Originally published In Press as doi:10.1074/jbc.M102875200 on May 4, 2001
J. Biol. Chem., Vol. 276, Issue 27, 25503-25511, July 6, 2001
The Intronless and TATA-less Human
TAFII55 Gene Contains a Functional
Initiator and a Downstream Promoter Element*
Tianyuan
Zhou
and
Cheng-Ming
Chiang§
From the Department of Biochemistry, Case Western Reserve
University School of Medicine, Cleveland, Ohio 44106-4935
Received for publication, April 2, 2001, and in revised form, May 3, 2001
 |
ABSTRACT |
Human TAFII55
(hTAFII55) is a component of the multisubunit general
transcription factor TFIID and has been shown to mediate the functions
of many transcriptional activators via direct protein-protein interactions. To uncover the regulatory properties of the general transcription machinery, we have isolated the
hTAFII55 gene and dissected the
regulatory elements and the core promoter responsible for
hTAFII55 gene expression. Surprisingly, the hTAFII55 gene has a single
uninterrupted open reading frame and is the only intronless general
transcription factor identified so far. Its expression is driven by a
TATA-less promoter that contains a functional initiator and a
downstream promoter element, as illustrated by both transfection assays
and mutational analyses. Moreover, this core promoter can mediate the
activity of a transcriptional activator that is artificially recruited to the promoter in a heterologous context. Interestingly, in the promoter-proximal region there are multiple Sp1-binding sites juxtaposed to a single AP2-binding site, indicating that Sp1 and AP2
may regulate the core promoter activity of the
hTAFII55 gene. These findings
indicate that a combinatorial regulation of a general
transcription factor-encoding gene can be conferred by both ubiquitous
and cell type-specific transcriptional regulators.
 |
INTRODUCTION |
Studies on eukaryotic promoters have identified several core
promoter elements, which are characteristic DNA sequences required for
promoter function. The TATA box is an A/T-rich sequence located ~25-30 nucleotides upstream of the transcription start site. It contains a consensus sequence, TATA(A/T)A(A/T), whose recognition by
the TATA-binding protein
(TBP)1 subunit of TFIID
nucleates the formation of a preinitiation complex (1-3). A second
core promoter element, the initiator (Inr), contains a pyrimidine
(Y)-rich core sequence, YYA+1N(T/A)YY, surrounding the
transcription start site (4). The Inr is capable of directing accurate
transcription initiation either alone or in conjunction with a TATA box
or other core promoter elements (5-10). Several protein factors,
including the TAFII150/CIF150 component of TFIID (11-17),
RNA polymerase II (6), TFII-I/SPIN/BAP-135 (18-21), USF (22),
and YY1 (23), have been implicated in Inr function. However, the
nucleation pathways of these Inr-targeting proteins have not yet been defined.
The downstream promoter element (DPE), which is located 28-34
nucleotides downstream of the transcription start site in many Drosophila TATA-less promoters (9, 10, 24), has a consensus sequence, (A/G)G(A/T)CGTG, and can be recognized by the
dTAFII60 and dTAFII40 components of
Drosophila TFIID (9, 24). This finding suggests that TFIID
is likely to be the DPE-binding factor. Interestingly, negative
cofactor 2 (NC2 or Dr1-Drap1), initially characterized as a
TBP-inhibitory activity on a TATA-containing promoter (25-28), has
recently been shown to facilitate transcription from DPE-driven
promoters (29). It seems that TFIID and NC2, two of the DPE-acting
factors, may work synergistically through the DPE, although their
functional relationship remains to be elucidated. Another upstream core
promoter element, (G/C)(G/C)(G/A)CGCC, was identified through binding
site selection as a GC-rich sequence recognized by TFIIB (30). This
TFIIB recognition element (BRE) is located immediately upstream of the
TATA box and can be used to modulate preinitiation complex assembly in
eukaryotic cells (30) as well as in Archaea (31).
Analysis of the promoter database reveals that 57% of the
Drosophila core promoters do not contain a TATA box, and the
DPE occurs in ~40% of the Drosophila promoters (10).
Although such statistical data are not yet available for the human
genome, it appears that the promoters of human housekeeping genes,
oncogenes, growth factors, and transcription factors often lack a TATA
box (32). In addition, many natural promoters contain distinct
combinations of core promoter elements whose differential utilization
plays an important role in regulating gene expression in a spatial,
temporal, or lineage-specific manner (13, 33, 34).
Human TAFII55 (hTAFII55) was first identified
as an RNA polymerase II-specific TBP-associated factor
(TAFII) in TFIID (35, 36) and, like many other
TAFIIs, was also detected in the
TBP-free-TAFII-containing complex (37). However,
TAFII55 is not present in some other TAFII-containing complexes, such as human PCAF (38) and
yeast SAGA complexes (39), suggesting that TAFII55 has
unique properties distinct from its role as a structural component of
TFIID and of TBP-free-TAFII-containing complex. This idea
is further substantiated by the finding that TAFII55 can
interact with many transcription factors, including Sp1, YY1,
USF, CTF, adenovirus E1A, and HIV-1 Tat (35), and can
also mediate vitamin D3 and thyroid hormone receptor
activation in a ligand-independent manner (40), consistent with a
coactivator role of TAFII55 in transcriptional regulation. Moreover, TAFII55 may be implicated in mRNA 3' end
processing, as it shows strong affinity toward the human
cleavage-polyadenylation specificity factor (41).
TAFII55 homologues have also been identified in several
organisms. The mouse homologue, mTAFII55, is 95% identical
to its human counterpart (42), and the Saccharomyces
cerevisiae homologue, yTaf67, is essential for cellular
viability2 (43). Recently,
the Schizosaccharomyces pombe homologue of yTaf67, Ptr6p
(poly(A)+ RNA transport), was shown to be involved in
nucleocytoplasmic transport of mRNAs during a genetic screen for
mutants that accumulate mRNAs in the nucleus (44). Moreover,
proteins that share high sequence homology with hTAFII55
have also been identified in Caenorhabditis elegans
(GenBankTM accession number Z67755) and Drosophila
melanogaster (GenBankTM accession number AF017096).
The chromosomal location of the hTAFII55
gene has been mapped to 5q31, where chromosomal mutations have been
associated with stomach adenocarcinoma (45), suggesting that
hTAFII55 or other genes localized
in this region may act as an oncogene.
Interestingly, Northern blot analysis showed that hTAFII55
is differentially expressed in various human
tissues.3 In addition, we
observed that in a HeLa-derived cell line that conditionally expresses
FLAG-tagged hTAFII55, the overall level of the induced
tagged protein and the endogenous untagged hTAFII55 protein
remains constant (46). This indicates a tight regulation over
hTAFII55 expression in vivo.
In order to understand the regulation of
hTAFII55 gene expression and to gain further insight into the regulatory pathways of general transcription factor-encoding genes, we dissected the cis-acting elements
and trans-acting factors that regulate the expression of the
hTAFII55 gene. Our studies indicate that
hTAFII55 gene expression is
combinatorially regulated by both ubiquitous and cell type-specific transcription factors. Moreover, we have characterized the core promoter elements of the hTAFII55 gene,
which surprisingly contains a single uninterrupted open reading frame
whose expression is driven by a TATA-deficient promoter with a
functional initiator and a DPE. Collectively, these findings uncover
unusual features of hTAFII55 gene
structure and regulatory properties that are significantly different
from other general transcription factor-encoding genes.
 |
EXPERIMENTAL PROCEDURES |
Isolation of Human TAFII55 Genomic Clones--
A
human genomic library, derived from the HT1080 human fibrosarcoma cell
line and cloned in the
-DASH II vector (Stratagene), was screened
with a 32P-labeled DNA fragment
spanning the first 474 nucleotides (cut between the HpaI and
EcoRI sites) of the hTAFII55 cDNA (35). From
~1 × 106 plaque-forming units, 12 positive clones
were isolated. The inserts were individually cloned into the
NotI site of pBS-SK (+) (Stratagene). A clone, pBS/3'-8,
which contains an insert of ~17 kb, including regions 5' and 3' of
hTAFII55, was manually sequenced
(GenBankTM accession number AF349038).
Plasmid Constructions--
A 1459-bp genomic DNA fragment that
extends 1436 bp upstream and 23 bp downstream of the 5' end of the
hTAFII55 cDNA (35) was amplified by polymerase chain
reaction (PCR) from pBS/3'-8 using an upstream KpnI
site-containing primer (5' CATTCTGGTACCAGGCACTGGGACAC 3') and a
downstream BglII site-containing primer (5'
AGCGCGAGATCTTGCCGAGAGG 3'). The amplified DNA fragment was then cloned
into pGL2-Basic (Promega) between the KpnI and
BglII sites. The resulting construct was denoted
pGL2-TAF55(
1372/+87).
A series of hTAFII55 promoter deletion
constructs, including pGL2-TAF55(
128/+87), pGL2-TAF55(
99/+87),
pGL2-TAF55(
71/+87), pGL2-TAF55(
55/+87), pGL2-TAF55(
26/+87),
pGL2-TAF55(
128/+36), pGL2-TAF55(
71/+36), pGL2-TAF55(
55/+36), and
pGL2-TAF55(
26/+36) were similarly made in pGL2-Basic by using primer
pairs with introduced KpnI and BglII sites at
their 5' and 3' ends, respectively. The numbers in the deletion
constructs indicate the boundaries of the inserts relative to the
transcription start site.
The plasmids pGL2-TAF55(
748/+87) and pGL2-TAF55(
281/+87) were
created by first cleaving pGL2-TAF55(
1372/+87) with ScaI or XbaI, filling in the XbaI-digested end with
Klenow enzyme, and releasing the inserts with BglII. The
promoter-containing fragments were then cloned into pGL2-Basic between
the BglII site and the Klenow- filled-in XhoI
site to generate pGL2-TAF55(
748/+87) and pGL2-TAF55(
281/+87),
respectively. The plasmid pGL2-TAF55(
161/+87) was generated by
cloning a PCR fragment, amplified with an upstream primer spanning
161 to
144 and the same downstream BglII site-containing primer ending at +87, between the BglII site and the
Klenow-filled-in XhoI site of pGL2-Basic. Similarly, the
plasmid pGL2-TAF55(
1372/
140) was made by inserting a PCR fragment,
amplified with the same upstream KpnI site-containing primer
ending at
1372 and a downstream primer spanning
157 to
140,
between the KpnI site and the Klenow-filled-in XhoI site of pGL2-Basic.
Promoter constructs containing nucleotide substitutions in the
sequence motifs of Sp1, AP2, Inr, and DPE (denoted by asterisks) were
individually generated by PCR amplification with primer pairs spanning
the mutated nucleotides according to the QuikChange site-directed mutagenesis protocol (Stratagene). The plasmids
pGL2-TAF55(
71/+36)Sp1*-60, pGL2-TAF55(
71/+36)AP2*,
pGL2-TAF-55(
71/+36)Sp1*-60/AP2*, pGL2-TAF55(
71/+36)Sp1*-20, pGL2-TAF55(
26/+36)Inr*, pGL2-TAF55(
26/+36)DPE*, and
pGL2-TAF55(
26/+36)Inr*DPE* were constructed in the backbone of
pGL2-TAF55(
71/+36) or pGL2-TAF55(
26/+36) using primer pairs
containing the introduced mutations as shown in Figs. 4B and
5A. For five Gal4-binding site-containing constructs, the
SacI-PstI fragment of
pG5HMC2AT (47) with 5 Gal4-binding sites was
first cloned into pBS-SK(+) between SacI and PstI
sites to generate pBS-5Gal, from which the
SmaI-KpnI fragment was isolated and cloned into
pGL2-TAF55(
26/+36), pGL2-TAF55(
26/+36)Inr*, pGL2-TAF55(
26/+36)DPE*, pGL2-TAF55(
26/+36)Inr*DPE*, and pGL2-Basic at the same enzyme-cutting sites to create pGL2-5Gal(
26/+36)WT, pGL2-5Gal(
26/+36)Inr*, pGL2-5Gal(
26/+36)DPE*,
pGL2-5Gal(
26/+36)Inr*DPE*, and pGL2-5Gal, respectively. All
constructs were confirmed by restriction enzyme digestion and DNA sequencing.
The HIV-1 promoter construct pGL2-HIV(
167/+80) was created by
transferring the XhoI-HindIII fragment, which
contains the HIV-1 promoter region spanning
167 to +80, from p-167
(48) into the same enzyme-cutting sites in pGL2-Basic. The
pBS-TAF55(
128/+87) plasmid used to generate riboprobe for RNase
protection analysis was created by subcloning the
SmaI-HindIII fragment from pGL2-TAF55(
128/+87) into the same enzyme-cutting sites of pBS-SK(+). The other plasmids, pHIV+58 (49), pGL7072-161 (50), pSGVP (51), pSG424 (52), and
pGL2-Control (Promega) have already been described.
Transient Transfection and Reporter Gene Analysis--
C-33A
cells, which were derived from human cervical carcinoma, were
maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented
with 10% fetal bovine serum in humidified 5% CO2 incubator at 37 °C. Transient transfection was carried out in C-33A
cells with 4 µg of each reporter plasmid, either alone or in
conjunction with varying amounts of the Gal4-VP16-expressing plasmid
(pSGVP) supplemented with the cloning vector (pSG424) to a total of 1 µg, using the calcium phosphate precipitation method as described
(53). The transfected cells, after rinsing twice with 1× PBS, were
collected 24 h post-transfection by a rubber policeman and
resuspended in 100 µl of T250E5 buffer (250 mM Tris-HCl,
pH 7.6, and 5 mM EDTA). Cell lysates were then prepared by
three cycles of freezing and thawing in liquid nitrogen and a 37 °C
water bath. Following centrifugation at 4 °C for 10 min, 2 µl of
the supernatant was mixed with 350 µl of luciferase buffer (25 mM HEPES, pH 7.8, 5 mM ATP, 15 mM
MgSO4) with luciferase assays conducted by automatically
injecting 100 µl of 0.2 mM luciferin (Analytical
Luminescence Laboratory) into the samples and measuring the
luminescence for 12 s after an initial 2-s delay, using a Monolight 2010 luminometer (Analytical Luminescence Laboratory). Transfection and reporter gene assays were performed independently at
least four times, each in duplicate.
In Vitro Transcription and Primer Extension--
In
vitro transcription was performed with HeLa nuclear extracts and
analyzed by primer extension as described (50). The Luc-5 primer (5'
CTCTTCATAGCCTTATGCAG 3') and the Luc-1 primer (5' TCTTTATGTTTTTGGCGTCT
3') that anneal to nucleotides 151-170 and 81-100, respectively, of
pGL2-Basic were used for examining products derived from
hTAFII55 promoter-containing constructs, whereas a chloramphenicol acetyltransferase primer (5'
CAACGGTGGTATATCCAGTG 3') that anneals to nucleotides 4936-4953 of
pSV2CAT (54) was used for determining the product derived from pHIV+58.
All the primer extension products were analyzed on an 8 M
urea, 5% Long Ranger (FMC) polyacrylamide gel together with the
dideoxynucleotide sequencing products generated with the phosphorylated
forms of the corresponding primers.
RNase Protection Assay--
Total cellular RNA was prepared from
eight 100-mm plates of 80% confluent C-33A cells by guanidinium
thiocyanate/phenol extraction method using 8 ml of Trizol reagent (Life
Technologies, Inc.) according to the manufacturer's instructions.
Poly(A)+ RNA was isolated by first passing heat-treated
total cellular RNA, after mixing with an equal volume of 2× loading
buffer, through a 1-ml oligo(dT)-cellulose (Amersham Pharmacia Biotech)
column, which was pre-equilibrated with 1× loading buffer (20 mM Tris-HCl, pH 7.6, 0.5 M LiCl, 1 mM EDTA, and 0.1% SDS). The flow-through fraction was
collected, denatured at 65 °C for 5 min, chilled on ice, and loaded
again onto the column. This process was repeated for two additional
times. The column was then washed with 6-8 column volumes of 1×
loading buffer. Poly(A)+ RNA was eluted with 1 column
volume of elution buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 0.05% SDS) for a total of three times,
precipitated with ethanol, and finally resuspended in diethyl pyrocarbonate-treated water.
An antisense riboprobe, corresponding to +87 to
128 of the
hTAFII55 promoter region with flanking
polylinker sequences, was synthesized by transcribing the
BamHI-linearized pBS-TAF55(
128/+87) template with 2 units
of T7 RNA polymerase in the presence of 2 µCi/µl
[
-32P]CTP, 10 µM CTP, 0.1 mM
ATP, UTP, and GTP, 40 mM Tris-HCl, pH 8.0, 8 mM
MgCl2, 50 mM NaCl, 30 mM
dithiothreitol, 1 unit/µl RNasin (Promega), and 2 mM
spermidine in a 25-µl mixture. The reaction was conducted at 37 °C
for 60 min. The riboprobe was then separated on a 4% polyacrylamide-8
M urea gel, eluted from the gel slice in elution buffer
(0.5 M ammonium acetate, 10 mM magnesium
acetate, 0.1% SDS, and 1 mM EDTA), extracted with
phenol/chloroform, precipitated with ethanol, and finally dissolved in
50 µl of 1× hybridization buffer (40 mM PIPES, pH 6.7, 0.4 M NaCl, and 1 mM EDTA). RNase protection
assay was carried out as described previously (55) with minor
modifications. Briefly, ~5 × 105 cpm of the
in vitro synthesized riboprobe was mixed with 3 µg of
poly(A)+ RNA in a 30-µl reaction mixture containing 80%
formamide in a final 1× hybridization buffer, overlaid with mineral
oil, heated at 90 °C for 10 min, and hybridized at 58 °C
overnight. The hybridization reaction was then quenched on dry ice and
incubated with 350 µl of RNase solution containing 14 µg of RNase A
(Sigma), 50 units of RNase T1 (Amersham Pharmacia Biotech), 0.3 M NaCl, 10 mM Tris-HCl, pH 7.5, and 5 mM EDTA at 30 °C for 60 min. The ribonucleases were degraded by adding 50 µg of proteinase K (U. S. Biochemical Corp.) and 5 µl of 10% SDS and incubated for another 15 min at 37 °C. The protected fragments were purified by phenol/chloroform extraction, precipitated twice with ethanol, and finally analyzed on a 5% polyacrylamide-urea gel with a DNA sequencing ladder loaded in parallel
as size markers. The migration differences between the protected RNA
fragments and the DNA size markers were adjusted using undigested
riboprobe as standard.
 |
RESULTS |
A 1.4-kb Genomic Fragment Preceding the 5' End of the Human
TAFII55 cDNA Sequence Has Intrinsic Promoter
Activity--
To understand the regulatory properties of general
transcription factor-encoding genes, we isolated a dozen genomic clones from an HT1080 human fibrosarcoma genomic library using probes derived
from hTAFII55 cDNA (35). One of the isolated clones, 3'-8, containing the entire open reading frame and flanking regions was
completely sequenced (17,042 bp, GenBankTM accession number
AF349038). The hTAFII55 gene, which encodes a component of the eukaryotic core promoter-binding factor TFIID, encompasses the complete cDNA sequence of
hTAFII55, suggesting that it is an
intronless gene (Fig. 1A).
This finding is surprising, given the fact that the human general
transcription factor-encoding genes so far identified, including TFIIA
(
/
and
), TFIIB, TFIIE
, TFIIE
, the RAP30 and RAP74
subunits of TFIIF, components (p89, p80, p62, p52, p44, p34, CDK7,
cyclin H, and MAT1) of TFIIH, TBP, and other TAFIIs in
TFIID, all have introns (data not shown). The possibility that
our hTAFII55 genomic DNA was derived from
retrotransposition of the hTAFII55 cDNA was excluded
for the following reasons. First, a poly(A) tail sequence found at the
3' end of the hTAFII55 cDNA (35) is absent in all of
our genomic clones. The hTAFII55 sequences identified in the genomic clones and the cDNA diverge at the 3' cleavage site where poly (A) addition occurs (data not shown), indicating that reverse transcription and retroviral insertion are
unlikely to be involved in generating the genomic copy. Second, all of
our independent clones that extended beyond the 3' end of the
hTAFII55 cDNA had identical sequences, and all of them lack a poly(A) tail. Third, a portion of the BAC clone 249h5
(GenBankTM accession number AC005618), derived from human
chromosome 5, has a nearly identical nucleotide sequence with that of
our 3'-8 genomic clone. Fourth, the human protocadherin-
A1 gene sequence found at the 5' end of the 3'-8 clone is also present in human
chromosome 5, indicating the authenticity of our isolated hTAFII55 genomic sequence. Finally, the
entire sequence of our 3'-8 clone is also found in the just-deposited
human genome databases (56, 57). Taken together, the absence of a
poly(A) tail in our genomic clones and the co-localization of the
entire genomic sequence in a single chromosomal locus exclude the
possibility that our genomic clones are artifacts and further confirm
that the hTAFII55 gene is indeed devoid
of introns, an unusual feature distinct from all the other general
transcription factor-encoding genes so far identified.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Identification of the human
TAFII55 promoter.
A, schematic diagram of the 3'-8 genomic clone containing
the hTAFII55 gene. The complete
nucleotide sequence of the 3'-8 genomic clone, which contains a total
of 17,042 base pairs (bp) represented by the thick bar with
the hTAFII55 open reading frame (ORF)
indicated by an open box, is deposited to
GenBankTM with accession number AF349038. The
positions of the isolated hTAFII55 cDNA (35, 36) and
its corresponding mRNA, relative to the genomic clone, are
indicated by a thin line and a thick line,
respectively. The 1459-bp genomic fragment encompassing the 5' end of
the hTAFII55 cDNA upstream of a luciferase reporter
gene as in pGL2-TAF55( 1372/+87) is also depicted. B, the
1.4-kb genomic fragment upstream of the 5' end of the human
TAFII55 cDNA has intrinsic promoter activity. Human
cervical carcinoma C-33A cells were transiently transfected with
reporter plasmids pGL2-TAF55( 1371/+87), pGL-HIV+80, pGL7072-161, or
pGL2-Control, which contains the hTAFII55
promoter from 1372 to +87 ( 1372/+87), the HIV-1 promoter
from 167 to +80 ( 167/+80), the human papillomavirus type
11 (HPV-11) promoter spanning 7072-7933/1-161
(7072/161), or the SV40 promoter/enhancer
(Pro/Enh), respectively. The pGL2-Basic plasmid
(vector), used for constructions of the above-mentioned
reporter plasmids, was also included as control. The luciferase
activity was determined as described under "Experimental
Procedures" and normalized to that of the
hTAFII55 promoter construct.
|
|
To identify a functional promoter in the isolated
hTAFII55 gene, we cloned a 1.4-kb genomic
DNA fragment that extends 1436 bp upstream and 23 bp downstream of the
5' end of the hTAFII55 cDNA (35) into pGL2-Basic (Fig.
1A). The promoter activity of the resulting construct,
pGL2-TAF55(
1372/+87), was examined by luciferase assays in a human
cervical carcinoma-derived C-33A cell line following transient
transfection. As shown in Fig. 1B, the 1.4-kb genomic
fragment of hTAFII55 has promoter activity that is stronger than those exhibited by HIV-1, human papillomavirus type 11 (HPV-11), and SV40.
Mapping the Transcription Start Site of the hTAFII55
Promoter--
In order to locate the transcription start site of the
hTAFII55 gene, we first performed
in vitro transcription with HeLa nuclear extracts, using
pGL2-TAF55(
1372/+87). The in vitro synthesized transcripts
were then detected by primer extension analysis (Fig.
2A). To minimize artifacts
caused by spurious primer annealing, we used two primers, Luc-1 and
Luc-5, that anneal to different positions of the transcript and are
expected to generate ~150- and 210-nucleotide products, respectively.
When either primer was used, the transcription start site was mapped to
the same position in the genomic sequence (nucleotide 12,849), which
was designated +1 (Fig. 2A, lanes 1 and 3,
indicated by an arrow). Several signals of less intensity
corresponding to +3 to +6 positions were also detected. The presence of
multiple minor transcription start sites in a TATA-less promoter is not
uncommon (see Refs. 9, 24, and 58-60; and see below). A control
template with the TATA-containing HIV-1 promoter was mapped to the same
start site as determined previously (Fig. 2A, lane 5; Ref.
49). The transcripts derived from the
hTAFII55 and HIV-1 promoters are RNA
polymerase II-specific, since the addition of a low concentration (2 µg/ml) of
-amanitin, which inhibits the activity of RNA polymerase II, completely abolished the specific signals (Fig. 2A,
compare lanes 1 and 2, 3 and
4, and 5 and 6).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
Mapping of the transcription start site of
the hTAFII55 promoter.
A, primer extension analysis of the in vitro
synthesized hTAFII55 transcript. In vitro
transcription was conducted with HeLa nuclear extracts using the
hTAFII55 promoter-containing construct
pGL2-TAF55( 1372/+87) or the HIV-1 promoter-containing construct
pHIV+58, in the absence ( ) or presence (+) of 2 µg/ml of
-amanitin. Two primers, Luc-1 and Luc-5, whose relative positions
and expected sizes of primer extension products are indicated at the
bottom, were used to determine the start site of the
hTAFII55 gene, whereas a
chloramphenicol acetyltransferase (CAT) primer that
anneals to the chloramphenicol acetyltransferase reporter gene was used
for mapping the start site of the HIV-1 promoter. DNA sequencing
ladders, prepared from the phosphorylated forms of the corresponding
primers and DNA templates as employed for in vitro
transcription, were included for the assignment of the transcription
start sites (indicated by arrows). The DNA sequences
surrounding the transcription start sites are shown on the
left of each panel with a bent arrow pointing to
the major start site at +1 and solid squares
indicating relative intensities of the transcription signals. Two
reproducible transcription signals, mapped to an upstream (indicated by
an arrowhead) or downstream (indicated by an
asterisk) location of the hTAFII55 cDNA, are
marked on the right of the panels. B, RNase
protection analysis of in vivo hTAFII55
transcripts. RNase protection assays were performed by first
hybridizing in vitro synthesized antisense riboprobe of 285 nt spanning 128 to +87 with endogenous poly(A)+ RNA
isolated from C-33A cells or with tRNA. RNase A and RNase T1 were then
added to digest the single-stranded region. The protected fragments,
along with a DNA size marker (A, C, G, and T) and
the original riboprobe ( ) used to adjust the migration difference
between DNA and RNA, were then analyzed on a 5% polyacrylamide, 8 M urea gel and visualized after exposure to an x-ray film.
The positions of the major protected fragment (87 nt) and the riboprobe
are indicated, respectively, by arrows.
|
|
A transcription signal detected in the Luc-5 experiment (Fig. 2A,
lane 3, indicated by an asterisk) may result from a
premature termination of reverse transcriptase during primer extension, since it lies within the isolated cDNA region (36). Another transcription signal detected in the Luc-1 experiment (Fig. 2A, lane 1, shown with an arrowhead) is located at
57,
surrounded by GC-rich sequences. It might represent an alternative
transcription start site or a spurious transcript caused by nonspecific
initiation of RNA polymerase II in vitro. To distinguish
between these two possibilities, we isolated endogenous
poly(A)+ RNA from C-33A cells and determined the
transcription start site using RNase protection assay with an antisense
RNA probe that spans nucleotides from +87 to
128 relative to the
transcription start site (Fig. 2B). A correct initiation at
+1 would give rise to a protected fragment of 87 nucleotides. In
contrast, were transcription initiated from
57, a 144-nt protected
fragment would be detected. As shown in Fig. 2B, only an
87-nt protected fragment, corresponding to the start site mapped
in vitro, was observed when the 32P-labeled
riboprobe was hybridized with poly(A)+ RNA but not with
tRNA (lanes 1 and 2). The absence of a 144-nt protected fragment suggests that the start site detected at
57 is an
artifact caused by nonspecific initiation of RNA polymerase II in
vitro. Therefore, we concluded that nucleotide 12,849 in the 3'-8
genomic clone is the major transcription start site of the
hTAFII55 promoter both in vivo
and in vitro.
Transcription Factors Potentially Regulate hTAFII55
Promoter Activity--
A search for transcription factors potentially
regulating hTAFII55 gene expression was
performed using the MatInspector program. We found putative
binding sites for STAT-1, MEF2, E2F, Sp1, AP2, AREB6, and E47 in the
promoter-proximal region (Fig. 3A). Obviously, no TATA box is
located between
25 and
30, but, instead, there are consensus Inr
and DPE sequences surrounding the transcription start site and spanning
+29 to +35, respectively. This inspection reveals that an intrinsic
TATA-less promoter is used for hTAFII55
gene expression, which is likely regulated by both ubiquitous and cell
type-specific transcription factors.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 3.
Promoter sequences containing Sp1- and
AP2-binding sites are important for
hTAFII55 promoter
activity. A, reporter gene assays performed in C-33A
cells with hTAFII55 promoter constructs
that sequentially remove potential transcription factor-binding sites.
Transient transfection and reporter gene assays were performed as
described under "Experimental Procedures" using plasmids containing
the hTAFII55 promoter sequences with the
indicated boundaries. The pGL2-Basic plasmid containing no insert was
also used for transfection as control. Luciferase activity was
normalized to that of the full-length promoter construct,
pGL2-TAF55( 1372/+87), and presented in the bar graph with
error bars showing standard deviation. B,
in vitro transcription and primer extension analysis of
hTAFII55 promoter deletion constructs
with HeLa nuclear extracts. In vitro transcription was
performed in HeLa nuclear extracts with plasmids containing the
hTAFII55 promoter sequences as indicated.
The in vitro synthesized transcripts were then mapped by
primer extension using Luc-1 primer and analyzed on a 5%
polyacrylamide-urea gel. The products with correct transcription start
sites at +1 are indicated by an arrow. DNA sequencing
ladders, prepared from pGL2-TAF55( 1372/+87) using the
5'-phosphorylated Luc-1 primer and [ -35S]dATP, were
included to determine the position of the correctly initiated
transcripts. Schematic diagrams of the promoter deletion constructs
used for both experiments are drawn on the left, with
potential transcription factor-binding sites marked in
boxes.
|
|
Sequences for Sp1, AP2, AREB6, and E47 Binding Are Important for
hTAFII55 Gene Expression--
To define the transcription
factor-binding sites that were important for
hTAFII55 gene expression, we made a
series of 5' deletion constructs and tested their promoter activity
following transfection into C-33A cells. As shown in Fig.
3A, deletions progressing to
99 that removed the STAT-1,
MEF2, and E2F sites showed no significant reduction in promoter
activity in C-33A cells. Further deletion of the region from
99 to
71, which contains no known transcription factor-binding sites,
resulted in ~2-fold decrease in promoter activity. Interestingly,
deletion up to
55, which removes a putative Sp1-binding site
centering on
60, caused another 2-3-fold reduction. An additional
deletion to
26, which eliminates an overlapping Sp1- and AP2-binding
site at
50, resulted in an extra 8-fold reduction. In contrast, an
upstream fragment spanning
1372 and
140 showed no promoter
activity, further confirming our results of start site mapping.
A similar conclusion was also obtained by in vitro
transcription and primer extension assays performed with HeLa nuclear
extracts using similar hTAFII55 deletion
constructs. As shown in Fig. 3B, whereas a series of 5'
deletions up to
128 did not markedly affect promoter functioning, the
71/+87 construct reduced ~50% of the promoter activity. Further
deletions to
55 and
26 significantly decreased the signal
intensity. However, the transcription start site initiating at +1 was
still detectable after longer exposure. This analysis suggests that
both Sp1 and AP2 sites are important for
hTAFII55 gene expression. Moreover, both
in vitro and in vivo assays indicated that the
26/+87 construct, although it shows much weaker promoter activity
compared with that from the 1.4-kb genomic fragment, could still direct
reporter gene expression, suggesting that the critical core promoter
elements essential for hTAFII55 promoter
activity are retained in this short region (see below).
To examine whether the downstream region containing putative AREB6- and
E47-binding sites are also critical for
hTAFII55 gene expression, we created
several 3' deletion constructs removing the sequence between +36 and
+87 and tested their promoter activity in C-33A cells by transfection
assays. As shown in Fig. 4A,
promoter constructs deleted to +36 reduced reporter gene activity
~3-fold. This result reveals that the sequences downstream of the
transcription start site, including the AREB6- and E47-binding sites,
contribute to hTAFII55 promoter activity.
Nevertheless, for core promoter activity, the region between +36 and
+87 seems dispensable. The
55/+36 construct still maintained promoter
activity sufficient to drive reporter gene expression.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
The
hTAFII55 promoter is
regulated by proteins targeting the AREB6-, E47-, Sp1-, and AP2-binding
sites in C-33A cells. A, reporter gene assays performed
in C-33A cells with hTAFII55 promoter
constructs with or without the AREB6- and E47-binding sites. Transient
transfection and reporter gene assays were performed as described under
"Experimental Procedures" using plasmids containing the
hTAFII55 promoter sequences with the
indicated boundaries. The pGL2-Basic plasmid containing no insert was
also used for transfection as control. Luciferase activity was
normalized to that of the full-length promoter construct,
pGL2-TAF55( 1372/+87), and presented in the bar graph with
error bars showing standard deviation. B,
nucleotide substitutions in the Sp1- and AP2-binding sites reduce
hTAFII55 promoter activity in C-33A
cells. Transient transfection and reporter gene assays were performed
with plasmids containing the hTAFII55
promoter sequences with the indicated boundaries. Asterisks
indicate mutations introduced at specific protein-binding motifs in the
plasmids. The nucleotides changed in each motifs are denoted at the
bottom.
|
|
From the deletion analysis, it appears that Sp1 and AP2 likely play an
important role in optimizing hTAFII55
promoter activity, which could be conferred by a small DNA fragment
spanning
26 to +36. To test this hypothesis, we created the
26/+36
promoter construct and compared its promoter activity with several 5'
deletion constructs all ending at +36 as well as with new constructs
containing nucleotide substitutions in the DNA-binding sites for Sp1
and AP2. As shown in Fig. 4B, nucleotide substitutions at
the
60 Sp1-binding site reduced promoter activity 2-3-fold (compare
2nd and 3rd constructs), consistent with the result from the 5'
deletion constructs (see Fig. 3A, compare
71/+87 and
55/+87 constructs). However,
mutations introduced at the AP2-binding site showed only 10-20%
reduction of reporter activity (Fig. 4B, compare
2nd and 4th constructs and 3rd and
5th constructs). Interestingly, mutations at the
20
Sp1-binding site showed the same activity as that of the wild-type
construct (Fig. 4B, compare 2nd and 6th
constructs). This finding indicates that different
promoter-proximal Sp1-binding sites contribute unequally to
hTAFII55 promoter activity. As expected,
the
26/+36 construct still retains promoter activity (Fig.
4B). A similar result was also obtained with in
vitro transcription assays performed with HeLa nuclear extracts
(data not shown).
The hTAFII55 Core Promoter Is TATA-less with Functional
Inr and DPE Sequences--
The finding that a DNA fragment spanning
26 to +36 still retained hTAFII55
promoter activity and that mutations introduced at the
20 Sp1-binding
site had no effect on reporter activity (Fig. 4B) suggested
that the Inr and DPE motifs present in this region were likely to be
the functional modules driving hTAFII55
gene expression. To test this, we introduced mutations in the Inr and
DPE, either individually or in combination, and tested the activity of
the core promoter constructs using transfection assays in C-33A cells.
As shown in Fig. 5A, mutations in the Inr and the DPE reduced promoter activity ~33- and 5-fold, respectively, whereas double mutations essentially abolished the promoter function.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5.
Inr and DPE are both important core promoter
elements for hTAFII55 gene
expression. A, mutations at the Inr and the DPE reduce
hTAFII55 promoter activity. Transient
transfection and reporter gene assays were performed as described under
"Experimental Procedures" using plasmids containing either
wild-type or mutated nucleotides at the Inr and/or the DPE of the
hTAFII55 promoter fragment spanning 26
to +36. The pGL2-Basic plasmid (vector) containing no insert
was also used for transfection as control. Luciferase activity was
normalized to that of the wild-type promoter construct,
pGL2-TAF55( 26/+36), and presented in the bar graph with
error bars showing standard deviation. Asterisks
and × indicate mutations introduced at specific
protein-binding motifs in the plasmids. The nucleotides changed in each
motifs are denoted at the bottom. B, the Inr and
DPE modules of the hTAFII55 core promoter
can mediate transcriptional activation in a heterologous promoter
context. Transient transfection was performed in C-33A cells by
cotransfecting different amounts of the Gal4-VP16-expressing plasmid
(pSGVP), together with either wild-type (WT) or mutated
reporter constructs driven by 5 Gal4-binding sites as indicated.
|
|
To verify that the Inr and the DPE identified in the
hTAFII55 promoter can function as
independent promoter modules, we introduced five Gal4-binding sites
into the wild-type and mutated hTAFII55
core promoter constructs, and we tested promoter activity by
cotransfection with a Gal4-VP16-expression plasmid. As shown in Fig.
5B, expression of Gal4-VP16 significantly enhanced wild-type
(WT) hTAFII55 promoter activity in a
dose-dependent manner. In contrast, Gal4-VP16 had little,
if any, effect on constructs containing Inr mutation (Inr*) or Inr and
DPE double mutations (Inr*DPE*). The heterologous promoter with the DPE
mutation (DPE*) showed a slight response to Gal4-VP16. This result
demonstrates that the Inr and the DPE derived from the
hTAFII55 promoter are indeed core
promoter elements that can mediate the activity of a transcriptional
activator artificially recruited to the promoter in a heterologous context.
 |
DISCUSSION |
In this report, we describe the detailed characterization of
regulatory elements and core promoter critical for
the expression of the human TAFII55 gene,
which encodes a component of the general transcription factor TFIID.
Sequencing of our isolated hTAFII55
genomic clones and mapping of the transcription start site reveal that
the hTAFII55 gene is intronless, a
feature distinct from the other general transcription factor-encoding genes so far identified (56, 57, 61-63). Furthermore, expression of
hTAFII55 is driven by a TATA-less promoter with
a functional Inr and the DPE active in both homologous and heterologous
promoter contexts.
Intronless Genes--
In higher eukaryotes, most genes contain
introns. Compared with 96% intronless genes in S. cerevisiae, there are 17% intronless genes in D. melanogaster and merely 6% of genes in mammals without introns
(64). One family of intronless genes encodes histones, which are
comparatively small, abundantly expressed and highly conserved in
sequence (65). Another family encodes G-protein-coupled receptors (66).
Since intronless genes such as those encoding hsp70 (67),
c-jun (68), and interferon-
(69) do not require post-transcriptional splicing, they may be expressed more efficiently and are believed to be involved in immediate response to extracellular signals. On the other hand, many viruses that undergo reverse transcription during the replication cycle have evolved special mechanisms to facilitate specifically export of intronless gene products to the cytoplasm and inhibit the splicing process (70, 71).
Considering the hTAFII55 gene has
multiple STAT- and E2F-binding sites in its promoter-proximal region,
it seems probable that hTAFII55 is involved in integrating
extracellular signals to the general transcription machinery. This
point of view is further supported by the finding that
hTAFII55 can interact with many transcription factors (35)
and can also mediate the functions of several nuclear hormone receptors
(40).
Core Promoter Elements--
One interesting property of the
hTAFII55 promoter sequence is that it has
no cognate TATA box or even AT-rich sequences within the
promoter-proximal 80 nucleotides upstream of the transcription start
site. Instead, it contains a consensus Inr that overlaps the
transcription start site and the DPE core sequence (GGACGGA) from +29
to +35. Both the Inr and the DPE are critical for
hTAFII55 core promoter function, as
illustrated by both transfection assays (Fig. 5) and in
vitro transcription analysis (data not shown). The Inr is clearly
protected by proteins present in nuclear extracts (data not shown),
consistent with the functional importance of the Inr (Fig. 5). Although
mutations at the DPE did not completely abolish promoter function,
these constructs displayed dramatic decreases in promoter activity. We
speculate that the incomplete destruction of the Sp1-binding site at
the
20 region in the
26/+36 promoter-based constructs might
partially compensate for the loss of the DPE function. It is also
likely that the Inr and the DPE of the
hTAFII55 gene as well as the
20
Sp1-binding site are differentially utilized in different cell types.
Therefore, the DPE may be more important in some cells than in others.
Nevertheless, this study is the first demonstration of a functional DPE
in a human promoter following the initial report on hIRF (24).
MED-1 (multiple start site element downstream) in many TATA-less
promoters and DCE (downstream core promoter element) in the TATA-containing human
-globin promoter are additional examples of
downstream elements that function in concert with the Inr and appear to
affect TFIID binding (58, 72). Cellular proteins, such as TFIID and
NC2, have been reported to act through these downstream promoter
elements. However, it is not clear whether the downstream sequences are
essential for promoter activity merely to affect preinitiation complex
formation or whether they are also involved in promoter clearance and
the formation of a highly processive RNA polymerase II elongation
complex (73).
Our present study provides convincing evidence that the
26/+36
sequence can serve as an independent core promoter module, which can be
further activated by a transcriptional activator in the context of a
heterologous promoter (Fig. 5B). The
hTAFII55 core promoter could thus be a
model to analyze further molecular mechanisms of transcription
initiation on TATA-less promoters.
Transcription Factors Binding to the Promoter-proximal
Region--
Our study also details transcriptional regulation of
hTAFII55 promoter activity by Sp1 and AP2
proteins, a phenomenon commonly observed in mammalian TATA-less
promoters (74, 75). Sp1 is a well characterized ubiquitous
transcription factor whose binding sites are found in numerous
promoters that regulate both ubiquitous and tissue-specific genes (60,
76-78). Mice with homozygous deletions of the Sp1-coding gene show
severe developmental defects and die early during embryogenesis,
suggesting that Sp1 is essential for embryonic development (79). Our
study also indicates the importance of Sp1 in regulating
TAFII55 gene expression. First, deletion
of the GC-rich Sp1-binding sequences resulted in a significant
reduction in hTAFII55 promoter activity (Fig. 3). Second, point mutations introduced at the Sp1-binding sites
resulted in similar decreases in activity (Fig. 4). Third, DNase I
footprinting shows direct binding of purified Sp1 to its cognate DNA
sequences (data not shown).
In contrast, AP2 is a cell type-specific transcription factor important
in retinoid-controlled morphogenesis and differentiation, especially in
neural crest-derived cell lineages and epithelial cells (80). AP2
responds to at least two different signal transduction pathways, the
phorbol ester/protein kinase C signaling and the cAMP-dependent protein kinase pathway (81). AP2 has a
spatially and temporally restricted expression pattern in murine
embryos and shows significant expression levels in adult skin and
urogenital tissues (80). We found that Sp1 and AP2 proteins, whose
binding sites are closely positioned on the
hTAFII55 promoter, could bind
simultaneously to the promoter (data not shown). This finding suggests
that Sp1 and AP2 can regulate the
hTAFII55 promoter in a combinatorial
manner, although they do not appear to function synergistically in
C-33A cells (Fig. 4B). We estimate by quantitative Western
blotting analysis that C-33A cells have ~100 fg of Sp1 and less than
5 fg of endogenous AP2 per cell (data not shown). It is likely that the
relatively low level of AP2 proteins in C-33A cells cannot confer
significant activator function on
hTAFII55 expression. AP2 may function as
a more potent transcription activator in keratinocytes or in the neural
crest lineage in which it is expressed in high levels. We will further clarify the role of AP2 in regulating
hTAFII55 gene expression by
overexpressing AP2 in C-33A cells or by performing transfection assays
in different cell types.
The discovery of many potential transcription factor-binding sites in
the hTAFII55 promoter-proximal region
raises several interesting issues. Many TATA-less genes involved in DNA replication and cell cycle control have been reported to contain E2F-
and Sp1-binding sites (77). Colocalization studies of cells at
different stages of the cell cycle indicate that Sp1 may physically and
functionally associate with E2F (77, 82). It remains to be investigated
whether the E2F proteins also functionally interact with Sp1 on the
hTAFII55 promoter. Intriguingly, the presence of a MEF2-binding site may account for the preferential expression of the TAFII55 mRNA in skeletal muscle, as
revealed in Northern blotting analysis. Although transfection assays
and in vitro transcription carried out in human cervical
cancer cell lines (HeLa or C-33A) did not reveal the functional
importance of E2F-, STAT-, and MEF2-binding sites in the
hTAFII55 promoter, we cannot exclude the
possibility that these factors are either limiting in our cells or they
require additional cellular factors to support activator function.
These interesting possibilities remain to be addressed in the future.
 |
ACKNOWLEDGEMENTS |
We thank R. G. Roeder for pHIV+58 and
p-167; M. C. Thomas for pGL7072-161; J. Lasky for cloning of the
hTAFII55 gene; S. Y. Hou, K. Kitiphongspattana, D. Vichugsananon, and S.-Y. Wu for assistance in
sequencing the hTAFII55 genomic clones; P. de Haseth, S. Y. Hou, and S.-Y. Wu for helpful discussions; and C. Croniger, S. Y. Hou, P. M. MacDonald, D. McPheeters, D. Samols, M. Snider and S.-Y. Wu for comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by Grant 9950106N from the
American Heart Association and in part by Grants GM59643 and CA81017 from the National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF349038.
Graduate student on leave from the Dept. of Biochemistry,
University of Illinois, Urbana-Champaign, IL 61801.
§
A Pew Scholar in the Biomedical Sciences and a Mt. Sinai Health
Care Foundation Scholar. To whom correspondence should be addressed: Dept. of Biochemistry, Case Western Reserve University School of Medicine, 10900 Euclid Ave., Cleveland, OH 44106-4935. Tel.:
216-368-8550; Fax: 216-368-3419; E-mail:
c-chiang@biochemistry.cwru.edu.
Published, JBC Papers in Press, May 4, 2001, DOI 10.1074/jbc.M102875200
2
S.-Y. Wu and C.-M. Chiang, unpublished data.
3
C.-M. Chiang, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
TBP, TATA-binding
protein;
TFIID, transcription factor IID;
TAFII55, a 55-kDa
TBP-associated factor found in TFIID;
hTAFII55, human
TAFII55;
Sp1, specificity protein 1;
AP2, activator protein
2;
Inr, initiator element;
DPE, downstream promoter element;
kb, kilobase pair;
PCR, polymerase chain reaction;
PIPES, 1,4-piperazinediethanesulfonic acid;
HIV-1, human immunodeficiency
virus type 1;
nt, nucleotide.
 |
REFERENCES |
| 1.
|
Breathnach, R.,
and Chambon, P.
(1981)
Annu. Rev. Biochem.
50,
349-383
|
| 2.
|
Hernandez, N.
(1993)
Genes Dev.
7,
1291-1308
|
| 3.
|
Burley, S. K.,
and Roeder, R. G.
(1996)
Annu. Rev. Biochem.
65,
769-799
|
| 4.
|
Smale, S. T.
(1997)
Biochim. Biophys. Acta
1351,
73-88
|
| 5.
|
Smale, S. T.,
and Baltimore, D.
(1989)
Cell
57,
103-113
|
| 6.
|
Carcamo, J.,
Buckbinder, L.,
and Reinberg, D.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
8052-8056
|
| 7.
|
Weis, L.,
and Reinberg, D.
(1992)
FASEB J.
6,
3300-3309
|
| 8.
|
Javahery, R.,
Khachi, A.,
Lo, K.,
Zenzie-Gregory, B.,
and Smale, S. T.
(1994)
Mol. Cell. Biol.
14,
116-127
|
| 9.
|
Burke, T. W.,
and Kadonaga, J. T.
(1996)
Genes Dev.
10,
711-724
|
| 10.
|
Kutach, A. K.,
and Kadonaga, J. T.
(2000)
Mol. Cell. Biol.
20,
4754-4764
|
| 11.
|
Verrijzer, C. P.,
Yokomori, K.,
Chen, J.-L.,
and Tjian, R.
(1994)
Science
264,
933-941
|
| 12.
|
Verrijzer, C. P.,
Chen, J.-L.,
Yokomori, K.,
and Tjian, R.
(1995)
Cell
81,
1115-1125
|
| 13.
|
Hansen, S. K.,
and Tjian, R.
(1995)
Cell
82,
565-575
|
| 14.
|
Kaufmann, J.,
Verrijzer, C. P.,
Shao, J.,
and Smale, S. T.
(1996)
Genes Dev.
10,
873-886
|
| 15.
|
Kaufmann, J.,
Ahrens, K.,
Koop, R.,
Smale, S. T.,
and Müller, R.
(1998)
Mol. Cell. Biol.
18,
233-239
|
| 16.
|
Martinez, E.,
Ge, H.,
Tao, Y.,
Yuan, C.-X.,
Palhan, V.,
and Roeder, R. G.
(1998)
Mol. Cell. Biol.
18,
6571-6583
|
| 17.
|
Chalkley, G. E.,
and Verrijzer, C. P.
(1999)
EMBO J.
18,
4835-4845
|
| 18.
|
Roy, A. L.,
Meisterernst, M.,
Pognonec, P.,
and Roeder, R. G.
(1991)
Nature
354,
245-248
|
| 19.
|
Roy, A. L.,
Du, H.,
Gregor, P. D.,
Novina, C. D.,
Martinez, E.,
and Roeder, R. G.
(1997)
EMBO J.
16,
7091-7104
|
| 20.
|
Grueneberg, D. A.,
Henry, R. W.,
Brauer, A.,
Novina, C. D.,
Cheriyath, V.,
Roy, A. L.,
and Gilman, M.
(1997)
Genes Dev.
11,
2482-2493
|
| 21.
|
Yang, W.,
and Desiderio, S.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
604-609
|
| 22.
|
Du, H.,
Roy, A. L.,
and Roeder, R. G.
(1993)
EMBO J.
12,
501-511
|
| 23.
|
Seto, E.,
Shi, Y.,
and Shenk, T.
(1991)
Nature
354,
241-244
|
| 24.
|
Burke, T. W.,
and Kadonaga, J. T.
(1997)
Genes Dev.
11,
3020-3031
|
| 25.
|
Meisterernst, M.,
and Roeder, R. G.
(1991)
Cell
67,
557-567
|
| 26.
|
Inostroza, J. A.,
Mermelstein, F. H.,
Ha, I.,
Lane, W. S.,
and Reinberg, D.
(1992)
Cell
70,
477-489
|
| 27.
|
Goppelt, A.,
Stelzer, G.,
Lottspeich, F.,
and Meisterernst, M.
(1996)
EMBO J.
15,
3105-3116
|
| 28.
|
Mermelstein, F.,
Yeung, K.,
Cao, J.,
Inostroza, J. A.,
Erdjument-Bromage, H.,
Eagelson, K.,
Landsman, D.,
Levitt, P.,
Tempst, P.,
and Reinberg, D.
(1996)
Genes Dev.
10,
1033-1048
|
| 29.
|
Willy, P. J.,
Kobayashi, R.,
and Kadonaga, J. T.
(2000)
Science
290,
982-985
|
| 30.
|
Lagrange, T.,
Kapanidis, A. N.,
Tang, H.,
Reinberg, D.,
and Ebright, R. H.
(1998)
Genes Dev.
12,
34-44
|
| 31.
|
Qureshi, S. A.,
and Jackson, S. P.
(1998)
Mol. Cell
1,
389-400
|
| 32.
|
Zhang, M. Q.
(1998)
Genome Res.
8,
319-326
|
| 33.
|
Novina, C. D.,
and Roy, A. L.
(1996)
Trends Genet.
12,
351-355
|
| 34.
|
Ren, B.,
and Maniatis, T.
(1998)
EMBO J.
17,
1076-1086
|
| 35.
|
Chiang, C.-M.,
and Roeder, R. G.
(1995)
Science
267,
531-536
|
| 36.
|
Lavigne, A.-C.,
Mengus, G.,
May, M.,
Dubrovskaya, V.,
Tora, L.,
Chambon, P.,
and Davidson, I.
(1996)
J. Biol. Chem.
271,
19774-19780
|
| 37.
|
Wieczorek, E.,
Brand, M.,
Jacq, X.,
and Tora, L.
(1998)
Nature
393,
187-191
|
| 38.
|
Ogryzko, V. V.,
Kotani, T.,
Zhang, X.,
Schlitz, R. L.,
Howard, T.,
Yang, X.-J.,
Howard, B. H.,
Qin, J.,
and Nakatani, Y.
(1998)
Cell
94,
35-44
|
| 39.
|
Grant, P. A.,
Schieltz, D.,
Pray-Grant, M. G.,
Steger, D. J.,
Reese, J. C.,
Yates, J. R.,
and Workman, J. L.
(1998)
Cell
94,
45-53
|
| 40.
|
Lavigne, A.-C.,
Mengus, G.,
Gangloff, Y.-G.,
Wurtz, J.-M.,
and Davidson, I.
(1999)
Mol. Cell. Biol.
19,
5486-5494
|
| 41.
|
Dantonel, J.-C.,
Murthy, K. G.,
Manley, J. L.,
and Tora, L.
(1997)
Nature
389,
399-402
|
| 42.
|
Wu, S.-Y.,
Thomas, M. C.,
Hou, S. Y.,
Likhite, V.,
and Chiang, C.-M.
(1999)
J. Biol. Chem.
274,
23480-23490
|
| 43.
|
Moqtaderi, Z.,
Yale, J. D.,
Struhl, K.,
and Buratowski, S.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
14654-14658
|
| 44.
|
Shibuya, T.,
Tsuneyoshi, S.,
Azad, A. K.,
Urushiyama, S.,
Ohshima, Y.,
and Tani, T.
(1999)
Genetics
152,
869-880
|
| 45.
|
Purrello, M.,
Di Pietro, C.,
Viola, A.,
Rapisarda, A.,
Stevens, S.,
Guermah, M.,
Tao, Y.,
Bonaiuto, C.,
Arcidiacono, A.,
Messina, A.,
Sichel, G.,
Grzeschik, K.-H.,
and Roeder, R.
(1998)
Oncogene
16,
1633-1638
|
| 46.
|
Wu, S.-Y.,
and Chiang, C.-M.
(1996)
BioTechniques
21,
718-725
|
| 47.
|
Chiang, C.-M.,
Ge, H.,
Wang, Z.,
Hoffmann, A.,
and Roeder, R. G.
(1993)
EMBO J.
12,
2749-2762
|
| 48.
|
Rosen, C. A.,
Sodroski, J. G.,
and Haseltine, W. A.
(1985)
Cell
41,
813-823
|
| 49.
|
Kato, H.,
Horikoshi, M.,
and Roeder, R. G.
(1991)
Science
251,
1476-1479
|
| 50.
|
Hou, S. Y.,
Wu, S.-Y.,
Zhou, T.,
Thomas, M. C.,
and Chiang, C.-M.
(2000)
Mol. Cell. Biol.
20,
113-125
|
| 51.
|
Sadowski, I.,
Ma, J.,
Triezenberg, S.,
and Ptashne, M.
(1988)
Nature
335,
563-564
|
| 52.
|
Sadowski, I.,
and Ptashne, M.
(1989)
Nucleic Acids Res.
17,
7539
|
| 53.
|
Chiang, C.-M.,
Broker, T. R.,
and Chow, L. T.
(1991)
J. Virol.
65,
3317-3329
|
| 54.
|
Gorman, C. M.,
Moffat, L. F.,
and Howard, B. H.
(1982)
Mol. Cell. Biol.
2,
1044-1051
|
| 55.
|
Melton, D. A.,
Krieg, P. A.,
Rebagliati, M. R.,
Maniatis, T.,
Zinn, K.,
and Green, M. R.
(1984)
Nucleic Acids Res.
12,
7035-7056
|
| 56.
|
International Human Genome Sequencing Consortium.
(2001)
Nature
409,
860-921
|
| 57.
|
Venter, J. C.,
Adams, M. D.,
Myers, E. W.,
Li, P. W.,
Mural, R. J.,
et al..
(2001)
Science
291,
1304-1351
|
| 58.
|
Ince, T. A.,
and Scotto, K. W.
(1995)
J. Biol. Chem.
270,
30249-30252
|
| 59.
|
Boam, D. S.,
Davidson, W. I.,
and Chambon, P.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
270,
19487-19494
|
| 60.
|
Benson, L. Q.,
Coon, M. R.,
Krueger, L. M.,
Han, G. C.,
Sarnaik, A. A.,
and Wechsler, D. S.
(1999)
J. Biol. Chem.
274,
28794-28802
|
| 61.
|
Chalut, C.,
Gallois, Y.,
Poterszman, A.,
Moncollin, V.,
and Egly, J.-M.
(1995)
Gene
161,
277-282
|
| 62.
|
Scheer, E.,
Mattei, M.-G.,
Jacq, X.,
Chambon, P.,
and Tora, L.
(1995)
Genomics
29,
269-272
|
| 63.
|
van der Knaap, J. A.,
Borst, J. W.,
van der Vliet, P. C.,
Gentz, R.,
and Timmers, H. T. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
11827-11832
|
| 64.
|
Lewin, B.
(2000)
Genes VII
, pp. 37-65, Oxford University Press, New York
|
| 65.
|
Kedes, L. H.
(1979)
Annu. Rev. Biochem.
48,
837-870
|
| 66.
|
Gentles, A. J.,
and Karlin, S.
(1999)
Trends Genet.
15,
47-49
|
| 67.
|
Wu, B.,
Hunt, C.,
and Morimoto, R.
(1985)
Mol. Cell. Biol.
5,
330-341
|
| 68.
|
Hattori, K.,
Angel, P.,
Le Beau, M. M.,
and Karin, M.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
9148-9152
|
| 69.
|
Nagata, S.,
Mantei, N.,
and Weissmann, C.
(1980)
Nature
287,
401-408
|
| 70.
|
Huang, Z.-M.,
and Yen, T. S.
(1995)
Mol. Cell. Biol.
15,
3864-3869
|
| 71.
|
Trubetskoy, A. M.,
Okenquist, S. A.,
and Lenz, J.
(1999)
J. Virol.
73,
3477-3483
|
| 72.
|
Lewis, B. A.,
Kim, T. K.,
and Orkin, S. H.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
7172-7177
|
| 73.
|
Rougvie, A. E.,
and Lis, J. T.
(1988)
Cell
54,
795-804
|
| 74.
|
Mavrothalassitis, G. J.,
Watson, D. K.,
and Papas, T. S.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
1047-1051
|
| 75.
|
Weis, L.,
and Reinberg, D.
(1997)
Mol. Cell. Biol.
17,
2973-2984
|
| 76.
|
Chang, D. J.,
Paik, Y. K.,
Leren, T. P.,
Walker, D. W.,
Howlett, G. J.,
and Taylor, J. M.
(1990)
J. Biol. Chem.
265,
9496-9504
|
| 77.
|
Karlseder, J.,
Rotheneder, H.,
and Wintersberger, E.
(1996)
Mol. Cell. Biol.
16,
1659-1667
|
| 78.
|
Pipaón, C.,
Tsai, S. Y.,
and Tsai, M.-J.
(1999)
Mol. Cell. Biol.
19,
2734-2745
|
| 79.
|
Marin, M.,
Karis, A.,
Visser, P.,
Grosveld, F.,
and Philipsen, S.
(1997)
Cell
89,
619-628
|
| 80.
|
Mitchell, P. J.,
Timmons, P. M.,
Hebert, J. M.,
Rigby, P. W.,
and Tjian, R.
(1991)
Genes Dev.
5,
105-119
|
| 81.
|
Imagawa, M.,
Chiu, R. |