272, 32642-32648
13. Traverse, S., Gomez, N., Paterson, H., Marshall, C., and Cohen, P. (1992) Biochem. J. 288, 351-355
14. Brunet, A., Roux, D., Lenormand, P., Dowd, S., Keyse, S., and Pouyssegur, J. (1999) EMBO J. 18, 664-674
15. Swanson, K. D., Taylor, L. K., Haung, L., Burlingame, A. L., and Landreth, G. E. (1999) J. Biol. Chem. 274, 3385-3395
16. Reszka, A. A., Seger, R., Diltz, C. D., Krebs, E. G., and Fischer, E. H. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 8881-8885
17. Fukuda, M., Gotoh, Y., and Nishida, E. (1997) EMBO J. 16, 1901-1908
18. Rubinfeld, H., Hanoch, T., and Seger, R. (1999) J. Biol. Chem. 274, 30349-30352
19. Lenormand, P., Sardet, C., Pages, G., L'Allemain, G., Brunet, A., and Pouyssegur, J. (1993) J. Cell Biol. 122, 1079-1088
20. Adachi, M., Fukuda, M., and Nishida, E. (1999) EMBO J. 18, 5347-5358
21. Khokhlatchev, A. V., Canagarajah, B., Wilsbacher, J., Robinson, M., Atkinson, M., Goldsmith, E., and Cobb, M. H. (1998) Cell 93, 605-615
22. Yao, Z., Dolginov, Y., Hanoch, T., Yung, Y., Ridner, G., Lando, Z., Zharhary, D., and Seger, R. (2000) FEBS Lett. 468, 37-42
23. Yung, Y., Dolginov, Y., Yao, Z., Rubinfeld, H., Michael, D., Hanoch, T., Roubini, E., Lando, Z., Zharhary, D., and Seger, R. (1997) FEBS Lett. 408, 292-296
24. Bott, C. M., Thorneycroft, S. G., and Marshall, C. J. (1994) FEBS Lett. 352, 201-205
25. Camps, M., Nichols, A., Gillieron, C., Antonsson, B., Muda, M., Chabert, C., Boschert, U., and Arkinstall, S. (1998) Science 280, 1262-1265
26. Tanoue, T., Adachi, M., Moriguchi, T., and Nishida, E. (2000) Nat. Cell Biol. 2, 110-116
27. Silverman, M. A., Benard, O., Jaaro, H., Rattner, A., Citri, Y., and Seger, R. (1999) J. Biol. Chem. 274, 2631-2636
28. Whitmarsh, A. J., Cavanagh, J., Tournier, C., Yasuda, J., and Davis, R. J. (1998) Science 281, 1671-1674
29. Brunet, A., and Pouyssegur, J. (1996) Science 272, 1652-1655
30. Wilsbacher, J. L., Goldsmith, E. J., and Cobb, M. H. (1999) J. Biol. Chem. 274, 16988-16994
31. Eblen, S. T., Catling, A. D., Assanah, M. C., and Weber, M. J. (2001) Mol. Cell. Biol. 21, 249-259
32. Bardwell, A. J., Flatauer, L. J., Matsukuma, K., Thorner, J., and Bardwell, L. (2001) J. Biol. Chem. 276, 10374-10386
33. Schaeffer, H. J., Catling, A. D., Eblen, S. T., Collier, L. S., Krauss, A., and Weber, M. J. (1998) Science 281, 1668-1671
34. Moore, M. S., and Blobel, G. (1994) Trends Biochem. Sci. 19, 211-216


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
D. Chuderland, G. Marmor, A. Shainskaya, and R. Seger
Calcium-mediated Interactions Regulate the Subcellular Localization of Extracellular Signal-regulated Kinases
J. Biol. Chem., April 25, 2008; 283(17): 11176 - 11188.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Bendetz-Nezer and R. Seger
Role of Non-phosphorylated Activation Loop Residues in Determining ERK2 Dephosphorylation, Activity, and Subcellular Localization
J. Biol. Chem., August 24, 2007; 282(34): 25114 - 25122.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Burgermeister, D. Chuderland, T. Hanoch, M. Meyer, M. Liscovitch, and R. Seger
Interaction with MEK Causes Nuclear Export and Downregulation of Peroxisome Proliferator-Activated Receptor {gamma}
Mol. Cell. Biol., February 1, 2007; 27(3): 803 - 817.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. M. Burza, I. Pekala, J. Sikora, P. Siedlecki, P. Malagocki, M. Bucholc, L. Koper, P. Zielenkiewicz, M. Dadlez, and G. Dobrowolska
Nicotiana tabacum Osmotic Stress-activated Kinase Is Regulated by Phosphorylation on Ser-154 and Ser-158 in the Kinase Activation Loop
J. Biol. Chem., November 10, 2006; 281(45): 34299 - 34311.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Tarrega, P. Rios, R. Cejudo-Marin, C. Blanco-Aparicio, L. van den Berk, J. Schepens, W. Hendriks, L. Tabernero, and R. Pulido
ERK2 Shows a Restrictive and Locally Selective Mechanism of Recognition by Its Tyrosine Phosphatase Inactivators Not Shared by Its Activator MEK1
J. Biol. Chem., November 11, 2005; 280(45): 37885 - 37894.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Tang, X. Qi, D. Mercola, J. Han, and G. Chen
Essential Role of p38{gamma} in K-Ras Transformation Independent of Phosphorylation
J. Biol. Chem., June 24, 2005; 280(25): 23910 - 23917.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Azriel-Tamir, H. Sharir, B. Schwartz, and M. Hershfinkel
Extracellular Zinc Triggers ERK-dependent Activation of Na+/H+ Exchange in Colonocytes Mediated by the Zinc-sensing Receptor
J. Biol. Chem., December 10, 2004; 279(50): 51804 - 51816.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. M. Aebersold, Y. D. Shaul, Y. Yung, N. Yarom, Z. Yao, T. Hanoch, and R. Seger
Extracellular Signal-Regulated Kinase 1c (ERK1c), a Novel 42-Kilodalton ERK, Demonstrates Unique Modes of Regulation, Localization, and Function
Mol. Cell. Biol., November 15, 2004; 24(22): 10000 - 10015.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
Z. Raviv, E. Kalie, and R. Seger
MEK5 and ERK5 are localized in the nuclei of resting as well as stimulated cells, while MEKK2 translocates from the cytosol to the nucleus upon stimulation
J. Cell Sci., May 1, 2004; 117(9): 1773 - 1784.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Tu and F. S. Lee
Subdomain VIII Is a Specificity-determining Region in MEKK1
J. Biol. Chem., November 28, 2003; 278(48): 48498 - 48505.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. L. Robinson, A. W. Whitehurst, M. Raman, and M. H. Cobb
Identification of Novel Point Mutations in ERK2 That Selectively Disrupt Binding to MEK1
J. Biol. Chem., April 19, 2002; 277(17): 14844 - 14852.
[Abstract] [Full Text] [PDF]


Home page