![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 27, 24931-24936, July 6, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Departments of Medicine and Pharmacology, New York
University School of Medicine, New York, New York 10016
Received for publication, March 30, 2001, and in revised form, May 3, 2001
The transcription factor(s) that mediate
insulin-increased gene transcription are not well defined. These
studies use phenotypic conversion of Rat2 and Chinese hamster ovary
(CHO) cells with transcription factors to identify components
required for regulation of prolactin promoter activity and its control
by insulin. The pituitary-derived GH4 cells contain all of the
transcription factors required for insulin-increased
prolactin-chloramphenicol acetyltransferase (CAT) expression while HeLa
cells require only Pit-1, a pituitary-specific factor. However, Rat2
and CHO cells require additional factors. We had determined previously
that the transcription factor that mediates insulin-increased prolactin
gene expression was likely an Ets-related protein. Elk-1 and Sap-1 were
the only Ets-related transcription factors tested as chimeras with LexA
DNA-binding domain that were able to mediate insulin-increased
expression of a LexA-CAT reporter plasmid. Elk-1 and Sap-1 are
expressed in GH4 and HeLa cells but Rat2 and CHO cells express Sap-1,
but not Elk-1. Expression of Elk-1 made Rat2 cells (but not CHO cells) insulin responsive. C/EBP It is important to identity the insulin responsive transcription
factor(s) that mediate insulin regulation of gene transcription. This
will allow the definition of signaling pathways to those factors. It
may also suggest strategies for replacing insulin in these processes.
The proximal prolactin promoter contains sequences that mediate
cell-specific expression and responses to numerous stimuli including
insulin, epidermal growth factor
(EGF),1 and agents that
elevate cAMP. The transcription factor Pit-1 mediates cell
type-specific prolactin gene transcription by binding to several sites
in the proximal and distal prolactin promoter (1, 2). Pit-1 is a Pou
domain protein that is found in pituitary lactotrophs, somatotrophs,
and thyrotrophs. Insulin, EGF and cAMP act at an overlapping element at
The Ets-related proteins are a large family of transcription
factors with a highly conserved DNA-binding domain (8). This domain has
a basic region and a tryptophan-rich section similar to the binding
domains found in Myc and Myb. These proteins specifically interact with
sequences containing the core trinucleotide GGA. Although this sequence
is essential for Ets-factor binding, flanking sequences are also
important and may determine the different sequence specificity of these
proteins (9). The Ets-binding domain is also crucial to protein-protein
interactions that determine the biological function of the DNA-protein
interaction (10). The activity of Ets-related factors was shown to be
altered by phosphorylation (11).
C/EBPs belong to the bZip family of transcription factors. These have a
conserved COOH-terminal domain containing a basic DNA-binding domain
and a leucine zipper that mediates protein/protein interaction. At
least 6 different genes have been identified that produce C/EBP-related
proteins, c/ebp Physical interactions between transcription factors are known to be
important for a number of processes. The recruitment of CBP/p300 by
phosphorylated CREB was shown to account for the activity of CREB (19).
The activity of the nuclear receptor superfamily of transcription
factors is modulated by a number of co-repressors and co-activators all
of which physically interact (20). C/EBP Previous studies identified Ets-related proteins in GH4 cells and
nuclear extracts from GH4 cells (3) and suggested that an Ets-related
transcription factor mediated insulin increased prolactin gene
expression (6, 7). Therefore, plasmids that expressed LexA fusion
proteins of a variety of Ets-related factors were prepared.
Insulin-increased CAT expression was observed only with the fusion
proteins containing the ternary complex factors Elk-1 and Sap-1 (22).
The observation that knockdown of Elk-1 reduced insulin-increased
prolactin gene expression commensurate with Elk-1 reduction indicated
that Elk-1 was required for insulin sensitivity. This was supported by
transformation of Rat-2 and CHO cells to insulin-sensitive phenotype by
Elk-1 expression (Sap-1 is naturally expressed in those cell lines).
However, insulin-sensitive transcription in CHO cells also required
C/EBP Materials--
TnT lysates for transcription translation were
purchased from Promega. Glutathione-agarose, acetyl-CoA, and silica gel
plates were obtained from Sigma. Reagents used for gel electrophoresis were purchased from Fisher Scientific. A filter binding kit for preparation of mRNA was purchased from Trevigen. The Calypso single tube reverse transcriptase-polymerase chain reaction (RT-PCR) kit was
from Tetralink. Antibody to LexA was from Upstate Biotechnology and
anti-hemagglutinin antibody was from Roche Molecular
Biochemicals. Antibody to Elk-1, Sap-1, SRF, and C/EBP Plasmids--
The construction of pPrl-CAT plasmids containing
Transient Gene Transfection Facilitated by
Electroporation--
Electroporation experiments and CAT assays were
performed as described (25). GH4 cells were placed in Dulbecco's
modified Eagle's medium that contained 10% hormone-depleted serum for
24 h, harvested with an EDTA solution, and 20-40 × 106 cells were used for each electroporation. Trypan blue
exclusion before electroporation ranged from 95 to 99%. The voltage of
the electroporation was 1550 volts. This gives trypan blue exclusion of
70 to 80% after electroporation. The transfected cells were then
plated in multiwell dishes (Falcon Plastics) at 5 × 106 cells/9-cm2 tissue culture well in
Dulbecco's modified Eagle's medium with 10% hormone-depleted serum.
Cells were refed at 24 h with Dulbecco's modified Eagle's medium
with 10% hormone-depleted serum ± EGF (40 ng/ml recombinant
human EGF, R & D), insulin (1 µg/ml bovine insulin, Calbiochem), or
cAMP (0.1 mM, 8-(4-chlorophenylthio)-adenosine-3',5'-cyclic monophosphate, Sigma). After 48 h, the wells were washed three times with normal saline and frozen. CAT activity was assayed essentially as described previously (26) except that
[14C]chloramphenicol was replaced with BODIPY
chloramphenicol (Molecular Probes, Eugene, OR) and fluorescence
intensity was measured using a FluoroImager 575 (Molecular Dynamics,
Sunnyvale, CA) with ImageQuant software.
Control of transfection efficiency was performed using a Rous sarcoma
virus- Protein-Protein Interaction Assay Using GST Fusion
Proteins--
Glutathione-agarose beads (Sigma) were mixed with
bacterial lyastes containing GST fusion protein or GST. The beads were
then washed extensively to remove unbound proteins. The amount of GST fusion protein or GST on the beads was estimated by dye binding after
SDS-polyacrylamide gel electrophoresis and equal amounts of
glutathione-agarose bound GST fusion protein or GST were used in each
incubation. L-[35S]Methionine-labeled
proteins were prepared using TNT reticulocyte lysates (Promega).
Approximately equal amounts of 35S-labeled protein (as
estimated from gel band using ImageQuant software, Amersham Pharmacia
Biotech) were used in each incubation. The incubation was carried out
for 1 h at 4 °C in 300 µl of a buffer containing 50 mM KCl, 25 mM HEPES (pH 7.9), 6% glycerol, 5 mM EDTA, 5 mM MgCl2, 0.05% Triton
X-100, and 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride.
The beads were collected by centrifugation and washed three times with
incubation buffer. The beads were then resuspended in SDS sample buffer
and the bound proteins were analyzed by SDS-polyacrylamide gel electrophoresis.
RT-PCR of Elk-1 and Sap-1 mRNA--
mRNA was
prepared using a filter binding protocol (Trevigen). The amount of
mRNA was estimated from the absorbance at 260/280 nm. The ratio of
the optical density at 260 nm to the optical density at 280 nm was
generally 2 or greater. Approximately equal amounts of mRNA (~0.1
µg) were then used with primers for the mRNA for
glyceraldehyde-3-phosphate dehydrogenase in a single tube RT-PCR
assay (Tetra Link, Amherst, NY). The glyceraldehyde-3-phosphate dehydrogenase primers were
459GATTGTCAGCAATGCATCCTGCAC482 and
996CACCCTGTTGCTGTAGCCATATTC973. The PCR was
carried out at 94 °C for 20 s, 55 °C for 20 s, and 68 °C for 20 s. In all of the RT-PCR experiments, the number of PCR cycles was adjusted to achieve linearity. For
glyceraldehyde-3-phosphate dehydrogenase, 25 cycles were used to
maintain linearity and samples varied less than ±25%. The RT-PCR
product from this reaction was quantitated using a FluoroImager 575 and
ImageQuant software (Amersham Pharmacia Biotech). Equal amounts of
mRNA (based on glyceraldehyde-3-phosphate dehydrogenase signal)
were then used for assay of C/EBP LexA Fusion Proteins of Elk-1 and Sap-1 Mediate Insulin-increased
Transcription--
Previous studies (3, 6, 7) suggested that
insulin-increased prolactin gene expression was mediated by an
Ets-related transcription factor. Therefore, LexA fusion proteins were
constructed with a variety of Ets-related transcription factors to
determine whether any of these could mediate the effects of insulin.
LexA was chosen instead of the more common Gal4 since the Gal4 operator contains an Ets-response element and is strongly activated by insulin
in GH4 cells.2 GH4 cells were
co-transfected with the Lex6X-CAT reporter plasmid and various LexA-Ets
factor fusion proteins and incubated with or without insulin for
24 h (Fig. 1). The LexA fusion
constructs of Elk-1 (LexA-Elk-(105/428)) and Sap-1 (LexA-Sap-(90/431))
were insulin responsive. Insulin increased Lex6X-CAT expression
9-10-fold in GH4 cells transfected with LexA fusion proteins
containing the C terminus of either Elk-1 or Sap-1 (Fig. 1). EGF also
increased Lex6X-CAT expression 8-fold in LexA-Elk-transfected GH4
cells, but no increase in Lex6X-CAT expression was observed in
LexA-Sap-transfected cells treated with EGF. The plasmids expressing
LexA-GABP Rat2 Cell Conversion into Cells with Insulin-responsive Prolactin
Promoter Transcription by Expression of Elk-1 and
Pit-1--
Prolactin-CAT expression is insulin sensitive in GH4 and
HeLa cells, but not in Rat2 cells. Transcription from the prolactin promoter is increased by cAMP in Rat2 cells. This implies that the lack
of insulin responsiveness is not due to a general inactivation of the
prolactin promoter in Rat2 cells and suggested that the insulin-sensitive transcription factor might not be present in Rat2
cells. RT-PCR was used to estimate levels of expression of Elk-1 and
Sap-1 in the GH4, HeLa, Rat 2, CHO, and 3T3 cells (a positive control)
since levels of Elk-1 and Sap-1 were too low to be detected by
Western blotting in our cultures. All of the cell lines have
measurable, but variable amounts of Sap-1 (Fig. 2, bottom). However, Elk-1 was
not detectable in lysates from Rat2 cells or CHO cells (Fig. 2,
top). Therefore, Rat2 cells were transfected with an
expression vector for Elk-1 (MLV-Elk-1) along with the prolactin-CAT
reporter, RSV-Pit-1 (to increase transcription from the prolactin
promoter), and the insulin receptor. Insulin increased prolactin-CAT
expression 4-5-fold in Elk-1 transfected Rat2 cells (Fig.
3). This compares to the 8-10-fold
increase in prolactin-CAT expression in cAMP-treated GH4 cells. Sap-1,
SRF, Ets1, Elf1, and GABP were also expressed under the same conditions to determine if this effect was specific to Elk-1. Insulin did not
increase prolactin-CAT expression with any of these transcription factors. Thus, Elk-1 specifically mediated the insulin-increased expression of prolactin-CAT.
C/EBP
Elk-1 and Sap-1 also interact with each other (Fig. 4,
bottom). 35S-Elk-1 and 35S-Sap-1 but
not 35S-SRF associate with GST-Elk-(105-350) (Fig. 4,
bottom, lanes 2, 6, and 10) and with
GST-Sap-(95-340) (Fig. 4, bottom, lanes 3, 7, and
11). None of the 35S-labeled proteins associated
with the GST control (Fig. 4, bottom, lanes 4, 8, and
12).
CHO Cells Are Converted into Cells with Insulin-responsive
Prolactin Promoter Transcription by Expression of Elk-1, Pit-1, and
C/EBP Knockdown of Elk-1 in GH4 Cells--
Knockdown experiments
could confirm that Elk mediates insulin-increased prolactin gene
expression. Twelve different Elk-1 antisense oligonucleotides were
designed to the 5' region of the mouse Elk-1 gene flanking the first
ATG. One of these, CATCACTAGGGAAGCACTCACGCCATT, was able to
consistently reduce levels of Elk-1 mRNA without affecting C/EBP
Antisense oligonucleotides can have many non-antisense effects (29).
Therefore, it was important to determine the levels of Elk-1 in
antisense-treated GH4 cells. Parallel wells were harvested in lysis
buffer and mRNA was prepared. RT-PCR was then performed using
primers to C/EBP Insulin-increased prolactin gene expression requires
Elk-1--
Fusion proteins containing the C terminus of either Elk-1
or Sap-1 mediated insulin increased prolactin-CAT expression (Figs. 1).
These results were specific for Elk-1 and Sap-1 since LexA fusion
proteins with other Ets-transcription factors, Elf-1, Ets-1, and
GABP
Sap-1 alone is not able to mediate insulin-responsive gene
transcription since Rat2 and CHO cells expressed Sap-1 (Fig. 2) and yet
were not insulin responsive (Figs. 3 and 5). This was surprising since
either Elk-1 or Sap-1 could function independently in the activation of
the serum response element of the c-fos promoter (22, 23,
27, 30). It is possible that Sap-1 levels in Rat-2 and CHO cells were
below some threshold necessary to mediate insulin responses. However,
this appears unlikely as insulin-increased prolactin-CAT expression was
not observed in Rat-2 or CHO cells even when Sap-1 was exogenously
expressed (Figs. 3 and 5). Thus, the role of Sap-1 in insulin-increased
prolactin gene expression remains unclear. Sap-1 might play no role in
insulin-increased transcription. Alternatively, it is possible that
Elk-1/Sap-1 heterodimerization might be required for insulin-increased
transcription. The interaction between Elk-1 and Sap-1 in the GST
pull-down experiments suggested that Elk-1 and Sap-1 might
heterodimerize in vivo to mediate effects on gene
transcription. Elk-1 and Sap-1 were not known to form dimers in
solution, but the phosphorylation dependent formation of a dimer on the
c-Fos serum response element was reported (31). Since the c-Fos serum
response element has only a single, weak Ets-response element, this is
likely a protein-protein interaction. The GST pull-down experiments
(Fig. 4) demonstrated physical association between Elk-1/Elk-1,
Elk-1/Sap-1, and Sap-1/Sap-1. The associations observed in our GST
pull-down experiments are clearly independent of phosphorylation. The
prolactin promoter has two Ets-response sequences. The CGGAAA sequence
at
However, it has not yet proved possible to knockdown Sap-1 in GH4
cells. The use of antisense oligonucleotides designed against the
sequence of human Sap-1 was unsuccessful. This is likely due to a
substantial difference in the non-coding region of the Sap-1 gene from
human and mouse. The sequences of the human Elk-1 and the mouse Elk-1
differ greatly in the 5'-untranslated region and the same is likely to
be true of Sap-1. However, the sequence of the mouse and/or rat Sap-1
gene is unknown. Finally, no Sap-1 minus cell line has been identified.
C/EBP
C/EBP
Expression of C/EBP
Several reports have suggested that C/EBP family members can mediate
effects of cAMP (32, 33). It is possible that C/EBP
It remains to be determined how the factors that interact in the
promoter region of the prolactin gene increase transcription in
response to insulin. The carboxyl terminus of Elk-1 contains numerous
phosphorylation sites and experiments with LexA-Elk-1 fusion proteins
indicated that this region of Elk-1 is essential for insulin-increased
LexA-CAT expression mediated by these fusion proteins.3 This modification
of Elk-1 might be required to recruit a co-activator complex to the
promoter. It was reported that Elk-1 can recruit CBP to the Fos
promoter (34). However, experiments using expression of E1a mutants did
not support a role for CBP in prolactin promoter activation by
insulin.4 Alternatively,
phosphorylated Elk-1 might interact with the basal transcription
factors such as TFIIB to stabilize the initiation complex. Further
research will attempt to further define how insulin-modified Elk-1
activates transcription.
We thank D. Ron, J. Leiden, R. Maurer,
S. L. McKnight, C. C. Thompson, R. Treisman, and J. Whittaker
for plasmids used in these studies.
*
This work was supported National Institutes of Health Grant
DK43365 and the New York State Health Research Council.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Medicine, TH
450, NYU Medical Center, 550 First Ave., New York, NY 10016. Tel.:
212-263-7927; Fax: 212-263-7701; E-mail: stanlf01@med.nyu.edu.
Published, JBC Papers in Press, May 4, 2001, DOI 10.1074/jbc.M102826200
2
K. K. Jacob and F. M. Stanley,
unpublished observation.
3
A. Vulin, K. K. Jacob, and F. M. Stanley, manuscript in preparation.
4
A. Vulin and F. M. Stanley,
unpublished data.
The abbreviations used are:
EGF, epidermal growth factor;
CAT, chloramphenicol acetyltransferase;
RT-PCR, reverse transcriptase-polymerase chain reaction;
SRF, serum
response factor;
GABP, GA binding protein;
GST, glutathione
S-transferase.
Elk-1, C/EBP
, and Pit-1 Confer an Insulin-responsive Phenotype
on Prolactin Promoter Expression in Chinese Hamster Ovary Cells
and Define the Factors Required for Insulin-increased
Transcription*
and
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
also binds to the prolactin promoter at a
sequence overlapping the binding site for Elk-1. Expression of both
C/EBP
and Pit-1 in CHO cells is required for high basal transcription of prolactin-CAT. Expression of Elk-1 converts CHO cells
into a phenotype in which prolactin gene expression is increased by
insulin treatment. Finally, antisense mediated reduction of Elk-1 in
GH4 cells decreased insulin-increased prolactin gene expression and
confirmed the requirement for Elk-1 for insulin-increased prolactin
gene expression. Thus, both C/EBP
and Pit-1 were required for high
basal transcription while insulin sensitivity required Elk-1.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
100/
66 that is also critical for high level basal transcription of
the prolactin gene (3, 4). This control region contains a cAMP
responsive sequence TGACGGA. Overlapping this element is an Ets-factor
binding sequence CGGAAA that is repeated at
71/
68. This element was
shown to mediate the effects of insulin, insulin-like growth
factor-I, and EGF (3, 4). Furthermore, mutation of this
multiresponse element causes a profound reduction in basal prolactin
gene expression (3). This results from elimination of C/EBP
binding
that is necessary for high-level basal prolactin gene expression (5). The other transcription factors that interact at this complex element
have not been identified, but it is likely that at least one
Ets-related factor functions through this element. Expression of the
DNA-binding domain of Ets-2 acts as a dominant negative inhibitor of
transcription mediated by Ets-related factors. Expression of this
inhibitor in GH cells partially blocks both insulin and EGF-increased
prolactin-CAT expression (4, 6). Ets-related factors have been shown to
bind to this promoter region (6, 7).
, c/ebp
,
c/ebp
, c/ebp
, c/ebg
, and
c/ebp
(12-15). Several of these have alternate splice variants. Thus, C/EBP
is found in alternately translated 42- and
30-kDa forms. The 42-kDa form is initiated from the first start codon
and activates gene transcription while the 30-kDa protein is initiated
from the third start codon and has been shown to be inhibitory (16).
These proteins can bind to DNA only as homo- or heterodimers and
heterodimerization between stimulatory and inhibitory bZIP proteins has
been shown to be important in regulating their activity. The consensus
DNA binding sequence for bZIP proteins is T(T/G)NNGNAA(T/G) (17).
C/EBPs are expressed only in terminally differentiated tissues such as
liver and adipocytes. C/EBPs have been linked to numerous genes that
are regulated by insulin and/or cAMP such as phosphoenolpyruvate
carboxykinase (14) and the acetyl-CoA carboxylase gene (18).
directly interacts with the
DNA-binding domain of c-Myb (21). The Ets-related factors
Elk-1 and Sap-1 were identified as proteins interacting with serum
response factor on the c-fos promoter (22, 23).
. Thus, both Elk-1 is required for insulin-increased prolactin
gene expression under conditions where Pit-1 and C/EBP
support basal
transcription of the gene.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
were from
Santa Cruz. Secondary antibodies were from Kierkegard and Perry.
Substrate for chemiluminescence was from Pierce. Oligonucleotides were
purchased from Operon. Dulbecco's modified Eagle's medium containing
4.5 g/liter glucose and iron-supplemented calf serum were obtained from
Hyclone Laboratories. All other reagents were of the highest purity
available and were obtained from Sigma, Bio-Rad, Eastman, Fisher, or
Roche Molecular Biochemicals.
173/+75 of prolactin 5'-flanking DNA was described (24). The human
insulin expression vector, pRT3HIR2, was the gift of Dr. J. Whittaker (Hagedorn Research Institute, Gentofte, Denmark). The
plasmid CMV-GABP
was provided by Dr. C. Thompson (Carnegie
Institute, Baltimore, MD). Plasmids containing the cDNA for Elk-1,
Sap-1, and SRF were the gift of Dr. R. Treisman (Imperial Cancer
Research Fund, London, United Kingdom). Dr. R. Maurer (Oregon
Health Sciences University, Portland, OR) generously provided a plasmid
containing the cDNA for human c-Ets-1. The expression plasmid for
human Elf-1 was from Dr. J. Leiden (University of Chicago, Chicago,
IL). The cDNA for C/EBP
was the gift of Dr. S. L. McKnight
(Tularik, S. San Francisco, CA). The CAT reporter, Lex6X-CAT, and the
LexA expression plasmid, pEG202, were gifts of Dr. R. Brent (Harvard Medical School, Boston, MA). The plasmid Lex6X-CAT contains 3 ColE1
operators, each containing 2 LexA operator sites, inserted into the
-globin promoter at the XhoI site (125 base pairs from the
-globin start of transcription). The pEG202 is a vector for expression of the LexA DNA-binding domain (amino acids 1-202) in
yeast. Therefore, a HindIII/XhoI fragment from
this plasmid that contained the LexA cDNA and the polylinker was
recloned into pcDNA3 (Invitrogen) to make LexApcDNA3. The
cDNAs for the various Ets-related transcription factors (Elk-1,
Sap-1, Elf-1, Ets-1, GABP
, and GABP
) were used as templates in
PCR reactions to produce cDNAs having restriction sites suitable
for cloning into LexA-pcDNA3. The cDNAs were then cloned
COOH-terminal to and in-frame with the LexA cDNA in this vector.
These LexA-Ets-related protein expression vectors containing various
fractions of the wild type protein are listed in the appropriate figure
legends. The cDNAs for Elk-1 and Sap-1 were also cloned into
pcDNA3 to make plasmids pcDNA-Elk and pcDNA-Sap. The
plasmid pGEXkg-C/EBP
that expresses a glutathione S-transferase (GST)-C/EBP
fusion protein was constructed
by inserting the NcoI fragment of C/EBP
into the vector
pGEXkg. The NcoI insert includes amino acids 1 to 353 of
C/EBP
. GST-Elk-(105/350) and GST-Sap-(95/340) were made by
cloning a PCR fragment into the EcoRI site of pGEX-2T
(Amersham Pharmacia Biotech). The production of the correct sized
fusion proteins in yeast and/or tissue culture was verified by Western
blotting with antibodies to LexA, Elk-1, Sap, and C/EBP
.
-galactosidase expression plasmid. Briefly, 2 µg of Rous
sarcoma virus-
-galactosidase expression plasmid was included in the
experiments. The
-galactosidase activity in the cell lysates was
determined using
o-nitrophenyl-
-D-galactopyranoside. Transfection efficiency did not vary significantly among transfections performed at the same time. The percent acetylation was then corrected for minor variations in
-galactosidase activity by converting the
percent acetylation to percent acetylation/A430
-galactosidase activity/mg of protein. The fold stimulation or
inhibition was then determined. Statistical analysis was performed on
all experiments and p values are presented for relevant comparisons.
, Elk-1, Pit-1, and Sap-1
mRNAs. Elk-1 primers were
1063GTAGAAGGGCCCAAGGAAGAGTTG1086 and
1527CTGGGCGCTGCCACTGGATGGAAACTGGAA1498. Elk-1
PCR was carried out for 30 cycles at 94 °C for 20 s, 60 °C
for 20 s, and 68 °C for 20 s. Sap-1 primers were
891GCTTTTGCCACCACACCACCCATTTCG917 and
1392GCCCAGACAGAGTGAATGGCCCATGACTG1364. Sap-1
PCR was carried out for 30 cycles at 94 °C for 20 s, 55 °C
for 20 s, and 68 °C for 20 s. C/EBP
primers were
820GCCAAGAAGTCGGTGGATAAGAAC843 and
968CGGTCATTGTCACTGGTCAACTCC945. C/EBP
PCR
was carried out for 30 cycles at 94 °C for 20 s, 55 °C for
20 s, and 68 °C for 5 s. Pit-1 primers were
190TCTGTGCCTTCCTGTCATTATGG212 and
684CCTCCGTTTCCTCTTCCTTTCG663. Pit-1 PCR was
carried out for 25 cycles at 94 °C for 20 s, 55 °C for
20 s, and 68 °C for 30 s.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-(1-320), LexA-Elf-(1/195), LexA-Elf-(292/536), and
LexA-Ets1-(1/332) were not insulin or EGF responsive (Fig. 1). Finally,
a LexA-SRF fusion protein was also tested since Elk and Sap were shown
to cooperate with SRF in growth factor and serum stimulation of the
c-fos promoter (22, 27). However, neither insulin nor EGF
increased Lex6X-CAT expression in the presence of the LexA-SRF fusion
protein.

View larger version (19K):
[in a new window]
Fig. 1.
Effect of other LexA-transcription factor
fusion proteins on Lex6X-CAT expression. GH4 cells were
electroporated with 10 µg of Lex6X-CAT (26), 5 µg of an expression
vector for the human insulin receptor, pRT3HIR2 (J. Whittaker), and 2 µg of Rous sarcoma virus-
-galactosidase. Vectors (10 µg) that
express the LexA DNA-binding domain (1/202) fused to a portion of the
cDNA for a transcription factor fused COOH-terminal to and in-frame
with the LexA DNA-binding domain were also included in each
electroporation. The transcription factors used were Ets1, Elf, Elk-1,
Sap-1, GABP
, and SRF. A vector containing only the LexA DNA-binding
domain was used as a control. After 24 h, the medium was exchanged
and 1 µg/ml insulin, or 40 ng/ml EGF was added to the appropriate
cultures. The plates were harvested 48 h after electroporation by
washing 3 times with normal saline and freezing. The average percent
acetylation/10 µg of protein in control and insulin- or EGF-treated
cultures was determined, adjusted for
-galactosidase expression, and
the CAT activity from cells incubated with hormones were compared with
control levels to determine the fold-stimulation
(Fold-Control). The results are from three separate
experiments done in duplicate.

View larger version (41K):
[in a new window]
Fig. 2.
Relative Elk-1 and Sap-1 mRNA levels in
various cell types. The cell types indicated in the figure were
cultured in growth medium until nearly confluent. They were washed with
normal saline solution and solubilized in lysis buffer. The mRNA
was then prepared. RT-PCR was performed first using primers for
glyceraldehyde-phosphate dehydrogenase to standardize the level of
mRNA between samples (data not shown). Standardization of the
mRNA using RT-PCR of GAP-DH agreed closely with measurement of the
optical density at 260 nM. The RT-PCR was then repeated
using primers specific for Elk-1 (top) and Sap-1
(bottom). The PCR products were resolved on 1% agarose gel
electrophoresis using ethidium bromide to stain the DNA. The image was
then developed and quantitated using a FluoroImager (Amersham Pharmacia
Biotech).

View larger version (26K):
[in a new window]
Fig. 3.
Insulin-increased prolactin-CAT transcription
in Rat2 cells expressing Elk-1. Rat2 cells were electroporated
with 10 µg of pPrl(
173/+75)CAT (26), 5 µg of an expression vector
for the human insulin receptor, pRT3HIR2 (J. Whittaker), and 2 µg of
Rous sarcoma virus-
-galactosidase alone or with 10 µg of a vector
expressing a cDNA for the Ets-related transcription factor
indicated. After 24 h, the medium was exchanged and 1 µg/ml
insulin or 0.1 mM 8-(4-chloreophenylthio)-cAMP was added to
the appropriate cultures. The plates were harvested 48 h after
electroporation by washing 3 times with normal saline and freezing. The
average percent acetylation/10 µg of protein in control and insulin-
or cAMP-treated cultures was determined, adjusted for
-galactosidase
expression, and the CAT activity from cells incubated with hormones
were compared with control levels to determine the fold-stimulation
(Fold-Control). The results are from three separate
experiments done in duplicate.
, Elk-1, and Sap-1 Interact in Vitro--
However,
prolactin-CAT expression was not increased in CHO cells (that also lack
Elk-1) under the same conditions (see Fig. 5, below). This implied that
another transcription factor was required for insulin-increased
prolactin-CAT expression in addition to Elk-1 and Pit-1. It was
possible that this factor was C/EBP
since C/EBP
binds to the
prolactin promoter at a site overlapping the insulin response element
(5). A physical interaction between Elk-1/Sap-1 and C/EBP
was
established by the association of [35S]Elk-1 or
[35S]Sap-1 translated in vitro with
GST-C/EBP
(Fig. 4, top).
Elk-1 (lane 2) binds to C/EBP
with an apparent lower
affinity than Sap-1 (lane 5) since an equal number of
counts/min of 35S-labeled protein was used in each case.
However, binding of SRF (lane 8) used as a control, was not
detected.

View larger version (66K):
[in a new window]
Fig. 4.
In vitro association of Elk-1,
Sap-1, and C/EBP
. Top,
35S-labeled Elk-1, Sap-1, or SRF were incubated with a
GST-C/EBP
fusion protein or with GST that had been purified using
GST-agarose (Sigma). The agarose beads were washed extensively and
eluted in SDS sample buffer. The labeled proteins were resolved on a
10% SDS-polyacrylamide gel and visualized using a PhosphorImager
(Amersham Pharmacia Biotech). The input lanes contain 10% of the total
35S added in the incubations. Bottom,
35S-labeled Elk-1, Sap-1, or SRF were incubated with
GST-Elk-(105-350) or Sap-(95-340) fusion proteins or with GST that
had been purified using glutathione-agarose. The samples were washed,
resolved, and visualized as above.
--
Insulin did not increase prolactin-CAT expression in CHO
cells electroporated with Elk-1 and Pit-1 (data not shown). This was
unlike the response of Rat2 cells (Fig. 3) and suggested that at least
one other transcription factor (in addition to basal factors) was
required for insulin-increased prolactin-CAT expression. The
interactions between Elk and Sap and C/EBP
suggested that C/EBP
might be the factor that is low or missing in CHO cells. Expression of
the prolactin-CAT reporter plasmid was undetectable in CHO cells
transfected with either C/EBP
or Pit-1 alone while co-transfection
with both Pit-1 and C/EBP
resulted in high level expression from the
prolactin promoter. However, insulin treatment had no effect unless
Elk-1 was co-transfected with C/EBP
and Pit-1 (Fig.
5). Insulin increased prolactin promoter
activity was not restored using any of the other Ets-related
transcription factors (the <2-fold increase seen in Sap-1
electroporated cultures was not significant). Thus, CHO cells can be
transformed into an insulin-sensitive phenotype through
co-expression of the transcription factors Elk-1 and C/EBP
.

View larger version (23K):
[in a new window]
Fig. 5.
Insulin-increased prolactin-CAT transcription
in CHO cells expressing Elk-1. CHO cells were electroporated with
10 µg of pPrl(
173/+75)CAT (26), 5 µg of an expression vector for
the human insulin receptor, pRT3HIR2 (J. Whittaker), and 2 µg of Rous
sarcoma virus-
-galactosidase alone or with 10 µg of a vector
expressing a cDNA for the indicated expression vector for
Ets-related transcription factor. After 24 h, the medium was
exchanged and 1 µg/ml insulin or 0.1 mM
8-(4-chloreophenylthio)adenosine-cAMP was added to the
appropriate cultures. The plates were harvested 48 h after
electroporation by washing 3 times with normal saline and freezing. The
average percent acetylation, 10 µg of protein in control and
insulin-treated cultures was determined, adjusted for
-galactosidase
expression, and the CAT activity from cells incubated with hormones
were compared with control levels to determine the fold-stimulation
(Fold-Control). The basal CAT activity in cultures electroporated with
Pit-1 and C/EBP
was set as 1 since CAT activity in cultures without
both Pit-1 and C/EBP
were too low to measure (data not shown). The
results are from three separate experiments done in duplicate.
, Pit-1, or Sap-1 mRNA. This oligonucleotide was delivered into GH4 by scraping the cells from the dish in the presence of 1 µM antisense oligonucleotide. Pores open in adherent
cells when they are scraped from the plastic dish and small molecules
in the medium can enter the cell for a short period after scraping (28). GH4 cells were also scraped in the presence of a control antisense oligonucleotide and without any oligonucleotide. The cells
were harvested after 24 h and electroporated as described above
with the prolactin-CAT reporter plasmid in the presence of 1 µM antisense oligonucleotide. Six wells were set up from each electroporation. Two each for determination of CAT activity in
control and insulin-treated cultures and two wells for preparation of
mRNA for comparative determination of the level of mRNA for Elk-1 and other transcription factors. The cells were treated as
described under "Experimental Procedures." Insulin-increased prolactin-CAT expression is reduced to 40% of control levels by treatment of GH4 cells with the antisense Elk-1 oligonucleotide (Fig.
6) while the level of CAT expression in
the cells treated with the control antisense oligonucleotide is not
significantly different from the control.

View larger version (15K):
[in a new window]
Fig. 6.
Insulin-increased prolactin-CAT expression is
inhibited by antisense Elk-1. Antisense oligonucleotides were
delivered into GH4 cells by scraping the cells from the dish in the
presence of 1 µM antisense oligonucleotide. Pores open in
adherent cells when they are scraped from the plastic dish and small
molecules in the medium can enter the cell for a short period after
scraping (28). The GH4 cells were then plated in growth medium. The
cells were harvested after 24 h and electroporated with 10 µg of
pPrl-(
173/+75)CAT (26), 5 µg of an expression vector for the human
insulin receptor, pRT3HIR2 (J. Whittaker), and 2 µg of Rous sarcoma
virus-
-galactosidase and with or without 1 µM
antisense oligonucleotide. After 24 h, the medium was exchanged
and 1 µg/ml insulin was added to the appropriate cultures. The plates
were harvested 48 h after electroporation by washing 3 times with
normal saline and freezing. The average percent acetylation, 10 µg of
protein in control and insulin-treated cultures was determined,
adjusted for
-galactosidase expression, and the CAT activity from
cells incubated with insulin were compared with control levels to
determine the fold-stimulation (Fold-Control). The results
are from three separate experiments done in duplicate.
, Elk-1, Pit-1, and Sap-1. Comparative mRNA
levels for control cells and cells treated with antisense Elk and the
control antisense oligonucleotide are shown (Fig. 7). The antisense oligonucleotide to
Elk-1 reduced Elk-1 mRNA levels to 30% of control (Fig. 7), while
the control antisense oligonucleotide was without effect. The antisense
oligonucleotides did not affect expression of C/EBP
, Sap-1, or Pit-1
mRNA.

View larger version (54K):
[in a new window]
Fig. 7.
C/EBP
, Elk-1, Pit-1,
and Sap-1 mRNA levels in antisense-treated cultures. Control
cells and cells treated with antisense oligonucleotides in parallel
with those in Fig. 6 were cultured in hormone-depleted serum and
harvested at the same time as the cells in Fig. 6. The mRNA was
then prepared. RT-PCR was performed first using primers for
glyceraldehyde-phosphate dehydrogenase to standardize the level of
mRNA between samples (data not shown). The RT-PCR was then repeated
using primers specific for C/EBP
, Elk-1, Pit-1, or Sap-1. The PCR
products were resolved on 1% agarose gel electrophoresis using
ethidium bromide to stain the DNA. The image (top) was then
developed and quantitated using a FluoroImager (Amersham Pharmacia
Biotech).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(Fig. 1) did not mediate this response. This suggested that
either Elk-1 or Sap-1 could mediate insulin-responsive gene transcription. Insulin-increased prolactin gene transcription is not
observed in Rat-2 and CHO cells. The Rat-2 and CHO cells have
endogenous Sap-1, but Elk-1 was not detectable in these cell lines. The
expression of Elk-1 in Rat-2 and CHO cells, along with transcription
factors necessary for establishing basal transcription of the prolactin
gene, converts them into an insulin-sensitive phenotype. Finally, Elk-1
knockdown in GH4 cells reduced insulin-increased prolactin-CAT
expression commensurate with reduced Elk-1 expression. These studies
establish that Elk-1 is necessary for insulin-increased prolactin gene expression.
96/
92 is the strongest while an AGGA sequence is at
76/
73.
Thus, it appears likely that two Ets-related transcription factors can
bind simultaneously to the prolactin promoter. Protein-protein
interactions may stabilize this interaction and select for the
heterodimer over the monomer.
Is an Accessory Factor for Elk-1 in Insulin-increased
Transcription--
Insulin does not increase prolactin-CAT expression
in CHO cells that transiently express Elk-1 (data not shown) although
insulin-increased Lex6X-CAT transcription is observed in CHO cells
expressing LexA-Elk-1 fusion proteins (data not shown). This suggested
that the insulin-signaling pathway was intact in CHO cells but that
some other transcription factor required for insulin-sensitive
prolactin-CAT expression was not expressed. The observation that
C/EBP
was a physiological regulator of prolactin gene expression
whose binding site overlaps the insulin response element (5) suggested
that C/EBP
might be this required factor.
associates with Elk-1/Sap-1 in vitro as indicated
by association in GST pull-down assays (Fig. 4). However, the
physiological significance of this observation is presently unclear.
The C/EBP
binding element of the prolactin promoter is weak compared
with the consensus C/EBP-response element. Thus, it is possible that interaction with Elk-1/Sap-1 stabilizes the weak association with the
prolactin DNA. This seem unlikely since deletion of the Ets-binding element did not reduce basal prolactin gene expression as would be
expected if this also weakened the association of C/EBP
with the
prolactin promoter (3).
along with Pit-1 and Elk-1 in CHO cells
converted CHO cells to an insulin responsive phenotype. Previous experiments showed that insulin-increased prolactin-CAT expression was
inhibited by expression of Chop 10/Gad 53. This factor binds to
C/EBP
and inactivates it. Thus, both knock-in and knock-down experiments now establish that C/EBP
is an accessory factor required for insulin-increased prolactin-CAT expression.
may mediate
cAMP-increased prolactin gene expression since mutation of the C/EBP
response element eliminates cAMP responsiveness. However, C/EBP
expression in CHO cells does not make the prolactin promoter cAMP
responsive in those cells. This could be due to failure of cAMP
signaling pathways to link to C/EBP in CHO cells or to lack of a
co-regulator recruited by C/EBP
. Finally, the cAMP response might be
mediated by another factor that associates in the complex of
transcription factors that bind to this element.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
Present address: Amgen, Inc., Thousand Oaks, CA 90210.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Nelson, C.,
Albert, V. R.,
Elsholz, H. P.,
Lu, L. I.-W.,
and Rosenfeld, M. G.
(1988)
Science
239,
1400-1405
2.
Mangalam, H. J.,
Albert, V. R.,
Ingraham, H. A.,
Kapiloff, M.,
Wilson, L.,
Nelson, C.,
Elsholtz, H.,
and Rosenfeld, M. G.
(1989)
Genes Dev.
3,
946-958
3.
Jacob, K. K.,
and Stanley, F. M.
(1994)
J. Biol. Chem.
269,
25515-25520
4.
Jacob, K. K.,
Sap, J.,
and Stanley, F. M.
(1998)
J. Biol. Chem.
273,
4800-4809
5.
Jacob, K. K.,
and Stanley, F. M.
(1999)
Endocrinology
140,
4542-4550
6.
Jacob, K. K.,
Ouyang, L.,
and Stanley, F. M.
(1995)
J. Biol. Chem.
270,
27773-27779
7.
Ouyang, L.,
Jacob, K. K.,
and Stanley, F. M.
(1996)
J. Biol. Chem.
271,
10425-10428
8.
Wasylyk, B.,
Hahn, S. L.,
and Giovane, A.
(1993)
Eur. J. Biochem.
211,
7-18
9.
LaMarco, K. L.,
and McKnight, S. L.
(1989)
Genes Dev.
3,
1372-1383
10.
Lim, F.,
Kraut, N.,
Frampton, J.,
and Graf, T.
(1992)
EMBO
11,
643-652
11.
Coffer, P.,
de Jonge, M.,
Mettouchi, A.,
Binetray, B.,
Ghysdail, J.,
and Kruiher, W.
(1994)
Oncogene
9,
911-921
12.
Cao, Z.,
Umek, R.,
and McKnight, S.
(1991)
Genes Dev.
5,
1538-1552
13.
Ron, D.,
and Habener, J. F.
(1992)
Genes Dev.
6,
439-453
14.
Park, E. A.,
Gurney, A. L.,
Nizielski, S. E.,
Hakimi, P.,
Cao, Z.,
Moorman, A.,
and Hanson, R. W.
(1993)
J. Biol. Chem.
268,
613-619
15.
Lekstrom-Himes, J.,
and Xanthopoulos, K.
(1998)
J. Biol. Chem.
243,
28545-28548
16.
Hemati, N.,
Ross, S. E.,
Erickson, R. L.,
Groblewski, G. E.,
and MacDougald, O. A.
(1997)
J. Biol. Chem.
272,
25913-25919
17.
Huang, J. H.,
and Liao, W. S. L.
(1994)
Mol. Cell. Biol.
14,
4475-4484
18.
Tae, H. J.,
Luo, X.,
and Kim, K. H.
(1994)
J. Biol. Chem.
269,
10475-10484
19.
Chrivla, J. C.,
Kwok, R. P. S.,
Lamb, N.,
Hagiwara, M.,
Montminy, M. R.,
and Goodman, R. H.
(1993)
Nature
365,
855-859
20.
McKenna, N.,
Lanz, R.,
and O'Malley, B.
(1999)
Endo. Rev.
20,
321-344
21.
Verbeek, W.,
Gombart, A.,
Chumakov, A.,
Muller, C.,
Freedman, A.,
and Koeffler, H.
(1999)
Blood
93,
3327-3337
22.
Marais, R.,
Wynne, J.,
and Treisman, R.
(1993)
Cell
73,
381-393
23.
Dalton, S.,
and Treisman, R.
(1992)
Cell
76,
597-612
24.
Stanley, F. M.
(1988)
J. Biol. Chem.
263,
13444-13448
25.
Stanley, F. M.
(1989)
Mol. Endocrinol.
3,
1627-1633
26.
Stanley, F. M.
(1992)
J. Biol. Chem.
267,
16719-16726
27.
Hill, C. S.,
Marais, R.,
John, S.,
Wynne, J.,
Dalton, S.,
and Treisman, R.
(1993)
Cell
73,
395-406
28.
Partridge, M.,
Vincent, A.,
Matthews, P.,
Puma, J.,
Stein, D.,
and Summerton, J.
(1996)
Antisense Nucleic Acid Drug Dev.
6,
169-175
29.
Stein, C.
(1999)
Nature Biotech.
17,
209
30.
Norman, C.,
Runswick, M.,
Pollock, R.,
and Treisman, R.
(1988)
Cell
55,
989-1003
31.
Gille, H.,
Kortenhann, M.,
Strahl, T.,
and Shaw, P.
(1996)
Mol. Cell. Biol.
16,
1094-1102
32.
Roesler, W.,
Park, E.,
and McFie, P.
(1998)
J. Biol. Chem.
273,
14950-14957
33.
Park, E.,
Song, S.,
Vinson, C.,
and Roesler, W.
(1999)
J. Biol. Chem.
274,
211-217
34.
Janknecht, R.,
and Nordheim, A.
(1996)
Biochem. Biophys. Res. Commun.
228,
831-837
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
F. M. Stanley Insulin-Increased Prolactin Gene Expression Requires Actin Treadmilling: Potential Role for P21 Activated Kinase Endocrinology, December 1, 2007; 148(12): 5874 - 5883. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.L. Crawford, T. Blomquist, D.N. Mullins, Y. Yoon, D.R. Hernandez, M. Al-Bagdhadi, J. Ruiz, J. Hammersley, and J.C. Willey CEBPG regulates ERCC5/XPG expression in human bronchial epithelial cells and this regulation is modified by E2F1/YY1 interactions Carcinogenesis, December 1, 2007; 28(12): 2552 - 2559. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Vulin, K. K. Jacob, and F. M. Stanley Integrin Activates Receptor-Like Protein Tyrosine Phosphatase {alpha}, Src, and Rho to Increase Prolactin Gene Expression through a Final Phosphatidylinositol 3-Kinase/Cytoskeletal Pathway that Is Additive with Insulin Endocrinology, August 1, 2005; 146(8): 3535 - 3546. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Takeshita, K. Suzuki, S. Sasaki, N. Ishii, D. M. Klinman, and K. J. Ishii Transcriptional Regulation of the Human TLR9 Gene J. Immunol., August 15, 2004; 173(4): 2552 - 2561. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Schweppe, A. A. Melton, K. S. Brodsky, L. D. Aveline, K. A. Resing, N. G. Ahn, and A. Gutierrez-Hartmann Purification and Mass Spectrometric Identification of GA-binding Protein (GABP) as the Functional Pituitary Ets Factor Binding to the Basal Transcription Element of the Prolactin Promoter J. Biol. Chem., May 2, 2003; 278(19): 16863 - 16872. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Wilson, P. J. McFie, and W. J. Roesler Different Transcription Factor Binding Arrays Modulate the cAMP Responsivity of the Phosphoenolpyruvate Carboxykinase Gene Promoter J. Biol. Chem., November 8, 2002; 277(46): 43895 - 43902. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Vulin and F. M. Stanley A Forkhead/Winged Helix-related Transcription Factor Mediates Insulin-increased Plasminogen Activator Inhibitor-1 Gene Transcription J. Biol. Chem., May 31, 2002; 277(23): 20169 - 20176. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Duval and A. Gutierrez-Hartmann Editorial: PRL-Releasing Peptide Stimulation of PRL Gene Transcription--Enter AKT Endocrinology, January 1, 2002; 143(1): 11 - 12. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||