|
Originally published In Press as doi:10.1074/jbc.M101692200 on May 16, 2001
J. Biol. Chem., Vol. 276, Issue 28, 25959-25969, July 13, 2001
HMGN3a and HMGN3b, Two Protein Isoforms with a Tissue-specific
Expression Pattern, Expand the Cellular Repertoire of
Nucleosome-binding Proteins*
Katherine L.
West §,
Yuko
Ito ,
Yehudit
Birger,
Yuri
Postnikov,
Hitoshi
Shirakawa¶, and
Michael
Bustin
From the Protein Section, Laboratory of Metabolism, Division of
Basic Science, NCI, National Institutes of Health,
Bethesda, Maryland 20892
Received for publication, February 23, 2001, and in revised form, May 10, 2001
 |
ABSTRACT |
HMGN1 (HMG-14) and HMGN2 (HMG-17) are
nuclear proteins that bind specifically to nucleosomes, reduce the
compactness of the chromatin fiber, and enhance transcription from
chromatin templates. Here we report that many vertebrates contain an
additional type of HMGN protein named HMGN3 (Trip 7). The human
HMGN3 gene is located on chromosome 6 and spans 32 kilobase pairs, which is nearly 10-fold longer than the closely related
HMGN2 gene. However, the intron/exon boundaries of the
HMGN3 gene are identical to those of HMGN1 and
HMGN2. Unique within the HMGN family, the HMGN3 transcript
undergoes alternative splicing and generates two different variants,
HMGN3a and HMGN3b. The shorter variant, HMGN3b, arises from an
additional splice site that truncates exon V and causes a frameshift.
The resulting HMGN3b protein lacks the majority of the C-terminal
chromatin-unfolding domain. Both splice variants are found in many
vertebrates from frogs to man and are expressed in many tissues. The
pattern of tissue-specific expression differs considerably from those
of HMGN1 and HMGN2 at both the mRNA and the protein level. Our
results expand the multiplicity of the HMGN protein family and raise
the possibility that these nucleosome-binding proteins function as
co-activators in tissue-specific gene expression.
 |
INTRODUCTION |
The DNA in eukaryotic nuclei is organized into chromatin by
wrapping around histone octamers to form nucleosomes, and the nucleosomal array is compacted by the subsequent binding of linker histones. This organization inhibits the access of protein complexes that carry out activities such as transcription, replication, repair,
and recombination (1). Several cellular mechanisms, including
modification of the core histone N-terminal tails and ATP-dependent nucleosome remodeling, are known to unfold
chromatin and facilitate access to the DNA (2). In addition, all
mammalian and most vertebrate cells contain the non-histone chromosomal HMGN proteins (HMG-14/-17),1
which have been shown to act as chromatin architectural elements that
promote chromatin unfolding and enhance transcription from chromatin
templates (3-10). Consistent with a role in unfolding chromatin for
transcription, HMGN family members are preferentially associated with
actively transcribed regions of DNA in vivo (11).
HMGN proteins are the only known proteins that specifically recognize
the generic structure of the 147-base pair nucleosome core particle,
the building block of the chromatin fiber (12, 13). They contain the
following three highly conserved functional domains: the bipartite
nuclear localization signal
(NLS),2 the
nucleosome-binding domain (NBD), and the chromatin-unfolding domain.
The two founding members of the HMGN family, HMGN1
(HMG-14)1 and HMGN2 (HMG-17),1 bind to isolated
nucleosome core particles in a cooperative manner, forming complexes of
one core particle with either two molecules of HMGN1 or two molecules
of HMGN2 (14). In vivo, HMGN2 has been shown to bind to
clusters of approximately six contiguous nucleosomes that do not
contain any HMGN1 (15). Cross-linking, footprinting, and chromatin
reconstitution experiments suggest that the proteins unfold chromatin
by targeting histone H1 (4, 16) and by interacting with the N-terminal
tail of histone H3 (17), two elements known to compact chromatin
(18-21).
Immunofluorescence studies have revealed that HMGN1 and HMGN2 are
localized in many foci throughout the nucleus and that these foci
co-localize with sites of active transcription (11, 15). The two
proteins appear to be segregated into distinct domains, however, as
each focus only contains either HMGN1 or HMGN2 (15). Photobleaching
experiments have shown that HMGN1 and HMGN2 are highly mobile in the
nucleus, in contrast to the almost immobile histone H2B (22, 23).
Furthermore, the intranuclear organization of HMGN1 and HMGN2 is
dependent on transcriptional activity, as the addition of
transcriptional inhibitors causes HMGN2 to be relocated to
interchromatin granules, and mitotic chromosomes are void, or highly
depleted, of both HMGN1 and HMGN2 (11, 24). Post-translational
modifications are also likely to alter the localization of HMGN
proteins, as phosphorylation and acetylation inhibit the interaction of
HMGN1/HMGN2 with chromatin (25-27), and both HMGN1 and HMGN2 are
modified at several positions in vivo (26, 28-30). Thus,
the intranuclear organization of the HMGN proteins is highly dynamic,
and the proteins participate in the regulation of transcription and
other DNA-dependent activities by unfolding chromatin.
The hallmark of HMGN proteins is the nucleosome-binding domain, which
was originally found only in the canonical HMGN1 and HMGN2 proteins.
Recently, we discovered a new member of the HMGN family, NBP-45 (also
named NSBP1), that also binds specifically to nucleosome core particles
(31). NBP-45 is unique in that in addition to the nucleosome-binding
domain and the chromatin-unfolding domain, it has a large (321 amino
acids), negatively charged C-terminal domain that can activate
transcription in a reporter assay.
In addition, a cDNA coding for a closely related protein named Trip
7 (renamed HMGN3),1 was detected in a HeLa cell library by
a yeast two-hybrid assay using the ligand
binding/dimerization/transactivation domain of rat thyroid hormone
receptor 1 (TR 1) as bait (32). In the two-hybrid assay, HMGN3
interacted with both the thyroid hormone receptor and with
retinoid X receptor in a ligand-dependent manner. In
view of the similarity between HMGN3 and the other known members of the
HMGN family, and considering that these proteins bind to nucleosomes,
it is possible that HMGN3 promotes the interaction of hormone receptors
with the chromatin template. However, to date, neither the protein nor
the gene coding for HMGN3 has been characterized. In
GenBankTM, the annotation of the partial HMGN3 cDNA
clone indicates the presence of additional residues N-terminal to the
PKRK motif that is the consensus start sequence of all HMGN proteins,
raising the possibility that in fact HMGN3 is a novel type of HMGN protein.
Here we report the first characterization of the HMGN3 gene,
transcript, and protein. We demonstrate that the protein is encoded by
an unusually large gene located on human chromosome 6 and is expressed
in a tissue-specific manner. Unlike other members of the HMGN family,
HMGN3 exists as two splice variants, named HMGN3a and HMGN3b, and the
latter lacks most of the C-terminal chromatin-unfolding domain. The
presence of additional members of the HMGN family within eukaryotic
cells raises the possibility that these proteins have specific roles in
tissue-specific gene regulation.
 |
EXPERIMENTAL PROCEDURES |
Data Base Searching and Sequence Manipulation--
HMGN3 ESTs
were found by searching GenBankTM with the L40351 sequence
using the basic BLAST 2.1 tool on the NCBI website. Sequences were
manipulated and aligned using Biowire Jellyfish version 1.21 or
Multialin (33). The polyadenylation signal in the human
HMGN3 gene was identified using the Baylor College of Medicine HGSC web tool. CpG islands were identified using the European
Bioinformatics Institute CpG island web tool. The genomic sequence of
human HMGN3 was found by a BLAST search of the working draft of the
human genome on the NCBI website using the consensus mRNA sequence
for HMGN3a. The promoters of the HMGN1, HMGN2, and HMGN3 genes were scanned for potential transcription
factor-binding sites using the TFSEARCH program, which utilizes the
TRANSFAC data base (34).
The following ESTs were used to deduce the mRNA sequences of the
HMGN3 family: for Homo sapiens HMGN3a, L40357, W52083, and
N36318; for H. sapiens HMGN3b, N35766, W7070, BE791451, BE876835, BF033675, and AV759176; for Mus musculus HMGN3a, AW823915 and BF662554; for M. musculus HMGN3b, W59311, AA929763, AA981952, AW209932, W64196, AA222444, BF714654, BF135613, and
AA537482; and for M. musculus HMGN3a or HMGN3b, AW214601,
BE949981, AW519800, AI848175, AA675136, BE980222, and AI449254. The
consensus mRNA sequences for mouse and human HMGN3a and HMGN3b have
been deposited in the GenBankTM data base.
The Rattus sp. HMGN3 sequence was only found as two separate
ESTs, H31484, which contains the first 156 nucleotides of the open
reading frame, and AA851306, which has the remaining 152 nucleotides of
the open reading frame and 412 nucleotides of the 3'-UTR. The EST for
Bos taurus HMGN3a is AV597694, which is consistent
with the sequences of ESTs BE488022 and AW437389. The accession numbers
for Xenopus laevis HMGN3a and HMGN3b are AW765830 and
BE506630, respectively. Their sequences are consistent with the
consensus sequence from ESTs AW200492, AW764421, AW764338, AW764769,
and AW767112.
Cloning the 5'-Sequence of Human HMGN3 mRNA--
The 5'-UTR
of human HMGN3 was cloned from a human heart CapSite
cDNATM library according to the manufacturer's
instructions (Eurogentec). The first PCR utilized an HMGN3-specific
primer (CTGCTTTTCCTCCTTCTTCCC, primer 1, Fig. 1) and a primer specific
to the 38-mer recapping oligonucleotide that was used to generate the
library. A second (nested) PCR was performed using the first PCR as a
template, a second HMGN3-specific primer (TGGTTTGGGTTCAGGTTTTGG, primer 2, Fig. 1), and a second primer specific to the 38-mer recapping oligonucleotide. Agarose gel electrophoresis revealed that one PCR
product had been generated, and this was ligated into the vector
pCR2.1-TOPO (Invitrogen). The CapSite cDNATM HMGN3
clone was identified by DNA sequencing.
Overproduction of Recombinant Proteins and Preparation of Tissue
Culture Extracts--
For the production of recombinant HMGN3a, the
open reading frame of human HMGN3a was amplified from I.M.A.G.E. clone
268,208 (accession number N36318, obtained from ATCC) by PCR. The 5'- and 3'-primers contained NdeI and SalI sites,
respectively. HMGN3b was amplified from I.M.A.G.E. clone 268,208 using
the same 5'-primer and a 3'-primer that contained a SalI
site and also introduced the codons for Glu, Asn, stop after codon 74, 5'-TCACCGTCGACTCAGTTTTCAGTACCTTCCTTTCCAGC-3'. The PCR products were
subcloned into the NdeI and SalI sites of the
bacterial expression vector pET30a. The sequences of the insert and the
I.M.A.G.E. clone were confirmed by DNA sequencing. To create the
expression vector for His6-HMGN3a, the HMGN3a open reading
frame was amplified by PCR using oligonucleotides containing restriction sites for either NcoI or SalI. The
PCR product was cloned into the NcoI and SalI
sites of pET30a, so that HMGN3a was inserted C-terminal to, and in
frame with, the His6 and S-tags. The expression vector for
His6-HMGN1 was a generous gift from Professor Ulla Hansen.
For overexpression of recombinant proteins, expression vectors were
transformed into BL21-DE3lysS cells, and expression was induced with
0.4 mM
isopropyl-1-thio- -D-galactopyranoside. Recombinant HMGN
proteins and 5% PCA tissue culture extracts were prepared as described
previously (35). Mouse tissues were homogenized in phosphate-buffered
saline, and then PCA extracts were prepared as described previously
(36). Overexpressed His6-tagged protein was purified using
TALON metal affinity resin (CLONTECH) as described in the manufacturer's instructions.
Antibody Production--
Antibodies were produced by Quality
Biologicals, Inc. Two antibodies were raised in rabbit against keyhole
limpet hemocyanin conjugates of the following peptides from hHMGN3:
antibody 2751, RKSPENTEGKDGSKVTKQEPT; antibody 2752, KTSAKKEPGAKISRGA.
Antibody 2859 was raised in chicken against the following peptide:
APSENGETKAEEAQKTESVDNEGE. The antibodies were affinity purified using
the same peptide sequences.
Western Blot Analysis--
Protein samples were run on 15%
SDS-polyacrylamide gels (Bio-Rad) and blotted onto polyvinylidene
difluoride membrane. After blocking in PBST (phosphate-buffered saline
with 0.1% Tween 20) with 5% milk, membranes were washed in PBST and
then incubated at 4 °C overnight with primary antibody in PBST and
1% milk. The final antibody concentrations used were as follows: 2751 and 2752, 6 ng/ml; 2859, 50 ng/ml; HMGN2, 1 ng/ml (37). Membranes
were washed three times in PBST and then incubated with anti-rabbit or
anti-chicken IgG-peroxidase conjugate (Pierce) in PBST containing 5%
milk. Membranes were washed and then the bound antibodies were detected
with ECL plus detection reagent (Amersham Pharmacia Biotech).
Mass Spectrometry--
HeLa cell 5% PCA extracts were further
purified by reverse phase high pressure liquid chromatography as
described previously (35). Fractions containing the high mobility band
that was believed to correspond to HMGN3b were identified by Western
analysis of 15% SDS-polyacrylamide gels. The band in question was cut
from the gel and analyzed by matrix-assisted laser desorption
ionization/time of flight mass spectrometry (Protein/DNA Technology
Center, Rockefeller University).
Gel Retardation Analysis--
Nucleosome core particles were
purified from chicken red blood cell nuclei as described previously
(18, 38). Recombinant HMGN protein (20-200 nM) was
incubated with 50 nM core particles in 5 µl of 2× TBE
with 2% Ficoll for 15 min on ice. Samples were then loaded directly
onto a 5% polyacrylamide gel made in 2× TBE and electrophoresed at
4 °C. A parallel lane containing bromphenol blue and xylene cyanol
dyes was run to measure the migration distance. After electrophoresis,
gels were stained with SYBR gold stain (Molecular Probes) and
photographed using a yellow photographic filter.
Analysis of the Nucleosome Sequence Preferences of HMGN1 and
HMGN3--
His6-tagged HMGN1 and HMGN3a (20 µg) were
incubated with 80 µl of a 25% slurry of TALON resin in 2× TBE on a
rotating wheel overnight at 4 °C. The slurry was washed 5 times with
2× TBE and resuspended in a total volume of 80 µl of 2× TBE. The
efficiency of HMGN binding to the resin was assessed by
SDS-polyacrylamide gel electrophoresis. The HMGN resin (400 ng of
protein) was incubated with 10 µg of nucleosome core particles in 100 µl of binding buffer (20 mM Tris, pH 7.5, 100 mM NaCl, 2 mM EDTA, 0.1% Tween 20, 5% glycerol, 2 mM dithiothreitol, 0.5 mg/ml bovine serum
albumin). The total volume of resin slurry added was equalized to 5 µl in each reaction. Samples were incubated for 2 h at 4 °C
on a rotating wheel and then the HMGN resin with bound core particles
was pelleted and washed 3 times with binding buffer. To extract the DNA
from the pelleted resin, 150 µl of stop buffer (0.2 M
NaCl, 1 mM EDTA, 1% lithium dodecyl sulfate, 0.4 M LiOAc) was added, and then the mixture was extracted
twice with phenol/chloroform/isoamyl alcohol prior to ethanol
precipitation in the presence of glycogen. As a control, DNA was also
extracted from the unselected nucleosome pool. The DNA sequences were
analyzed by a modified version of the Random Amplified Polymorphic DNA
(RAPD) method, which is a PCR-based technique (39). Each RAPD reaction
contained one set of three 10-base oligonucleotide primers (obtained
from Operon technologies, Inc.), which generated an average of 60 PCR
products. In a previous study of whether HMGN1 and HMGN2 display
sequence preference when binding to nucleosomes, 30 sets of 3 primers
each were used to screen the nucleosomal DNA (39). Here, three of the
primer sets were used. Set 1 contained primers W11, AE18, and BE11
(Operon Technologies, Inc.). Set 2 contained K06, AM03, and AD13. Set 3 contained primers AD08, AR11, and F08. PCRs were performed with
amplitaq DNA polymerase under the manufacturer's recommended
conditions (PerkinElmer Life Sciences) and contained one set of
end-labeled primers and 50 ng of extracted nucleosomal DNA. A control
reaction without template DNA was also performed. The PCR conditions
were 30 cycles of 30 s at 95 °C, 30 s at 45 °C, and
30 s at 72 °C. Samples were electrophoresed on a sequencing gel, which was then dried and visualized by PhosphorImager analysis (Molecular Dynamics).
Northern Hybridization--
Human and mouse RNA master dot blots
and Northern blots (CLONTECH) were probed with
32P-labeled open reading frame of human HMGN3 according to
the manufacturer's protocol. The human RNA master blot was also probed
with nucleotides 632-1015 from the 3'-UTR of the HMGN2 cDNA. The
autoradiograms were scanned using a Molecular Dynamics densitometer and
analyzed with ImageQuant software (Molecular Dynamics). The samples on the dot blots have been normalized to eight different housekeeping genes to allow the accurate determination of relative mRNA
expression levels, whereas the samples on the Northern blots are
normalized to -actin (CLONTECH).
The RNA samples on the human RNA master dot blot in Fig. 7 are as
follows: A1, whole brain; A2, amygdala;
A3, caudate nucleus; A4, cerebellum;
A5, cerebral cortex; A6, frontal lobe;
A7, hippocampus; A8, medulla oblongata;
B1, occipital lobe; B2, putamen; B3,
substantia nigra; B4, temporal lobe; B5,
thalamus; B6, subthalamic nucleus; B7, spinal
cord; C1, heart; C2, aorta; C3,
skeletal muscle; C4, colon; C5, bladder;
C6, uterus; C7, prostate; C8, stomach;
D1, testis; D2, ovary; D3, pancreas;
D4, pituitary gland; D5, adrenal gland;
D6, thyroid gland; D7, salivary gland;
D8, mammary gland; E1, kidney; E2,
liver; E3, small intestine; E4, spleen;
E5, thymus; E6, peripheral leukocyte;
E7, lymph node; E8, bone marrow; F1, appendix; F2, lung; F3, trachea; F4,
placenta; G1, fetal brain; G2, fetal heart;
G3, fetal kidney; G4, fetal liver; G5,
fetal spleen; G6, fetal thymus; G7, fetal lung;
H1, yeast total RNA; H2, yeast tRNA;
H3, Escherichia coli rRNA; H4,
E. coli DNA; H5, poly(rA); H6, human
Cot 1 DNA; H7, human DNA 100 ng; and
H8, human DNA 500 ng.
The RNA samples on the mouse RNA master dot blot in Fig. 7 are as
follows: A1, brain; A2, eye; A3,
liver; A4, lung; A5, kidney; B1,
heart; B2, skeletal muscle; B3, smooth muscle;
C1, pancreas; C2, thyroid; C3, thymus;
C4, submaxillary gland; C5, spleen;
D1, testis; D2, ovary; D3, prostate;
D4, epididymis; D5, uterus; E1, 7-day
embryo; E2, 11-day embryo; E3, 15-day embryo,
E4, 17-day embryo; F1, yeast total RNA;
F2, yeast tRNA; F3, E. coli rRNA; and
F4, E. coli DNA.
 |
RESULTS |
The mRNA for HMGN3 Exists as Two Splice Variants--
HMGN3
was detected in a yeast two-hybrid assay through its
ligand-dependent interaction with the thyroid hormone
receptor, TR 1 (32). The annotated sequence of the partial HMGN3
cDNA clone in the GenBankTM data base (accession number
L40357) indicates the presence of several amino acids upstream to the
PKRK motif that is the consensus N terminus of all HMGN proteins. Thus,
it is possible that translation of the HMGN3 mRNA initiates
upstream of this partial cDNA, generating a novel type of HMGN
protein with additional N-terminal residues. A BLAST search with the
L40357 sequence yielded over 60 EST clones for human HMGN3, indicating
that this gene is widely expressed. Whereas there is some sequence
variability in the 5' regions of these clones, probably as a result of
sequence or cloning errors, the EST with the longest sequence upstream of the putative open reading frame is clone BE791451. This clone does
not contain any additional translation initiation codons, suggesting
that the start of the protein is at the PKRK motif. To confirm that
this is the full transcript, the 5'-UTR was also cloned by PCR from a
CapSite cDNATM library (Fig.
1A). The generation of the
CapSite cDNATM library utilizes the 5'
m7GpppN cap structure on eukaryotic mRNAs, so each
cDNA clone should include its complete 5' end. Two nested PCRs,
each using a library-specific primer and a primer specific for HMGN3,
were performed to clone the 5'-UTR of the mRNA. A single product
was generated, cloned, and sequenced. The sequence of the CapSite
cDNATM HMGN3 clone is the same as that of clone
BE791451, except that it has 5 nucleotides missing from the 5' end
(Fig. 1A). We conclude that translation of HMGN3 initiates
at the ATG codon at the start of the PKRK motif.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 1.
The mRNA sequences of human and mouse
HMGN3. A, alignment of the consensus mRNA sequences
from human and mouse HMGN3. The mRNA sequences were derived by
comparison of several different EST clones, and nucleotides conserved
between human and mouse are in bold. For human HMGN3, the
sequence of the 5'-UTR was independently verified by PCR cloning from a
CapSite cDNATM library, and the sequence from the PCR
product is italicized. The reverse complements of the two
primers used in cloning are indicated by dotted underlines.
The translation initiation and termination codons are double
underlined, and the 41-nt deletion in the splice variant is
underlined. The polyadenylation signal is indicated by a
dashed underline. B, the mRNA sequences of human HMGN3a
and HMGN3b in the region of differential splicing. The translated
sequence of hHMGN3a is shown above the alignment, and the
translation of hHMGN3b is shown below. The consensus GT and
AG splice site nucleotides are indicated in bold and
underlined.
|
|
The complete sequence of the human HMGN3 mRNA, which has been
deposited in GenBankTM, was deduced by comparing the
sequences of several EST clones and the CapSite cDNATM
clone (Fig. 1A). The mRNA is 854 nt long, encodes a
protein of 98 residues, and has a strong polyadenylation signal 24 nucleotides from the end (Fig. 1A). The human EST data base
also contains many ESTs that are predicted to encode a truncated form
of HMGN3. These ESTs have a 41-nucleotide deletion that occurs after
the codon for glycine 72 (Fig. 1, A and B). The
deletion causes a frameshift such that the succeeding codons encode
Thr-Glu-Asn-STOP, and thus the translation product is 77 residues long.
It is notable that the consensus mRNA sequences for the full-length
and truncated proteins are identical except for the 41-nt deletion,
indicating that they are both from the same gene and result from
alternative splicing of the same primary transcript. Indeed, the
message contains the consensus splicing signals GT and AG at either end
of the deletion (indicated in bold and underlined
in Fig. 1B). The predicted full-length and truncated
proteins are termed HMGN3a and HMGN3b, respectively, to indicate that
they are different splice forms.
The structures of the HMGN3 mRNAs are similar to those of HMGN1
(40) and HMGN2 (41), as each has a short 5'-UTR of 107-150 nt, an open
reading frame of 237-276 nt, and a longer 3'-UTR of 440-900 nt (Fig.
2A). The open reading frame of
HMGN3 shares 56-65% identity with those of HMGN1 and HMGN2. The
5'-UTR is less conserved, sharing 43-48% identity with those of HMGN1
and N2, and the 3'-UTRs are only 35-39% identical.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
The mRNA and gene structure of
HMGN3. A, schematic representations of the mRNAs
for human HMGN3a and HMGN3b and HMGN1 and HMGN2. The HMGN3b mRNA
has a 41-nt deletion and a new stop signal, which shorten the open
reading frame by 63 nt. The homologies between HMGN3 and either HMGN1
or HMGN2 for the 5'-UTR, the open reading frame, and the 3'-UTR are
indicated below the respective regions of the HMGN1 and HMGN2 mRNA
diagrams. B, structures of the genes for human
HMGN2 and HMGN3. The size of the gene, from the
start of exon I to the end of exon VI, is shown to the right
of each diagram. Exon numbers are indicated in roman
numerals below the HMGN3 gene
representation. Exon I includes the 5'-UTR (white) and the
first five codons of the open reading frame (black). The
portion of exon V absent from the HMGN3b splice variant is indicated in
white. Exon VI encodes the end of the open reading frame
(black) and the whole of the 3'-UTR (white). The
sizes of each intron and exon are shown in the table below.
For both exons I and VI, the number in parentheses
corresponds to the number of nucleotides in the open reading frame
within that exon. For exon V and intron V, the size of the region in
HMGN3a is given first and then the size in
HMGN3b.
|
|
The Structure of the HMGN3 Gene--
The HMGN3 gene was
identified by a BLAST search of the human genome data base using the
consensus HMGN3 mRNA sequence. The gene is located on chromosome 6 in band 6q27 at 83.8 megabases, and the genomic sequence confirms the
mRNA sequence shown in Fig. 1A. The HMGN3
gene has six exons, as do the HMGN1 and HMGN2
genes (Fig. 2B) (42, 43), and the intron/exon boundaries are
conserved between all three genes (Fig.
3A). Exon I of the
HMGN3 gene encodes the 5'-UTR and the first four amino acid
residues. Exon VI encodes the final 12 residues and all of the 3'-UTR.
The genomic sequence reveals that the shorter splice variant HMGN3b
arises due to a truncation of exon V, and all the other exons are the
same between the two variants. In contrast to the relatively short
genes for HMGN1 (6.8 kb) and HMGN2 (3.5 kb), the
HMGN3 gene spans over 32 kb (Fig. 2B). The
longest intron in the HMGN3 gene is intron I, which is 18 kb, and each subsequent intron is shorter than the one before it.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
The amino acid sequence of HMGN3 is conserved
between different vertebrate species, and with other HMGN
proteins. A, alignment of the amino acid sequences of
human HMGN3a, HMGN3b, HMGN2, and HMGN1. Highly conserved residues are
in bold, and the total number of amino acids is given at the
end of each sequence. The peptides used to raise antibodies
to HMGN3 are indicated above the alignment. The two nuclear
localization signals (NLS1 and NLS2), the NBD, and the
chromatin-unfolding domain are also indicated. Below the
alignment are the exon boundaries and the percent homologies between
HMGN3 (N3) and HMGN1 (N1) or HMGN2
(N2) within each exon. B, HMGN3a and HMGN3b are
found in several vertebrates. Identical amino acid residues are
indicated by a period, and the percent identity between
human HMGN3 and each clone is to the right of each sequence.
Residues of hHMGN3a that are conserved in all the HMGN3a sequences
shown are represented in bold, and those that are not also
conserved with HMGN1 or HMGN2 are underlined. The
GenBankTM accession numbers for the cDNA sequences are
as follows: M. musculus HMGN3a, AW823915; M. musculus HMGN3b, AA981952; Rattus sp. HMGN3, H31484
(start) and AA851306 (end); B. taurus, AV597694; X. laevis HMGN3a, AW765830; and X. laevis HMGN3b,
BE506630.
|
|
Two retropseudogenes for HMGN3 were identified, both located
on chromosome 1 in band 1q21.3. Both retropseudogenes lack introns and
are 93% identical to the mRNA sequence of HMGN3a from bases 1 to
735. The first retropseudogene, starting at position 117,353 of contig
NT_004441.3, has no typical regulatory elements in its 5' region,
whereas the 5'-sequence for the second retropseudogene, starting at
position 287,580 of contig NT_004441.3, is not available. The lack of
introns or regulatory elements points to a retroviral mechanism of
origin, although no direct repeats could be identified for either
retropseudogene. Neither of these retropseudogenes could produce
functional proteins if they were transcribed, as the first has crucial
mutations in the nuclear localization signal, and the second has a
frameshift shortly after the start of the open reading frame.
Like most housekeeping genes (44), the genes for HMGN1 and
HMGN2 have CpG islands that span the entire promoter region
and terminate at the start of exon II (42, 43). The CpG island program
from the European Bioinformatics Institute defined the HMGN2
CpG island as spanning nucleotides 279 to +795, with a G + C content
of 73% and a CpG dinucleotide content of 11.4%. The CpG island for
HMGN1 stretches from 556 to +857, has a C + G content of
70%, and a CpG content of 9.5%. The HMGN3 gene also has a
CpG island from 160 to +922, but it is less prominent, with a G + C
content of 58.5%, and a CpG content of 6%. A search for potential
transcription factor-binding sites in the promoters for HMGN1,
HMGN2, and HMGN3 revealed very few sites that are
present in all three genes. The major element common to all three genes is a CCAAT box between 59 and 101, which conforms well to the 9-base pair consensus sequence for the transcription factor NF-Y (45).
The CCAAT box is one of the most ubiquitous promoter elements, and NF-Y
is the major factor that recognizes it (46). Sp1 consensus sites, which
can bind members of a large family of Sp1-related transcription
factors, are found in a very high number of promoters (47, 48), and
both HMGN1 and HMGN2 have several Sp1 sites. HMGN3 does not have either a TATA box or Sp1 consensus
sites. The only other potential binding site that is common to all
three genes is that for SRY. The lack of conserved transcription
factor-binding sites between the promoters of the HMGN genes
and the less prominent CpG island for HMGN3 suggests that
the expression of each of these genes is regulated differently.
The Amino Acid Sequence of HMGN3 Is Highly Related to Those of
HMGN1 and HMGN2--
The amino acid sequence of HMGN3a is 41 and 54%
identical to those of HMGN1 and HMGN2, respectively (Fig.
3A). Significantly, all the functional domains
characteristic of the HMGN protein family, the bipartite nuclear
localization signal (NLS1 and -2), the NBD, and the chromatin unfolding
domain are present in HMGN3a (Fig. 3A). The NBD, which is
rich in prolines and positively charged residues and is encoded mainly
by exons III and IV, is very highly conserved between the three
proteins. In particular, 9 of the 10 residues encoded by exon III are
invariant in all HMGN proteins. The second residue in this domain,
Thr-23 in HMGN3, varies between the different HMGN classes,
being Lys in all HMGN1 proteins and Gln for nearly all HMGN2 proteins.
The bipartite nuclear localization signal in exons I (NLS1) and V
(NLS2) is also highly conserved between the three proteins. The
C-terminal domain of HMGN3 differs to a greater extent, however, being
only 25 and 43% identical to those of HMGN1 and HMGN2, respectively.
It does contain the peptide PSENGETKAE, however, which is well
conserved in all other HMGN proteins (49). The C-terminal domain of
HMGN3a has a net negative charge of 8, which is greater than the
charges of 7 and 2 for HMGN1 and HMGN2, respectively. The
C-terminal domain is responsible for the chromatin unfolding and
transcriptional activation activities of HMGN proteins, and the overall
negative charge is characteristic of the transcriptional activation
domains in many other proteins (50), including all members of the
HMGB (HMG box) family (49). Most of the C-terminal domain is absent in
the splice variant HMGN3b, as the final 24 residues, including the
PSENGETKAE peptide, are replaced by the residues Glu and Asn.
HMGN3 Is Present in Many Vertebrate Species--
ESTs for HMGN3a
were found in cDNA libraries from a variety of vertebrates,
including mouse, rat, cow, and frog (Fig. 3B). A 915-nt
consensus sequence for mouse HMGN3 mRNA was deduced by comparison
of several ESTs (Fig. 1A). It is 80% identical to the human
mRNA overall, and the open reading frame is 91% identical to that
of human HMGN3. In addition, splice variants homologous to human HMGN3b
were identified in murine and frog EST libraries (Fig. 3B).
The nucleotide sequences surrounding the splice sites at either end of
the 41-nt deletion, including the AG and GT dinucleotides noted
earlier, are absolutely conserved between the human, mouse, and frog
sequences. The same sequences are found in the rat and cow ESTs,
suggesting that the HMGN3b splice variant also exists in these species.
At the amino acid level, the cow, mouse, and frog HMGN3a
share 91, 86, and 71% identity with human HMGN3a, respectively (Fig.
3B). An alignment of the human, mouse, rat, cow, and frog
HMGN3a protein sequences reveals that 61 of the 98 residues are
absolutely conserved between these species (Fig. 3B,
residues in bold). Many of these residues are also conserved with HMGN1 and HMGN2, but 18 of them do not occur in either human HMGN1
or HMGN2 and thus represent a unique amino acid signature for HMGN3
(Fig. 3B, underlined residues). For example, the
variable residue encoded by exon III is Thr in all species of
HMGN3. These observations imply that HMGN3a and HMGN3b are distinct
HMGN proteins that are well conserved in all vertebrates and thus may
play important roles within the cell.
HMGN3a and HMGN3b Are Translated in Vivo--
To determine whether
the mRNA for HMGN3 is indeed translated in vivo, Western
blot analysis was performed on cell extracts using the following three
antibodies raised against peptides from HMGN3: 2751, 2752, and
2859 (Fig. 3A). The peptides were chosen for their lack
of conservation with HMGN1 and HMGN2, with the intention of generating
antibodies specific for HMGN3. Western blots of recombinant proteins
revealed that all three antibodies are indeed specific for HMGN3, as
they recognize HMGN3a but do not recognize HMGN1 or HMGN2 (Fig.
4A, lanes 5-13). Furthermore, a polyclonal antibody raised against full-length HMGN2 only weakly recognizes HMGN3 (Fig. 4A, lane 16), despite the 54%
identity between the two proteins.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 4.
HMGN3a and HMGN3b proteins are
expressed in vivo. A, antibodies raised against
peptides from HMGN3 are specific for this protein. Western blot
analysis of recombinant HMGN1, HMGN2, and HMGN3a with antibodies 2751 (lanes 5-7), 2752 (lanes 8-10), and 2859 (lanes 11-13) against HMGN3, or with a polyclonal antibody
against HMGN2 (lanes 14-16). Lanes 1-4 show a
Coomassie Blue-stained gel of the same proteins and molecular
mass size markers. For the Western blots, 100 ng of each
recombinant protein was loaded, whereas 500 ng of each protein was
loaded on the Coomassie Blue-stained gel. B, two forms of
HMGN3 are expressed in HeLa cells. Western blots of recombinant HMGN3a
(lanes 1 and 4), 5% PCA extract from HeLa cells
(lanes 2 and 5), and recombinant HMGN3b
(lane 3). The blots were probed with either antibody 2752 (lanes 1-3) or 2859 (lanes 4 and 5).
C, HMGN3 is expressed in a cell line-specific manner.
Recombinant HMGN3a (lane 1) and 5% PCA extracts from HeLa
(lane 2), MCF-7 (lane 3), Hepa 1 (lane
4), and CV-1 cells (lane 5) were loaded. The top
panel shows a Western blot probed with antibody 2752; the
middle panel shows a blot probed with anti-HMGN2; and the
bottom panel shows part of the equivalent Coomassie
Blue-stained gel in the region of H1 as a loading control.
|
|
Western blots of a 5% PCA extract from HeLa cells probed with
antibodies 2752 (Fig. 4B, lane 2) or 2751 (not shown) reveal two bands. The upper band has the same mobility as recombinant HMGN3a
(Fig. 4B, lane 1) and corresponds to the full-length HMGN3a. These data support the above conclusion that translation begins at the
PKRK motif, rather than at an unidentified upstream ATG codon, which
would generate a larger protein. The lower band in the HeLa extract has
the same mobility as recombinant HMGN3b, the splice variant (lane
3). Antibody 2859, which was raised against a C-terminal peptide,
recognizes the full-length protein but not the smaller band (Fig.
4B, lane 5). Furthermore, matrix-assisted laser
desorption ionization/time of flight spectrometry of the lower band
confirmed that this protein is indeed a C-terminally truncated variant
of HMGN3. These data are consistent with the lower band corresponding
to the splice variant that is truncated at the C-terminal end and
indicate that both splice forms are expressed in HeLa cells. Extracts
from the human breast carcinoma line, MCF-7, contain much less HMGN3
than HeLa cells (Fig. 4C, lane 3), and no HMGN3 was detected
in extracts from the monkey kidney cell line, CV-1 (Fig. 4C, lane
5), or the mouse liver cell line, Hepa-1 (Fig. 4C, lane
4). In contrast, HMGN2 had high expression in HeLa, MCF-7, and
CV-1 cells but lower expression in the Hepa-1 cell line. It can be
concluded that both HMGN3a and HMGN3b are translated in vivo
and that their levels of expression vary considerably between cell lines.
HMGN3 Binds to Nucleosomes with Little or No Sequence
Selectivity--
The hallmark of HMGN proteins is the
nucleosome-binding domain that enables them to bind specifically to
chromatin, and sequence comparisons indicate that HMGN3 also possesses
a nucleosome-binding domain. To determine whether this domain is
functional, the ability of recombinant HMGN3a to bind to nucleosomes
was analyzed by gel retardation assays (Fig.
5). HMGN3a was able to bind nucleosome core particles in a similar manner to HMGN1, and with comparable affinity (Fig. 5, compare lanes 5 and 10). This
is consistent with the observation that the nucleosome-binding domain
is highly conserved between HMGN1, HMGN2, and HMGN3 (Fig.
3A).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5.
Binding of HMGN3a to nucleosome core
particles. Gel mobility shift assay of nucleosome core particles
with recombinant HMGN3a (lanes 1-5) or HMGN2 (lanes
6-10) under cooperative binding conditions at the molar ratios
indicated above each lane. The unbound core particles
(cp) and the complex of 2 HMGN molecules per core particle
(2HMGN-cp) are indicated.
|
|
To test whether HMGN3 recognizes specific chromatin subunits, we used a
recently developed approach for examining the DNA sequence of
nucleosomes bound by HMGN proteins, which is based on the
random amplified polymorphic
DNA method (RAPD) (39). This sensitive technique is
suitable for detecting differences in the sequence composition of
different DNA pools. Histidine-tagged HMGN3a or HMGN1 was incubated
with a large excess of nucleosome core particles, and the fraction of
core particles that bound to the HMGN protein was isolated using the
histidine tag. DNA from the bound core particles was extracted and
amplified in three different RAPD PCRs, each of which contained one set
of three 10-base oligonucleotide primers. The RAPD reaction generates a mixture of differently sized products depending on where the
oligonucleotides anneal within the nucleosomal DNA population. The
three primers sets used here are a subset of the 30 primer sets used in
a previous study of whether HMGN1 and HMGN2 display sequence
preferences when binding to nucleosomes (39). After electrophoresis on
sequencing gels, the pattern of bands from the HMGN3a-bound core
particles (Fig. 6, lanes 4 and
8) was compared with those from unbound (lanes 2 and 6) and HMGN1-bound core particles (lanes 3 and 7). No significant differences were found between the
three DNA samples for any of the primer sites tested (Fig. 6 and data
not shown). The data indicate that HMGN3a does not have a detectable
sequence preference when binding to nucleosomes. This concurs with
previous data showing that neither HMGN1 nor HMGN2 have strong DNA
sequence preferences (39).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 6.
RAPD sequence analysis reveals no sequence
specificity in the binding of HMGN3a to nucleosomes. Analysis of
nucleosome core particles bound to HMGN1 or HMGN3a affinity columns.
DNA was extracted from the bound core particles and then used as a
template in two PCRs, each containing one set of three different 10-mer
oligonucleotides as primers (set 1, lanes 1-4; set 2, lanes 5-8). The PCRs were run on a sequencing gel, and
differences in the DNA composition of each sample would be reflected as
differences in the ladder of DNA bands. Control PCRs containing no DNA
template (lanes 1 and 5) or the whole nucleosome
core particle population (lanes 2 and 6) were
also performed.
|
|
HMGN3 Has a Tissue-specific Expression Pattern--
The expression
of HMGN3 in a wide range of human and mouse tissues was analyzed by RNA
dot blots (Fig. 7). In these blots, the
amounts of RNA in each spot are normalized to the transcription levels
of 8 housekeeping genes; therefore, the intensity of the spot is
indicative of the relative mRNA abundance in a tissue. Quantitative
analysis of the spots indicates tissue-specific variations in the
mRNA levels of each of the transcripts. HMGN3 is expressed in
nearly all the tissues tested, but there is considerable variation in
the level of expression between different tissues. The highest expression of human HMGN3 occurs in the pancreas, the pituitary gland,
and the heart, whereas expression was low in the brain. In contrast,
the expression of mouse HMGN3 is very low in the pancreas but high in
the brain and prostate. The highest expression in mouse is in the eye,
however, where it is expressed at a 3-fold higher level than in the
brain. Intermediate expression of HMGN3 is found in many tissues in
both mouse and human, including the thyroid, kidney, and testis,
whereas expression in the liver is intermediate in humans but very low
in mouse. The data indicate that whereas the expression of HMGN3 is
comparable between mouse and human in many tissues, there are some
major differences between the HMGN3 expression patterns in the two
species.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 7.
RNA dot blots show tissue-specific expression
of HMGN3 in both human and mouse. Human (A and
C) and mouse (B) RNA master blots
(CLONTECH) were probed for HMGN3 or HMGN2.
D, comparison of relative HMGN3 expression in selected human
(shaded bars) and mouse tissues (black bars). The
human data was normalized to the strongest signal from the human
tissues (pancreas), whereas the mouse data was normalized to expression
in mouse brain. The dot blot coordinates of each tissue are listed
below each data point. Coordinates of the tissue spots not
shown are listed under "Experimental Procedures." E,
comparison of HMGN3 (shaded bars) and HMGN2 (open
bars) expression in selected human tissues. The HMGN2 data were
normalized to the highest HMGN2 expression, which is in the
thymus.
|
|
The pattern of expression of HMGN3 is significantly different from that
of HMGN2, which also displayed tissue specificity (Fig. 7E).
For example, in the pancreas HMGN3 is expressed at a high level,
whereas HMGN2 is only expressed at an intermediate level. Conversely,
in the thymus there is high expression of HMGN2 but intermediate
expression of HMGN3.
To confirm the tissue-specific expression pattern revealed by the RNA
dot blots, human and mouse multiple tissue Northern blots were probed
with hHMGN3 (Fig. 8). Three transcripts
of 0.9, 1.5, and 2.7 kb were observed, with the smallest transcript
being most abundant in all the tissues tested. These transcripts have different sizes than those of HMGN1 and HMGN2, which are 1.2 in human
and 1.1 kb in mouse. The size of the smallest transcript, 0.9 kb,
corresponds to the mRNA sizes of 854 and 915 bases deduced from human and mouse EST sequences, respectively (Fig. 1A).
It is likely that the longer mRNAs have extended 3'-UTRs due to
transcription readthrough. The Northern blot for mouse HMGN3 reveals a
similar pattern of tissue-specific expression as the mouse RNA dot
blot, with high expression in the brain, intermediate expression in the
kidney and testis, and low expression in the liver and skeletal muscle.
The lower panel shows the mouse Northern blot probed for -actin as a loading control.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 8.
Northern blot of HMGN3 mRNA in mouse and
human tissues. The multiple tissue Northern blot was probed for
HMGN3 (upper panel) or -actin (lower
panel).
|
|
To determine whether the pattern of HMGN3 protein expression
corresponds to the observed mRNA pattern, Western blot analysis was
performed on extracts from six different mouse tissues (Fig. 9). The splice variant, HMGN3b, was
present at significantly higher levels than the full-length form
(HMGN3a) in all the tissues, but the ratio between HMGN3a and HMGN3b
appeared to be constant in all tissues. Consistent with the mRNA
expression data, the highest protein expression was in the brain, with
intermediate expression in the kidney and low expression in the liver.
However, HMGN3 protein levels were significantly lower in the testis
than in the kidney, whereas the mRNA expression is similar in both tissues (Fig. 7C and 8), suggesting that in some tissues the
levels of HMGN3 proteins may be regulated post-transcriptionally. In contrast to he wide variation in HMGN3 protein levels, HMGN2 was expressed at a fairly constant level in the tissues analyzed (Fig. 9).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 9.
Both HMGN3a and HMGN3b are expressed in a
tissue-specific manner. Western analysis of 5% PCA extracts from
mouse tissues using antibody 2752 (upper panel) or
anti-HMGN2 (lower panel). Recombinant human HMGN3a and human
HMGN2 were run as markers.
|
|
 |
DISCUSSION |
Our results show that many cell types contain two new
nucleosome-binding proteins named HMGN3a and HMGN3b, which are splice variants of a transcript originating from a gene located on chromosome 6. The structures of the HMGN3a and HMGN3b proteins are very similar to
those of the canonical members of the HMGN family, HMGN1 and HMGN2.
Both splice variants contain the bipartite nuclear localization signal
and the nucleosome-binding domain. HMGN3a also contains a typical
chromatin-unfolding domain. However, HMGN3b has a C-terminal truncation
in which a critical portion of the chromatin-unfolding domain is
deleted. Both HMGN3 splice variants are expressed in a tissue-specific
manner that differs from that of HMGN2. ESTs for HMGN3a and HMGN3b are
found in a wide range of vertebrates, including frog, and the protein
sequence is over 70% conserved between species. Our findings expand
the cellular repertoire of nucleosome-binding proteins and raise the
possibility that different members of the HMGN protein family
participate in the regulation of specific sets of genes.
The HMGN3 Gene--
The HMGN3 gene spans 32 kb and is
much longer than the 6.8-kb HMGN1 gene or the 3.5-kb
HMGN2 gene. However, the intron/exon boundaries of the
HMGN3 gene are identical to those of the canonical HMGN1 and HMGN2, and all three genes have CpG
islands in their 5' region, although the CpG island for
HMGN3 is less prominent than those of HMGN1 and
HMGN2. The HMGN3 promoter area, spanning ~500
nucleotides 5' to the start of transcription, shares little sequence
homology with those of HMGN1 and HMGN2, and the
only major element common to all three genes is a CCAAT box that fits the consensus sequence for the transcription factor NF-Y (45, 46). The
lack of conserved elements in the HMGN3 promoter compared with those for HMGN1 and HMGN2, and its less
prominent CpG island, indicate that the regulation of expression of
HMGN3 is likely to be quite different from those of HMGN1 and HMGN2 and
may account for the distinct tissue-specific expression patterns of
these proteins.
The HMGN3a and HMGN3b Splice Variants--
The major HMGN3
transcript is 854 nt long and, unlike other HMGN transcripts, undergoes
alternative splicing in which 41 nt at the 3' end of exon V are
removed, resulting in the deletion of 22 amino acids from the C
terminus of the protein. At the amino acid level, the full-length
variant, HMGN3a, shares 41 and 54% identity with HMGN1 and HMGN2,
respectively. The most conserved regions are the nucleosome-binding
domain and the two nuclear localization signals. The functionality of
the nucleosome-binding domain was confirmed by gel shift analysis using
recombinant HMGN3a and nucleosome core particles. The nuclear
localization of HMGN3 was confirmed by microscopy of cells transfected
with a plasmid expressing GFP-tagged
HMGN3.3
Although the chromatin-unfolding domain of HMGN3a is less well
conserved than other domains of the protein, it still has a net
negative charge and possesses the conserved peptide PSENGETKAE that is
found in all HMGN family members. It is interesting that the C-terminal
22 residues, including the PSENGETKAE peptide, are absent from the
splice variant, HMGN3b. C-terminal deletion mutants of HMGN1 or HMGN2
truncated at the same position are unable to unfold chromatin or to
activate transcription but can still bind to nucleosomes (4, 6).
Replacement of the deleted region with the acidic activation domains of
HMGB2 (HMG-2)1 or GAL4 restored the chromatin unfolding and
transcription activation abilities of HMGN1, indicating the importance
of the negative charge in the C-terminal domain (4). These data
indicate that the full-length protein, HMGN3a, is likely to unfold
chromatin and activate transcription, whereas the shorter splice
variant may be inactive in this respect. Furthermore, it is conceivable that the splice variant could act as a dominant negative inhibitor by
binding to chromatin and preventing the access of full-length HMGN
proteins (6). This could be an important function, as HMGN3b is present
at levels similar to or greater than those of HMGN3a. The ratio
between the two proteins did not vary significantly between different
mouse tissues, suggesting that the alternative splicing is not subject
to tissue-specific regulation. There are many reports of splice
variants with functional differences, including a recent study on the
splice variants HMGAIa (HMG-I) and HMGA1b (HMG-Y),1 which
differ by 11 amino acid residues between the first and second AT-hook
DNA binding domains (51, 52). The two variants modulate the expression
of distinctive sets of genes, and only HMGA1b can promote tumor
formation and metastasis in nude mice (53).
Tissue and Species Specificity of HMGN3 Splice Variants--
HMGN3
is expressed in most tissues, although at apparently lower levels than
its closest homologue HMGN2. A rough indication of the overall level of
expression is given by the observation that in the human EST data base
there are ~65 ESTs for HMGN3, compared with over 470 ESTs for HMGN2.
It is relevant that all previous protein purification and cDNA
cloning detected HMGN1 and HMGN2 but not HMGN3 proteins. Taken
together, the data suggest that HMGN3 is less abundant than HMGN1 or HMGN2.
The level of HMGN3 expression varies considerably between tissues, and
the tissue-specific expression pattern is distinct from those of HMGN2
or HMGN1. For example, human HMGN3 is expressed most highly in the
pancreas and pituitary gland, whereas human HMGN2 is expressed most
highly in the thymus and thyroid gland. In comparison, the highest
expression of HMGN1 is in the kidney and
thymus.4 Mouse HMGN3 has a
different expression pattern than human HMGN3 and is particularly
highly expressed in the eye and brain. Preliminary immunolocalization
studies with brain slices indicate that HMGN3 but not HMGN2 localizes
to regions that are enriched in antigens specific for glial
cells.3
Like HMGN1 and HMGN2, both variants of HMGN3 are present in a wide
range of vertebrates from amphibians to human, and the degree of
sequence conservation with human HMGN3a varies from 71% in frog to
91% in cow. The level of sequence conservation is comparable to those
of HMGN1 and HMGN2, which share 65-76% identity between their human
and frog counterparts. It is notable that 18 of the HMGN3a residues are
totally conserved between all the species studied yet do not occur in
either HMGN1 or HMGN2. Thus, the HMGN3 splice variants are clearly a
novel type of HMGN protein and may perform functions that are distinct
from those of HMGN1 or HMGN2.
Cellular Function of HMGN3 Proteins--
The discovery of
additional HMGN proteins raises the possibility that the different
family members have distinct roles within the cell, an hypothesis
supported by the strong evolutionary conservation and distinct
tissue-specific expression patterns of each HMGN protein. Recent
studies have shown that HMGN proteins are highly mobile within the
nucleus (23) and that they are components of multiprotein complexes
(39). Indeed, it is likely that the HMGN proteins are targeted to their
sites of action in chromatin by association with specific protein
partners, rather than by recognizing particular DNA sequences (39). We
speculate that the different HMGN isoforms are components of different
protein complexes and are thus specifically localized to the distinct chromatin regions where they are required.
The original finding that HMGN3a binds to TR 1 and retinoid X
receptor in a ligand-dependent fashion (32) points to one possible function for this protein. Chromatin modification is an
important aspect of the mechanism of action of the thyroid hormone
receptor (54, 55). It is possible that TR 1 recruits HMGN3 to assist
in chromatin unfolding and promote transcriptional activation. We have
been unable to confirm the interaction of HMGN3 with TR 1 by using
recombinant proteins in vitro, however, and we are currently
investigating the possibility that additional proteins and/or chromatin
are needed to facilitate the interaction in vivo.
 |
ACKNOWLEDGEMENTS |
We thank Ulla Hansen and Han-Fei Ding for the
expression vector for His6-HMGN1.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Both authors contributed equally to this work.
§
To whom correspondence and reprint requests should be addressed:
Bldg. 37, Rm. 3D12, NCI, National Institutes of Health, Bethesda, MD
20892. Tel.: 301-496-5235; E-mail: klmarsh@pop.nci.nih.gov.
¶
Present address: Laboratory of Nutrition, Division of Life
Sciences, Graduate School of Agricultural Science, Tohoku University, 1-1 Tsutsumidori-Amamiya-cyo, Aoba-ku, Sendai 981-8555, Japan.
Published, JBC Papers in Press, May 16, 2001, DOI 10.1074/jbc.M101692200
1
The revised nomenclature for HMG proteins is as
follows: HMGN1 was HMG-14. HMGN2 was HMG-17. HMGN3 was Trip7. HMGB2 was
HMG-2. HMGAIa was HMG-I. HMGAIb was HMG-Y.
3
Y. Ito, unpublished observations.
4
M. Bustin, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
NLS, nuclear
localization signal;
TR 1, thyroid hormone receptor 1;
NBD, nucleosome binding domain;
UTR, untranslated region;
PCR, polymerase
chain reaction;
PCA, perchloric acid;
kb, kilobase pair;
nt, nucleotide;
RAPD, random amplified polymorphic DNA.
 |
REFERENCES |
| 1.
|
Wolffe, A. P.,
and Kurumizaka, H.
(1998)
Prog. Nucleic Acids Res. Mol. Biol.
61,
379-422
|
| 2.
|
Wolffe, A. P.,
and Hayes, J. J.
(1999)
Nucleic Acids Res.
27,
711-720
|
| 3.
|
Bustin, M.,
Trieschmann, L.,
and Postnikov, Y. V.
(1995)
Semin. Cell Biol.
6,
247-255
|
| 4.
|
Ding, H. F.,
Bustin, M.,
and Hansen, U.
(1997)
Mol. Cell. Biol.
17,
5843-5855
|
| 5.
|
Trieschmann, L.,
Postnikov, Y. V.,
Rickers, A.,
and Bustin, M.
(1995)
Mol. Cell. Biol.
15,
6663-6669
|
| 6.
|
Trieschmann, L.,
Alfonso, P. J.,
Crippa, M. P.,
Wolffe, A. P.,
and Bustin, M.
(1995)
EMBO J.
14,
1478-1489
|
| 7.
|
Weigmann, N.,
Trieschmann, L.,
and Bustin, M.
(1997)
DNA Cell Biol.
16,
1207-1216
|
| 8.
|
Vestner, B.,
Bustin, M.,
and Gruss, C.
(1998)
J. Biol. Chem.
273,
9409-9414
|
| 9.
|
Paranjape, S. M.,
Krumm, A.,
and Kadonaga, J. T.
(1995)
Genes Dev.
9,
1978-1991
|
| 10.
|
Bustin, M.
(1999)
Mol. Cell. Biol.
19,
5237-5246
|
| 11.
|
Hock, R.,
Wilde, F.,
Scheer, U.,
and Bustin, M.
(1998)
EMBO J.
17,
6992-7001
|
| 12.
|
Mardian, J. K.,
Paton, A. E.,
Bunick, G. J.,
and Olins, D. E.
(1980)
Science
209,
1534-1536
|
| 13.
|
Sandeen, G.,
Wood, W. I.,
and Felsenfeld, G.
(1980)
Nucleic Acids Res.
8,
3757-3778
|
| 14.
|
Postnikov, Y. V.,
Trieschmann, L.,
Rickers, A.,
and Bustin, M.
(1995)
J. Mol. Biol.
252,
423-432
|
| 15.
|
Postnikov, Y. V.,
Herrera, J. E.,
Hock, R.,
Scheer, U.,
and Bustin, M.
(1997)
J. Mol. Biol.
274,
454-465
|
| 16.
|
Alfonso, P. J.,
Crippa, M. P.,
Hayes, J. J.,
and Bustin, M.
(1994)
J. Mol. Biol.
236,
189-198
|
| 17.
|
Trieschmann, L.,
Martin, B.,
and Bustin, M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
5468-5473
|
| 18.
|
Ausio, J.,
Dong, F.,
and van Holde, K. E.
(1989)
J. Mol. Biol.
206,
451-463
|
| 19.
|
Fletcher, T. M.,
and Hansen, J. C.
(1995)
J. Biol. Chem.
270,
25359-25362
|
| 20.
|
Thomas, J. O.
(1999)
Curr. Opin. Cell Biol.
11,
312-317
|
| 21.
|
de la Barre, A. E.,
Gerson, V.,
Gout, S.,
Creaven, M.,
Allis, C. D.,
and Dimitrov, S.
(2000)
EMBO J.
19,
379-391
|
| 22.
|
Misteli, T.,
Gunjan, A.,
Hock, R.,
Bustin, M.,
and Brown, D. T.
(2000)
Nature
408,
877-881
|
| 23.
|
Phair, R. D.,
and Misteli, T.
(2000)
Nature
404,
604-609
|
| 24.
|
Hock, R.,
Scheer, U.,
and Bustin, M.
(1998)
J. Cell Biol.
143,
1427-1436
|
| 25.
|
Spaulding, S. W.,
Fucile, N. W.,
Bofinger, D. P.,
and Sheflin, L. G.
(1991)
Mol. Endocrinol.
5,
42-50
|
| 26.
|
Bergel, M.,
Herrera, J. E.,
Thatcher, B. J.,
Prymakowska-Bosak, M.,
Vassilev, A.,
Nakatani, Y.,
Martin, B.,
and Bustin, M.
(2000)
J. Biol. Chem.
275,
11514-11520
|
| 27.
|
Herrera, J. E.,
Sakaguchi, K.,
Bergel, M.,
Trieschmann, L.,
Nakatani, Y.,
and Bustin, M.
(1999)
Mol. Cell. Biol.
19,
3466-3473
|
| 28.
|
Cooper, E.,
and Spaulding, S. W.
(1983)
Endocrinology
112,
1816-1822
|
| 29.
|
Levy-Wilson, B.
(1981)
Proc. Natl. Acad. Sci. U. S. A.
78,
2189-2193
|
| 30.
|
Sterner, R.,
Vidali, G.,
and Allfrey, V. G.
(1981)
J. Biol. Chem.
256,
8892-8895
|
| 31.
|
Shirakawa, H.,
Landsman, D.,
Postnikov, Y. V.,
and Bustin, M.
(2000)
J. Biol. Chem.
275,
6368-6374
|
| 32.
|
Lee, J. W.,
Choi, H. S.,
Gyuris, J.,
Brent, R.,
and Moore, D. D.
(1995)
Mol. Endocrinol.
9,
243-254
|
| 33.
|
Corpet, F.
(1988)
Nucleic Acids Res.
16,
10881-10890
|
| 34.
|
Heinemeyer, T.,
Wingender, E.,
Reuter, I.,
Hermjakob, H.,
Kel, A. E.,
Kel, O. V.,
Ignatieva, E. V.,
Ananko, E. A.,
Podkolodnaya, O. A.,
Kolpakov, F. A.,
Podkolodny, N. L.,
and Kolchanov, N. A.
(1998)
Nucleic Acids Res.
26,
362-367
|
| 35.
|
Postnikov, Y. V.,
Lehn, D. A.,
Robinson, R. C.,
Friedman, F. K.,
Shiloach, J.,
and Bustin, M.
(1994)
Nucleic Acids Res.
22,
4520-4526
|
| 36.
|
Pash, J.,
Popescu, N.,
Matocha, M.,
Rapoport, S.,
and Bustin, M.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
3836-3840
|
| 37.
|
Bustin, M.
(1989)
Methods Enzymol.
170,
214-251
|
| 38.
|
Kornberg, R. D.,
LaPointe, J. W.,
and Lorch, Y.
(1989)
Methods Enzymol.
170,
3-14
|
| 39.
|
Shirakawa, H.,
Herrera, J. E.,
Bustin, M.,
and Postnikov, Y.
(2000)
J. Biol. Chem.
275,
37937-37944
|
| 40.
|
Landsman, D.,
Srikantha, T.,
Westermann, R.,
and Bustin, M.
(1986)
J. Biol. Chem.
261,
16082-16086
|
| 41.
|
Landsman, D.,
Soares, N.,
Gonzalez, F. J.,
and Bustin, M.
(1986)
J. Biol. Chem.
261,
7479-7484
|
| 42.
|
Landsman, D.,
McBride, O. W.,
Soares, N.,
Crippa, M. P.,
Srikantha, T.,
and Bustin, M.
(1989)
J. Biol. Chem.
264,
3421-3427
|
| 43.
|
Landsman, D.,
McBride, O. W.,
and Bustin, M.
(1989)
Nucleic Acids Res.
17,
2301-2314
|
| 44.
|
Gardiner-Garden, M.,
and Frommer, M.
(1987)
J. Mol. Biol.
196,
261-282
|
| 45.
|
Mantovani, R.
(1998)
Nucleic Acids Res.
26,
1135-1143
|
| 46.
|
Mantovani, R.
(1999)
Gene (Amst.)
239,
15-27
|
| 47.
|
Cook, T.,
Gebelein, B.,
and Urrutia, R.
(1999)
Ann. N. Y. Acad. Sci.
880,
94-102
|
| 48.
|
Berg, J. M.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11109-11110
|
| 49.
|
Bustin, M.,
and Reeves, R.
(1996)
Prog. Nucleic Acids Res. Mol. Biol.
54,
35-100
|
| 50.
|
Hahn, S.
(1993)
Cell
72,
481-483
|
| 51.
|
Johnson, K. R.,
Lehn, D. A.,
and Reeves, R.
(1989)
Mol. Cell. Biol.
9,
2114-2123
|
| 52.
|
Friedmann, M.,
Holth, L. T.,
Zoghbi, H. Y.,
and Reeves, R.
(1993)
Nucleic Acids Res.
21,
4259-4267
|
| 53.
|
Reeves, R.,
Edberg, D. D.,
and Li, Y.
(2001)
Mol. Cell. Biol.
21,
575-594
|
| 54.
|
Freedman, L. P.
(1999)
Cell
97,
5-8
|
| 55.
|
Minucci, S.,
and Pelicci, P. G.
(1999)
Semin. Cell Dev. Biol.
10,
215-225
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Ueda, F. Catez, G. Gerlitz, and M. Bustin
Delineation of the Protein Module That Anchors HMGN Proteins to Nucleosomes in the Chromatin of Living Cells
Mol. Cell. Biol.,
May 1, 2008;
28(9):
2872 - 2883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Furusawa, J.-H. Lim, F. Catez, Y. Birger, S. Mackem, and M. Bustin
Down-Regulation of Nucleosomal Binding Protein HMGN1 Expression during Embryogenesis Modulates Sox9 Expression in Chondrocytes
Mol. Cell. Biol.,
January 15, 2006;
26(2):
592 - 604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. West, M. A. Castellini, M. K. Duncan, and M. Bustin
Chromosomal Proteins HMGN3a and HMGN3b Regulate the Expression of Glycine Transporter 1
Mol. Cell. Biol.,
May 1, 2004;
24(9):
3747 - 3756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Z. Strichman-Almashanu, M. Bustin, and D. Landsman
Retroposed Copies of the HMG Genes: A Window to Genome Dynamics
Genome Res.,
May 1, 2003;
13(5):
800 - 812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Ito and M. Bustin
Immunohistochemical Localization of the Nucleosome-Binding Protein HMGN3 in Mouse Brain
J. Histochem. Cytochem.,
September 1, 2002;
50(9):
1273 - 1275.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Raina, N. Mishra, S. Kumar, S. Kharbanda, S. Saxena, and D. Kufe
Inhibition of c-Abl with STI571 Attenuates Stress-Activated Protein Kinase Activation and Apoptosis in the Cellular Response to 1-beta -D-Arabinofuranosylcytosine
Mol. Pharmacol.,
June 1, 2002;
61(6):
1489 - 1495.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|