![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 28, 25929-25938, July 13, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
andFrom the Department of Pharmacology, Emory University School of Medicine, Atlanta, Georgia 30322
Received for publication, October 5, 2000, and in revised form, April 25, 2001
| |
ABSTRACT |
|---|
|
|
|---|
The GluR1 glutamate receptor subunit is expressed
in most brain areas and plays a major role in excitatory synaptic
transmission. We cloned and sequenced 5 kilobase pairs of the rat
GluR1 promoter and identified multiple transcriptional start
sites between GluR1 is one of the most abundant glutamate receptor subunits of
the AMPA1 subtype in the
brain. AMPA receptors are assembled from GluR1-GluR4 subunits and
mediate fast excitatory responses at most synapses. AMPA receptor
subunits, including GluR1, are expressed by neurons and glial cells
in vivo and in vitro (for reviews see Refs. 1 and
2), but the density of functional receptors is much lower in astrocytes
than neurons.
GluR1 expression is regulated by many different stimuli. For example,
GluR1 protein levels are up-regulated by basic fibroblast growth factor
in hippocampal neurons (3), and GluR1 transcription is increased by
basic fibroblast growth factor and platelet-derived growth factor in
oligodendrocyte precursor cells (4). In cultured cerebellar granule
cells, high potassium (25 mM) induces GluR1 mRNA levels
by 27-fold and protein levels by 11-fold (5). GluR1 is also induced
during long term potentiation (6, 7) and repeated electroconvulsive
shocks (8). In human epileptic tissues, increases of GluR1 and GluR2
mRNAs (9) as well as immunoreactivity (10) and
[3H]AMPA binding (11) have been reported. Furthermore,
chronic treatment with cocaine or morphine up-regulates GluR1
specifically in the ventral tegmental area, an area known to be
involved in addiction (12, 13), and GluR1 is up-regulated after
treatment with haloperidol or clozapine in the medial prefrontal cortex (14).
On the other hand, GluR1 levels decline with maturation in the
brain (15). Moreover, neurectomy of the hypoglossal nerve leads to
total loss of GluR1 in the hypoglossal nucleus 14 days later, with
recovery by 60 days after the transection (16). Deafferentiation in the
dorsal horn produces down-regulation of GluR1 in laminae I and II and
up-regulation in laminae III-V (17).
Thus, GluR1 expression is up- and down-regulated in multiple
conditions, both normal and pathological, but the mechanisms regulating
GluR1 expression have not been studied previously. As an initial step
toward this goal, we have cloned the rat GluR1 promoter. We have
identified Sp1- and CREB-binding sites near the transcriptional start
sites and several regions that contribute to high expression in neurons.
Isolation and Characterization of Genomic Clones--
Probes for
genomic screening were radiolabeled using random primers, Klenow DNA
polymerase, and [ Constructs--
To obtain a control RNA for primer extension and
RNase protection assays, a deletion construct from the original
SacI-SacI construct was made by digestion with
EcoRI and religation, resulting in a GluR1 construct from
For transfection and luciferase assays, fragments of the 5'-flanking
regions of the thymidine kinase (TK), GluR1, and GluR2 genes were
cloned into the pGL3 basic vector (Promega) in front of the firefly
luciferase reporter gene using restriction sites or PCR cloning with
Pfu polymerase (CLONTECH). All resulting
constructs were verified by sequencing. The BglII to
HindIII fragment of the TK promoter was excised from the
pRL-TK vector (Promega) and cloned into pGL3. The GluR2 promoter
(
Putative CRE sites were mutated by a PCR mutagenesis strategy (20)
introducing different restriction sites as follows: 243 SpeI, Poly(A)+ RNA Preparation--
For primer extension
analysis and RNase protection assays, poly(A)+ RNA was
prepared from adult male rat brains according to Verdoorn and
Dingledine (22).
Primer Extension Analysis--
The following oligonucleotides
were used for primer extension analysis (bottom strand, all relative to
the first ATG, see Fig. 1): PE-A, RNase Protection Assay--
DNA templates for the antisense
probes were cloned into pBluescript KS( Electrophoretic Mobility Shift Assay (EMSA)--
Nuclear
extracts were prepared from embryonic rat forebrain cultures maintained
for 5-9 days in vitro according to Harant et al.
(23). Annealed oligonucleotides were end-labeled with [
The GluR1 oligonucleotides were named by their 5' end, and
sequences containing one or more putative SP1 sites are
underlined:
For CREB binding assays the following GluR1 oligonucleotides
(putative CRE sites are underlined) were tested: Cell Culture, Transfection, Immunostaining, and Luciferase
Assays--
The procedures were slightly modified from Myers et
al. (24). Primary mixed neuronal-glial cell cultures (referred to
as "forebrain cultures") were prepared from E18 to E19 rat cortex with striatum. For transfections, the dissociated cells were plated into 12-well culture dishes (Falcon or Costar) precoated overnight with
180 µg/ml poly-D-lysine and grown in defined serum-free
DMEM supplemented with B27 (both Life Technologies, Inc.), which
enhances neuronal survival. The cultures were transfected on days 4-7, when counting of immunolabeled cultures grown on glass coverslips revealed about 3% GFAP-positive cells and 65% MAP2-positive cells. Primary glial cultures were obtained from the primary forebrain cultures by changing the medium to DMEM with 10% fetal bovine serum,
which induced neuronal cell death as described by Myers et
al. (24). When glial cells were confluent they were trypsinized and replated into 12-well dishes for transfection. Immunolabeling showed about 90% GFAP-positive cells in these cultures. Visually, the
contaminating cells appeared to be progenitor cells, microglia, and
some oligodendrocytes.
For transfection, cells in each well were incubated with 1 µg of each
construct in 6 µl of Plus reagent mixed with 4 µl of LipofectAMINE
(Life Technologies, Inc.) and 0.5 ml of minimal serum-free medium (DMEM
supplemented with 0.5 µM insulin, 100 µg/ml human
apotransferrin, 0.03 µM selenium, and 60 µM
putrescine, all Sigma) per well. After 3-5 h, 0.5 ml of fresh minimal
serum-free medium was added to forebrain cultures, or DMEM with 10%
fetal calf serum was added to glial cultures. After 24 h cells
were harvested for luciferase assays in 150 µl of lysis buffer
(Promega) per well or fixed and immunostained (as in Ref. 24). For
experiments assessing CRE sites, cortical cultures were used, and the
DNA-LipofectAMINE Plus mixture was replaced after 3-5 h with 1 ml of
fresh minimal serum-free medium containing glutamate receptor blockers
(30 µM 6-cyano-7-nitroquinoxaline-2,3-dione, 20 µM MK801, 100 µM
D(-)2-amino-5-phosphonovaleric acid). 24 h later, 100 µl of 10×
drug solution in medium was added for 18 h until lysis. Luciferase
activity was determined on 20-µl samples with a Turner Designs
luminometer using 85 µl of luciferase assay reagent (Promega) per
sample. At least three independent plasmid preparations for each
construct were transfected in triplicates or quadruplets in at least
three different primary cultures.
All luciferase activity values were normalized to the activity of the
TK promoter after subtracting the activity of the promoter-less pGL3
basic vector, which were both transfected in parallel plates of the
same culture preparation. Alternatively, when promoter activity of
GluR1 constructs was expressed as a ratio to that of the empty pGL3
vector, similar results were obtained. Luciferase activity of the pGL3
vector was 16 times lower in glial cultures compared with forebrain
cultures; luciferase driven only by the pGL3 vector gave an average of
12 ± 2.4 Turner light units (TLU) per well (mean ± S.E.,
n = 34) in glial cultures versus 194 ± 28.5 TLU (n = 41) in forebrain cultures. The TK
promoter activity per well was 10,600 ± 2000 TLU for forebrain
cultures (n = 43) and 538 ± 94.5 TLU for glial
cultures (n = 48). To measure the neuronal specificity
of GluR1 promoter constructs, which mainly expressed luciferase in
neurons (see Table I), we assessed neuronal specificity (N/G) relative
to the TK promoter by calculating the ratio of neuronal to glial
expression after normalization to the TK promoter. This N/G ratio is
only used as a tool to compare the neuronal specificity of different
GluR1 promoter fragments, but it underestimates the actual neuronal
specificity since the TK promoter itself was expressed at higher levels
on a per cell basis in the forebrain cultures. By taking the average
transfection efficiency of forebrain (0.75%) and glial (7%) cultures
and an estimated 5 times higher cell density in the forebrain cultures into account, the "neuronal" to glial activity ratio for the TK promoter per cell is about 37.
Statistics--
For all statistical comparisons GraphPad Prizm
was used. An analysis of variance was performed followed by a post hoc
Bonferroni test with selected pairs to compare neighboring constructs.
To compare all constructs to each other a post hoc Tukey test was employed. When only two samples were in one group ( Sequence and Transcriptional Start Sites--
The sequence of the
5'-proximal region and 593 nucleotides of the first intron of the rat
GluR1 gene is shown in Fig. 1. All numbering refers to the first ATG, and some important features are
highlighted within the sequence. The exon-intron borders of the first
two introns were determined from sequence comparison of the genomic
clone and the published GluR1 cDNA (18). This comparison revealed a
discrepancy between the two sequences in the 5'-untranslated region. In
the rat genomic sequence, the CAAGAGAAA sequence (at
The initiation region is GC-rich but lacks convincing TATA and CCAAT
elements. Multiple initiation sites were identified by primer extension
analysis using five different primers and poly(A)+ brain
RNA (Fig. 2A, B).
Nonspecific termination of the reverse transcriptase was monitored
using synthetic GluR1 control RNAs with known length (* in Fig.
2B). Primers PE-A, PE-B, and PE-D (PE-D not shown) gave rise
to main DNA products identifying transcriptional start sites near
RNase protection assays were performed to confirm primer extension
analysis. Probe A revealed all the RNA ends found by primer extension
(Fig. 2C), and probe B, which was located more upstream, reconfirmed sites A and B (not shown). Two faint bands found by RNase
protection and primer extension assays with primers PE-A and -B,
revealing possible start sites flanking the GA repeat at GluR1 Promoter Activity--
Promoter activity of different GluR1
and GluR2 fragments cloned into the pGL3 vector was assessed by
measuring firefly luciferase activity after transfection into primary
forebrain and glial cultures. To compare promoter activities across
experiments, we normalized all luciferase activities to the TK
promoter. GluR1 promoter activity was strongest in forebrain cultures
for the construct that contained all transcriptional start sites and
the 64-bp GA repeat but lacked the region with the first two upstream
ATGs in the 5'-untranslated region (construct Neuronal Specificity--
All examined GluR1 promoter constructs
showed higher activity in forebrain compared with glial cultures. To
determine whether luciferase was expressed primarily in neurons or
glial cells, and whether there is heterogeneity in the glial cultures,
we transfected both forebrain and glial cultures with GluR1 promoter
constructs on glass coverslips and double-immunostained with antibodies
directed against luciferase and either the neuronal marker,
microtubule-associated protein 2 (MAP2), or the astrocyte marker, glial
acidic fibrillary protein (GFAP). In forebrain cultures, most
luciferase-positive cells transfected with GluR1 constructs of
different length were co-labeled with the anti-MAP2 antibody but never
co-stained for GFAP (see Table I and
examples of luciferase- and MAP2-positive double stainings in Fig.
4). In glial cultures, we found no cells that expressed luciferase in three different immunocytochemical experiments. The low luciferase activity in glial cultures might be
below detection threshold. We only detected a few luciferase-positive cells when the luciferase gene was under control of the SV40 promoter, which results in higher enzymatic luciferase activity in glial cultures. These results demonstrate that in our glial and forebrain cultures, astrocytes uniformly show low levels of luciferase expression rather than a small proportion of glial cells showing high expression. Therefore, we conclude that the GluR1 promoter is mostly
neuron-specific.
The immunolabeling results of transfected cells allow us to use the
ratio of luciferase activity in forebrain cultures versus glial cultures (N/G, after normalization to the TK promoter, see "Experimental Procedures") as a measure to assess neuronal
specificity of different GluR1 fragments. Different GluR1 promoter
fragments showed ratios of expression in neurons versus glia
(N/G) ranging from 2.2 to higher than 49 (Fig. 3). The neuronal to
glial expression ratio of the most neuron-specific GluR1 constructs
(all constructs extending 5' from Regions Conferring Neuronal Specificity--
Within the regions
tested, the major elements conferring neuronal specificity reside
between
The neuronal specificity of the region from
The presence of the glial silencing region was suggested by the results
of deleting sequence between Regions Enhancing Expression, GA Repeat--
Sequential
5'-deletions from Regions Reducing Expression--
Deletion of several sequences
enhanced promoter activity, pointing to possible negative regulatory
regions in the GluR1 promoter. For example, in neurons and in glia,
deletion of the sequence between
Deletion of the sequence between Sp1 Sites--
In most TATA-less promoters, including those for
GluR2, NR1, NR2B, NR2A, and KA2 glutamate receptor subunits, Sp1 sites
reside close to the initiation sites (28). A search of the GluR1
sequence around the initiation sites allowing one mismatch to the
consensus sequences G/T G/A GGC G/T G/A G/A G/T (from tfsites data
base in GCG) or G/T G/A GG C/A GG G/A (from the transfac data
base used by MatInspector) revealed five putative Sp1 binding sites between CRE Sites--
The transcription factor CREB is thought to play a
key role in long term potentiation and addiction, in both of which the GluR1 expression is up-regulated. Thus, we examined the GluR1 gene for
putative CRE sites (consensus sequences, TGACG(T/A)(C/A)A and
(A/T)CGT(A/C)AC and (G/T)(A/T)CGTCA), and we identified several promising regions near the initiation sites. Eight oligonucleotides spanning the region between
By computer search two putative AP1 sites were found around We have cloned and characterized 5 kb of the rat GluR1 promoter.
The main findings of this study are as follows. 1) The GluR1 promoter
organization is similar to other known glutamate receptor promoters
(reviewed in Ref. 28) with multiple transcriptional start sites,
Sp1-binding sites, and the lack of TATA and CAAT boxes. 2) The GluR1
promoter is neuron-specific, the neuronal specificity appears to reside
mainly within the neuronal expression-enhancing regions,
295 and
202 (relative to the first ATG). Similar to
other glutamate receptor subunit promoters, the GluR1 promoter lacks
TATA and CAAT elements in that region but binds Sp1 proteins at two
sites. Promoter activity of GluR1 fragments cloned into pGL3 was
assessed by immunocytochemistry and by measuring luciferase activity
after transfection into primary cultures of rat cortical neurons and glia. GluR1 promoter activity was stronger in neurons, with neuronal specificity appearing to reside mainly within the neuronal
expression-enhancing regions,
1395 to
743 and
253 to
48. The
latter region contains 4 sites that bound recombinant cAMP-response
element-binding proteins and a glial silencing region between
253 and
202. In both neurons and glia, promoter activity was increased by a
64-base pair GA repeat upstream of the initiation sites and reduced by
a 57-base pair region that contained an N box. In contrast to the GluR2 promoter the regulatory regions are mainly located outside of the GluR1
initiation region.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]ATP (Megaprime kit, Amersham
Pharmacia Biotech). About 1.35 × 106 phage plaques
from a Wistar rat genomic library (in
dash II vector, Stratagene)
were screened on nitrocellulose filters using the 5' 1587-bp
SacI-BamHI fragment from rat GluR1 cDNA (18) (GenBankTM accession number X17184) as a probe. Five
initially positive plaques were rescreened twice, prepared on a large
scale, and restriction-site mapped in Southern blots. Out of the five
phages, one phage insert hybridized to a PCR-amplified probe (bases
16-223 of the GluR1 cDNA) and contained mainly 5'-untranslated
sequence, the first intron, and at least part of the second intron. A
SacI-SacI fragment containing 5035-bp 5'
sequence, the first exon, and 593 bp of the first intron was subcloned
into the pBluescript KS(
) vector. This construct and several deletion
constructs derived from it were sequenced. Moreover, a 4.7-kb
EcoRI-EcoRI fragment with the 5' EcoRI
site at
459 (relative to the first ATG) and containing the first
intron and at least part of the second intron was cloned into
pBluescript KS(
) and partially sequenced (see Fig. 1). The programs
from the Genetics Computer Group (GCG) and MatInspector (19) were used
for sequence analysis of the promoter.
459 to +675. By using this construct as a template after digestion
with SacI, T3 RNA polymerase, and the RNA transcription kit
(Stratagene), a synthetic GluR1 cRNA was synthesized that included the
GluR1 5' sequence from
459 and 56-bp 5' linker sequence (named
control RNA-1). Control RNA-2 was made from GluR1 cDNA with a 5'
end 266 bp upstream of the ATG (Ref. 18 and see Fig. 2).
1253 to
111 relative to the first ATG or
822 to +320 relative to
the main initiation site) was excised from the pGL2 construct (24)
using NheI and BglII and inserted into pGL3.
PCR-amplified GluR1 fragments were cloned using SacI and
BglII sites introduced in the primers. The 64-bp GA repeat
in GluR1 was shortened during the PCR in some constructs to 62 bp
(
743/+8,
459/
202, and
459/
48), 58 bp (
402/+8), or 36 bp
(
459/+7deltaGA). No correlation between promoter activity and a 64- to 58-bp length of the GA repeat in different constructs was observed.
In the
459/rev
48 construct, the region between
254 and
48 was
inverted. This region was PCR-amplified with the upper primer
containing a HindIII site and the downstream primer a
BglII site. The PCR product was inserted in reverse
orientation into the BglII and HindIII sites of
the
459/
253 construct. For a list of constructs see Fig. 3.
208 NsiI,
151 NdeI, and
84
EcoRV. During this process
219A was mutated
unintentionally to T. As a positive control for CREB activity, we used
a vector that contained eight CRE sites from the intragenic inducible
cAMP early repressor (ICER) promoter upstream of the interleukin 2 promoter and luciferase (21).
187 to
216; PE-B,
155 to
184;
PE-C,
31 to
48; PE-D, +13 to
5; PE-E,
427 to
455. 100 ng of
each HPLC-purified oligonucleotide was end-labeled using 30 µCi of
[
-32P]ATP and T4 polynucleotide kinase (Life
Technologies, Inc.). The radiolabeled primers (specific activity
~5 × 108 cpm/µg) were hybridized for 2 h at
65 °C to 50 µg of poly(A)+ whole brain RNA (~3 × 106 cpm of primer) or 20 ng of synthetic GluR1 control
RNA (~106 cpm of primer) with 10 µg of yeast total RNA
in 150 mM KCl, 10 mM Tris-HCl, pH 8.3, 1 mM EDTA. The mixture was slowly cooled to room temperature
and precipitated with ethanol. Reverse transcription was carried out
for 1 h at 42 °C with 200 units of Superscript II (RNase
H-free, Life Technologies, Inc.) in first strand synthesis buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2) using 625 µM of each
dNTP and 5 ng/µl actinomycin D. After ethanol precipitation the
reaction products were analyzed on a 5% acrylamide, 8 M
urea sequencing gel using sequencing reactions as markers.
) (probe A,
870 to
88;
probe B,
1398 to
184) and linearized with EcoRI at
454. Antisense RNA probe was synthesized from 0.5 µg of linearized
template DNA by T7 polymerase and the Stratagene RNA transcription kit
using the supplied transcription buffer, 500 µM ATP, UTP,
and GTP each, 12 mM dithiothreitol, 33 units of RNAsin
(Promega), 100 µCi of [µ-32P]CTP (Amersham
Pharmacia Biotech, 800 Ci/mmol) at 37 °C for 1 h. 2 units of
DNase I (Epicentre) were added for 15 min at 37 °C to destroy the
DNA template. Template A gave rise to a complementary GluR1 RNA from
454 to
88 (Fig. 2, A and C), and probe B
covered
454 to
184. The probes were purified on a 5% acrylamide, 8 M urea gel and eluted at 37 °C for 2 h into the
buffer supplied by the RPA 2 kit (Ambion). The specific activity of the
probes was about 1.6 × 109 cpm/µg. 2 × 106 cpm probe was mixed with the different RNA samples (10 µg of poly(A)+ rat adult whole brain RNA, 2 ng of GluR1
control RNA in 10 µg of total yeast RNA, or 10 µg of total yeast
RNA alone) in hybridization buffer (80% formamide, 100 mM
sodium citrate, pH 6.4, 300 mM sodium acetate, 1 mM EDTA), denatured for 3-4 min at 90 ± 5 °C, and
hybridized overnight at 45 °C. The single-stranded RNA was then
digested with 0.5 units of RNase A and 20 units of RNase T1 per
reaction at 37 °C for 30 min in the supplied digestion buffer. The
reaction was stopped with the supplied solution, precipitated with
ethanol after adding 20 µg of additional yeast RNA, and analyzed on a 5% acrylamide, 8 M urea sequencing gel using sequencing
reactions as size markers.
-32P]ATP using T4 polynucleotide kinase and were
subsequently purified by PAGE. Gel slices were incubated overnight in
TE buffer, and the probe was separated from the gel by centrifugation
in microcon columns (Amicon) and elution in water. In vitro
binding reactions were conducted for 20 min at room temperature in a
20-µl volume containing 10 mM Tris, pH 7.5, 10%
glycerol, 50 mM NaCl (Sp1 and some c-Jun experiments), or
25 mM NaCl (CREB experiments), 1 mM dithiothreitol, 1 mM EDTA, 0.2 µg of
poly(dI-dC)·poly(dI-dC), 2.5 µg of bovine serum albumin, and
20,000-40,000 cpm probe. Adding nuclear extracts in the Sp1
experiments increased the salt concentration up to 70 mM
NaCl and 7 mM KCl. In some experiments competitor oligonucleotides (10-, 30- or 100-fold of the amount of labeled probe)
were included. When needed, 4 µg of anti-Sp1 or anti-c-Jun polyclonal
rabbit IgG antibodies (Santa Cruz Biotechnology, Inc.) were
preincubated with nuclear extracts on ice for 30 min. 2 µg of nuclear
extracts or one of the following recombinant proteins were added to
start the reaction, 0.2 footprinting units (fpu) of human Sp1, 0.3 footprinting units of human c-Jun (both Promega), or 0.5 µg of human
CREB1-bZIP corresponding to amino acids 254-327, which contained the
DNA binding and dimerization domain (Santa Cruz Biotechnology, Inc.).
The DNA-protein complexes were separated on non-denaturing 6% PAGE,
0.5× TBE gels (Fig. 5, assays concerning Sp1 and some c-Jun binding),
or Tris glycine, 8% PAGE gels (Fig. 6, assays using CREB-bZip and some
assays with c-Jun protein), run at 4 °C for 1.5-3 h. Dried gels
were exposed to Kodak X-Omat films for visualization.
Double-stranded oligonucleotide probes are as follows (top strand
only): Sp1 consensus, ATTCGATCGGGGCGGGGCGAGC; CREB
consensus, AGAGATTGCCTGACGTCAGAGAGCTAG; and AP1 consensus, CGCTTGATGAGTCA- GCCGGAA.
332a, AACACGGGAGGGTGAGAGAGG;
296,
TAGAGAAGAGGAGGAGAGCAGAGG;
275,
AGGGAGAGGGGGAGCGAGCTAGCG;
244,
CATGAGGACGGGCTGCTCAA;
232, CTGCTCCCGGCTCAGTTAATCTGGC (AP1 half-site is in boldface).
332b,
AACACGGGAGGGTGAGAGAGGAGA;
250,
TCCAAGCATGAGGACGGGCTGCTC;
218,
GTTAATCTGGCTGTCAGTCGGTGTT;
193,
ACGCTGCAGTTGAACTGCTCGGCTCCC;
165,
CTTCCAAGAGAAACCTCACGGAAGGAA;
117,
CAAGGAACTGCAGGAAGAAAAGAGCCG;
93,
CCGGCAGAGCATCAAGAAGAATCGAAG; and
78 as a negative
control, GAAGAATCGAAGGGAGGGGAGGGAAGA.
2349/+8
versus
2349/
253 and
459/
48 versus
459/rev
48) the unpaired t test was used.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
161 relative to
the first ATG) only occurs once, whereas it is repeated in tandem in
the mouse GluR1 gene (Celera data base) and the rat cDNA (Fig. 1,
overscored). This difference might be due to genetic variation
among rats. The first intron of about 2.8 kb is inserted after 82 bp of
translated sequence, and the second intron is located after the
138-bp-long exon 2. In the 5' region the rat GluR1 gene harbors a 96-bp
ACAT tetranucleotide repeat at
4815 and at
4309 a B2-like
repetitive sequence (25) of 210 bp including typical 15-bp terminal
direct repeats. The function of a 64-bp GA repeat between
394 and
333 is examined further below.

View larger version (77K):
[in a new window]
Fig. 1.
GluR1 sequence. The 5' sequence
of the rat GluR1 gene, part of the first two introns
(italics), and important features are shown. Numbering is
relative to the first ATG (circled). The main
transcriptional start sites are marked by closed triangles
and the same letters as in Fig. 2. All primers, PE-A to
PE-E, used for primer extension are underlined. Repetitive
sequences are shown in bold, and the sequence repeated in
tandem in the cDNA sequence (18) is overscored.
Restriction sites used for making the pGL3 constructs are
underlined. The bases at the beginning or end of GluR1
sequences cloned into pGL3 are bold and numbered.
Transcription factor binding sites for Sp1 and CREB and a putative N
box (on lower strand) are boxed. The location of the
exon/intron borders are shown with the intronic sequences in
italics. The GenBankTM accession number of this
sequence including the omitted sequence between
4035 and
1435 is
AF302117.
295
and
266 (Figs. 1 and 2; sites denoted as A and
B). Extension of primers PE-B, PE-C, and PE-D (PE-D not shown) resulted in bands at
219 and
214 (sites C and
D) and primers PE-C (Fig. 2A) and PE-D (not
shown) labeled
202 (site E). The matching
results from different primers confirmed the absence of a
161CAAGAGAAA repeat in brain RNA of Harlan Sprague-Dawley
rats. Another primer PE-E starting further upstream at
427 did not
give rise to any DNA product (not shown); thus it was unlikely that
there were more 5'-initiation sites.

View larger version (27K):
[in a new window]
Fig. 2.
Mapping of transcriptional start sites.
A, schematic of the 5'-GluR1 region showing the location of
three primers used for primer extension and RNase protection analysis.
The identified main transcriptional start sites in B and
C are depicted by the same letters
(A-E). B, results from primer extension
experiments with three different primers, PE-A, PE-B, and PE-C.
Nonspecific drop off sites of the reverse transcriptase on control RNAs
are marked by asterisks. The solid arrows mark
the main specific DNA products and their length. Adding the first base
number of the primer used (shown at the bottom gel) to the length minus
1 gives the position of the transcriptional start sites. The open
arrows mark the full-length end of the control RNAs. Note that the
autoradiogram of primer PE-C did not reveal a clear band for the
initiation site labeled B but shows a band
(triangle) that was not found in any other experiment and
was therefore not regarded to indicate a real initiation site.
C, results from a representative RNase protection assay. The
length of the protected RNA probe is shown in DNA bases. The actual
length of the RNA is about 5 bases (2-5%) shorter. Adding the
nucleotide length to the beginning of the probes minus 1 and adjusting
for the actual length matches the sites found by primer extension,
depicted by the same letters. Probe and control RNA were
treated the same way as the poly(A)+ RNA.
333 and
394, were not labeled in Figs. 1 and 2. A number of other fainter
bands appeared in these gels but were not consistently identified by
the various primers and probes, so they were not considered further.
Thus, RNase protection assays with two probes of different length
confirmed all main initiation sites found by primer extension (
295,
266,
219,
214, and
202) and ruled out introns in the
5'-untranslated region.
459/
48, 3'-deletion
series of Fig. 3). In glial cultures the
C, D, and E initiation sites were not essential because highest
promoter activity was produced by construct
459/
253. The shortest
GluR1 promoter construct tested (
209/+8), with only one main
transcriptional start site (E at
202), lacked activity in glial
cultures and had one of the lowest activity of all constructs in
forebrain cultures (18% of TK promoter activity).

View larger version (30K):
[in a new window]
Fig. 3.
GluR1 promoter activity in rat forebrain and
glial cultures. A depicts the promoter constructs used
to transfect primary forebrain and glial cultures derived from
embryonic rat cerebral cortex and striatum (see "Experimental
Procedures"). The initiation sites, the N box, the GA repeat, and the
upstream ATGs are marked. B and C, the mean and
S.E. of the luciferase activity of each construct is displayed as a
percentage of the TK promoter activity for forebrain (B) and
glial (C) cultures. For each construct at least three
independent plasmid preparations in at least three different primary
cultures were tested (N ranges from 9 to 67 for each
construct). The numbers, N/G, denote the ratio of neuronal over glial
expression; negative ratios due to lack of expression in glia are
labeled by asterisks and are described in the text as being
>49 (higher than the highest real ratio observed, which was 49).
Immunostaining of transfected cells in rat forebrain cultures

View larger version (96K):
[in a new window]
Fig. 4.
Luciferase expression driven by GluR1
promoters in MAP2-positive neurons. Forebrain cultures were
transfected with the GluR1
459/
48 (A-C) and
209/+8
(D-F) constructs, and 24 h later cultures were
double-immunostained for firefly luciferase using a secondary Cyan
Green-labeled antibody (B and E) and MAP2 using a
Texas Red-labeled secondary antibody (C and F).
Representative luciferase-positive cells co-stained for MAP2 were
photographed (E and F) or videocaptured
(B and C). Scale bar is 50 µm.
1395, N/G >49) was higher than
that of GluR2 (N/G = 16.2), due to low GluR1 promoter activity in
glia in contrast to GluR2. Inspection of functional promoter activities
in the 5'- and 3'-deletion series (Fig. 3) revealed several regions
responsible for significant effects on GluR1 promoter activity, often
in a cell type-specific manner.
253 and
48,
686 and
457, and
1395 and
743. Deletion
of the latter sequence,
1395 to
743, from construct
1395/+8
lowered the neuronal to glial expression ratio 4.9-fold. This deletion
reduced promoter activity in neurons 2.3-fold, whereas activity in glia
was very low for both constructs, suggesting a neuron-specific region
increasing expression. In contrast, deletion of the region
686 to
459 reduced the N/G ratio 2-fold by increasing activity specifically
in glia (2.3-fold, p > 0.001) but not neurons.
These data suggest that a glial silencing region may exist between
686 and
459. Furthermore, deletion of
258 to +7 or +8 from
constructs
2349/+8 and
459/+7 in the 3'-deletion series greatly
reduced the neuronal to glial expression ratio, from >49 and 5.1 in
the parent constructs to 2.1 and 2.2 in the deletion constructs.
Moreover, the shortest constructs (
258/+7 and
209/+8) in the
5'-deletion series were still neuron-specific as judged from the
neuronal to glial expression ratios of 8.9 and >49, consistent with
the immunocytochemistry (see below).
253 to +8 results from an
orientation-dependent neuronal expression increasing region
and a glial silencing region. Adding the sequence between
202 and
48 to the construct
459/
202 increased expression both in neurons
(1.8-fold, p < 0.001) and in glia (3.3-fold,
p < 0.001). However, the expanded region,
253 to +8
seems to be a neuron-specific positive region. In neurons, deleting the
sequence between
253 and +8 from the long
2349/+8 construct reduced
promoter activity by 2.1-fold (p < 0.05), whereas
activity increased in glia (p < 0.001). Furthermore,
in neurons the construct
459/
48 displayed 2.7-fold stronger
promoter activity than
459/
253 (p < 0.001), whereas both constructs had similar activity in glia. The activity of
the region between
253 and
48 was
orientation-dependent, in that inverting this sequence
reduced promoter activity in neurons by 3.2-fold (p < 0.001) and dramatically reduced neuronal selectivity by 5.5-fold
(compare
459/
48 with
459/rev
48 in Fig. 3).
253 and
202 from the 3' end of the
construct
459/
202, which specifically increased expression in glia
by 4.1-fold (p < 0.001). Likewise, deleting this 3'
region (
253 to +7/8) in the context of either a long construct
(
2349/+8) or a shorter construct (
459/+7) enhanced luciferase
activity in glia (both p < 0.001). This effect was not
observed when comparing construct
258/+7 with
209/+8 in the
5'-deletion series (Fig. 3) however, suggesting that the repressive effect required sequences between
459 and
258. In summary, the neuronal specificity of the GluR1 promoter appears to result from several regions that either increase expression in neurons or reduce
activity in glia. One potential explanation for the low GluR promoter
activity in glial cells could have been culturing in serum-containing
medium before and after transfection. However, removing the serum from
glial cultures had no effect on the neuronal specificity of the GluR1
promoter constructs (data not shown).
459 to
209 gradually reduced promoter activity in
glia, suggesting the importance of the initiation region and modest
general positive elements in this region. Deletion of the GA repeat had
the largest effect in the 5'-deletion series in both neurons and glia
(55 and 70% reduction, p < 0.001), although addition
of a second GA repeat to the 5' end of
402/+8 or of a GA repeat to
the 5' end of
258/+7 did not further increase promoter activity (not
shown). Purine or pyrimidine repeats often vary in length in different
alleles, e.g. between 24 and 62 bp in the 5'-untranslated
region of human GluR3 (26) and between 72 and 86 bp in rat GAP-43 (27).
Therefore, we tested whether the length of the GA repeat would affect
promoter activity of GluR1. A construct
459/+7
GA with the GA
repeat shortened to 36 bp had similar luciferase activity as the native
459/+7 construct with 64 bp in neurons (n = 24) but
lost activity by 55% in glia (n = 30, p < 0.05).
743 and
459 resulted in an
increase of promoter activity (2.2- and 2.4-fold, both
p < 0.001). The constructs
743/+8 and
686/+8 were
specifically designed to test whether the 57-bp region containing the N
box (CACNAG) had any silencing activity. By using a Student's
t test, the increase in activity seen in both neurons and
glia after deletion of the 57-bp region was significant
(p < 0.001), suggesting that the N box reduces
expression of GluR1.
48 and +7 from the 3' end of the
459/+7 construct increased promoter activity 2.6-fold in neurons
(p < 0.001) and more modestly in glia (1.3-fold,
p < 0.05). This region is transcribed and includes the
GluR1 translational start ATG plus two out-of-frame upstream ATGs, so
its repressive effect may have been at either the translational or
transcriptional levels. The data, taken together, suggest that multiple
negative and positive regions regulate the activity of the GluR1
promoter in both neurons and glia.
470 and
140. These sites were assessed for Sp1 binding by
EMSAs. Two out of the five synthetic GluR1 oligonucleotides, with 5'
ends at
296 and
275, formed high molecular weight bands with human
recombinant Sp1 protein as did an Sp1 consensus probe (Fig.
5A, lanes 1, 3, and
4). The same probes formed similar complexes with nuclear
extracts from forebrain cultures, which disappeared following
pretreatment with anti-Sp1 antibodies (Fig. 5B, compare lanes 8-10 with lanes 2, 4, and 5)
but not with c-Jun antibodies (not shown). Furthermore,
296 and
275
oligonucleotides competed for binding of nuclear extracts to the Sp1
consensus probe, whereas a nonspecific oligonucleotide did not (Fig.
5C). This experiment was repeated with labeled
296 and
275 probes and the respective competitors giving similar results. The
Sp1 sites were assigned to the sites that best matched the consensus
sequence and are located between the most upstream main initiation
sites A and B (Figs. 1 and 5D). The site at
270 also
resembles the GC box consensus sequence with one mismatch.

View larger version (55K):
[in a new window]
Fig. 5.
Sp1 binding around the initiation sites.
A, a representative EMSA using five different radiolabeled
GluR1 oligonucleotides (named by their 5' ends) and recombinant Sp1
protein (n = 3 independent experiments). The
arrow identifies a specific Sp1 protein-probe complex.
B, a similar experiment using recombinant Sp1 protein and
nuclear extracts prepared from 5-day forebrain cultures, which gave
rise to similar high molecular weight bands (n = 3).
Preincubation of the extracts with anti-Sp1 antibodies reduced the band
intensity, indicating that the highest band contained Sp1 protein
(n = 3). C, a competition experiment using
0-, 10-, 30-, and 100-fold competing oligonucleotides verifying that
the GluR1 oligonucleotides,
296 and
270 but not
232, can compete
for binding of nuclear extracts from forebrain cultures to Sp1 probe
(n = 2). D, the predicted location of the
two identified Sp1-binding sites in the GluR1 promoter in relation to
the initiation sites A-E.
332 and
67 were examined for CREB binding in EMSAs, including one negative control sequence starting at
78. Four of those oligonucleotides bound recombinant CREB-bZIP (Fig.
6A, lanes 4, 5, 7, and 9), although they all contained mismatches to CRE
consensus sites. To assess the function of these sites, all four sites
were mutated in construct
334/+8 as shown schematically in Fig.
6B. The effect of 10 µM of the adenylate
cyclase activator forskolin and 500 µM of the
phosphodiesterase inhibitor IBMX was compared between cortical cultures
transfected with wild type and mutated constructs. To maximize a
potential CREB effect on promoter activity, we grew the transfected
cells in glutamate receptor blockers (30 µM
6-cyano-7-nitroquinoxaline-2,3-dione, 20 µM MK801,
100 µM D(-)2-amino-5-phosphonovaleric acid, Fig. 6,
B and C) in order to lower any basal CREB
activation. This protocol enhanced the effect of forskolin treatment
(not shown), but we did not find any difference in expression between
constructs that contained or lacked the four CREs (Fig. 6C).
Another CREB-bZIP-binding site between
486 and
442 was found by
EMSAs (not shown), and CRE consensus sites are located further upstream
but were not tested for binding. However, the full-length GluR1
promoter did not give substantially higher responses to the
forskolin/IBMX treatment, indicating that under the conditions tested
proteins of the CREB family did not affect GluR1 promoter activity
(Fig. 6C).

View larger version (26K):
[in a new window]
Fig. 6.
CREB binding to GluR1 sites.
A, binding of recombinant CREB-bZIP to various GluR1
oligonucleotides named by their 5' ends was tested by EMSA. Data shown
are representative of three experiments. B, the CRE sites
identified in A (positions shown) were mutated in the
334/+8 construct. B and C, the function of CRE
sites was assessed by transfection of cortical cultures with the wild
type (WT,
334/+8) or mutated construct (m4) and
the full-length GluR1 promoter (
5035 to +8), and stimulating with 10 µM forskolin and 500 µM IBMX
(n = 5). Promoter activity was normalized to that of
parallel cultures treated with 10 µM dideoxyforskolin
(100%). No difference between the mutated and the wild type constructs
was observed. The IL2 promoter with 8 CRE sites from the ICER promoter
was stimulated to 436 and 506% of control under the same
conditions.
219 and
205. However, in several independent EMSAs these AP1 sites
or the other GluR1 oligonucleotides did not bind recombinant c-Jun,
whereas the AP1 consensus oligonucleotide did (not shown). In addition,
we did not observe any evidence for AP1 regulation of the GluR1
promoter when cortical cultures were transfected with different
constructs (
5035/+8,
2349/+8,
459/+7) and treated with 30-100
nM PMA for 5-24 h (99-144% of non-treated parallel cultures; n = 4).
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1395 to
743 and
253 to +8, the latter also contains a glial silencing
region. 3) Several CREB-binding sites, an expression-increasing GA
repeat, and a silencing region containing an N box were identified (Fig. 7). Many neuronal promoters,
including glutamate receptor promoters, contain an RE1 silencing
element, which reduces expression in non-neuronal cells. However, no
RE1-like sequences were found in the 5 kb of the GluR1 promoter.
Because primary cortical cultures consist of a mixture of neuronal cell
types, we cannot exclude that some promoter regions influence
expression only in a subpopulation of cells.

View larger version (18K):
[in a new window]
Fig. 7.
Main features of the rat GluR1 gene. The
main features of the GluR1 gene are shown. The ATGs, initiation sites,
N box, the GA repeat, and the identified Sp1- and CREB-binding sites
are shown. Cloning sites used for the promoter activity studies are
marked. Positive and negative regions active in neurons or glia are
shown. Note the neuron-specific positive elements between
1395 to
743 and
253 to
48 and the glial-specific negative elements
253
to
202 and
686 to
459. Also note the common positive regions,
such as the GA repeat and
202 to
48, and the common negative
elements,
48 to +7 and
743 to
686 containing the N box.
Neuronal Selectivity of a Minimal Promoter--
Luciferase assays
and immunohistochemistry show that even short GluR1 promoter constructs
express selectively in primary cultured neurons compared with
GFAP-positive astrocytes. The shortest and the longest GluR1 constructs
are the most neuron-specific because they display only background
activity in glia. Even small GluR1 promoter fragments close to the
transcriptional start sites retain substantial neuronal selectivity.
This is also observed with other promoters of neuronal genes, such as
GluR2 (24), rat
2-nicotinic acetylcholine receptor
subunit (29), the mouse neural adhesion molecule polysialic acid
synthase (30), and rat synapsin II (31). The 5'- and 3'-deletion series
reveal that no single region dominates or is essential for GluR1
promoter activity in neurons. Rather, transcriptional start sites and
regulatory elements are distributed throughout a broad region,
including transcribed regions and regions distant from the initiation sites.
Purine-rich Regions and Other Regulatory Elements-- In this first description of the GluR1 promoter, we have identified several regions governing expression, some of which resemble other neuronal promoters: 1) a purine-rich region in the 5'-untranslated region similar to GluR3 and a GA repeat similar to GAP-43, both increase expression in GluR1; 2) a GAP-43-like element in the region reducing expression in glia; and 3) a 57-bp activity-reducing region containing an N box.
The 64-bp GA repeat and a purine-rich region (
147 to
47) reside in
sequences that substantially increase GluR1 promoter activity. The
human GluR3 gene has a similar purine-rich region in the
5'-untranslated region (26), and GA or TC repeats are found in many
promoters, including neuronal promoters such as rat GAP-43 (32) and
mouse neurofilament (33). In supercoiled plasmids and in chromatin,
purine or pyrimidine repeats or enriched regions can form triplex DNA
structures, which leaves one strand single-stranded (34, 35). These
structural changes themselves might favor transcription by making the
DNA more accessible or allow binding of transcription factors. The
mechanism of the positive effect of the GluR1 GA repeat is unclear.
However, the positive effect was dependent on the position of the GA
repeat close to the initiation region, suggesting that the GA repeat
might help recruit Sp1 or general initiation factors. Moreover,
promoter activity was reduced by shortening the GA repeat in glia but
not in neurons, suggesting that variations of repeat length in
different alleles might affect neuronal specificity. In summary,
purine-rich regions are prominent in the GluR1 promoter and influence
promoter activity; however, their mechanism of action, whether by
changing the conformation of the DNA or by binding transcription
factors, remains largely unknown.
Silencing Regions--
About half of the neuronal specificity of
the GluR1 promoter was conferred by the region between
253 to
202,
which reduces expression in glia. This region resembles the GAP-43
non-neuronal repressive element, which consists of two sequences
separated by 9 or 10 bp (36, 37). The GluR1 Sp1 site at
289 outside of the identified silencing region is identical to the upstream GAP-43
half-site, and the sequence around the
242 thymidine with 4 and 5 purines on either side resembles the downstream half-site (37). Apart
from transcriptional regulation, cell-specific translational control
mediated by this sequence in either glia or neurons is possible, since
the glial silencing region is transcribed when the upstream GluR1
initiation sites are used.
A 57-bp region that inhibited expression in both forebrain and glial
cultures contains an N box (CACNAG) located at
735. An N box was also
found in a 1.4-kb negatively acting region of NR2B (38) and is found in
the homologous region of the human GluR1 promoter (see also Fig. 7). N
boxes can bind the Notch effectors Hes1 and Hes5, which are negative
regulators of the basic helix-loop-helix family and regulate neuronal
differentiation (39-41). Our finding that deletion of the short
sequence containing the N box increases luciferase activity recalls the
observation that binding of Hes1 to the N boxes of the Hes1
promoter suppresses transcription (40).
Taken together, our findings indicate that GluR1 silencing and activation elements are distributed over a wide region of the GluR1 promoter, as summarized in Fig. 7. Most features, including the N box, the upstream AUGs, and the three CREB-binding sites closest to the transcriptional start sites, are conserved in the human and mouse GluR1 promoter (GenBankTM accession number AC025156 (human); mouse promoter assembled from Celera data base). Indeed, the region between the GA repeat and the translational initiation codon shows 86 and 98% identity in human and mouse, respectively.
Translational control can play a prominent role in the regulation of
other glutamate receptor subunits, such as NR1 (42), NR2A (43), and
GluR2 (44). It would be worthwhile to investigate the possibility of
translational control in GluR1. Our study mapped the regions conferring
neuronal specificity and GluR1 expression and will lead the way to the
identification of individual elements governing GluR1 expression.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Nancy Ciliax for preparation of the forebrain primary cultures and Dr. T. J. Murphy for providing the CREB and AP1 control plasmids. We are grateful to Dr. Scott Myers for many useful discussions and encouragement during the study and to Dr. Edward Morgan and Dr. T. J. Murphy for comments on the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported in part by grants from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF302117.
Supported by the Deutsche Forschungsgemeinschaft and the Markey
Foundation. To whom correspondence should be addressed: Dept. of
Pharmacology, Emory University School of Medicine, 1510 Clifton Rd.,
Atlanta, GA 30322. Tel.: 404-727-5635; Fax: 404-727-0365; E-mail:
kborges@pharm.emory.edu.
Published, JBC Papers in Press, May 4, 2001, DOI 10.1074/jbc.M009105200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
AMPA,
-amino-3-hydioxy-5-methyl-4-isoxazole propionic acid;
CREB, cAMP-response element-binding proteins;
bp, base pair;
PCR, polymerase
chain reaction;
kb, kilobase pair;
PE, primer extension;
DMEM, Dulbecco's modified Eagle's medium;
EMSA, electrophoretic mobility
shift assay;
PAGE, polyacrylamide gel electrophoresis;
GFAP, glial
acidic fibrillary protein;
TK, thymidine kinase;
TLU, Turner light
units;
IBMX, isobutylmethylxanthine;
N/G, neurons versus
glia.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Dingledine, R., Borges, K., Bowie, D., and Traynelis, S. F. (1999) Pharmacol. Rev. 51, 7-61 |
| 2. | Gallo, V., and Ghiani, C. A. (2000) Trends Pharmacol. Sci. 21, 252-258 |
| 3. | Cheng, B., Furukawa, K., O'Keefe, J. A., Goodman, Y., Kihiko, M., Fabian, T., and Mattson, M. P. (1995) J. Neurochem. 65, 2525-2536 |
| 4. | Chew, L.-J., Fleck, M. W., Wright, P., Scherer, S. E., Mayer, M. L., and Gallo, V. (1997) J. Neurosci. 17, 227-240 |
| 5. | Condorelli, D. F., Dell'Albani, P., Aronic, E., Genazzani, A. A., Casabona, G., Corsaro, M., Balazs, R., and Nicoletti, F. (1993) J. Neurochem. 61, 2133-2139 |
| 6. | Nayak, A., Zastrow, D. J., Lickteig, R., Zahniser, N. R., and Browning, M. D. (1998) Nature 394, 680-683 |
| 7. | Cammarota, M., Bernabeu, R., deStein, M. L., Izquierdo, I., and Medina, J. H. (1998) Eur. J. Neurosci. 10, 2669-2676 |
| 8. | Naylor, P., Stewart, C. A., Wright, S. R., Pearson, R. C. A., and Reid, I. C. (1996) Mol. Brain Res. 35, 349-353 |
| 9. | Garcia-Ladona, F. J., Palacios, J. M., Probst, A., Wieser, H. G., and Mengod, G. (1994) Mol. Brain Res. 21, 75-84 |
| 10. | Mathern, G. W., Pretorius, J. K., Mendoza, D., Lozada, A., Leite, J. P., Chimelli, L., Fried, I., Sakamote, C., Assirato, J. A., and Adelson, P. D. (1998) J. Neuropathol. Exp. Neurol. 57, 615-634 |
| 11. | Zilles, K., Qü, M. S., Köhling, R., and Speckmann, E.-J. (1999) Neuroscience 94, 1051-1061 |
| 12. | Churchill, L., Swanson, C. J., Urbina, M., and Kalivas, P. W. (1999) J. Neurochem. 72, 2397-2403 |
| 13. | Fitzgerald, L. W., Ortiz, J., Hamedani, A. G., and Nestler, E. J. (1996) J. Neurosci. 16, 274-282 |
| 14. | Fitzgerald, L. W., Deutch, A. Y., Gasic, G., Heinemann, S. F., and Nestler, E. J. (1995) J. Neurosci. 15, 2453-2461 |
| 15. | Pelligrini-Giampietro, D. E., Bennett, M. V. L., and Zukin, R. S. (1992) Neurosci. Lett. 144, 65-69 |
| 16. | Yeo, J. F., Tang, F. R., and Leong, S. K. (1997) Int. J. Neurosci. 90, 9-20 |
| 17. | Carlton, S. M., Hargett, G. L., and Coggeshall, R. E. (1998) Neurosci. Lett. 242, 21-24 |
| 18. | Hollmann, M., O'Shea-Greenfield, A., Rogers, S. W., and Heinemann, S. (1989) Nature 342, 643-648 |
| 19. | Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995) Nucleic Acids Res. 23, 4878-4884 |
| 20. | Horton, R. M., Hunt, H. D., Ho, N. S., Pullen, K. J., and Pease, L. R. (1989) Gene (Amst.) 77, 61-68 |
| 21. | Abbott, K. L., Robida, A. M., Davis, M. E., Pavlath, G. K., Camden, J. M., Turner, J. T., and Murphy, T. J. (2000) J. Mol. Cell. Cardiol. 32, 391-403 |
| 22. | Verdoorn, T., and Dingledine, R. (1988) Mol. Pharmacol. 34, 298-307 |
| 23. | Harant, H., de Martin, R., Andrew, P. J., Foglar, E., Dittrich, C., and Lindley, I. J. D. (1996) J. Biol. Chem. 271, 26954-26961 |
| 24. | Myers, S. J., Peters, J., Huang, Y., Comer, M. B., Barthel, F., and Dingledine, R. (1998) J. Neurosci. 18, 6723-6739 |
| 25. | Lueders, K. K., and Paterson, B. M (1982) Nucleic Acids Res. 10, 7715-7729 |
| 26. | Gécz, J., Barnett, S., Liu, J., Hollway, G., Donnelly, A., Eyre, H., Eshkevari, H. S., Baltazar, R., Grunn, A., Nagaraja, R., Gilliam, C., Peltonen, L., Sutherland, G. R., Baron, M., and Mulley, J. C. (1999) Genomics 62, 356-368 |
| 27. | Eggen, B. J. L., Nielander, H. B., Rensen-de Leeuw, M. G. A., Schotman, P., Gipsen, W. H., and Schrama, L. H. (1994) Mol. Brain Res. 23, 221-234 |
| 28. | Myers, S. J., Dingledine, R., and Borges, K. (1999) Annu. Rev. Pharmacol. Toxicol. 39, 221-241 |
| 29. | Bessis, A., Salmon, A.-M., Zoli, M., Le Novére, N., Picciotto, M., and Changeux, J.-P. (1995) Neuroscience 69, 807-819 |
| 30. | Yoshida, Y., Kurosawa, N., Kanematsu, T., Kojima, N., and Tsuji, S. (1996) J. Biol. Chem. 271, 30167-30173 |
| 31. | Chin, L.-S., Li, L., and Greengard, P. (1994) J. Biol. Chem. 269, 18507-18513 |
| 32. | Nedivi, E., Basi, G. S., Akey, I. V., and Skene, J. H. P. (1992) J. Neurosci. 12, 691-704 |
| 33. | Yaworski, P. J., Gardner, D. P., and Kappen, C. (1997) J. Biol. Chem. 272, 25112-25120 |
| 34. | Larsen, A., and Weintraub, H. (1982) Cell 29, 609-622 |
| 35. | Htun, H., and Dahlber, J. E. (1989) Science 243, 1571-1576 |
| 36. | Weber, J. R. M., and Skene, J. H. P. (1997) J. Neurosci. 17, 7583-7593 |
| 37. | Weber, J. R. M., and Skene, J. H. P. (1998) J. Neurosci. 18, 5264-5274 |
| 38. | Sasner, M., and Buonanno, A. (1996) J. Biol. Chem. 271, 21316-21322 |
| 39. | Akazawa, C., Sasai, Y., Nakanishi, S., and Kageyama, R. (1992) J. Biol. Chem. 267, 21879-21885 |
| 40. | Takebayashi, K., Sasai, Y., Sakai, Y., Watanabe, T., Nakanishi, S., and Kageyama, R. (1994) J. Biol. Chem. 269, 5150-5156 |
| 41. | Ohtsuka, T., Ishibashi, M., Gradwohl, G., Nakanishi, S., Guillemot, F., and Kageyama, R. (1999) EMBO J. 18, 2196-2207 |
| 42. | Sucher, N. J., Brose, N., Deitcher, D. L., Awobuluyi, M., Gasic, G. P., Bading, H., Cepko, C. L., Greenberg, M. E., Jahn, R., Heinemann, S. F., and Lipton, S. A. (1993) J. Biol. Chem. 268, 22299-22304 |
| 43. | Wood, M. W., VanDongen, H. M. A., and VanDongen, A. M. J. (1996) J. Biol. Chem. 271, 8115-8120 |
| 44. | Myers, S. J., Huang, Y., and Dingledine, R. (1998) Soc. Neurosci. Abstr. 23, 923 |
This article has been cited by other articles:
![]() |
M. C. Boersma and M. K. Meffert Novel Roles for the NF-{kappa}B Signaling Pathway in Regulating Neuronal Function Sci. Signal., February 12, 2008; 1(6): pe7 - pe7. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Crepaldi, C. Lackner, C. Corti, and F. Ferraguti Transcriptional Activators and Repressors for the Neuron-specific Expression of a Metabotropic Glutamate Receptor J. Biol. Chem., June 15, 2007; 282(24): 17877 - 17889. [Abstract] [Full Text] [PDF] |
||||
![]() |
|