|
Originally published In Press as doi:10.1074/jbc.M102958200 on May 1, 2001
J. Biol. Chem., Vol. 276, Issue 27, 24726-24735, July 6, 2001
Promoter Regulatory Elements and DNase I-hypersensitive Sites
Involved in Serglycin Proteoglycan Gene Expression in Human
Erythroleukemia, CHRF 288-11, and HL-60 Cells*
Barbara P.
Schick ,
Irina
Petrushina,
Kristin C.
Brodbeck, and
Patria
Castronuevo
From the Cardeza Foundation for Hematologic Research, Jefferson
Medical College of Thomas Jefferson University,
Philadelphia, Pennsylvania 19107
Received for publication, April 3, 2001, and in revised form, April 27, 2001
 |
ABSTRACT |
We have compared regulation of the serglycin gene
in human erythroleukemia (HEL) and CHRF 288-11 cells, which have
megakaryocytic characteristics, with promyelocytic HL-60 cells.
Deletion constructs were prepared from the region 1123/+42 to
20/+42, and putative regulatory sites were mutated. In all three cell
lines, the two major regulatory elements for constitutive expression
were the ( 80)ets site and the cyclic AMP response element
(CRE) half-site at 70. A protein from HEL and CHRF, but not HL60,
nuclear extracts bound to the (-80)ets site. Another
protein from all three cell lines bound to the (-70)CRE. Phorbol
12-myristate 13-acetate (PMA) and dibutyryl cyclic AMP (dbcAMP)
increased expression of the reporter in HEL cells 2.5-3- and 4.5-fold,
respectively, from all constructs except those with (-70)CRE mutations.
PMA virtually eliminated expression of serglycin mRNA and promoter
constructs, but dbcAMP increased expression in HL-60 cells. The effects
of PMA and dbcAMP on promoter expression correlated with mRNA
expression. The strengths of two DNase I-hypersensitive sites in
the 5'-flanking region and the first intron in all three cells
correlated with relative endogenous serglycin mRNA expression. An
additional DNase I-hypersensitive site in HL60 DNA in the first intron
may be related to the high serglycin expression in HL60 relative to HEL
or CHRF cells.
 |
INTRODUCTION |
The serglycin proteoglycan is synthesized by a number of
hematopoietic cells, including platelets (1) and their parent megakaryocytes (2), granulocytes, macrophages, and lymphocytes (3-6),
mast cells (4), and a large number of hematopoietic tumor cell lines
(3, 7-10). Mature erythrocytes do not contain proteoglycans. We have
recently found that serglycin is a major component of endothelial (11),
murine uterine mesometrial decidual (12), and murine embryonic stem
cell proteoglycans.1
Serglycin is thought to be critical for packaging and storage of
various proteins in and secretion from hematopoietic cell granules and
for modulating their activity. Serglycin binds to and stabilizes the
chymases in the protease-containing secretory granules in mast cells
(4, 13) and binds to granule-associated cytokines or chemokines such as
MIP-1 and platelet factor 4 (14). Serglycin can bind to a number of
matrix proteins such as fibronectin and collagen (9, 15, 16) and thus
can influence cell/matrix interactions (16). We have reported that the
serglycin proteoglycan of platelets of Wistar-Furth rats, which have a
severe defect in granule structure and protein content, has
abnormally shortened glycyosaminoglycan chains (15). Mice with a
gene deletion of an enzyme required for heparin biosynthesis have
severe defects in mast cell granules because of the defect in the
heparin serglycin glycyosaminoglycan chains (17, 18). Serglycins from
other hematopoietic cells, endothelial cells, and decidua contain
primarily chondroitin sulfate (2, 4, 8, 9, 19). The overall structure
of the intact proteoglycan, rather than just the nature of the
glycyosaminoglycan chains, appears to govern the interactions of the
molecule with other proteins such as collagen, fibronectin (9, 15), and
CD44 (20, 21), suggesting that the core protein is important for
organizing these interactions. The intact serglycin proteoglycan could
play important modulatory roles in such diverse processes as
hematopoiesis, inflammation, and coagulation. It is therefore of
interest to understand how the synthesis of this proteoglycan is
regulated in various types of hematopoietic cells.
Little is known about the mechanisms that regulate either constitutive
or stimulated expression of the serglycin gene. Avraham et
al. (22) transfected a series of 10 deletion constructs within the
500/+24 region of the murine serglycin promoter into rat basophilic
leukemia cells and identified several broad positive and negative
regulatory regions of the murine serglyin promoter. A putative
regulatory element was suggested by loss of nearly all activity upon
truncation at 81 in the middle of an ets element, but this
site was not characterized.
A schematic diagram of the possible regulatory sites of the human
serglycin gene is shown in Fig. 1 and is based on the sequence information provided by Humphries et al. (7). The human (7, 23) and murine (24, 25) serglycin genes are 96% conserved from 1 to
119 and have considerable homology for an additional 200 bases. A
long purine-rich tract (dA26 in the human gene) is present
at 580 in the human gene, and a similar region is present at 624 in
the murine gene (25). Examination of the 5'-flanking sequences of the
human and mouse serglycin genes reveals a number of potential elements
that could regulate the expression of this gene. The conserved
1/ 119 region includes a glucocorticoid response element at 64, a
cyclic AMP response element
(CRE)2 half-site at 70, and
an ets site, CAGGAA, at 80. The CRE site was of interest
because of its important role in the regulation of several
hematopoietic genes (26, 27). The ets site was of interest
because of the loss of promoter activity when this site in the murine
gene was truncated (22). A reverse GATA-binding site (TTATC) at 357,
present in the human but not in the mouse gene, is identical to a
regulatory site of the megakaryocyte glycoprotein (GP) IIb gene
(28-31). A GATA site either alone or in combination with an
ets site is thought to regulate a number of genes that are
restricted in expression to megakaryocytes or erythrocytes (28,
31-38). Other elements that we considered are the E-boxes (39), motifs
of the sequence CANNTG that bind basic helix-loop-helix proteins.
 |
EXPERIMENTAL PROCEDURES |
Cell Lines
The human cell lines were human erythroleukemia (HEL) cells
(American Type Culture Collection, Manassas, VA), which have erythroid and megakaryocytic potential; CHRF-288-11 megakaryoblastic cells (donated by Dr. Michael Lieberman, University of Cincinnati) (40); and
HL-60 promyelocytic leukemia cells (American Type Culture Collection).
The murine mastocytoma cells were donated by Dr. Jeffrey Esko (41). HEL
and HL-60 cells were cultured in RPMI 1640 with 10% fetal bovine
serum, 2 mM glutamine. CHRF cells were cultured in
Fischer's medium with 20% horse serum. The murine mastocytoma cells
were cultured in 45% Ham's F-12 medium, 45% Dulbecco's modified
Eagle's medium, 10% fetal bovine serum. Immortal human skin
keratinocytes, HaCaT (42), a gift from Dr. Norbert E. Fusenig (German
Cancer Research Center, Heidelberg, Germany), were grown in
Dulbecco's modified Eagle's medium with 10% fetal bovine serum. All
media contained 100 units/ml penicillin and 100 µg/ml streptomycin.
Fetal bovine serum was from Hyclone (Logan, UT). All other tissue
culture reagents were from Life Technologies, Inc. The cells were
maintained in the presence of 5% CO2 and 95% humidity.
Preparation of Vectors
The pOGH human growth hormone (hGH) reporter gene system
(Nichols Institute Diagnostics, San Juan Capistrano, CA) (43) was used
for these studies. This system has been used for studies of promoter
expression of murine serglycin (22), human GP IIb (31), and PF4 (44).
The reporter protein is virtually 100% secreted, and small amounts of
supernatant are assayed. Ten constructs were prepared to encompass the
region from 1123/+42 to 20/+42. Inserts were prepared by polymerase
chain reaction (PCR) with human genomic DNA as template. The primers
were made in our institutional nucleic acid facility. Each primer
contained 20 bases of promoter sequence based on the published sequence
(7) placed 3' to an 8-bp GC-rich anchor and a 6-bp restriction site,
using Xba1 for the forward primer and BamHI for
the reverse primer. The PCR products were subjected to agarose gel
electrophoresis. The DNA bands were eluted from the gel, digested with
the appropriate restriction enzymes, and ligated into the appropriate
restriction sites in the pOGH vector. The vectors were propagated in
Escherichia coli JM-109 (Promega, Madison, WI) in LB medium.
The vectors were purified on Qiagen columns (Qiagen, Chatsworth, CA)
and quantitated by UV spectroscopy. The sequences were confirmed using
primers that were designed from the vector sequences flanking the
insert. Over the course of the work two to four different batches of
each vector were used.
For generation of the flt-1 promoter construct, primers were
forward 5'-cgcggccgtctaga 748CTTCTAGGAAGCAGAAGACT and
reverse 5'-cgcgccgcggatcc+159AGCCAGGAGACAACCACTTC
(lowercase letters indicate the zipper and restriction sites, and
uppercase letters indicate the coding sequence), and the vector was
constructed as described above. The resulting insert included the
sequence
5'- 90TGACGTCACCAGAAGGAGGTGCCGGGGTAGGAAGTG,
in which the active CRE and ets sites are underlined.
Mutagenesis
Mutagenesis was performed using the Altered Sites II mutagenesis
system (Promega) with the pALTER EX1 vector. The
Xba/BamHI restriction sites were compatible with
both the native pOGH and pAlter EX1 vectors. The mutagenesis probes
were 20-mers centered around the base to be modified. The mutations as
well as the integrity of the entire sequence of the insert were
confirmed by automated sequencing. Both the 543/+42 and the 284/+42
constructs were used for the single CRE (TGACTG TAACGT) and ets (CAGGAA CAGCAA) mutations and the double mutations of
the ets and CRE sites. Mutations were made within the
543/+42 construct at the 357TATC (reverse GATA) site
(GATA m1 was TTTC; GATA m2 was TCTC), and the E-box site
522CATCTG was changed to CATCCG.
In addition, mutations around the TATA-like region were performed
exactly as described by Avraham et al. (22):
31TTTCTAAA to TTTCTCAA (Mut1) or
TTTATAAA (mut2).
Transfections
Log phase cells were concentrated to 5 × 106/ml in 0.4 ml of electroporation buffer (30.8 mM NaCl, 120.7 mM KCl, 8.1 mM
Na2HPO4, 1.46 mM
KH2PO4, 5 mM MgCl2).
Electroporation was performed in a Bio-Rad Gene Pulser in 0.4-cm Gene
Pulser cuvettes. 50 µg of plasmid DNA was added to the cells. The
cells were incubated for 2-5 days in biotin-free medium. In
experiments in which the effects of phorbol 12-myristate 13-acetate
(PMA) (Sigma) (1.6 µM) or dbcAMP (1 mM)
(Sigma) were tested, the electroporated cells from a single cuvette
were divided into equal aliquots, and the test reagents were added
immediately to the wells, so that we would be assured of equivalent
transfection efficiency in samples that were being compared with each
other. Each of these experiments was set up in duplicate.
Transfection Controls
Background values were obtained from the medium of cells
transfected with the pOGH promoterless vector, which gave no expression of hGH over control culture medium. For an external standard, we used a
pOGH vector that had been prepared with the cytomegalovirus promoter
(pCMVhGH), which was kindly donated by Dr. Jaime Caro. The pCMVhGH
vector also provided a standard for measuring the response of our
serglycin constructs to PMA. In the data presented, all constructs
shown were used in each experiment. We also performed experiments
across all three cell lines with the same preparations of vectors to
eliminate random variations in vector preparations as a cause for
observed differences between cell lines. Our data are presented as the
activity of any given construct relative to the 543/+24 construct
within any given experiment. In some experiments, pCMVSEAP or pSV40SEAP
(Tropix, Bedford, MA), which have secretable placental alkaline
phosphatase as a reporter, were used as internal standards. The
relative activity profile of the serglycin promoter constructs was
essentially unchanged in the presence of pCMVSEAP, but the amount of
hGH activity was much greater in the presence of this plasmid. We
cannot explain the reason for this. pSV40SEAP had a smaller effect on
serglycin promoter expression.
Analysis of hGH and SEAP in Culture Supernatants
After the appropriate incubation times to ensure maximal
expression (2 days for HEL, 4-5 days for CHRF and HL-60; the pattern of expression of the reporter gene for HEL cells was unchanged with
longer incubations), the cells were pelleted, and aliquots of the
culture medium were removed for radioimmunoassay of the secreted hGH as
directed by the supplier. We found that less than 1% of the hGH
remained in the cell pellet. Secretion of the SEAP reporter protein was
quantitated in 30 µl of supernatant by a luminescence assay (Tropix)
using a tube luminometer (Monolight 2010, Analytical Luminescence
Laboratory). The activity profiles obtained from comparison of the hGH
measurements to the secretable internal control were consistent with
those obtained with the external control or the relative patterns of
expression of the constructs.
Estimation of Serglycin Synthesis by Northern Blotting
Cells were incubated with either PMA (1.6 µM), dbcAMP (1 mM), or dexamethasone
(10 5 M) for 72 h. RNA was extracted from
the cells with the Trizol reagent (Life Technologies, Inc.) according
to the manufacturer's instructions. Northern blots were run on 1.2%
agarose gels containing formaldehyde and ethidium bromide, and
electrophoresis was carried out in MOPS buffer (45). The RNA was
transferred to Hybond nylon membranes (Amersham Pharmacia Biotech) in
20× saline sodium citrate (3 M NaCl, 0.3 M
sodium citrate). Prehybridization and hybridization were carried out at
50 °C as described (45) using a buffer containing 50% formamide,
5× Denhardt's solution, 5× SSPE (sodium phosphate, EDTA, NaCl),
0.1% sodium dodecylsulfate, 0.1 mg/ml denatured salmon sperm DNA, and
0.3 mg/ml yeast tRNA. The probe was labeled with [32P]dCTP (New England Nuclear) by random hexamer priming
using a 271-bp fragment derived by reverse transcriptase-PCR from HEL cell RNA as a template. The primers were 5'-AATGCAGTCGGCTTGTCCTG and
5'-GCCTGATCCAGAGTAGTCCT, spanning nucleotides 73-344, based on the
cDNA sequence published by Nicodemus et al. (23). The probe identified the expected 1.3-kb band on Northern blots.
Electrophoretic Mobility Shift Assays
Nuclear extracts were prepared essentially by the method of
Dignam et al. (46). The integrity of the extracts was tested by performing EMSAs as described below with consensus oligonucleotides for universal transcription factors such as TFIID, Sp1, and AP-1 (Stratagene, La Jolla, CA).
Oligonucleotides for the EMSAs were generally 24-mers produced on a
nucleotide synthesizer at our institutional nucleic acid facility. The
sequences listed below and their complementary strands were hybridized,
and efficiency of hybridization was monitored on 4% agarose gels run
in Tris acetate/EDTA buffer. The double-stranded probes were
end-labeled with [ -32P]ATP (New England Nuclear) and
polynucleotide kinase (Life Technologies, Inc.) and purified on
Sephadex G-25 spin columns. The forward sequences, mutations, and other
reagents for investigation of each site were as follows.
ets Site--
ets was
5'- 89CTATTTGTTCAGGAAATTGTG, and
ets mutant was
5'- 89CTATTTGTTCAGCAAATTGTG (the
same mutation used for the transfection studies). For competition for
binding to the ets oligonucleotide, an oligonucleotide that
contained the CAGGAA ets site of the rat GP IIb gene (29)
but had no other homology with our probe was donated by Dr. Mortimer
Poncz, and an anti ets-1/ets-2 antibody and a
peptide containing the amino acid sequence that binds to the
ets-1 site were purchased from Santa Cruz Biotechnology,
Inc. (Santa Cruz, CA).
CRE Site--
For CRE,
5'- 78GAAATTGTGACGTGTGTTCTGG was
used for the EMSA. The competitor was the CREB consensus binding site,
5'-AGAGATTGCCTGACGTCAGAGAGCTAG (45).
DNA-protein binding reactions were carried out in 20 µl of total
volume using the buffer described by Uzan et al. (48), with
3 µg of nuclear extract, 0.5 µg of poly(dI-dC), and 100,000 dpm
labeled probe. Up to 15 pmol of unlabeled competitor probes or 1-2
µl of antisera were added to the reactions as desired. All components
except the probe were incubated together for 10 min at room
temperature, the probe was added, and the incubation was continued for
an additional 20 min. The samples were loaded onto a nondenaturing
polyacrylamide/bisacrylamide gel consisting of one-tenth the total gel
volume 5× Tris borate/EDTA, 5% acrylamide, 0.25% bisacrylamide, and
6.25% glycerol. The gel was run at 200 V for 2 h at 4 °C. The
gels were dried under vacuum and autoradiographed with Fuji film.
Ultraviolet Cross-linking of the Probes to the Nuclear
Extracts
The reactions were performed as described for the EMSA, but the
samples were exposed to UV light using an inverted light box suspended
over the open tubes for 30 min. The samples were then run on 20-cm
SDS-polyacrylamide gel electrophoresis gels. Prestained molecular weight standards were from Bio-Rad. The gels were dried and
subjected to autoradiography.
DNase I Hypersensitivity Assays
Cell Lines and Cell Culture--
Assays were performed with HEL,
CHRF 288-11, and HL60 cells. Immortal human skin keratinocytes, HaCaT
(42), were used as a control, because serglycin expression was not
detected by reverse transcriptase-PCR of HaCaT RNA.
Isolation of Nuclei and DNase I Digestion--
Preparation of
nuclei from the cells was performed essentially as described (49),
except that Igepal CA-630 was used as detergent instead of Nonidet
P-40. Approximately 3 × 108 cells were harvested and
washed in ice-cold phosphate-buffered saline. The cells were harvested
again, resuspended in 50 ml of ice-cold lysis buffer (40 mM
potassium chloride, 10 mM sodium chloride, 10 mM magnesium chloride, 10 mM Tris-HCl, pH 7.5, 0.5% Igepal CA-630), kept on ice for 10 min, and centrifuged at
400 × g for 10 min at 4 °C. The cells were
resuspended, and lysis buffer treatment was repeated. Subsequently, the
nuclei were resuspended in lysis buffer, and the nuclear titer was
adjusted to ~2 × 107 nuclei/ml. Aliquots of 0.5 ml
were distributed in tubes, and to each sample an appropriate amount of
DNase I buffer (1 mM magnesium chloride, 5 mM
calcium chloride) up to 40 µl was added. The nuclei were incubated at
4 °C with increasing amounts of DNase I (Roche Molecular
Biochemicals) up to 100 units for 4 min. The reactions were stopped by
adding 60 µl of 0.5 M EDTA, and the DNA was isolated by
proteinase K-SDS digestion and potassium acetate precipitation followed
by RNase A digestion, phenol-chloroform extraction, and ethanol
precipitation. The final purified DNA pellet was dissolved in
Tris/EDTA, pH 7.5.
Southern Blot Analysis--
DNAs (5 µg/sample) were digested
with HindIII, and the DNA fragments were separated in 1%
agarose gels by electrophoresis, transferred to nylon membranes (Hybond
N+; Amersham Pharmacia Biotech), and hybridized at 65 °C overnight
in a solution containing 50 mM Tris-HCl, pH 7.5, 1 M NaCl, 1% SDS, 10% dextran sulfate (Fisher), 0.05 mg/ml
salmon sperm DNA, and the H106 probe radiolabeled by the random priming
method (RadPrime DNA Labeling System by Life Technologies, Inc.). The
membrane was washed once with 2× saline sodium citrate at room
temperature for 5 min, followed by 0.5X saline sodium citrate at
65 °C for 3-5 min. The probe abutting the HindIII
restriction site in intron 1 of serglycin gene was 106 base pairs
(H106), generated using as forward primer nucleotides 3217-3235
(5'-AATCCTTTGACCGTAGCCC-3') and as reverse primer nucleotides
3322-3303 (5'-CCACTCTTGCATGGTTTGAC) based on the numbering sequence of
Humphries et al. (7). The sequence of the probe was verified
by automated sequencing, using the above forward and reverse primers.
Reverse Transcriptase-PCR Assays--
RNA from human HaCaT
keratinocyte cells was extracted with Trizol reagent (Life
Technologies, Inc.). Reverse transcriptase-PCR was performed as
described previously (11). Actin and GAPDH primers were used as
positive controls. The forward and reverse primers for human serglycin
were as described (11).
 |
RESULTS |
Transfections of HEL, CHRF-288-11, and HL-60 Cells with the Human
Serglycin Promoter Constructs
The results of the transfection experiments are shown in Fig.
1. Fig. 1a delineates the
scheme we designed for sequential removal of putative active sites in
the deletion constructs. The data shown in Fig. 1 (b and
c) are from seven experiments on each cell line that were
all performed using a single batch of each vector, and the entire
series of vectors was used in each experiment. Similar results were
obtained in other experiments when other batches of the vectors were
used. Fig. 1b shows the data from our deletion constructs,
and Fig. 1c shows data from the mutagenesis of some of the
putative regulatory sites. The data for the deletion constructs in Fig.
1b are expressed relative to the 543/+42 construct, which
served as the template for most of the mutations. The mutagenesis data
in Fig. 1c are expressed relative to the 543/+42
constructs used within the same experiment. In separate experiments in
which the external pCMVhGH control or the pCMV-SEAP or pSV40SEAP
internal control was used, the pattern of utilization was consistent
with that shown here.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Analysis of the human serglycin promoter by
deletion constructs and mutagenesis. a, schematic
representation of putative regulatory sites in the human serglycin
promoter, and the organization of these sites in the deletion
constructs. b, promoter analysis of the serglycin gene in
HEL, CHRF, and HL-60 cells. The deletion constructs shown in
panel a were used. The experiment was performed seven times
using the same batch of vectors for all three cell lines, but similar
results were found with different batches of vectors in other
experiments with different batches of vectors. In additional
experiments (not shown) the 20/+42 construct was used. This construct
exhibited about half the activity of the 54/+42. The data were
calculated relative to the 543 construct. The same profile was
obtained when the data were calculated relative to the pCMVGH external
control for each experiment or whether the internal control pCMVSEAP
was used. c, the activity of the mutations performed in the
context of the 543 or the 284 construct. The data for one GATA
mutation (m1) are shown; the second mutation gave essentially the same
results.
|
|
The most important positive regulatory elements common to all three
cell lines appeared to be between 89 and 54, because expression was
most greatly reduced when this region was deleted (Fig. 1b).
This region contains an ets site at 80, a CRE half-site at
70, and a glucocorticoid response element at 64. There were some
other interesting differences in promoter utilization both between the
two megakaryocytic cell lines and between these and the HL-60 cells
(Fig. 1b). Because the same preparations of vectors were
used with all the cell lines for these experiments, we believe that the
cell lines indeed utilize these constructs differently. For example, in
the HEL cells, the expression from the 543/+42 vector was always
25-50% less than that of the 344/+42 using several different vector
preparations. In contrast, in experiments performed at the same time
with the CHRF cells, the 344/+42 vector always gave somewhat less
expression than did the 543/+42. Deletion of the 543/ 344 region
removes the ( 522)E-box, ( 484) partial CRE, and ( 357) reverse GATA
sites. Removal of only the region from 543 to 504 did not reduce
promoter activity significantly in either the HEL or CHRF cells but
reduced activity by about one-third in the HL-60 cells. Another
striking difference was that in HEL cells, truncation of the 238
construct to 89 resulted in a 50% loss of activity, but there was no
significant change in activity in the CHRF cells and HL-60 cells. These
differences might be due to the use of a Sp1-like site, CCCACCC, in the
deleted region by HEL cells. We have not evaluated specifically the
effect of this site. One aspect unique to HL-60 cells was the
substantial increase of activity in the 284 construct compared with
344 and 89. We have no explanation for this finding.
Another characteristic common to the three cell lines was the low
activity of the three longest constructs. We have seen the same effect
with the murine promoter in various murine cell lines,3
using the 1248/+24 sequence of the promoter described by Angerth et al. (25). The genes have in
common a long poly(dA) stretch and a purine stretch, and the activity
of the deletion constructs from both genes increases when these regions
are removed. An analogous poly(dT) region is involved in regulation of
activity of the rat and human PF4 genes (44, 50, 51). Specific proteins
bind to the poly(dT) tract of the human PF4 promoter (44). Such long poly(dA) or poly(dT) stretches can interfere with nucleosome formation (52).
Mutation of either the ets or CRE sites greatly reduced the
activity of the constructs in all three cell lines, and the double mutation reduced activity nearly to background levels (Fig.
1c). The effect of the CRE mutation was greater than that of
the ets mutation in the 284/+42 construct, and the effect
of the ets mutation was greater than that of the CRE
mutation in the 543/+42 construct in all three cell lines, but in all
three cell lines the amount of inhibition resulting from mutation of
the ets site plus the CRE site in the single mutations, as
well as the effect of the double ets/CRE mutation, was close
to 100%. The reason for the different relative behaviors of the
mutated elements in the different length constructs is not understood.
Two different mutations of the GATA site failed to alter the activity
of the serglycin promoter in any of the cell lines (Fig.
1c). Mutation of the 522CATCTG E-box resulted
in significantly reduced expression, about 50% in HEL and HL60 and
25% in CHRF cells (Fig. 1c), in contrast to the lack of
effect of the loss of this element in the deletion constructs seen in
Fig. 1b. In separate experiments, we investigated the effect
of mutations around the TATA-like region. Mutations identical to two of
the three designed by Avraham et al. (22) in the murine
promoter were used. The third mutation could not be done because of the
sequence difference between the two species. Mut1 (A-C) had no effect,
in contrast to the 75% inhibition of activity seen by Avraham et
al. (22) when the murine promoter was introduced into a rat cell
line. Mut2, which introduced the sequence TATA into the gene, caused a
35% increase in activity, in contrast to the 92% reduction seen by
Avraham et al. (22).
Electrophoretic Mobility Shift Assays
Analysis of the ets Site--
We have performed EMSA analysis of
binding to the 80 CAGGAA region. A probe containing the
ets regulatory site of the rat GP IIb gene (from M. Poncz),
which has no other homology to the serglycin sequence, inhibits binding
to the serglycin ets probe in HEL cell nuclear extracts. An
oligonucleotide in which the CAGGAA sequence was mutated to CAGCAA, the
same mutation used in the mutagenesis experiments described above, did
not compete with the native sequence (Fig.
2a, right lane),
whereas the native sequence completely self-competed with the labeled
probe (not shown). Neither a peptide representing the DNA-binding
carboxyl-terminal domain nor an anti-ets-1/ets-2
antibody (Santa Cruz Biotechnology, Inc.) competed with the nuclear
extract for binding with the probe (not shown). CHRF nuclear extracts
contained a protein that bound similarly to that of HEL cells, but
HL-60 nuclear extracts bound a more quickly migrating complex (Fig.
2b) that appeared in a position similar to published reports
of migration of PU.1 (53), but the usual binding site for PU.1 is
GAGGAA.

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 2.
EMSA for binding to the CAGGAA ets site.
a, nuclear extract from HEL cells was incubated with the
32P-labeled CAGGAA probe. Competitors were the rat GP IIb
ets oligonucleotide (from M. Poncz) and the mutated human
ets oligonucleotide described in the text. b,
EMSA of CHRF and HL-60 nuclear extracts with the ets
oligonucleotide.
|
|
Analysis of the CRE Site--
Nuclear proteins of the same
mobility from HEL, CHRF, and HL-60 cells bound to both the CRE
oligonucleotide from the serglycin promoter and to the consensus CREB
sequence (Fig. 3a). Fig.
3b shows the cross-competition between the consensus CREB
oligonucleotide (54) and the serglycin putative CRE site
oligonucleotide in HEL cells; identical results were obtained for the
other cell lines. Thus these cell lines all appear to bind a species of
CREB protein.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 3.
EMSA for binding to the CRE
oligonucleotide. a, nuclear extracts (5 µg of
protein) from the three cell lines were incubated with the
32P-labeled serglycin CRE oligonucleotide (left
panel) or the 32P-labeled consensus CREB
oligonucleotide (right panel). The lanes marked
HEL represent 5 and 10 µg of nuclear extract.
b, competition between the CRE and CREB oligonucleotides.
32P-Labeled CRE (left panel) and
32P-labeled CREB (right panel). The data shown
are for HEL cells; the results from all the cell lines were
identical.
|
|
UV Cross-linking of Proteins to the ets/CRE
Oligonucleotide--
UV cross-linking of CHRF nuclear proteins to an
oligonucleotide that contained both the ets and CRE sites
showed cross-linking of proteins of the same size that had bound to
oligonucleotides containing either site alone (Fig.
4). Two proteins bound to the ets oligonucleotide; the lower molecular mass
protein, which was also the fainter band, is the major protein bound in
the presence of the CRE site. The bound protein is smaller than
ets-1 or ets-2 (53-56 kDa) (55), because the migration
position represents the protein plus the double-stranded
oligonucleotide. This protein might be, for example, erg1 or
elf-1 (56, 57). There appeared to be two bands bound to the
CRE oligonucleotide, and both appeared also to bind to the
ets/CRE oligonucleotide. HEL extracts behaved similarly, and
HL60 extracts bound only the CRE protein to the CRE or
ets/CRE oligonucleotides, and no proteins were cross-linked to the ets oligonucleotide (not shown).

View larger version (100K):
[in this window]
[in a new window]
|
Fig. 4.
Cross-linking of proteins to the
ets, CRE, and ets/CRE
oligonucleotides. The oligonucleotide is described in the text.
After exposure to UV light, the samples were electrophoresed on
SDS-polyacrylamide gel electrophoresis, and the protein/oligonucleotide
cross-linked complexes were detected by autoradiography.
|
|
Binding of Nuclear Proteins to GATA and E-box Sites--
We
performed a number of EMSAs with oligonucleotides containing the
reverse GATA site and several of the E-box sites. Specific binding of
proteins to the GATA oligonucleotide was observed in HEL and CHRF but
not HL60 cells. All three cell lines had nuclear proteins that bound
specifically to several of the E-box oligonucleotides. However, because
the transfection data show that these sequences are probably not key
regulatory elements, the EMSA data will not be presented here.
Effects of PMA and dbcAMP on Serglycin Expression
Effect of PMA and dbcAMP on Cell Proliferation in HEL, CHRF, and
HL-60 Cells--
All three cell lines exhibited a lag phase of about
24 h followed by a generation time of about 24 h for HEL and
CHRF and 18 h for HL-60. Treatment of all three cell lines with
PMA resulted in adhesion of cells to the culture dish and no further
increase in cell number. Thus after 2 days, the control cultures had
about twice as many cells as the PMA-treated cultures. dbcAMP blocked cell division and caused adhesion of HL-60 cells but not HEL and CHRF
cells, and the cell numbers after 2 days were about 80% of controls.
However, CHRF cells did not survive beyond 48 h in the presence of
dbcAMP.
Effects of PMA and dbcAMP on Serglycin mRNA Expression in HEL,
CHRF, and HL60 Cells--
The constitutive level of serglycin mRNA
expression was much greater in HL-60 cells than in the megakaryocytic
cell lines (Fig. 5a). Northern
blots showed that treatment with PMA for 2 days resulted in increased
expression of serglycin mRNA in HEL and CHRF cells but markedly
decreased expression in HL-60 cells. Treatment with dbcAMP resulted in
increased serglycin mRNA expression in HEL and HL60 cells but not
in CHRF cells (Fig. 5b), and the same effect was seen with
50 µM forskolin (not shown). The effect of dbcAMP in HEL
cells was much greater than that of PMA. Dexamethasone, which we tested
because of the proximity of a glucocorticoid response element to the
ets and CRE sites, did not alter mRNA expression in any
of our cell lines (not shown), in contrast to a recent report that
dexamethasone increased serglycin expression in murine mast cells
(58).

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 5.
Relative expression of serglycin mRNA in
HEL, CHRF, and HL-60 cells. a, Northern blot analysis of
mRNA expression in the cell lines. Cells were harvested after a
96-h incubation. 5 µg of RNA were applied to each lane. b,
effect of PMA and dbcAMP on serglycin mRNA expression in HEL, CHRF,
and HL-60 cells. 5 µg of RNA from HEL and CHRF and 2 µg from HL-60
cells were applied to the Northern gel.
|
|
Effects of PMA and dbcAMP on Promoter Utilization in HEL, CHRF, and
HL-60 Cells--
In these experiments, cells from a single
electroporation cuvette were aliquoted so that the control and the
treated samples were derived from a single pool of transfected cells,
eliminating the concern of differences in transfection efficiency
between samples that would be compared with each other. In 15 experiments with the HEL cells, expression of all deletion constructs
from 89 to 1123 and the constructs bearing mutations of the
80ets, 522CATCTG, and
357GATA sites was increased 2.5 ± 0.35-fold
(n = 15) in the presence of PMA. The exception was the
CRE mutation, which did not give increased hGH expression in response
to PMA. The electroporation process appeared to abrogate the PMA effect
on serglycin synthesis in CHRF cells, because endogenous serglycin
mRNA expression, expression from the serglycin promoter constructs,
and proteoglycan synthesis from [35S]sulfate and overall
proteoglycan size were all unchanged when the electroporated cells were
cultured with PMA. In HL-60 cells, expression from the promoter
constructs was virtually eliminated by PMA, with or without the CRE
mutation, so the repressive effect of PMA was independent of the CRE
half-site. Expression of the reporter gene from pCMVhGH in HL-60 cells,
on the other hand, was increased 15-20-fold by PMA relative to an
aliquot of untreated cells from the same electroporation cuvette,
showing that our protocol permitted transfection of the cells and that
the inhibitory effect of PMA on the serglycin promoter was specific and
was not due to failure to introduce the serglycin promoter vector into the cells.
In other experiments, the effect of dbcAMP was compared with that of
PMA in cells transfected with the 543/+42, the TATA region mutations,
the 284/+42, and the 284/+42 ets-mut and CRE-mut. Aliquots of cells from a single electroporation cuvette were used for
control and PMA and dbcAMP treatments to avoid variations in
transfection efficiency among samples that were being compared with one
another directly. The degree of enhancement or inhibition of reporter
activity with both agents was consistent with their effects on
endogenous serglycin mRNA expression, which were shown on the
Northern blot in Fig. 5b. In HEL cells, the expression from
all vectors but the CRE mutants was increased ~2.5-fold by PMA and
4.4 ± 0.6-fold by dbcAMP, and activity of the CRE-muts was
increased 2-fold by dbcAMP, as determined by the total hGH produced per
well. Thus in HEL cells, the response of the promoter constructs to PMA
and about half of the response to dbcAMP are mediated at least in part
by the 70 CRE half-site. In HL-60 cells, in contrast to the complete
inhibition by PMA, dbcAMP caused a 4-fold increase in hGH expression
from the 284/+42 construct, but there was no expression with the CRE
mutation construct either under unstimulated conditions or in the
presence of PMA or dbcAMP. Thus the PMA effect was independent of the
CRE because the activities of nonmutated and mutated constructs were
all reduced, but the dbcAMP effect in HL60 cells may be mediated
entirely through the CRE. In these experiments, the internal standard,
pCMVSEAP (the active element of the cytomegalovirus promoter includes a
CRE) was tested in HEL cells. Activation by dbcAMP was 73-fold, and activation by PMA was 26-fold; thus the effect on the cytomegalovirus promoter was much greater than the effect on the serglycin promoter, but the relative stimulations by dbcAMP and PMA were inverse to the
stimulation of the serglycin promoter constructs by these agents. PMA
also greatly stimulated expression of hGH from pCMVhGH (not shown).
Effect of PMA and dbcAMP on Binding of Nuclear Proteins to the ets
and CRE Oligonucleotides--
EMSAs showed that the binding of nuclear
proteins to the CRE site in all three cell lines was greater for cells
treated with PMA (Fig. 6), but binding of
proteins from PMA-treated HEL and CHRF cells to the ets site
was reduced. PMA did not change the binding of proteins to the
ets site in HL60 cells.

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 6.
EMSA of nuclear protein binding to the CRE
and ets sites after treatment of cells with PMA.
The cells were incubated with PMA, and the nuclear extracts were
prepared as described in the text. The bands were detected by
autoradiography. a, binding to ets
oligonucleotide. b, binding to CRE oligonucleotide.
|
|
Effect of dbcAMP on the flt-1 Promoter in HEL Cells--
To
compare the activity of the flt-1 promoter with that of the
serglycin promoter, HEL cells were transfected with the
flt-1 promoter construct, which contained the CRE and
ets sites, and the cells were subjected to treatment with
PMA or dbcAMP. A 10.3 ± 1.61-fold increase in activity with
dbcAMP and a 4.21 ± 1.12-fold increase with PMA
(n = 6) were observed. This finding was in contrast to
the finding that dbcAMP did not increase the activity of the flt-1 promoter in bovine aortic endothelial cells (59,
60).
DNase I Hypersensitivity
The Southern blots showing the DHSS are shown in Fig.
7. Two sites were found in all three cell
lines. These sites were identified by labeling of fragments containing
the 3'-end probe of the HindIII site at +3326 in Intron 1. The fragments identified were 3.6 and 2.5 kb in size and would
correspond to sites at 276 and +825 bp according to the numbering
scheme of Humphries et al. (7). The 276 site is about 200 bp upstream from the critical ets and CRE sites. The +825
site is within the first intron. These sites appeared at lower DNase I
concentrations in the HL60 cells compared with HEL and CHRF, and the
concentration required for CHRF was lower than that for HEL. Thus the
sensitivity of these sites corresponded to the relative serglycin
mRNA expression seen on the Northern blot in Fig. 5a.
The HL60 cells also had a unique DHSS shown at 1.25 kb on the Southern
blot. This would correspond to +2075, also within the first intron.
These three DHSS were not seen in the HaCaT DNA, but a faint site at
2.15 kb (+1176 in the gene) was present. Germline or nongermline
fragments were present in all four cell lines at >23.1 and 5.25 kb and
in CHRF at 8.1 kb.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 7.
Analysis of DNase I-hypersensitive sites
associated with the human serglycin proteoglycan gene in HEL, CHRF
288-11, HL-60, and HaCaT skin keratinocyte cells. Nuclei from HEL,
CHRF 288-11, HL-60, and HaCaT skin keratinocyte cells were isolated and
digested with increasing concentrations of DNase I, and DNA was
isolated and purified (see "Experimental Procedures"). DNA was
digested with HindIII and electrophoresed on 1% agarose
gels, and the gel was subjected to Southern transfer. The blots were
hybridized with the 32P-labeled 106-bp probe against the
3'-terminal sequence of the HindIII fragment, which
contained most of the serglycin sequence. The sizes (in kb) of
HindIII fragments of DNA are shown at the
left. The filled arrowheads correspond to the
germline fragments, whereas the open arrowheads correspond
to the DHSS. Dashes A, a, and b
correspond to other fragments that are neither germline fragments nor
DHSS. Dash B corresponds to a DHSS not associated with the
serglycin gene. Lane U corresponds to both undigested CHRF
288-11 and HaCaT skin keratinocyte DNase I-treated DNA, whereas
lane 229 corresponds to lymphoblast cellular DNA.
|
|
 |
DISCUSSION |
The expression of serglycin is up-regulated during normal
megakaryocyte maturation (2, 61), in normal leukocytes during the
period of granule formation (3), upon physiologic stimulation of
lymphocytes (5) or stimulation of murine T-lymphocytic EL4.E1 by PMA
(6), and in response to PMA in hematopoietic tumor cell lines with
megakaryocytic characteristics, such as HEL (8, 45), CHRF 288-11 (9),
and K562 (62). This has been shown by in situ hybridization
in human bone marrow cells (3) and by radiosulfate incorporation and/or
mRNA expression (2, 4, 8, 9, 45, 61, 63) in megakaryocytes and the
megakaryocytic cell lines. In contrast, the myeloid cell lines, such as
HL-60, down-regulate serglycin mRNA expression and protein
synthesis in response to PMA (62, 64, 65). These findings are supported by nuclear run-off experiments that have shown that PMA induces increased transcription of serglycin mRNA in K562 cells but, in contrast, reduces transcription in HL-60 (62). Thus transcriptional regulation appears to be a major factor governing expression of the
serglycin gene. There are no phorbol response elements in the known
5'-flanking sequences of either the human or the murine serglycin gene,
and thus the effect of PMA may not be mediated by a direct action of
the AP-1 proteins on this gene. We chose to examine cell lines
representative of megakaryocytic and myeloid cells to explore
regulation of a gene common to these cells that appears, at least in
response to PMA, to have elements that are susceptible to cell-specific regulation.
This study has shown by use of deletion constructs and site-directed
mutagenesis that two elements in the 5'-flanking region of the human
serglycin gene, (-80)ets and (-70)CRE sites, are critical
for gene expression in the cell lines that we have studied. The human
serglycin promoter is configured similarly to that of known
megakaryocyte/erythroid-specific genes in terms of the localization of
the ets and GATA sites that are critical for these genes
(28, 29, 31-33, 35-38, 44, 66) but is activated differently from these genes when expressed in the same HEL megakaryocytic cell line
that has been used for most of the megakaryocytic gene expression studies. Because the GATA site of the human serglycin gene is not
conserved in the murine gene, it is not surprising that this site is
not a critical regulator of expression of this gene. Avraham et
al. (22) had shown previously that truncation of the
ets site of the murine serglycin promoter resulted in loss
of activity, and Stevens et al. (67) had suggested
previously that this region, which also includes a glucocorticoid
response element just 5' to the CRE, was likely to be the major
regulatory region of both the human and the murine serglycin genes.
Some hematopoietic cell lineage-specific regulation may occur, because
serglycin gene expression increases in response to dexamethasone in
murine mast cells (58); but in the murine T-lymphocytic cell line
WEHI-7TG serglycin expression increases dramatically in response to the combination of forskolin and dexamethasone in comparison with the
minimal response to treatment by either of these agents alone (68), and
serglycin expression in the human cell lines used in our study is not
affected by dexamethasone. Nonhematopoietic cell-specific regulation
may also occur. Interestingly, serglycin mRNA expression is
up-regulated by retinoic acid with or without dbcAMP in F9
teratocarcinoma cells (69), which are characteristic of parietal
endoderm. Serglycin mRNA synthesis is up-regulated by tumor
necrosis factor- in human umbilical vein endothelial cells (70), but
it is not known whether cAMP is involved.
The importance of the ets site of the murine serglycin
promoter (22) was suggested initially by loss of activity of the construct in which the ets site was truncated in the study,
but this site was not characterized. Our findings of the importance of
the ets site in the human serglycin gene are of interest in light of the recent report that serglycin was identified as a target
for ets-1 activation by differential display and that
ets-1-transfected NIH 3T3 cells can activate the normally
quiescent serglycin gene (71). It is likely that endogenous NIH-3T3
CREB proteins interact with the transfected ets-1. However,
we have ruled out ets-1/ets-2 as the regulatory
ets family proteins for the serglycin gene in our cell lines
by our EMSAs with anti-ets antibodies. Thus far, the
ets proteins thought to be involved in megakaryocyte gene expression are PU.1 (29) and fli-1 (38). PU.1 has greater mobility on EMSAs than the HEL or CHRF nuclear proteins, which bind to
the ets oligonucleotide in our EMSAs, and has consistently been reported to bind to the sequence GAGGAA rather than CAGGAA, and
fli-1 is larger than would be indicated by our cross-linking data.
Only two examples of regulation by closely apposed CRE and
ets sites have been reported previously, for
flt-1 in bovine aortic endothelial cells (59, 60) and for
the transferrin receptor in differentiating murine erythroleukemia
cells (72). These studies have not shown a role for cAMP. The spatial
relationships of the two sites are reversed in the fli-1
promoter relative to their positions in the serglycin promoter; the CRE
site is 5' to the ets site in the flt-1 gene. The
flt-1 CRE is a full canonical palindromic site TGACGTCA (59,
60), but the serglycin CRE is a half-site TGACGT. The flt-1
gene is also expressed in megakaryocytes (73), but its regulatory
elements have not been studied in megakaryocytes. It is of interest to
compare the response of the flt-1 promoter to dbcAMP and
forskolin in bovine aortic endothelial cells (59, 60) to our data; in
contrast to our finding that the expression of the flt-1
promoter construct in the hematopoietic cells was increased 10-fold by
dbcAMP, this agent did not affect the activity of the flt-1
promoter in bovine aortic endothelial cells. The reason for this is not
known, but the structure of the DNA may play a role. It has been shown
that the TGA sequences of the CRE cause an inherent bend in DNA (74).
The different responses to cAMP could be due to factors such as the
presence of a full CRE in the flt-1 gene versus
the half-site in serglycin, the reversed orientation of the sites, the
changes in relative expression of proteins that bind to these sites (as
we showed for PMA), or the utilization of different ets
proteins in the complex. These factors could create different
interactions between CREB or ets proteins with CREB-binding
protein, the protein that binds to the cAMP response element-binding
protein and interacts with the transcription complex. The studies that
have shown interactions between closely apposed ets
and CRE sites have not shown dependence of these promoters on elevation
of cAMP levels (72, 75-77). The transferrin promoter is activated by
Me2SO or
N,N'-hexamethylene-bis-acetamide;
N,N'-hexamethylene-bis-acetamide alters expression of protein kinases A and C in MEL cells (78), but
Me2SO does not increase cAMP in MEL cells (79).
Interestingly, the EMSA data of Lok and Ponka (72) suggest that the
amount of protein bound to the ets site relative to the CRE
site decreases in
N,N'-hexamethylene-bis-acetamide- or
Me2SO-treated cells. This is similar to our data with
PMA-stimulated HEL and CHRF cells. ets sites have been shown
to interact with sites for other transcription factors, e.g.
an ets site cooperates with an Sp1 site in the megakaryocyte GP IIb promoter (29), and ets sites have been shown to
cooperate with API sites in a number of other genes (80). CREs
frequently interact with AP-1 sites, and a recent study demonstrated an
interaction between a CRE site and a basic helix-loop-helix binding
site in the neurospecific vgf promoter (81).
We have defined the CRE as a region that is involved in the response to
both PMA and dbcAMP and have found that the degree of change of
endogenous mRNA expression in response to PMA and dbcAMP parallels
the changes we have seen in the expression of the promoter constructs
with these agents. We have thus provided a physiologic correlation for
our findings. Previous studies with other systems have shown that PMA
alone can raise cAMP levels (81, 82), and many studies have shown that
PMA can act in synergy with other cAMP-elevating agents. Previous
studies have reported that the effect of PMA is exerted through the CRE
in the dopamine hydroxylase (83) and DNA polymerase B (84) promoters, but there are no ets sites in these promoters. We
have found that there were significant differences in the binding of nuclear proteins from the megakaryocytic cells compared with HL-60 cells to oligonucleotides representing the putative regulatory ets site (Fig. 3) and the reverse GATA site (not shown). We
hypothesize that the interaction between specific CRE and
ets proteins, and possibly other proteins, in the
megakaryocytic versus the promyelocytic cells may be
involved in the disparate effects of PMA on this promoter. This could
result from the changes in the relative amounts of the ets
and CRE site-binding proteins, which we have detected by EMSA. This may
also result from bending of the DNA in the presence of the various
ets family proteins (85) or the CRE site (74) or to
interaction with cell-specific factors in the initiation complex.
ets-1 was shown to interact with CREB-binding protein (83),
the protein that classically interacts with the CREB.
It is of interest to compare the regulatory sites of the serglycin
promoter to those of other proteoglycans. Chick cartilage aggrecan is
regulated by Sp1-, AP-2-, and NF-1-related sites (86), and rat aggrecan
is regulated post-transcriptionally by cAMP (87). The mouse aggrecan
gene has a high GC content and SP-1 and glucocorticoid response element
sites (88). The perlecan promoter has a transforming growth
factor- -responsive element that bound to unidentified transforming
growth factor- -inducible nuclear proteins with high affinity for NF1
members of transcription factors (89). Perlecan is down-regulated by
cAMP (90). The syndecan-1 promoter is activated by the Wilms' tumor
WT-1 protein (91). The biglycan gene has binding sites for Sp1, AP-1,
and AP-2 factors (92). It is up-regulated by cAMP (93), but no CRE is
present in the promoter, and the cAMP effect is mediated via a Sp1-like
proteins (94). The DSPG3 proteoglycan may be regulated at Sox-1 sites
(95). Likewise, Sp1 sites appear to be critical for expression of the
mouse ryudocan gene (96) and possibly for the rat glypican-1 gene (97).
The decorin gene has a purine/pyrimidene segment that is
sensitive to S1 nuclease and has potential binding sites for AP-1,
AP-5, and NF- B (98). Versican has a CRE half-site near the TATA box region (47), but the enhancer element does not include that region, and
there are no reports in the literature concerning the effects of cAMP
or analogs on versican synthesis. Thus the regulatory elements that we
have identified in the serglycin promoter are not found in common with
any of the known proteoglycan genes.
Our study is the first to show DNase I-hypersensitive sites in a
proteoglycan gene. The HEL and CHRF cells exhibited the same pattern of
DNase I hypersensitivity, but the site was stronger in CHRF cells. The
HL60 had the same two sites, which appeared to be stronger than in the
HEL and CHRF cells, but also a unique DHSS was found within the first
intron. The unique intronic DHSS may explain the differences in the
levels of endogenous expression among these three cell lines but cannot
explain the differences in the effects of PMA on expression of the
5'-flanking region promoter sequences between the megakaryocytic and
HL60 cells. The DHSS site around 276 was about 200 bp upstream of the
ets and CRE sites. No specific elements responsible for the
DNase I hypersensitivity have been defined in this region. Potential transcriptional regulation sites within 100 bp of the +825 site in the
first intron include PEA-1 and AP-1 sites. The +2027 region, the DHSS
region unique to HL60 cells, contains multiple potential E-box sites.
The first evidence that transcription of the serglycin gene is
regulated in a complex manner in different cell types was the finding
that the steady-state levels of the serglycin transcripts in
fibroblasts transfected with serglycin cDNA were considerably less
than in mast cells (24). Information on the regulation of serglycin
expression will be of interest in understanding the function of this
unique proteoglycan that is expressed widely in hematopoietic cells, in
endothelial cells, and in uterine decidual cells because the level of
expression in response to specific stimuli may have profound effects on
modulating assembly of secretory granules or vesicles in these cells
and the activity of the biologically active serglycin-binding proteins
subsequent to their release. A regulatory mechanism that warrants
further investigation is methylation of the DNA. Methylation patterns
differ between HL-60 and non-serglycin-expressing Molt 7 T-lymphoblasts
(7). Endogenous methylation of the CG pair that is part of the CRE in
the serglycin gene may affect the function of the CRE. Because
bacterial DNA is not methylated properly and synthetic DNA is not
methylated at all, the in vitro transfection and EMSA
studies would not take this possibility into account.
 |
ACKNOWLEDGEMENTS |
We thank Andrew Likens for preparation of the
graphics. We appreciate the kind donation of oligodeoxynucleotides from
Dr. Mortimer Poncz.
 |
FOOTNOTES |
*
This work was supported by United States Public Health
Services Grant HL-29282 and by a grant-in-aid from the American Heart Association, Southeastern Pennsylvania Affiliate (to B. P. S.) and by National Institutes of Health Training Grant T32 HL07821 (to
P. C.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Cardeza Foundation for
Hematologic Research, Thomas Jefferson University, 1015 Walnut St.,
Philadelphia, PA 19107. Tel.: 215-955-6312; Fax: 215-955-2366; E-mail: barbara.schick@mail.tju.edu.
Published, JBC Papers in Press, May 1, 2001, DOI 10.1074/jbc.M102958200
1
B. P. Schick, K. C. Brodbeck, and H.-C. K. Ho, submitted for publication.
3
B. P. Schick, H.-C. K. Ho, and K. C. Brodbeck, manuscript in preparation.
 |
ABBREVIATIONS |
The abbreviations used are:
CRE, cyclic AMP
response element;
CREB, CRE-binding protein;
DHSS, DNase I
hypersensitive site;
EMSA, electrophoretic mobility shift assay;
GP, glycoprotein;
HEL, human erythroleukemia;
PMA, phorbol 12-myristate
13-acetate;
PCR, polymerase chain reaction;
dbcAMP, dibutyryl cyclic
AMP;
hGH, human growth hormone;
bp, base pair(s);
MOPS, 4-morpholinepropanesulfonic acid;
kb, kilobase(s).
 |
REFERENCES |
| 1.
|
Alliel, P. M.,
Perin, J. P.,
Maillet, P.,
Bonnet, P.,
Rosa, J. P.,
and Jolles, P.
(1988)
FEBS Lett.
236,
123-126
|
| 2.
|
Schick, B. P.,
Walsh, C. W.,
and Jenkins-West, T.
(1988)
J. Biol. Chem.
263,
1052-1062
|
| 3.
|
Stellrecht, C. M.,
Mars, W. M.,
Miwa, H.,
Beran, M.,
and Saunders, G. F.
(1991)
Differentiation
48,
127-135
|
| 4.
|
Kolset, S. O.,
and Gallagher, J. T.
(1990)
Biochim. Biophys. Acta
1032,
191-211
|
| 5.
|
Birkenbach, M.,
Josefsen, K.,
Yalamanchili, R.,
Lenoir, G.,
and Kieff, E.
(1993)
J. Virol.
67,
2209-2220
|
| 6.
|
Elliott, J. F.,
Miller, C. L.,
Pohajdak, B.,
Talbot, D.,
Helgason, C. D.,
Bleackley, R. C.,
and Paetkau, V.
(1993)
Mol. Immunol.
30,
749-754
|
| 7.
|
Humphries, D.,
Nicodemus, C.,
Schiller, V.,
and Stevens, R.
(1992)
J. Biol. Chem.
267,
13558-13563
|
| 8.
|
Schick, B. P.,
and Senkowski-Richardson, S.
(1992)
Biochem. J.
282,
651-658
|
| 9.
|
Schick, B. P.,
and Jacoby, J. A.
(1995)
J. Cell. Physiol.
165,
96-106
|
| 10.
|
Maillet, P.,
Alliel, P. M.,
and Mitjavila, M. T.
(1992)
Leukemia (Baltimore)
6,
1143-1147
|
| 11.
|
Schick, B. P.,
Gradowski, J. F.,
and San Antonio, J. D.
(2001)
Blood
97,
449-458
|
| 12.
|
Ho, H.-C. K.,
McGrath, K. E., K. C., B.,
Palis, J.,
and Schick, B. P.
(2001)
Biol. Reprod.
64,
1667-1676
|
| 13.
|
Sali, A.,
Matsumoto, R.,
McNeil, H. P.,
Karplus, M.,
and Stevens, R. L.
(1993)
J. Biol. Chem.
268,
9203-9034
|
| 14.
|
Kolset, S. O.,
Mann, D. M.,
Uhlin-Hansen, L.,
Winberg, J. O.,
and Ruoslahti, E.
(1996)
J. Leukocyte Biol.
59,
545-554
|
| 15.
|
Schick, B. P.,
Pestina, T. I.,
San Antonio, J. D.,
Stenberg, P. E.,
and Jackson, C. W.
(1997)
J. Cell. Physiol.
172,
87-93
|
| 16.
|
Brennan, M. J.,
Oldberg, A.,
Hayman, E. G.,
and Ruoslahti, E.
(1983)
Cancer Res.
43,
4302-4307
|
| 17.
|
Forsberg, E.,
Pejler, G.,
Ringvall, M.,
Lunderius, C.,
Tomasini-Johansson, B.,
Kusche-Gullberg, M.,
Eriksson, I.,
Ledin, J.,
Hellman, L.,
and Kjellen, L.
(1999)
Nature
400,
773-776
|
| 18.
|
Humphries, D. E.,
Wong, G. W.,
Friend, D. S.,
Gurish, M. F.,
Qiu, W.-T.,
Huang, C.,
Sharpe, A. H.,
and Stevens, R. L.
(1999)
Nature
400,
769-772
|
| 19.
|
Barber, A.,
Kaser-Glanzmann, R.,
Jakabova, M.,
and Luscher, E.
(1972)
Biochem. Biophys. Acta
286,
312-329
|
| 20.
|
Toyama-Sorimachi, N.,
Kitamura, F.,
Habuchi, H.,
Tobita, Y.,
Kimata, K.,
and Miyasaka, M.
(1997)
J. Biol. Chem.
272,
26714-26719
|
| 21.
|
Toyama-Sorimachi, N.,
Sorimachi, H.,
Tobita, Y.,
Kitamura, F.,
Yagita, H.,
Suzuki, K.,
and Miyasaka, M.
(1995)
J. Biol. Chem.
270,
7437-7444
|
| 22.
|
Avraham, S.,
Avraham, H.,
Austen, K. F.,
and Stevens, R. L.
(1992)
J. Biol. Chem.
267,
610-617
|
| 23.
|
Nicodemus, C. F.,
Avraham, S.,
Austen, K. F.,
Purdy, S.,
Jablonski, J.,
and Stevens, R. L.
(1990)
J. Biol. Chem.
265,
5889-5896
|
| 24.
|
Avraham, S.,
Austen, K. F.,
Nicodemus, C. F.,
Gartner, M. C.,
and Stevens, R. L.
(1989)
J. Biol. Chem.
264,
16719-16726
|
| 25.
|
Angerth, T.,
Huang, R. Y.,
Aveskogh, M.,
Pettersson, I.,
Kjellen, L.,
and Hellman, L.
(1990)
Gene (Amst.)
93,
235-240
|
| 26.
|
Wollberg, P.,
Soderqvist, H.,
and Nelson, B. D.
(1994)
J. Biol. Chem.
269,
19719-19724
|
| 27.
|
Sakamoto, K. M.,
Fraser, J. K.,
Lee, H. J.,
Lehman, E.,
and Gasson, J. C.
(1994)
Mol. Cell. Biol.
14,
5975-5985
|
| 28.
|
Martin, F.,
Prandini, M.-H.,
Thevenon, D.,
Marguerie, G.,
and Uzan, G.
(1993)
J. Biol. Chem.
268,
21606-21612
|
| 29.
|
Block, K. L.,
Shou, Y.,
and Poncz, M.
(1996)
Blood
88,
2071-2080
|
| 30.
|
Block, K. L.,
and Poncz, M.
(1995)
Stem Cells
13,
135-145
|
| 31.
|
Block, K. L.,
Ravid, K.,
Phung, Q. H.,
and Poncz, M.
(1994)
Blood
84,
3385-3393
|
| 32.
|
Prandini, M. H.,
Martin, F.,
Thevenon, D.,
and Uzan, G.
(1996)
Blood
88,
2062-2070
|
| 33.
|
Lemarchandel, V.,
Ghysdae, J.,
Mignotte, V.,
Rahuel, C.,
and Romeo, P.-H.
(1993)
Mol. Cell Biol.
13,
668-675
|
| 34.
|
Bockamp, E. O.,
McLaughlin, F.,
Murrell, A. M.,
Gottgens, B.,
Robb, L.,
Begley, C. G.,
and Green, A. R.
(1995)
Blood
86,
1502-1514
|
| 35.
|
O'Prey, J.,
Ramsay, S.,
Chambers, I.,
and Harrison, P. R.
(1994)
Mol. Cell. Biol.
14,
851-868
|
| 36.
|
Hashimoto, Y.,
and Ware, J.
(1995)
J. Biol. Chem.
270,
24532-24539
|
| 37.
|
Ludlow, L. B.,
Schick, B. P.,
Budarf, M. L.,
Driscoll, D. A.,
Zackai, E. H.,
Cohen, A.,
and Konkle, B. A.
(1996)
J. Biol. Chem.
271,
22076-22080
|
| 38.
|
Bastian, L. S.,
Yagi, C.,
and Roth, G. J.
(1996)
J. Biol. Chem.
271,
18554-18560
|
| 39.
|
Ephrussi, A.,
Church, G. M.,
Tonegawa, S.,
and Gilbert, W.
(1985)
Science
227,
134-140
|
| 40.
|
Fugman, D. A.,
Witte, D. P.,
Jones, C. L.,
Aronow, B. J.,
and Lieberman, M. A.
(1990)
Blood
75,
1252-1261
|
| 41.
|
Montgomery, R. I.,
Lidholt, K.,
Flay, N. W.,
Liang, J.,
Vertel, B.,
Lindahl, U.,
and Esko, J. D.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11327-11331
|
| 42.
|
Boukamp, P.,
Petrussevska, R. T.,
Breitkreutz, D.,
Hornung, J.,
Markham, A.,
and Fusenig, N. E.
(1988)
J. Cell Biol.
106,
761-771
|
| 43.
|
Selden, R. F.,
Howie, K. B.,
Rowe, M. E.,
Goodman, H. M.,
and Moore, D. E.
(1986)
Mol. Cell. Biol.
6,
3173-3179
|
| 44.
|
Ravid, K.,
Doi, T.,
Beeler, D.,
Kuter, D. J.,
and Rosenberg, R.
(1991)
Mol. Cell Biol.
11,
6116-6127
|
| 45.
|
Schick, B. P.,
and Thornton, R. D.
(1993)
Leukemia (Baltimore)
7,
1955-1959
|
| 46.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489
|
| 47.
|
Naso, M. F.,
Zimmermann, D. R.,
and Iozzo, R. V.
(1994)
J. Biol. Chem.
269,
32999-33008
|
| 48.
|
Uzan, G.,
Prenant, M.,
Prandini, M.-H.,
Martin, F.,
and Marguerie, G.
(1991)
J. Biol. Chem.
266,
8932-8939
|
| 49.
|
Jucker, M.,
Roebroek, A. J.,
Mautner, J.,
Koch, K.,
Eick, D.,
Diehl, V.,
Van de Ven, W. J.,
and Tesch, H.
(1992)
Oncogene
7,
943-952
|
| 50.
|
Ramachandran, B.,
Surrey, S.,
and Schwartz, E.
(1995)
Exp. Hematol.
23,
49-57
|
| 51.
| Eisman, R., Surrey, S., Ramachandran, B., Schwartz, E., and Poncz, M. (1990) Blood 336-344
|
| 52.
|
Kunkel, G. R.,
and Martinson, H. G.
(1981)
Nucleic Acids Res.
9,
6869-6888
|
| 53.
|
Ray-Gallet, D.,
Mao, C.,
Tavitian, A.,
and Moreau-Gachelin, F.
(1995)
Oncogene
11,
303-313
|
| 54.
|
Mitchell, P. J.,
and Tjian, R.
(1989)
Science
245,
371-378
|
| 55.
|
Watson, D. K.,
McWilliams, M. J.,
Lapis, P.,
Lautenberger, J. A.,
Schweinfest, C. W.,
and Papas, T. S.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
7862-7866
|
| 56.
|
Duterque-Coquillaud, M.,
Niel, C.,
Plaza, S.,
and Stehelin, D.
(1993)
Oncogene
8,
1865-1873
|
| 57.
|
Rao, V. N.,
Huebner, K.,
Isobe, M.,
ar-Rushdi, A.,
Croce, C. M.,
and Reddy, E. S.
(1989)
Science
244,
66-70
|
| 58.
|
Eklund, K. K.,
Humphries, D. E.,
Zia, Z.,
Ghildyal, N.,
Friend, D. S.,
Gross, V.,
and Stevens, R. L.
(1997)
J. Immunol.
158,
4373-4380
|
| 59.
|
Ikeda, T.,
Wakiya, K.,
and Shibuya, M.
(1996)
Growth Factors
13,
151-162
|
| 60.
|
Wakiya, K.,
Begue, A.,
Stehelin, D.,
and Shibuya, M.
(1996)
J. Biol. Chem.
271,
30823-30828
|
| 61.
|
Schick, P. K.,
Schick, B. P.,
and Williams-Gartner, K.
(1989)
Blood
73,
1801-1808
|
| 62.
|
Stellrecht, C. M.,
Frazier, G.,
Selvanayagams, C.,
Chao, L. Y.,
Lee, A.,
and Saunders, G. F.
(1993)
J. Biol. Chem.
268,
4078-4084
|
| 63.
|
Schick, B. P.
(1991)
Arterioscler. Thromb.
11,
191-197
|
| 64.
|
Whyzmuzis, C. A.,
Wu, J. M.,
and Danishefsky, I.
(1993)
Biochem. Biophys. Res. Commun.
194,
118-125
|
| 65.
|
Laskin, J. D.,
Dokidis, A.,
Kirak, A. A.,
and Laskin, D. L.
(1991)
Leuk. Res.
15,
5515-5523
|
| 66.
|
Ravid, K.,
Beele, R. D. L.,
Rabin, M. S.,
Ruley, H. E.,
and Rosenberg, R. D.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
1521-1525
|
| 67.
|
Stevens, R. L.,
Wong, G. W.,
and Humphries, D. E.
(2000)
in
Proteoglycans
(Iozzo, R. V., ed)
, pp. 177-199, Marcel Dekker, New York
|
| 68.
|
Harrigan, M. T.,
Baughman, G.,
Campbell, N. F.,
and Bourgeois, S.
(1989)
Mol. Cell. Biol.
9,
3438-3446
|
| 69.
|
Grover, A.,
Edwards, S. A.,
Bourdon, M.,
and Adamson, E. D.
(1987)
Differentiation
36,
138-144
|
| 70.
|
Kulseth, M. A.,
Kolset, S. O.,
and Ranheim, T.
(1999)
Biochim. Biophys. Acta
1428,
225-232
|
| 71.
|
Robinson, L.,
Panayiotakis, A.,
Papas, T. S.,
Kola, I.,
and Seth, A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7170-7175
|
| 72.
|
Lok, C. N.,
and Ponka, P.
(2000)
J. Biol. Chem.
275,
24185-24190
|
| 73.
|
Mohle, R.,
Green, D.,
Moore, M. A.,
Nachman, R. L.,
and Rafii, S.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
663-668
|
| 74.
|
Muraosa, Y.,
and Shibahara, S.
(1993)
Mol. Cell. Biol.
13,
7881-7891
|
| 75.
|
Kozak, U. C.,
Kopecky, J.,
Teisinger, J.,
Enerback, S.,
Boyer, B.,
and Kozak, L. P.
(1994)
Mol. Cell. Biol.
14,
59-67
|
| 76.
|
Nakajima, K.,
Kusafuka, T.,
Takeda, T.,
Fujitani, Y.,
Nakae, K.,
and Hirano, T.
(1993)
Mol. Cell. Biol.
13,
3027-3041
|
| 77.
|
Shimura, H.,
Miyazaki, A.,
Haraguchi, K.,
Endo, T.,
and Onaya, T.
(1998)
Mol. Endocrinol.
12,
1473-1486
|
| 78.
|
Sprott, S. C.,
Hammond, K. D.,
and Savage, N.
(1991)
Int. J. Biochem.
23,
713-718
|
| 79.
|
Kuramochi, S.,
Sugimoto, Y.,
Ikawa, Y.,
and Todokoro, K.
(1990)
Eur. J. Biochem.
193,
163-168
|
| 80.
|
Nagamoto-Combs, K.,
Piech, K. M.,
Best, J. A.,
Sun, B.,
and Tank, A. W.
(1997)
J. Biol. Chem.
272,
6051-6058
|
| 81.
|
Church, D. J.,
Van der Bent, V.,
Vallotton, M. B.,
and Lang, U.
(1994)
Biochem. J.
303,
217-225
|
| 82.
|
Marley, P. D.,
Thomson, K. A.,
Hoy, K.,
and Maccarone, P.
(1993)
Eur. J. Pharmacol.
244,
7-14
|
| 83.
|
Kim, J. S.,
Nam, J. S.,
Chae, H. D.,
and Kim, K. T.
(1997)
Brain Res. Mol. Brain Res.
51,
154-160
|
| 84.
|
Englander, E. W.,
and Wilson, S. H.
(1992)
DNA Cell Biol.
11,
61-69
|
| 85.
|
Pio, F.,
Kodandapani, R.,
Ni, C. Z.,
Shepard, W.,
Klemsz, M.,
McKercher, S. R.,
Maki, R. A.,
and Ely, K. R.
(1996)
J. Biol. Chem.
271,
23329-23337
|
| 86.
|
Pirok, E. W.,
Li, H.,
Mensch, J. R.,
Henry, J.,
and Schwartz, N. B.
(1997)
J. Biol. Chem.
272,
11566-11574
|
| 87.
|
Lowe, G. N.,
Fu, Y. H.,
McDougall, S.,
Polendo, R.,
Williams, A.,
Benya, P. D.,
and Hahn, T. J.
(1996)
Endocrinology
137,
2208-2216
|
| 88.
|
Watanabe, H.,
Gao, L.,
Sugiyama, S.,
Doege, K.,
Kimata, K.,
and Yamada, Y.
(1995)
Biochem. J.
308,
433-440
|
| 89.
|
Ko, C. W.,
Bhandari, B.,
Yee, J.,
Terhune, W. C.,
Maldonado, R.,
and Kasinath, B. S.
(1996)
Mol. Cell Biochem.
162,
65-73
|
| 90.
|
Iozzo, R. V.,
Pillarisetti, J.,
Sharma, B.,
Murdoch, A. D.,
Danielson, K. G.,
Uitto, J.,
and Mauviel, A.
(1997)
J. Biol. Chem.
272,
5219-5228
|
| 91.
|
Cook, D. M.,
Hinkes, M. T.,
Bernfield, M.,
and Rauscher, F. J.
(1996)
Oncogene
13,
1789-1799
|
| 92.
|
Ungefroren, H.,
Cikos, T.,
Krull, N. B.,
and Kalthoff, H.
(1997)
Biochem. Biophys. Res. Commun.
235,
413-417
|
| 93.
|
Ungefroren, H.,
and Krull, N. B.
(1996)
J. Biol. Chem.
271,
15787-15795
|
| 94.
|
Ungefroren, H.,
Gellerson, B.,
Krull, N. B.,
and Kalthoff, H.
(1998)
J. Biol. Chem.
273,
29230-29240
|
| 95.
|
Deere, M.,
Dieguez, J. L.,
Yoon, S. J.,
Hewett-Emmett, D.,
de la Chapelle, A.,
and Hecht, J. T.
(1999)
Genome Res.
9,
449-456
|
| 96.
|
Tsuzuki, S.,
Kojima, T.,
Katsumi, A.,
Yamazaki, T.,
Sugiura, I.,
and Saito, H.
(1997)
J. Biochem. (Tokyo)
122,
17-24
|
| 97.
|
Asundi, V. K.,
Keister, B. F.,
and Carey, D. J.
(1998)
Gene (Amst.)
206,
255-261
|
| 98.
|
Mauviel, A.,
Santra, M.,
Chen, Y. Q.,
Uitto, J.,
and Iozzo, R. V.
(1995)
J. Biol. Chem.
270,
11692-11700
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. P. Atkinson, C. M. Koch, G. K. Clelland, S. Willcox, J. C. Fowler, R. Stewart, M. Lako, I. Dunham, and L. Armstrong
Epigenetic Marking Prepares the Human HOXA Cluster for Activation During Differentiation of Pluripotent Cells
Stem Cells,
May 1, 2008;
26(5):
1174 - 1185.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Abrink, M. Grujic, and G. Pejler
Serglycin Is Essential for Maturation of Mast Cell Secretory Granule
J. Biol. Chem.,
September 24, 2004;
279(39):
40897 - 40905.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Castronuevo, M. A. Thornton, L. E. McCarthy, J. Klimas, and B. P. Schick
DNase I Hypersensitivity Patterns of the Serglycin Proteoglycan Gene in Resting and Phorbol 12-Myristate 13-Acetate-stimulated Human Erythroleukemia (HEL), CHRF 288-11, and HL-60 Cells Compared with Neutrophils and Human Umbilical Vein Endothelial Cells
J. Biol. Chem.,
December 5, 2003;
278(49):
48704 - 48712.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Szutorisz, J. Lingner, A. P. Cuthbert, D. A. Trott, R. F. Newbold, and M. Nabholz
A Chromosome 3-encoded Repressor of the Human Telomerase Reverse Transcriptase (hTERT) Gene Controls the State of hTERT Chromatin
Cancer Res.,
February 1, 2003;
63(3):
689 - 695.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|