|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 276, Issue 28, 25651-25653, July 13, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From
Received for publication, April 13, 2001, and in revised form, May 21, 2001
Elevated levels of the hormone resistin, which is
secreted by fat cells, are proposed to cause insulin resistance and to
serve as a link between obesity and type 2 diabetes. In this report we
show that resistin expression is significantly decreased in the white
adipose tissue of several different models of obesity including the
ob/ob, db/db, tub/tub, and KKAy mice compared
with their lean counterparts. Furthermore, in response to several
different classes of antidiabetic peroxisome proliferator-activated receptor Adipocytes secrete a number of molecules such as tumor necrosis
factor- Resistin expression was also shown to be regulated by glitazones, a
class of insulin-sensitizing drugs approved for the treatment of type 2 diabetes (5). Rosiglitazone and other glitazones lower glucose and
lipid levels in patients with type 2 diabetes by activating the nuclear
receptor peroxisome proliferator-activated receptor In this report, we have examined resistin expression in several
different rodent models of obesity and its regulation in response to
different classes of PPAR Experimental Animals and Protocols--
All procedures performed
were in compliance with the Animal Welfare Act, United States
Department of Agriculture regulations and approved by the
GlaxoSmithKline and Harvard University Institutional Animal Care and
Use Committee. Animals were housed at 72 °F and 50% relative
humidity with a 12-h light and dark cycle and fed chow diet (Formulab
Diet 5008; PMI Feeds Inc., Richmond, IN). Age (9 weeks)- and
glucose-matched male Zucker diabetic fatty rats (Genetic Models, Inc.,
Indianapolis, IN) were gavaged twice daily for 7 days with vehicle
(0.05 M N-methylglucamine), GW1929 (5.0 mg/kg),
or rosiglitazone (3.0 mg/kg). Glucose, triglycerides, and
non-esterified fatty acids were measured as described previously (8). Insulin-treated animals received a mixture of Humulin®N and
Humulin®R (Lilly) by subcutaneous injection and were sacrificed 6 h later. Genetically obese ob/ob mice were from a colony
maintained at Harvard; the db/db, tub/tub, and KKAy mice
were from Jackson Laboratories (Bar Harbor, ME). All mice were
maintained on standard rodent chow. MCC-555 (20 mg/kg) was administered
by daily gavage for 10 days. Rosiglitazone (5 mg/kg) and GW1929 (5 mg/kg) were administered by daily intraperitoneal injections. Ambient
blood samples were obtained in the beginning and at the end of the
treatment period, and tissues were collected for further analyses 4 h
after food withdrawal.
RNA Preparation and Northern Blot Analysis--
Total RNA from
epididymal white adipose tissue was prepared from ZDF rats, resolved on
agarose gels, and blotted as described previously (9). Filters were
prehybridized at 68 °C in Express-Hyb (CLONTECH
Laboratories, Inc., Palo Alto, CA) for 60 min, followed by
hybridization to specific 32P-labeled cDNA probes at a
concentration of 1 × 106 cpm/ml for 2 h at
68 °C. Filters were washed twice in 2× SSC/0.1% SDS for 20 min,
followed by a single wash for 20 min in 0.1× SSC/0.1% SDS at
60 °C. A rat resistin cDNA clone was isolated from rat adipose
tissue RNA by reverse transcriptase PCR using nucleotide sequence
reported by Kim et al. (6). PCR oligonucleotide sequences used were as follows: coding strand, CTGAGCTCTCTGCCACGTACT;
non-coding strand, GCTCAGTTCTCAATCAACCGTCC. The cDNA was
subcloned into pUC18 (Amersham Pharmacia Biotech), sequenced to
confirm its identity, and used in Northern blot analysis. Image
analyses and quantitation from the phosphor screen were performed with
a Storm optical scanner using the ImageQuant software package
(Molecular Dynamics Inc., Sunnyvale, CA). Mouse resistin cDNA was
cloned by reverse transcriptase PCR based on the published sequence,
cloned and sequenced to confirm its identity, and used in Northern blot
analysis as described (10).
Resistin Expression in Obese Mice--
Because resistin is
identified as a gene negatively regulated by the insulin-sensitizing
drug rosiglitazone, and its protein level is increased in the
circulation of ob/ob and db/db mice relative to wild type controls (5),
it is reasonable to postulate that its expression in adipose tissue
would also be increased in obesity. To address this, we examined
resistin mRNA expression in several different genetic models of
obesity/diabetes including the ob/ob, db/db, tub/tub, and
KKAy mice compared with their age-matched lean littermates.
Northern blot analysis under high stringency conditions revealed a
single, 0.8-kilobase pair resistin mRNA as reported
previously (Fig. 1) (5). The resistin
mRNA was readily detectable in the adipose tissue of all lean mice
(Fig. 1). Unexpectedly, resistin levels were severely decreased in the
epididymal WAT of all models of obese mice relative to lean controls
(Fig. 1). This suppression was most dramatic in the tub/tub (35-fold)
and KKAy (50-fold) mice and was also very substantial in
the ob/ob (20-fold) and db/db (15-fold) animals. A similar suppression
in adipose tissue resistin mRNA expression was also observed in
mice with diet-induced obesity (data not shown). Thus, obesity
correlated with severely decreased WAT expression of resistin in these
mouse models.
Resistin Expression Is Stimulated by PPAR
We next examined the regulation of resistin in the WAT of ZDF rats
treated with either rosiglitazone or GW1929. Treatment with
rosiglitazone or GW1929 resulted in 46 and 74% decreases in glucose
levels, respectively, relative to vehicle-treated animals (data not
shown). Northern blot analysis with a resistin-specific probe revealed
two transcripts ~0.8 and 1.4 kilobase pairs in length (Fig.
3A). These transcripts are the
same size as those reported previously for rat resistin (6). Similar
to the ob/ob mice, Northern blot analysis revealed that
rosiglitazone or GW1929 treatment resulted in an increase in resistin
expression in WAT of ZDF rats (Fig. 3, A and B).
In agreement with a previous report (6), resistin expression was also
induced by insulin treatment (Fig. 3A). Thus both insulin
itself and insulin sensitizers stimulate the expression of resistin in
WAT.
Resistin has been proposed to serve as a link between obesity and
diabetes, with elevated levels of resistin promoting insulin resistance
(5). Moreover, PPAR *
This work was supported in part by Grant DK52539 from the
National Institutes of Health (to G. S. H.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Contributed equally.
Published, JBC Papers in Press, May 23, 2001, DOI 10.1074/jbc.C100189200
The abbreviations used are:
PPAR
ACCELERATED PUBLICATION
Adipose Tissue Resistin Expression Is Severely Suppressed
in Obesity and Stimulated by Peroxisome Proliferator-activated
Receptor 
Agonists*
§,,,,,, and
GlaxoSmithKline Research and Development,
Research Triangle Park, North Carolina 27709 and ¶ Division of
Biological Sciences and Department of Nutrition, Harvard School of
Public Health, Boston, Massachusetts 02115
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
agonists, adipose tissue resistin expression is
increased in both ob/ob mice and Zucker diabetic fatty rats. These data demonstrate that experimental obesity in rodents is associated with
severely defective resistin expression, and decreases in resistin
expression are not required for the antidiabetic actions of
peroxisome proliferator-activated receptor agonists.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
, leptin, and free fatty acids that can influence the ability
of the body to respond to insulin and metabolize glucose (1-4).
Recently, a novel 12.5-kDa cysteine-rich protein, termed resistin, was
shown to be secreted by adipocytes (5). Resistin expression was
markedly induced during the conversion of 3T3-L1 cells to mature
adipocytes (5, 6). Administration of resistin to wild type mice
impaired glucose tolerance and insulin action, and resistin levels were
reported to be increased in genetic and diet-induced forms of obesity
(5). When an antibody against resistin was administered to obese mice,
an increase in systemic insulin sensitivity was noted (5). Based on
these data, it was suggested that resistin serves as a hormonal link
between obesity and peripheral insulin resistance in diabetes
(5).
(PPAR)1 (7). Rosiglitazone
treatment was shown to reduce resistin expression in 3T3-L1 adipocytes
in vitro and in the white adipose tissue (WAT) of mice fed a
high fat diet (5). These data raised the interesting possibility that
decreases in resistin levels might be integral to the antidiabetic
actions of PPAR agonists.
agonists. Surprisingly, we find that
resistin expression is decreased in obese mice and increased in ob/ob
mice and Zucker diabetic fatty (ZDF) rats in response to PPAR agonists.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
View larger version (80K):
[in a new window]
Fig. 1.
Expression and regulation of resistin
mRNA in murine genetic models of obesity. Northern blot
analysis of adipose tissue resistin expression in male obese
(O) ob/ob, db/db, tub/tub, and KKAy mice or their
lean (L) counterparts. Adipsin and aP2 mRNA expression
are shown as controls. Ethidium bromide (EtBr) staining is
shown as a control for loading and integrity of RNA.
Agonists--
We next
examined the regulation of resistin expression in the WAT of male ob/ob
mice treated with different PPAR agonists including the
thiazolidinediones rosiglitazone and MCC-555 and the tyrosine
derivative GW1929. Rosiglitazone and GW1929 are full PPAR agonists
(8, 11). MCC-555 profiles as a low affinity full PPAR agonist in
cell-based assays but acts as a potent antidiabetic agent in
vivo (12). Treatment with rosiglitazone, GW1929, or MCC-555
resulted in 50, 50, and 30% reductions in serum glucose levels,
respectively, relative to treatment with vehicle alone and significant
increases in insulin sensitivity (data not shown). As expected,
Northern blot analysis demonstrated that each of these compounds
stimulated the expression of the PPAR target genes fatty acid
transporter protein (FATP) and phosphoenolpyruvate carboxykinase
(PEPCK) (Fig. 2A) in WAT.
Surprisingly, treatment with each compound also resulted in an increase
in resistin expression in WAT (Fig. 2, A and B).
MCC-555 resulted in a greater increase (8.4-fold) in resistin
expression compared with either rosiglitazone (3.4-fold increase) or
GW1929 (2.2-fold increase). These data indicate that decreases in
resistin expression are not required for the antidiabetic actions of
three different PPAR agonists in a standard genetic model of insulin
resistance.
View larger version (20K):
[in a new window]
Fig. 2.
Northern blot analysis of resistin, FATP, and PEPCK
expression in WAT of male 14-week-old ob/ob mice treated with the
PPAR agonist MCC-555 (A). Effects of three
PPAR agonists, MCC-555, rosiglitazone, and GW1929, on WAT resistin
expression in ob/ob mice (B). Each column shows
the mean ± S.E. obtained from four animals in each group.
Ethidium bromide (EtBr) staining is shown as a control for
loading and integrity of RNA. *, p < 0.01 relative to
vehicle treatment.
View larger version (31K):
[in a new window]
Fig. 3.
Northern blot analysis of resistin and FATP
expression in WAT of male ZDF rats treated with the PPAR agonists
rosiglitazone or GW1929 for 7 days or insulin for 6 h
(A). Quantitation of the rosiglitazone and GW1929 Northern
data shown in panel A (B). Data represent the
mean ± S.E. *, p < 0.01 relative to vehicle
treatment. Ethidium bromide (EtBr) staining is shown as a
control for loading and integrity of RNA.
agonists have been proposed to enhance insulin
sensitivity by decreasing resistin expression (5). Our data do not
support either of these proposals. We show that insulin resistance in
several common rodent genetic models is associated with decreases in
resistin expression. In addition, we demonstrate that different PPAR
agonists all stimulate resistin expression in two standard rodent
models of type 2 diabetes. Although we were unable to determine
resistin protein levels, it is unlikely that post-transcriptional
regulation could account for the magnitude of differences observed in
our study. Further studies are needed to determine the mode of
regulation and biological functions of resistin and whether it is an
effector of insulin resistance in obesity.
FOOTNOTES
To whom correspondence should be addressed: Harvard School of
Public Health, 665 Huntington Ave., Boston, MA 02115. Tel.: 617-432-1950; Fax: 617-432-1941; E-mail:
ghotamis@hsph.harvard.edu.
ABBREVIATIONS
, peroxisome
proliferator-activated receptor ;
WAT, white adipose tissue;
ZDF, Zucker diabetic fatty;
PCR, polymerase chain reaction;
FATP, fatty acid
transporter protein;
PEPCK, phosphoenolpyruvate carboxykinase.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
1.
Spiegelman, B. M.,
and Flier, J. S.
(1996)
Cell
87,
377-389
2.
Boden, G.
(1997)
Diabetes
46,
3-10
3.
Hotamisligil, G. S.
(1999)
J. Intern. Med.
245,
621-625
4.
Saltiel, A. R.
(2001)
Cell
104,
517-529
5.
Steppan, C. M.,
Bailey, S. T.,
Bhat, S.,
Brown, E. J.,
Banerjee, R. R.,
Wright, C. M.,
Patel, H. R.,
Ahima, R. S.,
and Lazar, M. A.
(2001)
Nature
409,
307-312
6.
Kim, K. H.,
Lee, K.,
Moon, Y. S.,
and Sul, H. S.
(2001)
J. Biol. Chem.
276,
11252-11256
7.
Spiegelman, B. M.
(1998)
Diabetes
47,
507-514
8.
Brown, K. K.,
Henke, B. R.,
Blanchard, S. G.,
Cobb, J. E.,
Mook, R.,
Kaldor, I.,
Kliewer, S. A.,
Lehmann, J. M.,
Lenhard, J. M.,
Harrington, W. W.,
Novak, P. J.,
Faison, W.,
Binz, J. G.,
Hashim, M. A.,
Oliver, W. O.,
Brown, H. R.,
Parks, D. J.,
Plunket, K. D.,
Tong, W. Q.,
Menius, J. A.,
Adkison, K.,
Noble, S. A.,
and Willson, T. M.
(1999)
Diabetes
48,
1415-1424
9.
Way, J. M.,
Harrington, W. W.,
Brown, K. K.,
Gottschalk, W. K.,
Sundseth, S. S.,
Mansfield, T. A.,
Ramachandran, R. K.,
Willson, T. M.,
and Kliewer, S. A.
(2001)
Endocrinology
142,
1269-1277
10.
Tong, Q.,
Dalgin, G.,
Xu, H.,
Ting, C. N.,
Leiden, J. M.,
and Hotamisligil, G. S.
(2000)
Science
290,
134-138
11.
Lehmann, J. M.,
Moore, L. B.,
Smith-Oliver, T. A.,
Wilkison, W. O.,
Willson, T. M.,
and Kliewer, S. A.
(1995)
J. Biol. Chem.
270,
12953-12956
12.
Reginato, M. J.,
Bailey, S. T.,
Krakow, S. L.,
Minami, C.,
Ishii, S.,
Tanaka, H.,
and Lazar, M. A.
(1998)
J. Biol. Chem.
273,
32679-32684
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  R. S. Ahima and M. A. Lazar Adipokines and the Peripheral and Neural Control of Energy Balance Mol. Endocrinol., May 1, 2008; 22(5): 1023 - 1031. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Biscetti, E. Gaetani, A. Flex, T. Aprahamian, T. Hopkins, G. Straface, G. Pecorini, E. Stigliano, R. C. Smith, F. Angelini, et al. Selective Activation of Peroxisome Proliferator-Activated Receptor (PPAR){alpha} and PPAR{gamma} Induces Neoangiogenesis Through a Vascular Endothelial Growth Factor-Dependent Mechanism Diabetes, May 1, 2008; 57(5): 1394 - 1404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Megia, J. Vendrell, C. Gutierrez, M. Sabate, M. Broch, J.-M. Fernandez-Real, and I. Simon Insulin sensitivity and resistin levels in gestational diabetes mellitus and after parturition Eur. J. Endocrinol., February 1, 2008; 158(2): 173 - 178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. A. Wendel, A. Purushotham, L.-F. Liu, and M. A. Belury Conjugated linoleic acid fails to worsen insulin resistance but induces hepatic steatosis in the presence of leptin in ob/ob mice J. Lipid Res., January 1, 2008; 49(1): 98 - 106. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-J. Kim, C. Nian, and C. H. S. McIntosh Resistin Is a Key Mediator of Glucose-dependent Insulinotropic Polypeptide (GIP) Stimulation of Lipoprotein Lipase (LPL) Activity in Adipocytes J. Biol. Chem., November 23, 2007; 282(47): 34139 - 34147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. P.E. Kadoglou, F. Iliadis, C. D. Liapis, D. Perrea, N. Angelopoulou, and M. Alevizos Beneficial Effects of Combined Treatment With Rosiglitazone and Exercise on Cardiovascular Risk Factors in Patients With Type 2 Diabetes Diabetes Care, September 1, 2007; 30(9): 2242 - 2244. [Full Text] [PDF]
|
|
|
|
|
|
H. Osawa, Y. Tabara, R. Kawamoto, J. Ohashi, M. Ochi, H. Onuma, W. Nishida, K. Yamada, J. Nakura, K. Kohara, et al. Plasma Resistin, Associated With Single Nucleotide Polymorphism -420, Is Correlated With Insulin Resistance, Lower HDL Cholesterol, and High-Sensitivity C-Reactive Protein in the Japanese General Population Diabetes Care, June 1, 2007; 30(6): 1501 - 1506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Clerc, M. G. Coll Constans, H. Lulka, S. Broussaud, C. Guigne, S. Leung-Theung-Long, C. Perrin, C. Knauf, C. Carpene, L. Penicaud, et al. Involvement of Cholecystokinin 2 Receptor in Food Intake Regulation: Hyperphagia and Increased Fat Deposition in Cholecystokinin 2 Receptor-Deficient Mice Endocrinology, March 1, 2007; 148(3): 1039 - 1049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G D Norata, M Ongari, K Garlaschelli, S Raselli, L Grigore, and A L Catapano Plasma resistin levels correlate with determinants of the metabolic syndrome Eur. J. Endocrinol., February 1, 2007; 156(2): 279 - 284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I Pantsulaia, G Livshits, S Trofimov, and E Kobyliansky Genetic and environmental determinants of circulating resistin level in a community-based sample Eur. J. Endocrinol., January 1, 2007; 156(1): 129 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Qi, Z. Nie, Y.-S. Lee, N. S. Singhal, P. E. Scherer, M. A. Lazar, and R. S. Ahima Loss of Resistin Improves Glucose Homeostasis in Leptin Deficiency Diabetes, November 1, 2006; 55(11): 3083 - 3090. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Haluzik, Z. Lacinova, M. Dolinkova, D. Haluzikova, D. Housa, A. Horinek, Z. Vernerova, T. Kumstyrova, and M. Haluzik Improvement of Insulin Sensitivity after Peroxisome Proliferator-Activated Receptor-{alpha} Agonist Treatment Is Accompanied by Paradoxical Increase of Circulating Resistin Levels Endocrinology, September 1, 2006; 147(9): 4517 - 4524. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. K. LeBrasseur, M. Kelly, T.-S. Tsao, S. R. Farmer, A. K. Saha, N. B. Ruderman, and E. Tomas Thiazolidinediones can rapidly activate AMP-activated protein kinase in mammalian tissues Am J Physiol Endocrinol Metab, July 1, 2006; 291(1): E175 - E181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Wang, K. A. Al-Regaiey, M. M. Masternak, and A. Bartke Adipocytokines and lipid levels in ames dwarf and calorie-restricted mice. J. Gerontol. A Biol. Sci. Med. Sci., April 1, 2006; 61(4): 323 - 331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. H. Shen, L. Zhang, Y. Gan, X. Wang, J. Wang, S. A. LeMaire, J. S. Coselli, and X. L. Wang Up-regulation of PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome Ten) Mediates p38 MAPK Stress Signal-induced Inhibition of Insulin Signaling: A CROSS-TALK BETWEEN STRESS SIGNALING AND INSULIN SIGNALING IN RESISTIN-TREATED HUMAN ENDOTHELIAL CELLS J. Biol. Chem., March 24, 2006; 281(12): 7727 - 7736. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. H. Leiter, P. C. Reifsnyder, W. Zhang, H.-j. Pan, Q. Xiao, and J. Mistry Differential Endocrine Responses to Rosiglitazone Therapy in New Mouse Models of Type 2 Diabetes Endocrinology, February 1, 2006; 147(2): 919 - 926. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Haugen, T. Ranheim, N. K. Harsem, E. Lips, A. C. Staff, and C. A. Drevon Increased plasma levels of adipokines in preeclampsia: relationship to placenta and adipose tissue gene expression Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E326 - E333. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Mitchell, D T Armstrong, R L Robker, and R J Norman Adipokines: implications for female fertility and obesity Reproduction, November 1, 2005; 130(5): 583 - 597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Tovar, R. Nogueiras, L. Y C Tung, T. R Castaneda, M. J. Vazquez, A. Morris, L. M Williams, S. L Dickson, and C. Dieguez Central administration of resistin promotes short-term satiety in rats Eur. J. Endocrinol., September 1, 2005; 153(3): R1 - R5. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lappas, K. Yee, M. Permezel, and G. E Rice Release and regulation of leptin, resistin and adiponectin from human placenta, fetal membranes, and maternal adipose tissue and skeletal muscle from normal and gestational diabetes mellitus-complicated pregnancies J. Endocrinol., September 1, 2005; 186(3): 457 - 465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Barb, S. G. Wadhwa, J. Kratzsch, A. Gavrila, J. L. Chan, C. J. Williams, A. W. Karchmer, and C. S. Mantzoros Circulating Resistin Levels Are Not Associated with Fat Redistribution, Insulin Resistance, or Metabolic Profile in Patients with the Highly Active Antiretroviral Therapy-Induced Metabolic Syndrome J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5324 - 5328. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gerber, A. Boettner, B. Seidel, A. Lammert, J. Bar, E. Schuster, J. Thiery, W. Kiess, and J. Kratzsch Serum Resistin Levels of Obese and Lean Children and Adolescents: Biochemical Analysis and Clinical Relevance J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4503 - 4509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Ohmori, Y. Momiyama, R. Kato, H. Taniguchi, M. Ogura, M. Ayaori, H. Nakamura, and F. Ohsuzu Associations Between Serum Resistin Levels and Insulin Resistance, Inflammation, and Coronary Artery Disease J. Am. Coll. Cardiol., July 19, 2005; 46(2): 379 - 380. [Full Text] [PDF]
|
|
|
|
|
|
S. Caja, I. Martinez, M. Abelenda, and M. Puerta Resistin expression and plasma concentration peak at different times during pregnancy in rats J. Endocrinol., June 1, 2005; 185(3): 551 - 559. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Chen, P.-F. Hung, and Y.-H. Kao IGF-I downregulates resistin gene expression and protein secretion Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E1019 - E1027. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Kurlawalla-Martinez, B. Stiles, Y. Wang, S. U. Devaskar, B. B. Kahn, and H. Wu Insulin Hypersensitivity and Resistance to Streptozotocin-Induced Diabetes in Mice Lacking PTEN in Adipose Tissue Mol. Cell. Biol., March 15, 2005; 25(6): 2498 - 2510. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Housova, K. Anderlova, J. Krizova, D. Haluzikova, J. Kremen, T. Kumstyrova, H. Papezova, and M. Haluzik Serum Adiponectin and Resistin Concentrations in Patients with Restrictive and Binge/Purge Form of Anorexia Nervosa and Bulimia Nervosa J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1366 - 1370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Lee, J. W. Bullen Jr., V. L. Stoyneva, and C. S. Mantzoros Circulating resistin in lean, obese, and insulin-resistant mouse models: lack of association with insulinemia and glycemia Am J Physiol Endocrinol Metab, March 1, 2005; 288(3): E625 - E632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Temple, R. N. Cohen, S. R. Wondisford, C. Yu, D. Deplewski, and F. E. Wondisford An Intact DNA-binding Domain Is Not Required for Peroxisome Proliferator-activated Receptor {gamma} (PPAR{gamma}) Binding and Activation on Some PPAR Response Elements J. Biol. Chem., February 4, 2005; 280(5): 3529 - 3540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Haugen, N. Zahid, K. T. Dalen, K. Hollung, H. I. Nebb, and C. A. Drevon Resistin expression in 3T3-L1 adipocytes is reduced by arachidonic acid J. Lipid Res., January 1, 2005; 46(1): 143 - 153. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Sato, K. Kobayashi, T. Inoguchi, N. Sonoda, M. Imamura, N. Sekiguchi, N. Nakashima, and H. Nawata Adenovirus-Mediated High Expression of Resistin Causes Dyslipidemia in Mice Endocrinology, January 1, 2005; 146(1): 273 - 279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Calabro, I. Samudio, J. T. Willerson, and E. T.H. Yeh Resistin Promotes Smooth Muscle Cell Proliferation Through Activation of Extracellular Signal-Regulated Kinase 1/2 and Phosphatidylinositol 3-Kinase Pathways Circulation, November 23, 2004; 110(21): 3335 - 3340. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Rival, A. Stennevin, L. Puech, A. Rouquette, C. Cathala, F. Lestienne, E. Dupont-Passelaigue, J.-F. Patoiseau, T. Wurch, and D. Junquero Human Adipocyte Fatty Acid-Binding Protein (aP2) Gene Promoter-Driven Reporter Assay Discriminates Nonlipogenic Peroxisome Proliferator-Activated Receptor {gamma} Ligands J. Pharmacol. Exp. Ther., November 1, 2004; 311(2): 467 - 475. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. K. Shetty, P. A. Economides, E. S. Horton, C. S. Mantzoros, and A. Veves Circulating Adiponectin and Resistin Levels in Relation to Metabolic Factors, Inflammatory Markers, and Vascular Reactivity in Diabetic Patients and Subjects at Risk for Diabetes Diabetes Care, October 1, 2004; 27(10): 2450 - 2457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Chen, M. Haluzik, N. J. Wolf, J. Lorenzo, K. R. Dietz, M. L. Reitman, and L. S. Weinstein Increased Insulin Sensitivity in Paternal Gnas Knockout Mice Is Associated with Increased Lipid Clearance Endocrinology, September 1, 2004; 145(9): 4094 - 4102. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Meier and A. M. Gressner Endocrine Regulation of Energy Metabolism: Review of Pathobiochemical and Clinical Chemical Aspects of Leptin, Ghrelin, Adiponectin, and Resistin Clin. Chem., September 1, 2004; 50(9): 1511 - 1525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M.-L. Delporte, S. A. El Mkadem, M. Quisquater, and S. M. Brichard Leptin treatment markedly increased plasma adiponectin but barely decreased plasma resistin of ob/ob mice Am J Physiol Endocrinol Metab, September 1, 2004; 287(3): E446 - E453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhang, M. Fu, T. Cui, C. Xiong, K. Xu, W. Zhong, Y. Xiao, D. Floyd, J. Liang, E. Li, et al. Selective disruption of PPAR{gamma}2 impairs the development of adipose tissue and insulin sensitivity PNAS, July 20, 2004; 101(29): 10703 - 10708. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Nogueiras, M. L. Barreiro, J. E. Caminos, F. Gaytan, J. S. Suominen, V. M. Navarro, F. F. Casanueva, E. Aguilar, J. Toppari, C. Dieguez, et al. Novel expression of resistin in rat testis: functional role and regulation by nutritional status and hormonal factors J. Cell Sci., July 1, 2004; 117(15): 3247 - 3257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Rajala, Y. Qi, H. R. Patel, N. Takahashi, R. Banerjee, U. B. Pajvani, M. K. Sinha, R. L. Gingerich, P. E. Scherer, and R. S. Ahima Regulation of Resistin Expression and Circulating Levels in Obesity, Diabetes, and Fasting Diabetes, July 1, 2004; 53(7): 1671 - 1679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Haluzik, C. Colombo, O. Gavrilova, S. Chua, N. Wolf, M. Chen, B. Stannard, K. R. Dietz, D. Le Roith, and M. L. Reitman Genetic Background (C57BL/6J Versus FVB/N) Strongly Influences the Severity of Diabetes and Insulin Resistance in ob/ob Mice Endocrinology, July 1, 2004; 145(7): 3258 - 3264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Asensio, P. Cettour-Rose, C. Theander-Carrillo, F. Rohner-Jeanrenaud, and P. Muzzin Changes in Glycemia by Leptin Administration or High- Fat Feeding in Rodent Models of Obesity/Type 2 Diabetes Suggest a Link between Resistin Expression and Control of Glucose Homeostasis Endocrinology, May 1, 2004; 145(5): 2206 - 2213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-H. Kim, L. Zhao, Y. Moon, C. Kang, and H. S. Sul Dominant inhibitory adipocyte-specific secretory factor (ADSF)/resistin enhances adipogenesis and improves insulin sensitivity PNAS, April 27, 2004; 101(17): 6780 - 6785. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. K. Heilbronn, J. Rood, L. Janderova, J. B. Albu, D. E. Kelley, E. Ravussin, and S. R. Smith Relationship between Serum Resistin Concentrations and Insulin Resistance in Nonobese, Obese, and Obese Diabetic Subjects J. Clin. Endocrinol. Metab., April 1, 2004; 89(4): 1844 - 1848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Felipe, M. L. Bonet, J. Ribot, and A. Palou Modulation of Resistin Expression by Retinoic Acid and Vitamin A Status Diabetes, April 1, 2004; 53(4): 882 - 889. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Morton, J. M. Paterson, H. Masuzaki, M. C. Holmes, B. Staels, C. Fievet, B. R. Walker, J. S. Flier, J. J. Mullins, and J. R. Seckl Novel Adipose Tissue-Mediated Resistance to Diet-Induced Visceral Obesity in 11{beta}-Hydroxysteroid Dehydrogenase Type 1-Deficient Mice Diabetes, April 1, 2004; 53(4): 931 - 938. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. Pittas, N. A. Joseph, and A. S. Greenberg Adipocytokines and Insulin Resistance J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 447 - 452. [Full Text] [PDF]
|
|
|
|
|
|
P. Ferre The Biology of Peroxisome Proliferator-Activated Receptors: Relationship With Lipid Metabolism and Insulin Sensitivity Diabetes, February 1, 2004; 53(90001): S43 - 50. [Abstract] [Full Text]
|
|
|
|
|
|
B.-S. Youn, K.-Y. Yu, H. J. Park, N. S. Lee, S. S. Min, M. Y. Youn, Y. M. Cho, Y. J. Park, S. Y. Kim, H. K. Lee, et al. Plasma Resistin Concentrations Measured by Enzyme-Linked Immunosorbent Assay Using a Newly Developed Monoclonal Antibody Are Elevated in Individuals with Type 2 Diabetes Mellitus J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 150 - 156. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. G. McTernan, F. M. Fisher, G. Valsamakis, R. Chetty, A. Harte, C. L. McTernan, P. M. S. Clark, S. A. Smith, A. H. Barnett, and S. Kumar Resistin and Type 2 Diabetes: Regulation of Resistin Expression by Insulin and Rosiglitazone and the Effects of Recombinant Resistin on Lipid and Glucose Metabolism in Human Differentiated Adipocytes J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6098 - 6106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Degawa-Yamauchi, J. E. Bovenkerk, B. E. Juliar, W. Watson, K. Kerr, R. Jones, Q. Zhu, and R. V. Considine Serum Resistin (FIZZ3) Protein Is Increased in Obese Humans J. Clin. Endocrinol. Metab., November 1, 2003; 88(11): 5452 - 5455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Lee, J. L. Chan, N. Yiannakouris, M. Kontogianni, E. Estrada, R. Seip, C. Orlova, and C. S. Mantzoros Circulating Resistin Levels Are Not Associated with Obesity or Insulin Resistance in Humans and Are Not Regulated by Fasting or Leptin Administration: Cross-Sectional and Interventional Studies in Normal, Insulin-Resistant, and Diabetic Subjects J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 4848 - 4856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Rajala and P. E. Scherer Minireview: The Adipocyte--At the Crossroads of Energy Homeostasis, Inflammation, and Atherosclerosis Endocrinology, September 1, 2003; 144(9): 3765 - 3773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. B. Seo, M. J. Noh, E. J. Yoo, S. Y. Park, J. Park, I. K. Lee, S. D. Park, and J. B. Kim Functional Characterization of the Human Resistin Promoter with Adipocyte Determination- and Differentiation-Dependent Factor 1/Sterol Regulatory Element Binding Protein 1c and CCAAT Enhancer Binding Protein-{alpha} Mol. Endocrinol., August 1, 2003; 17(8): 1522 - 1533. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A Asakawa, A Inui, T Kaga, G Katsuura, M Fujimiya, M A Fujino, and M Kasuga Antagonism of ghrelin receptor reduces food intake and body weight gain in mice Gut, July 1, 2003; 52(7): 947 - 952. [Abstract] [Full Text]
|
|
|
|
|
|
S. R. Smith, F. Bai, C. Charbonneau, L. Janderova, and G. Argyropoulos A Promoter Genotype and Oxidative Stress Potentially Link Resistin to Human Insulin Resistance Diabetes, July 1, 2003; 52(7): 1611 - 1618. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Moon, J. J.-M. Kwan, N. Duddy, G. Sweeney, and N. Begum Resistin inhibits glucose uptake in L6 cells independently of changes in insulin signaling and GLUT4 translocation Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E106 - E115. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yannakoulia, N. Yiannakouris, S. Bluher, A.-L. Matalas, D. Klimis-Zacas, and C. S. Mantzoros Body Fat Mass and Macronutrient Intake in Relation to Circulating Soluble Leptin Receptor, Free Leptin Index, Adiponectin, and Resistin Concentrations in Healthy Humans J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1730 - 1736. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Stutz, L. A. Pickart, A. Trifilieff, T. Baumruker, E. Prieschl-Strassmayr, and M. Woisetschlager The Th2 Cell Cytokines IL-4 and IL-13 Regulate Found in Inflammatory Zone 1/Resistin-Like Molecule {alpha} Gene Expression by a STAT6 and CCAAT/Enhancer-Binding Protein-Dependent Mechanism J. Immunol., February 15, 2003; 170(4): 1789 - 1796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chen and B. L. G. Nyomba Glucose Intolerance and Resistin Expression in Rat Offspring Exposed to Ethanol in Utero: Modulation by Postnatal High-Fat Diet Endocrinology, February 1, 2003; 144(2): 500 - 508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Freemark Pharmacologic Approaches to the Prevention of Type 2 Diabetes in High Risk Pediatric Patients J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 3 - 13. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Lean Is there a metabolic rationale to support a weight loss programme to prevent diabetes? The British Journal of Diabetes & Vascular Disease, January 1, 2003; 3(1_suppl): S12 - S17. [Abstract] [PDF]
|
|
|
|
|
|
H. Makimura, T. M. Mizuno, H. Bergen, and C. V. Mobbs Adiponectin is stimulated by adrenalectomy in ob/ob mice and is highly correlated with resistin mRNA Am J Physiol Endocrinol Metab, December 1, 2002; 283(6): E1266 - E1271. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Yu, S. Javorschi, A. L. Hevener, Y. T. Kruszynska, R. A. Norman, M. Sinha, and J. M. Olefsky The Effect of Thiazolidinediones on Plasma Adiponectin Levels in Normal, Obese, and Type 2 Diabetic Subjects Diabetes, October 1, 2002; 51(10): 2968 - 2974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pizzuti, A. Argiolas, R. Di Paola, R. Baratta, A. Rauseo, M. Bozzali, R. Vigneri, B. Dallapiccola, V. Trischitta, and L. Frittitta An ATG Repeat in the 3'-Untranslated Region of the Human Resistin Gene Is Associated with a Decreased Risk of Insulin Resistance J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4403 - 4406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. W. Rajala, Y. Lin, M. Ranalletta, X. M. Yang, H. Qian, R. Gingerich, N. Barzilai, and P. E. Scherer Cell Type-Specific Expression and Coregulation of Murine Resistin and Resistin-Like Molecule-{alpha} in Adipose Tissue Mol. Endocrinol., August 1, 2002; 16(8): 1920 - 1930. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wang, W. S. Chu, C. Hemphill, and S. C. Elbein Human Resistin Gene: Molecular Scanning and Evaluation of Association with Insulin Sensitivity and Type 2 Diabetes in Caucasians J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2520 - 2524. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Shojima, H. Sakoda, T. Ogihara, M. Fujishiro, H. Katagiri, M. Anai, Y. Onishi, H. Ono, K. Inukai, M. Abe, et al. Humoral Regulation of Resistin Expression in 3T3-L1 and Mouse Adipose Cells Diabetes, June 1, 2002; 51(6): 1737 - 1744. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li and M. A. Lazar Differential Gene Regulation by PPAR{gamma} Agonist and Constitutively Active PPAR{gamma}2 Mol. Endocrinol., May 1, 2002; 16(5): 1040 - 1048. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Engert, M.-C. Vohl, S. M. Williams, P. Lepage, J C. Loredo-Osti, J. Faith, C. Dore, Y. Renaud, N. P. Burtt, A. Villeneuve, et al. 5' Flanking Variants of Resistin Are Associated With Obesity Diabetes, May 1, 2002; 51(5): 1629 - 1634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. M. Forman The Antidiabetic Agent LG100754 Sensitizes Cells to Low Concentrations of Peroxisome Proliferator-activated Receptor gamma Ligands J. Biol. Chem., April 5, 2002; 277(15): 12503 - 12506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Cnop, M. J. Landchild, J. Vidal, P. J. Havel, N. G. Knowles, D. R. Carr, F. Wang, R. L. Hull, E. J. Boyko, B. M. Retzlaff, et al. The Concurrent Accumulation of Intra-Abdominal and Subcutaneous Fat Explains the Association Between Insulin Resistance and Plasma Leptin Concentrations : Distinct Metabolic Effects of Two Fat Compartments Diabetes, April 1, 2002; 51(4): 1005 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Sentinelli, S. Romeo, M. Arca, E. Filippi, F. Leonetti, M. Banchieri, U. Di Mario, and M. G. Baroni Human Resistin Gene, Obesity, and Type 2 Diabetes: Mutation Analysis and Population Study Diabetes, March 1, 2002; 51(3): 860 - 862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Osawa, H. Onuma, A. Murakami, M. Ochi, T. Nishimiya, K. Kato, I. Shimizu, Y. Fujii, J. Ohashi, and H. Makino Systematic Search for Single Nucleotide Polymorphisms in the Resistin Gene: The Absence of Evidence for the Association of Three Identified Single Nucleotide Polymorphisms With Japanese Type 2 Diabetes Diabetes, March 1, 2002; 51(3): 863 - 866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Levy, B. Davenport, J. N. Clore, and W. Stevens Lipid metabolism and resistin gene expression in insulin-resistant Fischer 344 rats Am J Physiol Endocrinol Metab, March 1, 2002; 282(3): E626 - E633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Walczak and P. Tontonoz PPARadigms and PPARadoxes: expanding roles for PPAR{gamma} in the control of lipid metabolism J. Lipid Res., February 1, 2002; 43(2): 177 - 186. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Havel Peripheral Signals Conveying Metabolic Information to the Brain: Short-Term and Long-Term Regulation of Food Intake and Energy Homeostasis Experimental Biology and Medicine, December 1, 2001; 226(11): 963 - 977. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. B. Savage, C. P. Sewter, E. S. Klenk, D. G. Segal, A. Vidal-Puig, R. V. Considine, and S. O'Rahilly Resistin / Fizz3 Expression in Relation to Obesity and Peroxisome Proliferator-Activated Receptor-{gamma} Action in Humans Diabetes, October 1, 2001; 50(10): 2199 - 2202. [Abstract] [Full Text]
|
|
|
|
|
|
E. D. Rosen and B. M. Spiegelman PPARgamma : a Nuclear Regulator of Metabolism, Differentiation, and Cell Growth J. Biol. Chem., October 5, 2001; 276(41): 37731 - 37734. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |