Originally published In Press as doi:10.1074/jbc.M103874200 on May 3, 2001
J. Biol. Chem., Vol. 276, Issue 27, 25621-25630, July 6, 2001
A Role for Sp1 in the Transcriptional Regulation of Hepatic
Triacylglycerol Hydrolase in the Mouse*
Donna N.
Douglas
,
Vernon W.
Dolinsky
§,
Richard
Lehner¶
**, and
Dennis E.
Vance

From the Departments of
Biochemistry,
¶ Pediatrics, and
Cell Biology, Canadian Institute
of Health Research Group on the Molecular and Cell Biology of Lipids,
University of Alberta, Edmonton, Alberta T6G 2S2, Canada
Received for publication, April 30, 2001
 |
ABSTRACT |
Microsomal triacylglycerol hydrolase (TGH)
hydrolyzes stored triacylglycerol in cultured hepatoma cells (Lehner,
R., and Vance, D. E. (1999) Biochem. J. 343, 1-10).
We studied expression of TGH in murine liver and found both protein and
mRNA increased dramatically at 27 days after birth. Nuclear run-on
assays demonstrated that this was due to increased transcription. We
cloned 542 base pairs upstream of the transcriptional start site of the
murine TGH gene. Electrophoretic mobility shift assays demonstrated
enhanced binding of hepatic nuclear proteins from 27-day-old mice to
the murine TGH promoter, yielding three differentially migrating
complexes. DNase I footprint analysis localized these complexes to two
distinct regions: site A contains a putative Sp binding site, and site B contains a degenerate E box. We transfected primary murine
hepatocytes with a series of 5'-deletion constructs upstream of the
reporter luciferase cDNA. Positive control elements were identified
in a segment containing site A. Competitive electrophoretic
mobility shift assays and supershift assays demonstrated that
site A binds Sp1 and Sp3. Transcriptional activation assays in
Schneider SL-2 insect cells demonstrated that Sp1 is a potent activator
of the TGH promoter. These experiments directly link increased
TGH expression at the time of weaning to transcriptional regulation by Sp1.
 |
INTRODUCTION |
Mammalian carboxylesterases (EC 3.1.1.1) are serine esterases
constituting a family of isoenzymes that are implicated in several
physiological processes. Multiple forms of carboxylesterase have been
identified in mammalian tissues, and some have been shown to differ in
biochemical, immunological, and genetic properties (for a review, see
Ref. 1 and references therein). Carboxylesterase activity is widely
distributed in mammalian tissues, with the highest levels being present
in liver microsomes (2). The ability of carboxylesterases to hydrolyze
various xenobiotoics and endogenous substrates, such as esters,
thioesters, or amide bonds, indicates that the known functions of these
enzymes are mainly for drug metabolism and detoxification of harmful
chemicals (1). Some carboxylesterases have been found to preferentially
hydrolyze lipids, such as long chain acyl-CoA (3), cholesteryl ester (4), and triacylglycerol
(TG)1 (5). Some
carboxylesterases are thought to participate in transport of fatty
acids across the endoplasmic reticulum membrane or in maintenance of
membrane structure.
In the liver, mobilization of stored TG to supply fatty acids for
metabolic energy occurs via an initial hydrolysis of stored TG and
subsequent resynthesis of TG as a component of very low density
lipoproteins (VLDLs) (for a review, see Ref. 6). Although the
enzymes catalyzing de novo synthesis of TG are associated with endoplasmic reticulum membranes, ~70% of the TG that is
secreted by hepatocytes in VLDLs has been calculated to arise from a
cytosolic storage pool, whereas only 30% is derived from de
novo TG synthesis (7, 8). Hormone-sensitive lipase, although
fundamental in adipose tissue lipid metabolism and overall energy
homeostasis, is not expressed in liver in sufficient quantities to
account for the rate of lipolysis of stored TG and subsequent VLDL
secretion (7).
Lehner and Verger (5) reported the purification of a member of the
carboxylesterase family from porcine liver, microsomal triacylglycerol
hydrolase (TGH), capable of hydrolyzing long, medium, and short chain
TGs in vitro (5). Further detailed characterization of TGH
with respect to its intracellular location, developmental expression,
and tissue and species specificity strongly supported a role for TGH in
the lipolysis of cytoplasmic TG, some of which is used for assembly
into VLDLs (9). Stable expression of rat TGH cDNA in McArdle RH7777
cells, a rat hepatoma cell line that lacks TGH and is defective in VLDL
secretion, demonstrated unambiguously that TGH does indeed hydrolyze
stored TG (10).
In our previous studies, we observed increased expression of rat TGH
mRNA and protein in liver at the time of weaning, coincident with
an enhanced ability to secrete VLDLs (9). The aim of the present study
was to determine whether the increased expression of TGH seen at the
time of weaning is linked to transcriptional regulation and to identify
potential transcription factors and cis-acting DNA elements
that might mediate the observed developmental expression of TGH in liver.
 |
EXPERIMENTAL PROCEDURES |
Isolation of Protein and RNA--
Livers samples from mice of
various ages were washed with ice-cold phosphate-buffered saline and
homogenized using a Polytron homogenizer (Brinkman Instruments)
for 30 s at low speed in 250 mM sucrose, 25 mM Tris-HCl (pH 7.4), and 5 mM EDTA to yield
20% (w/v) crude extract. Unbroken cells and cellular debris were
removed by 10 min of centrifugation at 500 × g.
Protein concentrations of total liver homogenates (supernatants) were
determined by the micro BCA method (Pierce) using bovine serum albumin
as a standard. For RNA isolation, livers were immediately frozen in
liquid nitrogen prior to extraction of total RNA using Trizol reagent
(Life Technologies, Inc.) according to the manufacturer's instructions.
Immunoblot Analysis--
Homogenate protein (50 µg) or nuclear
protein (10 µg) from murine liver was heated for 3 min at 90 °C in
62.5 mM Tris-HCl (pH 6.4), 10% (v/v) glycerol, 5% (v/v)
2-mercaptoethanol, 1.05% SDS, and 0.004% bromphenol blue. The protein
samples were electrophoresed on a 10% SDS-polyacrylamide gel in 25 mM Tris-HCl (pH 8.3), 192 mM glycine, and 0.1%
SDS buffer. The proteins were then transferred to nitrocellulose by
electroblotting in transfer buffer (25 mM Tris-HCl (pH
8.3), 192 mM glycine, 20% (v/v) methanol). Following transfer, membranes were incubated for 1 h at room temperature or
overnight at 4 °C with 5% skim milk in 20 mM Tris-HCl
(pH 7.4), 150 mM NaCl, 0.1% Tween 20 (T-TBS) and then
incubated for 1 h with antibody raised against the specified
protein. Depending on the primary antibodies, the secondary antibodies
used were goat anti-rabbit IgG, rabbit anti-goat IgG, or goat
anti-mouse IgG (Pierce) and were detected using the enhanced
chemiluminescence system (Amersham Pharmacia Biotech) according to the
manufacturer's instructions. Where indicated, primary and secondary
antibodies were stripped from the membrane by incubation with 100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl
(pH 6.7) for 30 min at 50 °C and the blot was reprobed with another
antibody. The primary antibodies used were affinity purified anti-TGH
polyclonal antibody (5), anti-actin monoclonal antibody (Sigma, clone
AC74, catalog number A 5316), and from Santa Cruz Biotechnology,
polyclonal anti-Sp1 (sc-59-G), anti-Sp2 (sc643,), anti-Sp3 (sc-644),
anti-E47 (sc-763x), and anti-YY1 (sc-1703x). In some cases, primary
incubations with anti-Sp antibodies also contained competitive
antigenic peptides to identify antigenically related proteins. These
peptides were SP1(PEP2)P (sc-59P), SP2(K-20)P (sc-643P), and SP3(D-20)P
(sc-644P) from Santa Cruz Biotechnology.
Northern Blot Analysis--
Equivalent amounts of total RNA (2.5 µg) were electrophoresed in a 1.2% agarose/formaldehyde gel and
transferred to HyBond-N+ membrane. TGH mRNA was detected by
incubation of the membrane with a 32P-labeled,
single-stranded antisense oligo designated pTGHII
(5'-GAGCAAAGTTGGCCCAGTATTTCATCACCATTTTGCTGA-3'). This oligonucleotide
was derived from the rat TGH cDNA sequence that is 90% identical
to the corresponding murine cDNA and does not align with other
carboxylesterases from the same gene family. Probes for
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) were prepared by
RT-PCR with murine liver total RNA with Superscript II (Life
Technologies, Inc.) according to the manufacturer's
instructions. The primers used were G3PDH1A
(5'-GAGCCAAACGGGTCATCATC-3') and G3PDH2B (5'-CATCACGCCACAGCTTTCCA-3'),
which were designed to amplify a 232-base pair fragment. The PCR
product was used as a template for Random Primers DNA Labeling
System (Life Technologies, Inc.) according to the manufacturer's
instructions. Northern hybridizations were visualized by autoradiography.
PCR-based Nuclear Run-on Assay--
This assay was performed
essentially as described (11). Briefly, highly purified and
transcriptionally active nuclei were prepared from murine liver
according to the methods of Marzluff and Huang (12). Freshly prepared
or frozen/thawed nuclei (200 µl) were split into two aliquots and
incubated for 30 min at 30 °C in 20% glycerol, 30 mM
Tris-HCl (pH 8.0), 2.5 mM MgCl2, 150 mM KCl, 1 mM dithiothreitol, and 40 units of
RNasin (Promega) with or without 0.5 mM (each)
ribonucleoside triphosphates (+/- rNTPs). After 30 min, nuclei were
lysed by the addition of 200 µl of 4 M guanidinium
thiocyanate, 25 mM sodium citrate (pH 4.0), 0.5% sarcosyl,
0.1 M 2-mercaptoethanol. Yeast tRNA (20 µg) was added,
and RNA was extracted by the acid-guanidinium-thiocyanate method and
then resuspended in water treated with diethylpyrocarbonate. RT-PCR was
performed as described above. The primers used for TGH were EX6F
(5-CACTGCTGCTCTGATTACAACAG-3') and EX10R (5'-GCGACCACTGGAATCATATTC-3'). The primers used for G3PDH were G3PDH1A and G3PDH2B. Because the run-on
products are not labeled, newly transcribed mRNA in isolated nuclei
was detected following nuclear transcription initiated by the addition
of exogenous rNTPs. Nuclear transcription reactions lacking exogenous
rNTPs were included to control for mRNAs synthesized by endogenous
rNTPs in isolated nuclei.
Cloning of the Murine TGH Promoter and Plasmid
Construction--
Genomic sequences containing the putative proximal
murine TGH promoter were identified by Southern blot analysis of
bacterial artificial chromosome clone 313P24 that contains the
complete murine TGH gene (13). Briefly, bacterial artificial chromosome DNA was digested with EcoRI, and a single 6-kilobase
pair DNA fragment that contained exon 1 was identified by
Southern blotting using a murine TGH exon 1-specific probe,
ATGCGCCTCTACCCTCTGATATG. This fragment was subcloned and sequenced by
gene walking using overlapping primers to determine sequences upstream
of the transcriptional start site. The sequence of the murine TGH
promoter was confirmed by sequencing both strands of the DNA. A genomic
fragment encoding the murine TGH promoter region spanning -542 and
+112 was cloned into the T/A cloning site of pCR2.1 TOPO (Invitrogen)
according to the manufacturer's instructions to create pCR
(-542/+112). The promoter region was excised from pCR 2.1 TOPO by
restriction digestion with KpnI and XbaI. The
insert was purified from an agarose gel (Qiagen gel elution kit) and
directionally ligated into pCI (Promega) that had been subjected to the
same restriction digestion and gel purification. The cloned fragment
was released from pCI by restriction digestion with KpnI and
SmaI, gel purified, and then directionally inserted into the
luciferase reporter vector, pGL3Basic (Promega) that had
also been digested by KpnI and SmaI and gel
purified to generate -542Luc. Luciferase reporter plasmids containing
serial deletions at the 5'-end of the cloned promoter fragment were
generated by standard PCR methods using -542Luc as template and
GLprimer2 (Promega) as the reverse primer with each of the
following forward primers: TGGCTGCTGCTGTCTGCTCTT (-313Luc), CTGAATTGAGGTGAGAG (-276Luc), TGAGTACTGGGCACTG (-198Luc),
TAGTGGGCGTGGCTTG (-154Luc), GAGCTCTTTGGAAGGAAGGAG (-116Luc),
CTGAGCTGGTTGAGCAAGAC (-48Luc), and TGGTCCACAACAGA (-10Luc). In each
case, the sequence of the forward primer started with
CGCGGTACC (KpnI site in boldface). Each of the
PCR products was directionally cloned into pGL3Basic
following restriction digestion of each with KpnI and
SmaI.
Vectors enabling expression of recombinant Sp proteins were obtained
from Dr. R. Tjian (pPacSp1 and pPac0) (14) and Dr. J. Noti (pPacSp3)
(15). The plasmid enabling expression of green fluorescent protein
(GFP) in insect cells (copia (XhoI)-eGFP) was kindly
provided by Dr. John F. Elliott (University of Alberta).
The cDNA for full-length Th1 (16) was obtained by RT-PCR. Briefly,
total RNA was obtained from hearts isolated from 1-day-old mice (as
described below for liver) and reverse-transcribed with Superscipt II
reverse transcriptase (Life Technologies, Inc.) and
oligo(dT)15 antisense primer. Primers used in subsequent
PCR were 5'-ATGAACCTCGTGGGCAGCTAC-3' and
5'-TCACTGGTTTAGCTCCAGCGCCCA-3'. The PCR (650 base pairs) product was
cloned into the T/A cloning site of pCR2.1 TOPO. Th1 and GFP were
excised from PCR2.1 TOPO and copia (XhoI)-eGFP respectively
using XhoI and BamHI and the ThI cDNA
fragment was directionally ligated downstream of the copia promoter in
place of GFP to generate a Th1 expression plasmid, copia-Th1.
Copia(XhoI) was generated by blunt-end self-ligation after
excision of GFP with XhoI and BamHI. Cloned
inserts of all transfection constructs were confirmed by DNA sequencing
(University of Alberta DNA Core Facility).
Cell Culture, Transfections, and Reporter Assays--
Murine
hepatic cells were isolated by collagenase perfusion and transiently
transfected with TGH promoter luciferase reporter constructs (2 µg)
using a cationic liposome technique (17). Reporter assays were
performed as recommended (Promega), and luciferase activity was
normalized to protein.
SL2 cells (American Type Culture Collection) were plated at a density
of 2-3 × 106 cells/35-mm dish in Schneider's
Drosophila medium (Life Technologies, Inc.) containing 10%
(v/v) heat-inactivated fetal bovine serum and transfected by a standard
calcium phosphate co-precipitation method (18). Each plate received 5 µg of 154Luc or reporter plasmid, pGL3Basic, with or
without 5 µg of Sp expression plasmid (pPacSp1, pPacSp3, or pPacO as
a control) and 5 µg of Th1 expression plasmid (copia(XhoI)
as a control). All plates received 5 µg of copia(XhoI)-eGFP as a control for transfection efficiency.
Total plasmid DNA was conserved (20 µg) for each transfection.
In vivo fluorescence measurements were carried out on a
FACScan flow cytometer (Becton Dickinson, San Jose, CA) equipped with
an argon laser. The sample temperature was maintained at 25 °C. SL2
cells expressing GFP were excited at 488 nm. Fluorescence emission was
detected at 525 nm. For quantification of GFP fluorescence, SL2 cells
were grown using the same conditions as for the luciferase assays. Background fluorescence of SL2 cells was determined at excitation wavelength of 488 nm using the vector copia(XhoI), which
does not contain the GFP coding region. Cell pellets were resuspended in phosphate-buffered saline (58 mM
Na2HPO4, 17 mM
NaH2PO4, 68 mM NaCl, pH 7.4). Data
analysis was performed using CELLQuest 3.1 (Becton Dickinson, San Jose,
CA), and the ratio of fluorescence intensity to cell density was taken
as a measure for GFP expression levels. Luciferase activities were
normalized to transfection efficiency as determined by GFP expression.
Statistical analysis was performed using a one-way analysis of variance
test followed by a post hoc Student-Newman-Keuls test.
Values of p less than 0.05 were taken to be significant.
Preparation and Dephosphorylation of Nuclear
Extracts--
Nuclear extracts from murine liver were prepared as
described (19). Dephosphorylation of extracts was performed in 25 mM Hepes (pH 7.5), 37 mM KCl, 50 mM
MgCl2 at 30 °C for 5 min and then 15 min on ice with
calf intestinal alkaline phosphatase (1 unit/50 µg of nuclear
extract). Dephosphorylation reactions were terminated by the addition
of a mixture of inhibitors to final concentrations of 10 mM
NaF, 10 mM sodium vanadate, 10 mM potassium pyrophosphate, and 5 mM sodium phosphate. For mock
dephosphorylation reactions, inhibitors were added to the extract
before the 30 °C incubation.
Electrophoretic Mobility Shift Assays--
Distal (-542/-371),
medial (-370/-68), and proximal (-67/+112) promoter fragments were
released from pCR (-542/+112) by restriction digestion with
BlpI/NotI, HindIII/BlpI,
and HindIII, respectively. Promoter fragments were purified
from 2% agarose gels using the Qiaex II gel extraction kit (Qiagen
Inc., Mississauga, Ontario, Canada) according to the manufacturer's
instructions and labeled by filling in ends using Klenow fragment in
the presence of [
-32P]dCTP. Promoter-derived
oligonucleotides were synthesized by the University of Alberta DNA
Core Facility. Complimentary oligonucleotides (10 nmol of each)
were heated at 70 °C in 100 µl of annealing buffer (10 mM Tris-HCl (pH 7.5) containing 100 mM NaCl and
1 mM EDTA). After 10 min, annealing reactions were slowly
cooled to room temperature, and 5 pmol of double-stranded
oligonucleotide was 5'-end labeled using T4 kinase (Roche
Diagnostics) and [
-32P]ATP
(PerkinElmer). The sequences of oligonucleotides used in EMSAs
are as follows (coding strand):
1565'-CCTAGTGGGCGTGGCTTGG-3'
138
(site A),
1255'-ACACCCAGAGAGCTCTTT-3'
108(site
B), and 5'-ATTCGATCGGGCGGGGCGAGC-3' (Sp consensus
oligonucleotide). For each binding reaction (40 µl), 4 µg of
poly(dI-dC)-poly(dI-dC), 8 µl of a 5× binding buffer (100 mM Tris-HCl (pH 7.4), 10 mM MgCl2, 250 mM NaCl, 5 mM EDTA, 50% glycerol, 0.5%
Nonidet P-40, 5 mM dithiothreitol), 2.5 µg of nuclear
extract and labeled probe (20,000 cpm) were incubated at room
temperature for 30 min. Competitive EMSAs were carried out under
identical conditions except that a 50 M excess of
nonlabeled double-stranded oligonucleotides or 2 µg of commercially
available antibody was added to the binding reactions 15 min prior to
the addition of labeled probe. Binding reactions were terminated by the
addition of 4 µl of gel loading buffer (30% (v/v) glycerol, 0.1%
(w/v) bromphenol blue, 0.1% (w/v) xylene cyanol). Protein-DNA
complexes were resolved on 3.5% (for labeled promoter fragments) or
6% (for labeled double-stranded oligos) nondenaturing polyacrylamide
gel electrophoresis with Tris borate-EDTA buffer system (45 mM Tris, 44.5 mM borate, 1 mM EDTA,
pH 8.0) at 4 °C and were detected by autoradiography. Specific
antibody-protein interactions were observed as supershifted or
immunodepleted complexes.
In Vitro DNase I Footprinting--
The sense strand of the TGH
medial promoter fragment was labeled by filling in the
HindIII site using Klenow fragment in the presence of
[
-32P]dCTP. Labeled DNA (20,000 cpm) was incubated for
30 min at room temperature with 10 µg of poly(dI-dC)-poly(dI-dC) and
10, 25, and 50 µg of nuclear protein extract from 37-day-old murine
liver in a final volume of 100 µl (20 mM Tris-HCl, pH
7.4, 2.2 mM MgCl2, 0.2 mM
CaCl2, 50 mM NaCl, 1 mM EDTA, 10%
glycerol, 0.1% Nonidet P-40, 1 mM dithiothreitol). To
determine the optimal conditions, a titration was performed for each
probe using increasing concentrations of DNase I for the same amount of
nuclear extract. DNase I (5-10 milliunits) in DNase I buffer (1 mM MgCl2, 1 mM dithiothreitol, 20 mM KCl) was added for 5 min at room temperature. DNase I
digestions were terminated by the addition of 200 µl of DNase I stop
buffer (200 mM NaCl, 30 mM EDTA, 1% SDS, 100 µg/ml tRNA) and 2 µl of proteinase K (25 µg/µl). After a 15-min
incubation at 37 °C, reaction mixtures were extracted twice with
phenol/chloroform/isoamylalcohol and were then ethanol-precipitated
before analysis on a 5% polyacrylamide, 7 M urea
sequencing gel.
 |
RESULTS |
Postnatal Expression of TGH in Murine Liver--
Immunoblot
analysis of proteins from livers of mice of various ages demonstrates
that TGH protein levels increase dramatically between 20 and 27 days
after birth (Fig. 1A). TGH
mRNA expression in these livers was evaluated by Northern blot
hybridization of total RNA with a murine TGH-specific oligonucleotide
as probe (Fig. 1B). TGH mRNA was detected as early as 1 day after birth with maximum expression at 27 days.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1.
Developmental expression of hepatic
microsomal TGH. A, immunoblot analysis of TGH. Proteins
of liver homogenates (20 µg) prepared from mice of various ages
(C, control, rat liver microsomes) were resolved on 12%
SDS-polyacrylamide gels, electroblotted onto nitrocellulose membranes,
and probed with anti-TGH antibody. Membranes were stripped and reprobed
with an antibody directed against -actin. These results represent
one of three experiments. B, Northern blot analysis of TGH
mRNA. Total RNA (2.5 µg) was extracted from livers of mice of the
indicated ages, separated on a 1.2% agarose/formaldehyde gel,
transferred to a HyBond-N+ nylon membrane, and probed with
32P-labeled TGH oligo-pTGHII. As a control, the expression
of G3PDH was also measured. C, in vitro nuclear
transcription reaction. Intact nuclei were isolated from livers of 7- and 27-day-old mice (d7 and d27, respectively),
and nuclear transcription reactions were performed with
(+NTPs) or without (-NTPs) ribonucleoside
triphosphates. Following transcription, nuclei were lysed, and
heteronuclear RNA was isolated. Transcripts encoding TGH and
G3PDH were detected by RT-PCR using gene-specific primers: EX6F (sense)
and EX10R (antisense) for TGH mRNA, and G3PDH1A (sense) and
G3PDH2B (antisense) for G3PDH. PCR products were analyzed by agarose
gel electrophoresis, and sequences were confirmed by sequencing. These
results are representative of three experiments performed with
individual nuclei preparations.
|
|
TGH transcription was detected with a modified nuclear run-on assay
based on RT-PCR (Fig. 1C). Amplicons for both TGH and G3PDH
were generated by RT-PCR of RNA obtained from isolated nuclei in which
nuclear transcription proceeded in the absence of exogenously supplied
rNTPs. It is unlikely that either amplicon represents cytoplasmic RNA
contamination. As our method involved lysing the cells in an
iso-osmotic solution followed by purification of nuclei by
sedimentation through a dense solution of sucrose (2 M). It is also unlikely that amplification occurred from genomic DNA contamination or immature, unprocessed heteronuclear RNA because the PCR primers were designed so that they spanned four introns of the
murine TGH gene (13). The only amplicons detected were those of the
expected sizes based on completely spliced cDNA. Indeed, intact
splicing machinery can be recovered from nuclei prepared with
techniques similar to those employed here (20). Therefore, mature
transcripts for both TGH and G3PDH are present in the nucleus in low
abundance and are available to act as functional templates for RT-PCR.
In livers from 7-day-old mice, no TGH transcription was observed (Fig.
1C, + rNTPs) above that for transcripts formed in the nuclei
prior to nuclear isolation or with endogenous NTPs (Fig. 1C, - rNTPs). In liver from 27-day-old mice, TGH transcripts were much
more readily detected when isolated nuclei were supplied exogenous
rNTPs. All PCRs were terminated while products in the + rNTP
reactions were still accumulating. These data suggest that the lower
levels of cytosolic TGH mRNA (Fig. 1B) seen in livers of
7-day-old mice might be due to a lower level of transcriptional activity from the TGH gene. Whereas TGH protein and mRNA expression appear to be temporally spaced, indicating regulation at a
posttranscriptional level, the nuclear run-on assay presented here
indicates that in the liver, postnatal expression of TGH mRNA is
regulated at the level of transcription.
Functional Assays of Murine TGH Promoter Activity in Primary
Hepatocytes--
To investigate the transcriptional regulation of the
murine TGH gene, a 6-kilobase pair DNA fragment derived from a
bacterial artificial chromosome clone, previously demonstrated to
contain the entire murine TGH gene (13), was sequenced. This DNA
fragment contains exon 1 and most of intron 1, extends 3 kilobase pairs upstream of the transcription start site, and presumably contains the
promoter. Fig. 2 shows 542 base pairs of
the 5' sequence flanking exon 1. This sequence is 59% identical to the
rat (4) and 46% identical to the previously cloned human (22)
promoter. No TATA box was found to precede the transcriptional start
site. Potential binding sites for transcription factors were identified
by searching the TRANSFAC data base with the murine sequence using the
Matinspector program (23). These sites include three Sp1 binding sites,
a nuclear factor 1, and two sterol response element-like
sequences. Interestingly, several of these binding sites are also
present in the human and rat promoter sequences, suggesting that we
have cloned a functional promoter with evolutionarily conserved
transcriptional regulatory patterns. Previous evidence for sterol
regulation of TGH transcription in the rat has been reported (24, 25),
suggesting that the sterol response element-like elements are
functional. We tested whether or not the cloned sequence had promoter
activity by designing fusion constructs of the 5'-flanking sequence
linked to the luciferase gene. In addition, several constructs were
made in which 5'-segments of the murine TGH gene were cloned upstream of the luciferase gene, and their promoter activities were tested in
transient transfection assays in primary hepatocytes obtained from
adult mice. A schematic illustration of the deletion constructs is
shown in Fig. 3A.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Nucleotide sequence in the vicinity of the
transcription start site for the murine TGH gene. The 542-base
pair DNA sequence preceding exon 1 (lowercase) is shown.
Putative binding sites for transcription factors are shown in
boldface. The transcription start site is indicated by
+1. The translational start codon is underlined
and in boldface. DNA sequences demonstrated to bind proteins
(sites A and B) are underlined.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
Promoter activity of TGH-luciferase gene
chimeras transiently transfected into murine primary hepatocytes.
A, localization of promoter fragments is shown, and putative
transcription factor consensus sites are indicated. Numbers
indicate the relative positions with respect to the start of
transcription. B, nested 5'-deletion promoter fragments were
cloned upstream of the luciferase coding region in pGL3Basic and
transiently transfected into murine primary hepatocytes. Luciferase
activity was normalized to equal amounts of protein. Data represent the
mean ± S.D. of three separate experiments, each performed in
triplicate.
|
|
The construct with the largest 5'-extension was -542Luc followed by
-313Luc. Transient transfection into primary murine hepatocytes revealed a reproducible reduction of luciferase activity (~50%) upon
deletion of the sequence spanning -154 to -117 (Fig. 3B), suggesting that positive control elements reside in this segment. Others have observed that reporter constructs containing this conserved
Sp consensus sequence from orthologous rat and human TGH promoters
activate transcription, whereas their elimination reduces promoter
activity (21, 22).
Interaction of Hepatic Nuclear Proteins with the Murine TGH
Promoter--
A genomic fragment containing the 5' proximal region of
the murine TGH gene (-542 to +112 of exon 1) was cut by restriction enzyme digestion to yield three smaller nonoverlapping fragments designated as the distal (-542 to -371), medial (-370 to -65), and
proximal (-64 to +112) promoter regions. Each of these promoter regions was evaluated for their ability to bind proteins from nuclear
extracts prepared from 7- and 27-day-old mice in an EMSA (Fig.
4). The medial promoter region exhibited
enhanced protein binding with nuclear extracts prepared from 27-day-old
compared with 7-day-old murine liver, yielding three major
differentially migrating protein-DNA complexes, C1, C2, and C3. Similar
migrating complexes with the medial promoter region and nuclear extract from 7-day-old mice were also visible, albeit with considerably longer
exposure times or with increased nuclear protein in the binding assay
(not shown). Although longer exposure times or increased nuclear
protein in the binding assay also revealed weak protein-DNA complexes
with distal and proximal promoter regions (not shown), identical
migration profiles were observed with nuclear extracts from 7- and
27-day-old murine livers for each of these regions.

View larger version (112K):
[in this window]
[in a new window]
|
Fig. 4.
Binding of nuclear extracts to TGH DNA
(-542/+112) by EMSA. Liver nuclear extracts were prepared
from 7- and 27-day-old mice (d7 and d27,
respectively) and used in binding assays with each of three
32P-labeled promoter fragments: distal (-542/-371),
medial (-370/-68), and proximal (-67/+112). Protein-DNA complexes
were resolved by 3.5% nondenaturing polyacrylamide gel electrophoresis
with Tris borate-EDTA buffer and were detected by autoradiography.
These results are representative of five independent experiments, each
using freshly isolated nuclear extracts.
|
|
DNase I Footprinting of the Medial Promoter Region of the Murine
TGH Gene--
To identify the cis-elements within the
medial promoter region that bind hepatic nuclear proteins, the medial
promoter region was subjected to DNase I footprint analysis (Fig.
5A). Two protected regions
within the medial promoter were observed using nuclear extracts from
27-day-old murine livers. Footprint 1 extends from -156 to -138 (site
A), and footprint 2 extends from -125 to -108 (site B). Sequence
alignment of the 5'-proximal promoters of the murine, human, and rat
TGH genes demonstrates that the protected regions corresponding to
sites A and B have been evolutionarily conserved (Fig. 5B).
Furthermore, DNase I footprinting of the human TGH proximal promoter
using nuclear extracts derived from adult murine liver and HeLa cells
also resulted in protection of the conserved site A (not shown). Thus,
the nuclear proteins that bind to this sequence may have an important
functional role in TGH expression along phylogenic lines.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
DNase I footprint analysis of the medial
(-370/-68) fragment of the murine TGH promoter.
A, nuclear proteins (0, 10, 20, and 50 µg) from the livers
of 27-day-old mice were incubated with single-end labeled medial
fragment of the murine TGH promoter. DNase footprint analysis was
performed. Sequencing reactions (A/G and C/T) were performed using a
DNA sequencing kit (Sigma, Seq-1) in parallel. Labeled DNA fragments
were resolved on a 5% polyacrylamide, 7 M urea sequencing
gel and observed by autoradiography. Nuclear proteins enhanced the
footprint of a GC-rich element -156 to -138 (site A) and
-125 to -108 (site B) in a dose-dependent
fashion. These results are representative of three individual
experiments, each using freshly isolated nuclear extracts.
B, alignment of protected murine TGH sites A and B with rat
and human TGH promoters.
|
|
The Transcription Factors Sp1 and Sp3 Bind to the Murine TGH
Promoter--
Comparison of the DNA sequences for site A with a data
base of transcription factor binding sites (23) revealed that this site
contains a canonical binding site for Sp1, a ubiquitously expressed
transcription factor required for the constitutive and inducible
expression of multiple genes (26). The Sp1 gene family includes at
least four distinct but closely related proteins, Sp1, Sp2, Sp3, and
Sp4, all of which recognize GC boxes with similar specificity and
affinity (26). To establish the identity of the protein(s) binding to
the medial promoter region of the TGH gene, we performed supershift
assays with antibodies specific for individual Sp proteins (Fig.
6). Antibodies specific for Sp1 were
added to an EMSA reaction with the 32P-labeled TGH medial
promoter fragment and nuclear extract from 27-day-old murine liver. The
mobility of the C2 complex was retarded so that the supershifted C2
complex co-migrated with the C1 complex. These results indicate the
presence of Sp1 in the C2 complex. The addition of antibodies specific
for Sp3 did not result in supershifted complexes but rather prevented
the formation of both C1 and C3 complexes. The anti-Sp3 antibody used
in this study is not directed against the DNA binding domain of Sp3 and
therefore is not expected to disrupt direct Sp3-DNA interactions. Sp3
may indirectly promote protein binding to the medial fragment, perhaps via protein-protein interactions, yielding the C1 and C3 complexes. Antibodies against Sp2 did not alter the mobility or formation of any
of the three complexes. Sp4 expression in the mouse is limited to the
brain (27) and therefore is not a candidate protein for binding to the
murine TGH promoter in the liver.

View larger version (91K):
[in this window]
[in a new window]
|
Fig. 6.
Supershift analysis of protein binding to the
TGH promoter using EMSA. Hepatic nuclear extracts were prepared
from 7- and 27-day-old mice (day 7 and day 27, respectively) and used in binding assays with the
32P-labeled medial (-370/-68) promoter fragment with (+)
or without (-) antibodies against Sp1 (anti-Sp1), Sp2
(anti-Sp2), or Sp3 (anti-Sp3). Protein-DNA
complexes and supershifted complexes were resolved by 3.5%
nondenaturing polyacrylamide gel electrophoresis with Tris borate-EDTA
buffer and were detected by autoradiography. Three differentially
migrating complexes, C1, C2 and C3, are indicated by
arrowheads. These results are representative of five
independent experiments, each using freshly isolated nuclear
extracts.
|
|
It is likely that C1, C2, and C3 complexes arise from protein binding
at sites A and B because each of these sites was protected from DNase I
digestion by binding to protein (Fig. 5). In an attempt to assign the
cis-element(s) responsible for protein binding in each of
the three complexes, double-stranded oligonucleotides corresponding to
sites A and B were synthesized and evaluated in EMSAs for their
abilities to compete with the medial fragment for protein binding (Fig.
7A). A 50-fold molar excess of
unlabeled double-stranded oligonucleotides corresponding to site A
resulted in abrogation of all three complexes, as did unlabeled Sp
consensus oligonucleotides, which contain a canonical Sp1 site (28). On the other hand, a double-stranded oligonucleotide corresponding to site
B did not compete with any of the proteins that bind to the medial
promoter fragment. Two implications arise from these results. First, Sp
nuclear proteins likely bind to site A. Second, binding of protein to
site B requires Sp binding at site A.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 7.
Analysis of protein-DNA interactions at sites
A and B using competitive EMSAs. A, band shift assays
were performed with hepatic nuclear extracts from 27-day-old mice using
the medial (-370/-68) promoter fragment as a probe. Unlabeled
oligonucleotides, derived from TGH sites A and B and Sp consensus
oligonucleotides, were added to the binding assays as competitors.
Results are representative of five independent experiments, each using
freshly isolated nuclear extracts. B, EMSAs were performed
with liver nuclear extracts from 7- and 27-day-old mice.
Oligonucleotides derived from TGH sites A and B and Sp consensus
oligonucleotides were used as probes. These results are representative
of five different experiments each with freshly isolated nuclear
extracts. C, EMSAs were carried out with liver nuclear
extracts from 27-day-old mice with site A (-156 to -138)
oligonucleotide as probe. Extracts were treated with calf intestine
alkaline phosphatase (CIAP), with phosphatase and
phosphatase inhibitors (CIAP + Pase Inh), or with antibodies
against Sp1 (anti Sp1) or Sp3 (anti Sp3).
s, slower migrating complex; f, faster migrating
complex. These results are representative of three independent
experiments, each using freshly isolated nuclear extracts.
|
|
Binding of sites A and B to nuclear proteins from murine liver was
examined directly. As shown in Fig. 7B, labeled site A double-stranded oligonucleotides formed only weak protein-DNA complexes
with nuclear proteins from 7-day-old murine liver, whereas equivalent
amounts of nuclear proteins from 27-day-old murine liver resulted in
enhanced binding to site A, reminiscent of that seen with the medial
fragment but yielding two distinct band shifts (s and f) rather than
three. Both site A and Sp consensus double-stranded oligonucleotides
bound nuclear proteins from 27-day-old murine liver more readily than
with equivalent protein from 7-day-old murine liver. In addition, both
site A and the Sp oligonucleotides bound nuclear proteins, resulting in
the same number of band shifts with similar mobilities. These
observations suggest that similar Sp proteins bind site A and the Sp
consensus oligonucleotides. The supershift assay with labeled medial
fragment (Fig. 6) supports a role for binding of Sp1 and Sp3 to site A. Furthermore, the nuclear protein(s) responsible for the observed band
shifts may be limiting in the livers of 7-day-old mice.
A double-stranded oligonucleotide corresponding to site B did not bind
nuclear protein (Fig. 7B). This finding is consistent with
the observation that a 50-fold molar excess of unlabeled site B
oligonucleotide failed to compete with the medial fragment of the TGH
promoter for binding nuclear protein (Fig. 7A). Protection of site B is likely the consequence of direct protein binding because
binding of nuclear protein to site A yields differentially migrating
complexes that account for two out of the three protein-DNA complexes
seen with the medial promoter. However, the possibility that DNase I
protection of site B resulted from altered secondary structure of DNA
induced by protein binding at the adjacent site A cannot be discounted.
Supershift assays shown above demonstrate that both Sp1 and Sp3 nuclear
proteins are involved in binding to the medial fragment of the murine
TGH promoter (Fig. 6). Similar supershift assays were performed to
demonstrate specific interaction with site A (Fig. 7C). The
addition of an antibody specific for Sp1 in an EMSA reaction with
32P-labeled site A double-stranded oligonucleotide and
nuclear extract from 27-day-old murine liver supershifted only a
fraction of the slower migrating complex. However, this complex was
completely supershifted by including 10-fold more anti-Sp1 into the
supershift assay (not shown). Addition of an antibody specific for Sp3
supershifted the faster migrating complex. Identical supershift
profiles were obtained with labeled Sp consensus oligonucleotides (not
shown), consistent with the band shifts observed by direct Sp1 and Sp3 binding in other studies (26). Taken together, these data suggest that
both Sp1 and Sp3 are capable of binding to the site A element.
Immunoblot Analysis of Candidate Transcription Factors That Bind to
Site A and Site B of the Murine TGH Promoter--
One mechanism that
might confer increased binding of nuclear transcription factors to site
A of the murine TGH promoter at the time of weaning is increased
hepatic expression of Sp1 and/or Sp3. We examined the levels of Sp1 and
Sp3 protein by immunoblot analysis of nuclear extracts isolated from
the livers of 7- and 27-day-old mice. As shown in Fig.
8A, low molecular weight
proteins were detected with anti-Sp1 antibody in both nuclear extracts. The amount of proteins that specifically cross-reacted with the anti-Sp
antibodies was diminished when a peptide against which the antibody was
raised was included in the incubation. The proteolysis of Sp1 appeared
to be specific because the same nuclear extracts contained
immunoreactive Sp3 having only those molecular weights that would be
expected to arise from alternate translational start sites.
Interestingly, we observed proteolysis of Sp1, but not of Sp3, in
nuclear extracts obtained from brain, heart, kidney, and spleen (not
shown). Nuclear extracts from livers of 7- and 27-day-old mice
contained full-length Sp1 and smaller polypeptide bands with similar
profiles and abundance. The levels of Sp3 were also similar in both
nuclear extracts. The differences between the levels of Sp1 and Sp3 in
day 7 and day 27 hepatic nuclear extracts were not an artifact of the
nuclear extract preparation because the levels of the nuclear protein
YY1, a ubiquitously expressed transcription factor that interacts with
a number of key regulatory proteins (e.g.
TATA-binding protein and Sp1) were not affected (29). Therefore,
it is not likely that enhanced binding of these two factors at day 27 is due to alteration in the abundance of Sp1 and Sp3.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 8.
Immunoblot analysis of Sp1, Sp3, and E47
proteins in hepatic nuclear extracts. Hepatic nuclear proteins (10 µg) were isolated from 7- and 27-day-old mice, resolved by 12%
SDS-polyacrylamide gels, electroblotted onto nitrocellulose membranes,
reacted with anti-Sp1 (A, left panel), stripped, and then
reprobed with anti-Sp3 (A, right panel). In each case, HeLa
cell nuclear extracts (Promega) were loaded as a positive control.
Parallel primary antibody incubations contained corresponding peptides
as negative controls (+/- peptide, as indicated). These
results are representative of at least three independent experiments,
each using freshly isolated nuclear extracts. The arrows
indicate normal migration of Sp1 or Sp3. The asterisks
indicate proteolytic products of Sp1. B, immunoblots for
E47. Membranes shown in A and B were stripped and
reprobed for YY1 to control for protein loading. These results are
representative of three independent experiments, each using freshly
isolated nuclear extracts.
|
|
Altered levels of phosphorylation of Sp1 result in changed DNA binding
activity (30-34). Because the levels of Sp1 and Sp3 in the liver were
found to be similar at days 7 and 27, we considered the possibility
that phosphorylation modulates binding of these factors to the TGH
promoter. Fig. 7C shows that nuclear extracts that had been
dephosphorylated with calf intestinal alkaline phosphatase exhibit
reduced binding of both Sp1 and Sp3 to site A, indicating a role for
phosphorylation in the binding of Sp proteins to the TGH promoter.
Comparison of the DNA sequences for site B with a data base of
transcription factor binding sites (23) revealed that this site
contains a degenerate E box with the expected half-sites for E47 and
Th1. E47 is a widely expressed member of the E family of basic
helix-loop-helix (bHLH) proteins. These factors play important roles in
differentiation processes as diverse as skeletal myogenesis,
neurogenesis, and hematopoiesis and function as either homodimers or
heterodimers with other classes of bHLH proteins to modulate gene
expression. For example, Myo D (a muscle-specific bHLH protein)
partners with E proteins, and the heterodimers bind avidly to consensus
(CANNTG) E box motifs that are functionally important elements in the
upstream regulatory sequences of many muscle-specific terminal
differentiation genes. Th1 was identified as a member of a family of
bHLH transcription factors using a modified two-hybrid screen of a
murine embryo cDNA library with the Drosophila E protein
daughterless, a Drosophila counterpart of mammalian E
proteins with specificity very similar to that of E47 (16).
Interestingly, like TGH, Th1 has a developmentally regulated expression
pattern that is both stage- and tissue-specific; Th1 mRNA is
expressed in the heart and certain neural crest derivatives during
embryogenesis and in adult tissue expression is specific to gut and
liver (16). We hypothesized that during the suckling period, a lack of
E47 and Th1 might account for the decreased binding of nuclear factors
to the B site of the TGH promoter and perhaps for the decreased
expression of TGH.
As shown in Fig. 8B, E47 is increased in hepatic nuclear
extracts derived from 27-day-old mice. This increase is not due to the
amount of protein loaded because the nuclear levels of YY1 were similar
at day 7 and day 27. However, we could not demonstrate an interaction
of E47 with the medial promoter by immunodepletion of nuclear extracts
or supershift assays (not shown), suggesting that E47 does not interact
with site B as a heterodimer with ThI. The possibilities that Th1
interacts with site B as a monomer or as a homodimer cannot be
eliminated
Transactivation of the Murine TGH Promoter in Drosophila Schneider
S2 Cells--
Previous reports have documented that Sp1 and Sp3 can
interact with each other and, in cooperation with other nuclear
transcription factors, either synergize or antagonize each other's
activity at any given DNA binding site (26). Because Sp1 binds to site A and Sp3 is involved in protein binding at site B, we next determined whether or not there was a functional interaction between Sp1 or Sp3
with ThI, a potential candidate for binding to site B. For this
purpose, expression plasmids for each of these nuclear transcription
factors were co-transfected into SL2 cells, and the activity of
(-154)Luc was monitored (Fig. 9).
Co-expression of Sp1 expression plasmid resulted in a 10-fold increase
in luciferase activity (p < 0.005), indicating that
Sp1 is a potent activator of the TGH promoter. By contrast,
co-expression of the luciferase construct with the Sp3 expression
plasmid had neither a stimulatory nor an inhibitory effect on
trans-activation. Co-expression of the luciferase construct with
equivalent amounts of both Sp1 and Sp3 expression vectors (not shown)
did not affect Sp1-stimulated promoter activity, indicating that Sp3
does not compete with Sp1 for site A. It is noteworthy that this lack
of trans-activation potential of Sp3 is not due to lack of expression
of Sp3, as determined by immunoblot analysis (not shown). Transfection
of Th1 expression plasmid did not by itself affect promoter activity
but, when co-transfected, attenuated Sp1-stimulated promoter activity
(p < 0.005) and positively cooperated with Sp3 to
trans-activate the promoter above basal activity, albeit modestly
(p < 0.05) (Fig. 9).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 9.
Transactivation assays of -154Luc
in Drosophila Schneider cells co-transfected with Sp1,
Sp3, and/or ThiI. -154Luc (5 µg) and the indicated plasmid
constructs (5 µg of each) were co-transfected into
Drosophila Schneider SL2 cells, and luciferase activity was
measured. Luciferase-specific activity in cell homogenates was
normalized for transfection efficiency monitored by co-transfection of
a plasmid (5 µg) expressing GFP and counting the number of cells
expressing GFP relative to total number of cells as determined by flow
cytometry. All transfections were performed with 20 µg of plasmid
DNA, and in all cases, control plasmids were included. Data represent
the mean ± S.E. of three independent experiments, each performed
in duplicate. Statistical analysis was performed using a one-way
analysis of variance test followed by a post hoc
Student-Newman-Keuls test. Values for p less than 0.05 were
taken to be significant. *, p < 0.005 compared with
-156Luc; **, p < 0.005 compared with pPacSp1;
#, p < 0.05 compared with pPacSp3.
|
|
 |
DISCUSSION |
Enhanced Interaction of Hepatic Nuclear Proteins from Weaned Mice
with a Putative Sp Binding Site and a Degenerate E Box Motif Within the
Murine TGH Proximal Promoter--
Marked changes in energy metabolism
occur during the transition from fetal to postnatal life and throughout
the weaning period. The lipoprotein profile of rats is not completely
developed until about 4 weeks after birth, corresponding to the onset
of weaning (35). In addition, rat hepatocytes from fetal and suckling
rats secrete substantially lower quantities of TG and apoB than do hepatocytes from adult rats (36). In this study, we have demonstrated that TGH mRNA expression is induced in murine liver at the time of
weaning (see Fig. 1B). Nuclear run-on analysis (Fig.
1C) revealed that this up-regulation occurs mainly at the
level of transcription. Because apoB mRNA is as abundant in 18-day
fetal liver as at any subsequent period of hepatic development (37), we
postulated that the developmental increase in TGH expression may be a
necessary event in the ontogeny of VLDL assembly/secretion. Hence, we
investigated the regulation of TGH expression by analyzing
cis-regulatory elements in the TGH promoter and their
corresponding transcription factors. These analyses revealed the
formation of three specific complexes with a fragment (-370 to -65)
of the TGH promoter that were enhanced in nuclear extracts prepared
from murine adult liver. DNase I footprinting experiments localized
these complexes to two adjacent, yet distinct, cis-elements;
a putative Sp binding site and a site containing a degenerate E box
with putative half-sites for E47 and ThI.
Sp1 and Sp3 Interact with the Murine TGH Proximal
Promoter--
The TGH proximal promoter lacks a TATA motif. In the
absence of a TATA box, mechanisms other than direct recruitment of
TATA-binding proteins have been implicated in initiating formation of
the basal transcription complex. In general, GC-rich promoters are
usually considered to be a target for regulation by zinc finger
transcription factors, and TATA-less promoters have been shown to be
particularly sensitive to regulation by the Sp family of proteins
(38-40). Sp1, originally identified as a cellular transcription factor
necessary for SV40 gene expression, is a ubiquitous nuclear protein
that activates the transcription of a wide variety of cell
type-specific genes, including the myeloid-specific integrin gene
CD11
(41), the monocytic-specific gene CD14 (42), the liver-specific
gene encoding
1 acid glycoprotein (43), and the
2 integrin gene (44). Further DNA binding studies identified a family of zinc-finger (His2-Cys2) transcription factors that includes
Sp1, Sp2, Sp3, Sp4, and two distantly related proteins termed basic
transcription element binding (BTEB) and BTEB2 (26). These new members
of the Sp family recognize GC boxes with specificities and affinities that are similar to those for Sp1. The apparent independence of members
of the Sp family from requiring the classic binding proteins to
activate transcription, together with the abilities of Sp factors to
associate with individual components of the basal transcriptional machinery, suggests that the Sp family of transcription factors regulate TATA-less promoters by by-passing selective steps in assembly
of the core transcription machinery. The predilection of the Sp family
of transcription factors to regulate TATA-less promoters is also
evident in the case of the TGH promoter. Results of the deletional
analysis indicate that the sequence between -156 and -117 of this
promoter contains positive regulatory cis-elements. DNase I
footprint analysis and computer assisted analysis of the intervening
sequence revealed the presence of a canonical binding site for the Sp
family of proteins. EMSA experiments established that the Sp consensus
element, which we termed site A, preferentially bound Sp1 and Sp3 from
liver nuclear extracts obtained from adult, weaned mice rather than
from suckling mice. In addition, three specific protein-DNA complexes
were formed with a fragment spanning -373 to -65 of the TGH promoter.
Whereas we were able to determine that Sp1 protein was present in one
of these protein-DNA complexes (C2), the identity of the proteins in
the fastest and slowest migrating (C3) complexes remains unknown.
However, the observation that an antibody against Sp3 prevented
formation of C1 and C3 rather than supershifting them implies an
indirect role for Sp3 in stabilizing the C1 and C3 protein-DNA
complexes, perhaps by protein-protein interactions. The results of the
competition experiments with Sp consensus sequence oligonucleotides
suggest that the DNA binding specificity of the protein(s) in the C1
and C3 complexes is similar to that of the Sp family of proteins. BTEB
is a protein of smaller size than Sp1 with DNA binding specificity
similar to that of Sp1. Thus, BTEB or a related protein is a candidate for the protein involved in the formation of the C1 and C3 complexes. The precise role of the proteins involved in formation of these complexes awaits the identification of these proteins.
Evidence That Phosphorylation Modulates Sp Binding to the Murine
TGH Proximal Promoter--
Although Sp1 is ubiquitously expressed,
recent evidence suggests that Sp1 expression (45), binding affinity
(46), and posttranscriptional modifications (47, 48) might be modulated to confer tissue-specific and developmental regulation of target genes
(49). Using immunoblot analysis, we have demonstrated that the levels
of Sp1 and Sp3 in liver nuclear extracts from 7- and 27-day-old mice
are the same and therefore increased amounts of these proteins do not
account for the increased binding to the TGH promoter. Several studies
have implicated a role for phosphorylation of Sp proteins in modulating
both their DNA binding activity and trans-activation potential. For
example, phosphorylation of Sp1 by DNA-dependent protein
kinase is induced by Sp1 binding to HIV-1 Tat protein in
vitro and phosphorylation of Sp1 by this kinase has been
correlated with changes in Sp1-directed transcription in
vivo (30). Other reports suggest that Sp1 is an in vivo
target for phosphorylation by protein kinase A, leading to increased DNA binding and transcription activity of some cAMP-responsive genes
(31, 32). In renal carcinoma cells, Sp1 physically interacts with
protein kinase C
and co-expression of Sp1 with protein kinase C
increases Sp1-mediated transcription. A dominant-negative protein kinase C
mutant has been shown to interact with Sp1 but Sp1-mediated transcriptional activity was not increased (33). Induction of the rat
ornithine decarboxylase gene by serum requires promoter regions that
contain multiple Sp1 binding sites and serum stimulation activated Sp1
binding activity 3-12-fold in a rat fibroblast cell line, without an
increase in the quantity of Sp1 protein. Treatment of the extracts with
potato acid phosphatase drastically reduced the induction of DNA
binding activity suggesting that phosphorylation of Sp1 is necessary
for increased DNA binding in response to serum stimulation (34). In
this study, we provide evidence suggesting that Sp binding to the TGH
promoter at the time of weaning is modulated by phosphorylation,
because treatment of nuclear extracts with calf intestinal alkaline
phosphatase abrogated binding to the site A element as well as
formation of the C1, C2, and C3 complexes with the medial fragment of
the TGH promoter.
Sp1 Is a Potent Activator of the Murine TGH Promoter in SL2
Cells--
In general, Sp1 functions as a transcriptional activator.
By contrast, Sp3 is a bifunctional protein with independent domains that can both activate and repress transcription. The predominant function of Sp3 depends upon both the promoter and the cellular milieu
(50). Our results indicate that there is a differential sensitivity of
the TGH promoter to these two proteins, with Sp1 being a potent
activator and Sp3 having no effect on reporter activity in SL2 cells.
From our EMSA studies, it is clear that Sp3 can bind to the site A
element when presented outside of the context of the TGH promoter.
However, we could not demonstrate a direct interaction of Sp3 with the
medial fragment of the TGH promoter; rather, we found an
indirect role for Sp3 in the binding of nuclear proteins to the TGH
promoter. It is possible that the SL2 cell line lacks the endogenous
proteins required for mediating an indirect Sp3-induced
trans-activation or trans-repression of the TGH promoter.
Evidence for an Indirect Interaction of Sp3 with the Murine TGH
Promoter--
TGH gene expression displays a distinct ontogenic
pattern, with expression being minimal after birth and throughout the
suckling period but increasing significantly at the time of weaning.
The paucity of TGH during the suckling period correlates with the inability of mice to secrete significant levels of VLDLs until the time
of weaning. The DNase I footprint analysis of the medial promoter
fragment revealed two cis-elements within the medial fragment of the TGH promoter that bind nuclear proteins from livers obtained from weaned animals. This study revealed that one of these
cis-elements, site A, binds Sp1 yielding the C1 complex. We
also show that Sp1 acts as a potent activator of TGH promoter activity
in SL2 cells. It is likely that binding of protein to site B is
responsible for the C1 and C3 complex. Furthermore, binding of protein
at this site may indirectly require Sp3 because both an antibody to Sp3
and an Sp consensus oligonucleotide prevents C1 and C3 complex
formation. Studies have revealed that three Sp3 variants of molecular
sizes 115, 80, and 78 kDa are abundantly expressed in a broad range of
tissues (51), and we show by immunoblot analysis that these variants
are present in the liver nuclear extracts used. The involvement of any
two of these Sp3 variants with a protein(s) that interacts at site B
could give rise to the two differentially migrating protein-DNA
complexes, namely C1 and C3.
Th1 Modulates Sp-induced TGH Promoter Activity in SL2
Cells--
Computer-assisted analysis of site B indicates that this
site contains a degenerate E box with putative half-sites for E47 and
Th1 transcription factors. Although the expression of both of these
proteins is increased in adult liver, heterodimerization of Th1 with
E47 at site B is unlikely because an antibody against E47 did not
affect the migration of the C1, C2, or C3 complexes. Our
trans-activation studies in SL2 cells demonstrate only a minor role for
Th1 in modulating Sp-induced promoter activity. However, we cannot
eliminate the possibility that SL2 cells contain endogenous proteins
that could compete with Th1 for binding to site B.
In summary, we have identified and partially characterized the
promoter-regulatory region controlling expression of the transcript of
the murine TGH gene. Our studies establish that the 5'-flanking region
of the murine TGH gene exhibits promoter activity. We identified and
characterized a positive cis-regulatory element in the TGH promoter that interacts with Sp1. We also defined an adjacent second
cis-element in the TGH promoter capable of binding nuclear proteins from adult murine liver. Although we are uncertain which transcription factor(s) binds this element, we suggest that binding of
protein to this element is modulated by Sp3. A role for Sp1 and Sp3 in
the ontogenic profile of TGH gene expression in the liver is suggested
by the interactions of these proteins with the TGH promoter.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. Kristin Waite for
helpful discussions during the course of these experiments and Dr. Jean
Vance for comments on the manuscript. We thank Dorothy Rutckowska for
assistance with flow cytometry.
 |
FOOTNOTES |
*
This work was supported by a grant from the Canadian
Institutes of Health Research and a contract from Glaxo Smith Kline.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Recipient of studentships from the Alberta Heritage Foundation for
Medical Research and the Canadian Institutes of Health Research.
**
Scholar of the Alberta Heritage Foundation for Medical Research.

Medical Scientist of the Alberta Heritage Foundation for
Medical Research. To whom correspondence should be addressed: Dept. of
Biochemistry, University of Alberta, 328 Heritage Medical Research Center, Edmonton, Alberta T6G 2S2, Canada. Tel.: 780-492-8286; Fax:
780-492-3383; E-mail: dennis.vance@ualberta.ca.
Published, JBC Papers in Press, May 3, 2001, DOI 10.1074/jbc.M103874200
 |
ABBREVIATIONS |
The abbreviations used are:
TG, triacylglycerol;
BTEB, basic transcription element binding;
EMSA, electrophoretic
mobility shift assay;
GFP, green fluorescent protein;
bHLH, basic
helix-loop-helix;
TGH, triacylglycerol hydrolase;
VLDL, very low
density lipoprotein;
RT, reverse transcription;
PCR, polymerase
chain reaction;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase;
rNTP, ribonucleoside triphosphate.
 |
REFERENCES |
| 1.
|
Satoh, T.,
and Hosakawa, M.
(1998)
Annu. Rev. Pharmacol. Toxicol.
38,
256-288
|
| 2.
|
Peters, J.,
and Nash, H. R.
(1978)
Biochem. Genet.
16,
553-568
|
| 3.
|
Alexson, S. E.,
Finlay, T. H.,
Hellman, U.,
Svensson, L. T.,
Diczfalusy, U.,
and Eggertsen, G.
(1994)
J. Biol. Chem.
269,
17118-17124
|
| 4.
|
Ghosh, S.,
Mallonee, D. H.,
Hylemon, P. B.,
and Grogan, W. M.
(1995)
Biochim. Biophys. Acta
1259,
305-312
|
| 5.
|
Lehner, R.,
and Verger, R.
(1997)
Biochemistry
36,
1861-1868
|
| 6.
|
Gibbons, G. F.,
Islam, K.,
and Pease, R. J.
(2000)
Biochim. Biophys. Acta
1483,
37-35
|
| 7.
|
Wiggins, D.,
and Gibbons, G. F.
(1992)
Biochem. J.
284,
457-562
|
| 8.
|
Yang, L.-Y.,
Kuksis, A.,
Myher, J. J.,
and Steiner, G.
(1995)
J. Lipid Res.
36,
125-136
|
| 9.
|
Lehner, R.,
Cui, Z.,
and Vance, D. E.
(1999)
Biochem. J.
338,
761-768
|
| 10.
|
Lehner, R.,
and Vance, D. E.
(1999)
Biochem. J.
343,
1-10
|
| 11.
|
Rolfe, F. G.,
and Sewell, W. A.
(1997)
J. Immunol. Met.
202,
143-151
|
| 12.
|
Marzluff, W. F.,
and Huang, R. C. C.
(1985)
in
Transcription and Translation: A Practical Approach
(Hames, B. D.
, and Higgins, S. J., eds)
, pp. 89-129, IRL Press, Oxford
|
| 13.
| Dolinsky, V. W., Sipione, S., Lehner, R., and Vance, D. E. (2001) Biochim. Biophys. Acta, in press
|
| 14.
|
Courey, A. J.,
and Tjian, R.
(1988)
Cell
55,
887-898
|
| 15.
|
Noti, J. D.
(1997)
J. Biol. Chem.
272,
24038-24045
|
| 16.
|
Hollenberg, S. M.,
Sternglanz, R.,
Cheng, P. F.,
and Weintraub, H.
(1995)
Mol. Cell. Biol.
15,
3813-3822
|
| 17.
|
Bratke, J.,
Kietzmann, T.,
and Jungermann, K.
(1999)
Biochem. J.
339,
563-569
|
| 18.
|
DiNocera, P. P.,
and Dawid, I. B.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
7095-7098
|
| 19.
|
Deryckere, F.,
and Gannon, F.
(1994)
BioTechniques
3,
405
|
| 20.
|
Eperon, I. P.,
and Krainer, A. R.
(1994)
in
RNA Processing: A Practical Approach
(Higgins, S. J.
, and Hames, B. D., eds), Vol. 1
, pp. 57-101, IRL Press, Oxford
|
| 21.
|
Nataranjan, R.,
Ghosh, S.,
and Grogan, W. M.
(1998)
Biochem. Biophys. Res. Commun.
243,
349-355
|
| 22.
|
Langmann, T.,
Becker, A.,
Aslanidis, C.,
Notka, F.,
Ullrich, H.,
Schwer, H.,
and Schmitz, G.
(1997)
Biochim. Biophys. Acta
1350,
65-74
|
| 23.
|
Quandt, K.,
Frech, K.,
Karas, H.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
23,
4878-4884
|
| 24.
|
Natarajan, R.,
Ghosh, S.,
and Grogan, W. M.
(1999)
J. Lipid Res.
40,
2091-2098
|
| 25.
|
Ghosh, S.,
Natarajan, R.,
Pandak, W. M.,
Hylemon, P. B.,
and Grogan, W. M.
(1998)
Am. J. Physiol.
274,
G662-G668
|
| 26.
|
Lania, L.,
Majello, B.,
and de Luca, P.
(1997)
Int. J. Biochem. Cell Biol.
29,
1313-1323
|
| 27.
|
Hagen, G.,
Muller, S.,
Beato, G.,
and Suske, G.
(1992)
Nucleic Acids Res.
20,
5519-5525
|
| 28.
|
Kadonaga, J. T.,
Jones, K. A.,
and Tjian, R.
(1986)
Trends Biochem. Sci.
11,
20-23
|
| 29.
|
Shi, Y.,
Lee, J.-S.,
and Galvin, K. M.
(1997)
Biochim. Biophys. Acta
1332,
F49-F66
|
| 30.
|
Chun, R. F.,
Semmes, O. J.,
Neuveut, C.,
and Jeang, K. T.
(1998)
J. Virol.
72,
2615-2629
|
| 31.
|
Rohlff, C.,
Ahman, S.,
Borellini, F.,
Lei, J.,
and Glazer, R. I.
(1997)
J. Biol. Chem.
272,
21137-21141
|
| 32.
|
Ahlgren, R.,
Suske, G.,
Waterman, M. R.,
and Lund, J.
(1999)
J. Biol. Chem.
274,
19422-19428
|
| 33.
|
Pal, S.,
Claffey, K. P.,
Cohen, H. T.,
and Mukopadhyay, D.
(1998)
J. Biol. Chem.
273,
26277-26280
|
| 34.
|
Kumar, A. P.,
and Butler, A. P.
(1998)
Biochem. Biophys. Res. Commun.
252,
517-523
|
| 35.
|
Johansson, M. B.
(1983)
Biol. Neonate
44,
278-286
|
| 36.
|
Coleman, R. A.,
Haynes, E. B.,
Sand, T. M.,
and Davis, R. A.
(1988)
J. Lipid Res.
29,
33-42
|
| 37.
|
Demmer, L. A.,
Levin, M. S.,
Elovson, J.,
Reuben, M. A.,
Lusis, A. J.,
and Gordon, J. I.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
8102-8106
|
| 38.
|
Dynan, W. S.,
and Tjian, R.
(1983)
Cell
35,
79-87
|
| 39.
|
Anderson, B. M.,
and Freytag, S. O.
(1991)
Mol. Cell. Biol.
11,
19335-19343
|
| 40.
|
Spanopoulou, E.,
Giguere, V.,
and Grosveld, F.
(1991)
Mol. Cell. Biol.
11,
2216-2228
|
| 41.
|
Chen, H. M.,
Pahl, H. L.,
Scheibe, R. J.,
Zhang, D. E., |