|
Originally published In Press as doi:10.1074/jbc.M101746200 on May 17, 2001
J. Biol. Chem., Vol. 276, Issue 28, 26090-26098, July 13, 2001
Alternative Mechanisms of Transcriptional Activation by
Rap1p*
Fatima-Zahra
Idrissi ,
Natalia
Garcia-Reyero,
Juan B.
Fernandez-Larrea, and
Benjamin
Piña§
From the Departament de Biologia Molecular i Cellular, Institut de
Biologia Molecular de Barcelona, Consejo Superior de
Investigaciones Científicas, Jordi Girona,
18.08034 Barcelona, Spain
Received for publication, February 26, 2001, and in revised form, May 17, 2001
 |
ABSTRACT |
Single Rap1p DNA-binding sites are
poor activators of transcription of yeast minimal promoters, even when
fully occupied in vivo. This low efficiency is due to two
independent repression mechanisms as follows: one that requires the
presence of histones, and one that requires Hrs1p, a component of the
RNA polymerase II mediator complex. Both repression mechanisms were
greatly reduced for constructs with tandemly arranged sites. In these
constructs, UASrpg sequences (ACACCCATACATTT) activated better than
telomere-like sequences (ACACCCACACACCC) in an
orientation-dependent manner. Both mutations in the SWI/SNF
complex and a deletion of amino acids 597-629 of Rap1p (Tox domain)
decreased synergistic effects of contiguous telomeric sites.
Conversely, deletion of amino acids 700-798 of Rap1p (Sil domain) made
UASrpg and telomeric sites functionally indistinguishable. We propose
that the Sil domain masks the main transactivation domain of Rap1p in
Rap1p-telomere complexes, where the Tox domain behaves as a secondary
activation domain, probably by interacting with chromatin-remodeling
complexes. Rap1p DNA-binding sites in ribosomal protein gene promoters
are mainly UASrpg-like; their replacement by telomeric sequences in one
of these promoters (RPS17B) decreased transcription by
two-thirds. The functional differences between UASrpgs and telomeric
sequences may thus contribute to the differential expression of
Rap1p-regulated promoters in vivo.
 |
INTRODUCTION |
The yeast transcriptional factor repressor activator protein 1 (Rap1p)1 is a
context-dependent regulator. It activates the transcription of a large number of heavily transcribed genes, including those encoding glycolytic enzymes, ribosomal proteins, and several components of the transcriptional machinery. It also behaves as a transcriptional repressor, as it is essential for silencing the HML and
HMR loci. Finally, Rap1p binds to yeast telomeres and is
required for their structural stability and transcriptional repression
(reviewed in Refs. 1-3). In this paper our goal was to understand the
genetic determinants of the various and in some cases contradictory
roles of Rap1p.
Rap1p binds to a variety of related DNA sequences (4). We have shown it
builds up structurally distinct complexes with two versions of its
consensus binding sequence, the UASrpg sequence (5'-ACACCCATACATTT-3')
and the telomere consensus sequence (5'-ACACCCACACACCC-3') (5, 6).
Crystallographic and chemical footprinting data indicate that, when
bound to telomeric sequences, the two nearly identical Myb-like domains
of the Rap1p DNA-binding domain make very similar contacts to two
identical DNA half-sites (ACACCC), (5, 7, 8). Some of these contacts
are not possible in Rap1p-UASrpg complexes, because of the presence of
Ts in the second half-site (ACATTT). We thus proposed that high
affinity binding of Rap1p to a UASrpg requires rearrangement of the
C-terminal moiety of the DNA-binding domain of Rap1p (6); such a
rearrangement appears not to be necessary for binding to different
versions of the telomeric sequence (8, 9). The structural
differences between different Rap1p-DNA complexes have functional
significance (5, 6); here, we provide a further genetic analysis
showing that these complexes are functionally different because they
activate transcription through different mechanisms.
The very low transcriptional activity of synthetic reporters
encompassing a single UASrpg or telomeric site in Rap1p-based activation is inconsistent with the identical affinity of Rap1p for
single and tandemly arranged sites in vitro (5). Here, we
show that single sites are completely occupied in vivo,
despite their low transcriptional activity, by two approaches. First, we observed the footprint of Rap1p in a single UASrpg in
vivo, using the characteristic KMnO4-hypersensitivity
site at the base T8 of the UASrpg when occupied (5, 10). Second,
we measured the ability of a single UASrpg to block activation through
an overlapping UASgal site, an experimental design known as binding interference (11).
When assayed as tandem repeats, UASrpgs showed a strong synergistic
effect, which was orientation-dependent, whereas telomeric sequences showed a lower synergism, irrespective of orientation (5, 6).
This contrasts with the results from single sites, which were not
affected by the orientation or the version of the site (5). One of the
main goals of this study was the identification of mutations affecting
these functional differences. We thus tested many mutations affecting
key steps of transcriptional activation; and those that clarify the
mechanisms of transactivation by Rap1p are included in this paper and
are described below.
For histone depletion, histone H4 can be selectively depleted in the
yeast strain UKY403, in which its sole copy is under the control of the
repressible GAL1 promoter (12). This strain loses 50% of
its normal complement of nucleosomes when transferred from a
galactose-containing medium, where it grows normally, to one containing
glucose, where it stops growing after a single cell cycle (12).
Nucleosome loss activates many (but not all) yeast reporters in
vivo (12, 13). It affects transcription of about 25% of yeast
genes either by increasing (15%) or decreasing (10%) the mRNA
levels (14).2 These results
show the pivotal role of histones in both activation and silencing of
many yeast genes.
HRS1 was identified as a suppressor of a hyper-recombinant
phenotype produced by hpr1 mutations (15). Deletion of the
HRS1 gene impairs transcription of many chromosomal genes,
but it also enhances transcription of many promoters when assayed as
episomal plasmids, by an unknown mechanism (15). Hrs1p is part of the mediator complex of RNA polymerase II, which is required for the transcription of a variety of promoters (16, 17). Mutations in certain
components of this complex also show this paradoxical phenotype,
i.e. inhibition of some genes and activation of others (18).
Chromatin remodeling is mediated by multisubunit complexes that alter
nucleosome structure in an ATP-dependent manner (19). Here
we assay mutations in two of these complexes, the SWI/SNF complex and
the RSC complex. These complexes have distinct roles in the cell. The
SWI/SNF complex is relatively rare, dispensable, and associated with
transcriptional activation, and the RSC complex is abundant, essential,
and related to cell cycle progression (19). The relevance of these
complexes in transcription regulation has been much debated. Deletion
of key components of the SWI/SNF complex affects the levels of about
only 1% of the yeast transcripts (20, 21). However, the SWI/SNF
complex is required for mitotic transcription, probably because of the
condensed state of mitotic chromatin (22). Human and yeast SWI/SNF
complexes directly reorganize the chromatin structure in
vitro to facilitate the binding of transcription factors (23,
24).
Rap1p is a large protein (827 amino acids) with multiple functions,
some of which are associated with various domains in the primary
protein structure (see Ref. 3 for a review). Analysis in
vivo of the functional regions within Rap1p revealed that the DNA-binding domain (amino acids 342-596) is the only portion of Rap1p
essential for growth (25). However, removal of the so-called activation
(Act) domain (amino acids 627-690, (26)) strongly decreases growth
rates and compromises the transcription of several, but not all,
Rap1p-regulated genes (25). Deletion of the so-called silencing (Sil)
domain (amino acids 700-798) results in a milder growth defect, an
increase in the transcription of several Rap1p-regulated genes, and the
loss of transcriptional silencing through Rap1p both at telomeres and
at the HML and HMR loci (25-27). This domain is the target for
interactions with telomeric proteins Rif1p, Rif2p, Sir2p, Sir3p,
and Sir4p (26, 28-31). Finally, deletion of amino acids 597-629 (the
Tox domain) has minor physiological effects but increases the amount of
mutated Rap1p present in the cell (25, 26). It also eliminates the
cellular toxicity produced by the overexpression of Rap1p both in
Saccharomyces cerevisiae and in Schizosaccharomyces
pombe (32, 33). Rap1p alleles truncated at the C-terminal domain,
as well as sir mutants, show a general de-repression in
telomere-proximal genes (14).2
Our results indicate that the architecture of Rap1p-based promoters
determines their ability to alleviate various overlapping mechanisms of
transcriptional repression. Single sites partially counteracted histone
repression, but their transcriptional activation was limited by a
putative Hrs1p-mediated transcriptional control. Tandemly arranged
telomeric sites eliminated both types of repression, but the resulting
complex was not fully active because of internal inhibition in the
Rap1p molecule by the Sil domain. The characteristic high activation
through tandemly arranged UASrpgs, which we refer to as the RPG effect
(6), appeared in this context as the result of the suppression of this
internal inhibition. We propose that this is probably mediated by the
remodeling of the C-terminal portion of the Rap1p molecule required for
its binding to UASrpgs (6).
The physiological significance of the RPG effect is unknown. No
mutation has been reported so far to abolish it, and so the question
cannot be directly addressed. We present two complementary approaches
as follows: a whole yeast genome search for UASrpg and telomeric
sequences in gene promoters, and the substitution of a UASrpg by a
telomeric sequence in a natural, Rap1p-controlled promoter. Both
analyses suggest that the functional differences between both types of
sequences apply to natural promoters and that they control the levels
of expression of Rap1p-regulated genes in vivo.
 |
MATERIALS AND METHODS |
Plasmids and Strains
The yeast strains used in this paper are listed in Table
I. Strain YPH499 was from the Yeast
Genetic Stock Center (YGSC), Berkeley, CA. Strain SCR101 U was
constructed by transformation of the parental SCR101 (35) with a
deleted version of the URA3 gene, lacking the
sequences between the endogenous StuI and EcoRV sites (36). Transformants were plated directly onto SD plates (6.7 g/liter yeast nitrogen base without amino acids (Difco), 20 g/liter
glucose, and 2% agar (Difco)) supplemented with 0.1% casamino
acids (Difco) plus 0.1% tryptophan, 0.02% uracil, and 900 mg/liter
5-fluoroorotic acid (Fluorochem, UK (37)). Plasmid pSLF -178K is a
derivative of pLG -312 (38), constructed by S. L. Forsburg. It
contains the sequences from 178 (XhoI) to the
BamHI site of the CYC1 promoter. Plasmids pRPG
and pTEL were constructed by inserting copies of the appropriate
oligonucleotides into the XhoI site of pSLF -178K (5).
These oligonucleotide sequences (upper sequences only) are as
follows: RPG1, 5'-TCGACACCCATACATT-3'; TEL1, 5'-TCGACACCCACACACCC-3';
RPG2, 5'-TCGACACCCATACATTTACACACACCCATACATT-3'; TEL2,
5'-TCGACACCCACACACCCACACACACCCACACACCC-3'; and RPG2-12, 5'-TCGACACTCATACATTTACACACACTCATACATT-3'. For convenience, the orientation of these oligonucleotides in the upper strand will be
referred to as "direct." In vivo binding interference
experiments were performed by synthetic UASs containing either
Gal4p-binding sites (pMD1) or overlapping Gal4p and Rap1p-binding sites
(pGR5). These synthetic UASs were cloned into the KpnI site
of pSLF -178. Their sequences are as follows: MD1,
5'-CCAAATACGGGTGTCAGTCCTCCGGAGTA-3'; GRC5,
5'-AAATGTACGGGTGTCAGTCCTCCGGAGTA-3'. RPS17B promoter
variants were constructed from a 335-bp genomic fragment from the
RPS17B promoter from 10 bp upstream of the UASrpg to the
first AUG (see Fig. 6, panel A). This fragment
was fused in-frame to the -galactosidase gene from pSLF -178K in
its unique BamHI site to give the plasmid pSN36. DNA
sequences 332/ 238, encompassing two UASrpgs and a poly(T) track
(Fig. 6, panel A), were replaced by tandem
repeats of either RPG sequences (ACACCCATACATTTACACACACCCATACATTT,
pSR320) or telomeric sequences (ACACCCACACACCCACACACACCCACACACCC,
pST47). Sequences of all constructs were determined by the T7
polymerase method (Amersham Pharmacia Biotech). Plasmids pRAP,
pRAP Sil, and pRAP Tox have been described elsewhere (25).
-Galactosidase Assays
Cells carrying the plasmids were grown in selective media until
medium-late logarithmic phase. Assays were performed by
permeabilization of the whole cells with chloroform and SDS (39).
Alternatively, yeast protein extracts were obtained using Y-PER
(Pierce) and used for -galactosidase assays as described (40).
Results from the two systems were similar; on average, the Y-PER method
gave about 30% more activity than the permeabilization method.
Histone Depletion Protocol
Strains MHY308 and UKY403 containing the reporter plasmids were
grown overnight at 30 °C in selective medium (1.7 g/liter yeast
nitrogen base without ammonium sulfate and amino acids (Life Technologies, Inc.), 5 g/liter ammonium sulfate, and 0.1 g/liter of the
appropriate markers) with 20 g/liter galactose as carbon source, to an
A600 between 0.6 and 1.2. Each culture
was then halved, spun down, and resuspended: one part in YEP (10 g/liter peptone, 5 g/liter yeast extract, Pronadisa, Spain) plus 20 g/liter glucose and the other part in YEP+ 20 g/liter galactose. These cultures were incubated for 6 h at 30 °C and processed for
-galactosidase activity determination.
KMnO4 Footprinting in Vivo
Treatment with KMnO4--
We used a modification of
the protocol described (41). YPH499 cells transformed with the
appropriate reporters were grown in 5 ml of selective SD medium (6.7 g/liter yeast nitrogen base without amino acids (Difco), 20 g/liter
glucose, and the appropriate markers at 0.1 g/liter) to saturation at
30 °C. The saturated culture was used to inoculate 200 ml of fresh
SD medium and left to grow at 30 °C until an
A600 of 1. The culture was then spun down,
resuspended in 1 ml, and divided into 2 aliquots, one to be used as
untreated control. The other was treated with 100 mM KMnO4 for 1 min at room temperature; the reaction was
terminated by adding 5 volumes of 0.9 M sorbitol, 0.1 M Tris, pH 8.0, 0.1 M EDTA, and 40 mM -mercaptoethanol. Both modified and control cells
were spun down and resuspended in 500 µl of Solution A (0.1 M EDTA, 1 M sorbitol, pH 7.5). Genomic DNA was
extracted as detailed below. Thereafter, DNA from untreated cells was
treated with 10 mM KMnO4 for 2 min on ice. The
reaction was stopped by the addition of an equal volume of 140 mM -mercaptoethanol, 50 mM EDTA, and 300 mM sodium acetate, pH 7. DNA was extracted twice with
phenol:chloroform:isoamyl alcohol (25:24:1) and precipitated with 1 volume of isopropyl alcohol.
Extraction of Genomic DNA--
Cells resuspended in 500 µl of
Solution A were spheroplasted by adding -mercaptoethanol to 10 mM and 500 µg of Zymoliase (Seikagaku, Japan) and
were incubated for 90 min at 30 °C. Spheroplasts were spun down and
resuspended in 500 µl of 50 mM Tris-HCl, pH 7.4, 20 mM EDTA. After addition of 50 µl of 10% SDS and vigorous vortexing, the mixture was incubated for 30 min at 65 °C.
After incubation, 200 µl of 5 M potassium acetate
was added, mixed thoroughly, and left on ice for 30 min. Proteins were
then spun down in a microcentrifuge for 15 min at 4 °C. DNA
on the supernatant was then was extracted with
phenol:chloroform:isoamyl alcohol (25:24:1) until no interphase was
visible and then precipitated with 1 volume of isopropyl alcohol.
Reiterated Primer Extension ("Linear Polymerase Chain
Reaction")--
DNA samples treated with KMnO4 (in
vivo or in vitro) were incubated with 1 M
piperidine for 30 min at 90 °C. The reaction products were extended
with the primer 5'-CTAAAGTTGCCTGGCCATCC-3', which hybridizes to the
CYC1 promoter 59 bp downstream from the XhoI site
in the lower strand. After denaturation for 4 min at 94 °C, the
oligonucleotide was annealed for 2 min at 60 °C and extended with
the Stoeffel fragment of DNA polymerase I (PerkinElmer Life Sciences)
for 2 min at 72 °C. The extension products were then re-denatured
for 45 s at 94 °C. This cycle was repeated 40 times. Extension
products were analyzed in a polyacrylamide sequencing gel with 8 M urea.
Computer Genomic Analysis
Promoters from all the yeast genomes (positions 600/1 from the
ATG) were searched for putative Rap1p-binding sequences with the
Regulatory Sequence Analysis Tools package (42), using the consensus
matrix for Rap1p from S. cerevisiae Promoter Data base (43).
Sequences containing one or more putative sites were re-scanned for
Rap1p sites by the MathInspector program (44, 45). Sub-telomeric genes
were discarded. Additional information was obtained from the
Saccharomyces Genome Data base web page (46).
 |
RESULTS |
In Vivo Footprinting of Rap1p by
KMnO4--
We treated yeast cells bearing plasmids
including UASrpg sites with KMnO4 in vivo. This
treatment damaged specific DNA bases, which can be observed by
reiterated extension of appropriate oligonucleotides. Fig.
1 shows results from YHP499 strain clones
either non-transformed (panel A) or transformed with pRPG1
(panel B) or pRPG2 (panel C) plasmids. We
observed two bands for each UASrpg, corresponding to bases T8
and A7 (lower and upper band of each pair in Fig. 1, respectively).
This pattern differed from the single strong KMnO4-hypersensitivity site at position T8 observed
in vitro with end-labeled DNA fragments (5, 6, 10). However,
when purified supercoiled plasmids were bound in vitro to
Rap1p (or to its DNA-binding domain), treated with KMnO4,
and analyzed by reiterated primer extension, we observed a two-band
pattern identical to the one shown in Fig. 1 (not shown). We concluded
that Rap1p distorted DNA in vivo as it does in
vitro.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 1.
In vivo KMnO4
footprinting of pRPG plasmids. Panel A, non-transformed
YPH499 strain. Panels B and C, strains
transformed with pRPG1d and pRPG2d, respectively. Panel D,
strain transformed with the mutant construct pRPG2-12. Positions of
various UASs are indicated by arrows; × indicates the
mutation in RPG12. Tracks labeled DNA correspond
to genomic DNA modified in vitro, and tracks
labeled in vivo correspond to cells treated with
KMnO4. In this case, the two tracks correspond to two times
of treatment.
|
|
The intensity of the KMnO4 hypersensitivity sites in
panels B and C of Fig. 1 suggests that both
constructs were similarly occupied in vivo, despite their
very distinct transcriptional activity (about 20-fold (5), see below).
We verified that the bands shown in Fig. 1 were actually originated by
the binding of Rap1p to the UASrpg sequences by repeating the
experiment with strains transformed with the plasmid pRPG2-12. This
construct bears two mutated sites (RPG-12 (47)); it displays a severely reduced affinity for Rap1p binding (47) and a negligible
transcriptional activation (5). This construct did not show the
characteristic KMnO4 hypersensitivity sites due to Rap1p
binding (Fig. 1, panel D).
In Vivo Binding Interference between Rap1p and
Gal4p--
Gal4p-binding sites (UASgal) consists of two palindromic
CGG sequences separated by 11 nucleotides (48). We constructed a hybrid
UAS in which an essentially canonical UASgal overlaps a single RPG site
(pGRC5, Fig. 2). In this construct, Gal4p
and Rap1p should interact simultaneously with the same GG doublet. As a
control, plasmid pMD1 contains a very similar sequence but lacks the
key C/G base pair at position 10 of the UASrpg, which is essential for
Rap1p binding (7, 47) (Fig. 2). Note that this residue lies outside the
Gal4p-binding sequence in a position that does not affect Gal4p binding
(48). Fig. 2 shows that, when transformed into BY4741 cells, this
construct behaved as a typical UASgal reporter, silent in glucose
(about 3 Miller units) and strongly activated in galactose (over 250 units (48)). Conversely, plasmid pGRC5 gave a weak activation in
glucose, as a single Rap1p-binding site (around 25 units (5)). This
value did not increase significantly in galactose, showing that Gal4p
did not activate this construct, presumably by its exclusion from its
binding site by Rap1p. Assays in vitro showed that the
complex formed by Rap1p and single sites is extremely stable, with
half-life values between 60 and 90 min (49).3 Together with the
footprinting data in Fig. 1, these data indicate that Rap1p binds
single sites in vivo but does not activate transcription from them.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
In vivo binding interference
between Rap1p and Gal4p. The relevant binding sites are
highlighted as follows: Gal4p relevant residues in
white and the RPG-like sequence underlined. The
sites are represented in direction 5' to 3' (upper strand)
relative to the CYC1 promoter. Note the mutation of the
Rap1p-binding site in the pMD1 plasmid (discontinuous line)
outside the Gal4p site. Values are averages of three independent
transformants, and error bars indicate standard
deviations.
|
|
Transcriptional Activation by Rap1p in Histone-depleted
Chromatin--
We analyzed the behavior of synthetic promoters bearing
different Rap1p-binding DNA sites in the histone-depletable strain UKY403, as well as in the isogenic wild type strain MHY308 (Table II). When grown in galactose, the two
strains gave very similar results for all constructs assayed, although
the values from the UKY403 strain were about 80% of the values from
strain MHY308 (Table II, column Gal-H4/wt). Apart from this difference,
the behavior of both UASrpg-based (RPG) and telomeric sequence-based (TEL) plasmids was essentially as reported for glucose-grown
transformants of unrelated genetic backgrounds (5).
Addition of glucose to strain MHY308 (the "wild type" strain)
increased transcription of all constructs 3-4-fold without changing their relative strengths (upper and lower sections of Table II). This
was probably associated with the change of carbon source. In contrast,
in strain UKY403 (the histone-depletable strain), addition of glucose
and the subsequent depletion of chromatin from nucleosomes changed the
relative strength of each construct. For example, addition of glucose
increased transcription of pSLF -178K only 2-fold in strain MHY308
and more than 20-fold in strain UKY403 (Table II). A similar but
reduced effect was observed with constructs bearing single
Rap1p-binding DNA sites, which increased their transcription 8.3-fold,
on average, in the histone-depleted conditions (Table II). As a result,
these constructs showed higher transcription levels in the
histone-depleted strains than in the wild type strain (Table II, column
Gal-H4/wt). In contrast, constructs with two sites showed a moderate
increase (about 3-fold) in their transcription in the histone-depleted
strain upon addition of glucose. This brought their transcription rates
to 60% (on average) of the corresponding values for the wild type
strain. Therefore, histone depletion had opposite effects in constructs
encompassing single or tandemly arrayed sites, activating the former
and reducing transcription from the latter. Single Rap1p molecules may
not completely counteract histone repression, which would be irrelevant
in constructs with tandemly arranged sites.
Histone depletion decreased the efficiency of single Rap1p-binding
sites to activate transcription over the basal levels of the UAS-less
pSLF -178K construct. The ratio between constructs with single sites
and the empty vector was, on average, 8.8 in the wild type strain and
only 1.9 in the histone-depleted strain (Table II). In addition, the
synergistic effect of adjacent sites was also reduced in
histone-depleted conditions, where plasmids pTEL2d, pTEL2r, and pRPG2r
gave, on average, only 2.1 times more -galactosidase units than
their single-site counterparts. This ratio was 6.2 in the wild type
strain (Table II). However, nucleosome loss did not affect the RPG
effect; the ratio between pRPG2d and the average of the rest of
constructs with two sites was 1.7 in the wild type strain and 2.1 in
the histone-depleted strain, a difference well within the expected
error (Table II).
Effects of a hrs1 Deletion on Transcriptional Activation by
Rap1p--
Deletion of the HRS1 gene did not affect
transcription of the UAS-less pSLF -178K plasmid but increased
transcription of the rest of plasmids (Fig.
3). On average, the increase was 5-fold for plasmids with single sites and 2.4-fold for constructs with two
sites. As a result, the relative strength of these plasmids was
significantly altered in the hrs1 strain relative to the wild type strain. For example, single sites, which in this particular yeast strain gave only 4.3 more units than the UAS-less vector, increased this figure to 17-fold in the hrs1 strain. This
suggests that Hrs1p acts as a repressor of the transcription of these
constructs. As for histone-depleted strains, the apparent synergistic
activation of plasmids pTEL2d, pTEL2r, and pRPG2r was severely reduced
in the hrs1 strain. These plasmids gave, on average, only
2.6 more -galactosidase units than their single-site counterparts in
the mutant background, a ratio that was 5.2 in the wild type strain (Fig. 3). Therefore, the synergistic activation shown by these constructs may reflect their ability both to counteract histone repression and to suppress a putative inhibitory effect of Hrs1p. However, as in histone-depleted conditions, the RPG effect persisted in
the hrs1 background; the ratio between the activity of
pRPG2d and the rest of constructs with two sites was 2.2 in the wild type strain and 1.8 in the hrs1 strain (Fig. 3). The same
conclusions were reached when integrated instead of episomal constructs
were assayed in hrs1 strains (data not shown).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 3.
Transcriptional activity of pRPG and pTEL
plasmids in a hrs1 strain. Strains
AYW3-1B (wild type, open bars) and SSAB-2C
( hrs1, solid bars) were transformed with the
plasmids indicated at the bottom. Values are averages of at
least three independent transformants, and error
bars indicate standard deviations.
|
|
Effects of Mutations in Chromatin Remodeling Complexes on
Transcriptional Activation by Rap1p--
Disruption of the SWI/SNF
complex notably reduced the transcriptional activation of all
constructs with Rap1p-binding DNA sites (Table
III). In the BY4741 strain background,
disruption of the ATPase subunit Snf2p reduced transcription
from pRPG1d to 40%, whereas transcription from pRPG2r, pTEL2d, and
pTEL2r was reduced to 10% and transcription from pRPG2d to 15%. A
swi1 mutant in the CY26 strain background had similar
effects. In contrast, rsc1 and rsc2
deletions had little effect on all assayed constructs (not shown),
although they seriously affected growth rates, which drop to about a
division every 4 h in selective media. These rates are similar to
those of the snf2 strain (not shown).
The ratios between plasmids in SWI/SNF complex mutants showed a pattern
similar to that observed in histone-depleted conditions. The
synergistic effect produced by contiguous sites in plasmids pTEL2d,
pTEL2r, and pRPG2r was lost in SWI/SNF mutant strains; these plasmids
produced between 1.5 and 1.6 more -galactosidase units than pRPG1d,
less than an additive effect (Table III). However, the RPG effect
persisted in the strains lacking the SWI/SNF complex, in which pRPG2d
gave, on average, 4.4 times more -galactosidase units than the rest
of constructs with two sites. This figure is slightly higher than the
one corresponding to wild type strains (Table III). Although this
increment may be due to some pleiotropic effect of these mutations, our
data indicate that the RPG effect occurred in the absence of the
SWI/SNF complex, and it did not depend on RSC1 or
RSC2 genes.
Dissection of the C-terminal Domain of Rap1p--
Strain SCR101
contains a chromosomal copy of the RAP1 gene under control
of the GAL1-10 promoter. This strain was supplemented with a single
copy plasmid encompassing variants of the Rap1p protein expressed from
its natural promoter. In this background, the episomal Rap1p variant is
the only Rap1p source when the cells are grown in glucose (25). The
results for three of these variants, as well as for an intact copy of
the RAP1 gene, are shown in Fig. 4.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4.
Transcriptional activity of pRPG and pTEL
plasmids in strains with various Rap1p variants. Plasmids
pSLF -178K, pRPG1d, pTEL1d, pRPG2d, pRPG2r, pTEL2d, and pTEL2r were
assayed in SCR101 U strain harboring episomal plasmids encompassing a
wild type copy of Rap1p (left), the Rap1 Sil allele
(center), or the Rap1 Tox allele (right). All
cells were grown in glucose. Values are averages from at least three
independent transformants. Gray bars correspond to
single-site plasmids; solid bars correspond to values from
tandemly arranged RPG sequences, and open bars correspond to
values from tandemly arranged TEL sequences. Error
bars indicate standard deviations. Note the different
scales for the y axis in the three panels.
|
|
Basal expression of the pSLF -178K vector was extremely low in this
genetic background, about 1 Miller unit, and identical for all the
Rap1p variants assayed. Although low, this value was highly
reproducible and clearly higher than for non-transformed cells, which
hardly showed -galactosidase
activity.4 Thus, there were
no differences in plasmid copy number or in the efficiency of
translation of the -galactosidase mRNA due to the presence of
Rap1p variants. Removal of the silencing domain of Rap1p (Rap1 Sil)
resulted in a moderate increase of transcription (less than 2-fold) of
the pRPG1d, pTEL1d, and pRPG2d plasmids, a stronger increase for
plasmids pRPG2r and pTEL2r (3-fold), and a 5-fold increase for pTEL2d
(Fig. 4). As a result, pRPG2d and pTEL2d plasmids became
indistinguishable in the Rap1 Sil background, both showing a very
strong synergistic, orientation-dependent activation (Fig.
4). The Rap1p Sil allele was thus insensitive to the differences
between RPG and TEL sequences. The effect of the Sil mutation did
not depend on the presence of the SIR complex, for deletion of the
SIR4 gene did not significantly alter the expression of any
of the assayed plasmids (data not shown).
Rap1 Tox deletion generally decreased activation through Rap1p
DNA-binding sites (Fig. 4). Transcription from plasmids pRPG1, pTEL1,
and pRPG2d was approximately halved, whereas transcription from
plasmids pRPG2r, pTEL2d, and pTEL2r was reduced to 10-20% of the
corresponding values in the wild type strain (Fig. 4). These effects
were opposite those found in the Rap1p Sil background. In addition,
in the Rap1 Tox background, plasmids pTEL2d, pTEL2r, and pRPG2r gave
-galactosidase activities that were only 1.5-3.5 times higher than
for pRPG1d and pTEL1d, thus showing low synergism, if any, above a
simple additive effect. In contrast, pRPG2d gave 35 times more activity
than pRPG1d or pTEL1d, indicating that its synergistic capacity was not
affected by Tox deletion (Fig. 4).
RPG Effect in a Natural Context--
Fig.
5, panel A, shows a
sequence analysis of 234 putative Rap1p-binding sites in the yeast
genome. Panel B shows the results of a similar analysis when
the sites corresponding to ribosomal protein gene promoters were
excluded (non-rp promoters, 177 sites). The results from the 64 sites
corresponding to ribosomal gene (rp) promoters are shown in panel
C. Of the 13 positions analyzed, positions 8, 12, and 13 showed
different base distribution between rp promoters and the rest. Whereas
position 8 hardly revealed sequence specificity in non-rp promoters,
Ts prevailed (67%) in rp promoters. Position 12 showed an even
distribution of Cs and Ts (47 and 42%, respectively) in non-rp
promoters, whereas there is a strong preference for Ts in rp
promoters (75%). For position 13, there is a preference for Cs
in non-rp promoters (47%) and for Ts in rp promoters (50%). A
similar analysis of all UASrpg from rp promoters (50) (186 sites, Fig.
5, panel D) also revealed a clear preference for Ts
at positions 8, 12, and 13 (67, 73, and 47%, respectively). All these
data demonstrate a strong preference for RPG-like sequences in the
UASrpgs of rp promoters, which is not observed for Rap1p-binding
sites in non-rp promoters.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 5.
Relative frequency of the
different bases of Rap1p DNA-binding sites from yeast promoters.
Panel A, base composition of 234 putative Rap1p-binding
sites found in yeast promoters throughout the whole yeast genome, using
the strict consensus sequence RCACCCANACAYN. Panel B, subset
of 177 sites from the previous set, corresponding to non-rp genes.
Panel C, subset of 64 sites from rp gene promoters.
Panel D, analysis of 186 UASrpg sites from rp promoters, as
defined in Ref. 50, selected with the broad consensus AYCCRNNCM. Note
the similarity of distributions in panels C and
D. Bar sizes indicate the absolute frequency
(number of genes); bases are coded as follows: A,
light stripes; T, solid bars;
C, dark stripes; G, empty
bars.
|
|
These results point to the relevance of RPG-like sequences for
the physiology of rp promoters. Fig. 6
shows an experiment aimed at testing this hypothesis. Plasmid pSN36
essentially contains all promoter sequences from the RSP17B
gene, fused to the -galactosidase gene. When introduced into BY4741
cells, it gave a relatively strong -galactosidase activity, around
200 Miller units. Replacement of the natural UASs in this promoter (two
UASrpgs and a poly(T) track) by a sequence similar to the UAS of
plasmid pRPG2d (pSR320) did not alter the expression of the construct,
except for a slight increase up to 250 units. However, when the same
sequences were replaced by a sequence similar to the UAS from pTEL2d
(pST47), the expression of the construct dropped by two-thirds, down to 70 units (Fig. 6). These results indicate that the RPG effect is at
least partially responsible for the characteristic high expression
of rp genes.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 6.
Base mutation analysis of the
RPS17B promoter. Panel A, structure of
the fusion of RPS17B promoter to the lacZ
gene. Base positions are given relative to the first ATG; the
lacZ gene starts just after the G of this codon.
Panel B, transcription of the different variants of this
promoter; the bars represent Miller units from three
independent transformants for each construct; lines indicate
standard deviations. The structure of the different promoters is
indicated in the left; R stands for RPG-like
sequences, and T stands for TEL-like ones. Tn
indicates a poly(T) track found in the natural PRS17B promoter (plasmid
pSN36, top bar). Note that RPG sites of pSR320 (middle
bar) are somewhat different from the natural ones. These sites
were substituted by TEL sites in pST47 (bottom bar).
|
|
 |
DISCUSSION |
Synergism between adjacent activator proteins is attributable to
several mechanisms. Binding of many activators to their cognate DNA
sequences requires the formation of homo- or heteroduplexes. This is
the case for most members of the nuclear receptor family (51) and for
factors binding to DNA through leucine-zipper motifs, like Jun and Fos
(52). However, functional synergism may also occur between factors that
do not cooperate for binding to DNA, as is the case of adjacent Rap1p
molecules (5, 6). In these UASs, synergism may reflect a cooperative
action either for binding to nucleosomes (53) or for interaction with
transcriptional cofactors (54-56). Our footprinting data in
vivo showed a similar sensitivity to KMnO4 for single
and for tandemly repeated UASrpg sites in constructs whose
transcription differed by 10-20-fold, suggesting a similar occupancy
for single and double sites. The finding that a single Rap1p site
prevents binding of Gal4p to its cognate sites further demonstrates
that Rap1p binds to isolated sites, although it does not activate
through them but marginally. In this regard, Rap1p molecules binding to
single sites behave as positive control mutants that bind DNA but do
not activate transcription. This phenotype has been related to lack of
interaction with key coactivators (Ref. 57 and references therein).
Nucleosome loss activates transcription of many repressed yeast
promoters in vivo, whereas activated promoters either do not change or even reduce their transcription rates in histone-depleted conditions (12, 13, 58). Our results indicate that transcription of the
parental pSLF -178K reporter and that of constructs with a single
Rap1p-binding DNA site were impaired by nucleosomes, since their
removal increased the transcription rates. In contrast, transcription
of constructs with two adjacent sites was reduced, rather than
increased, by histone depletion. The synergistic activation by adjacent
Rap1p-binding DNA may thus be the relief of the transcriptional repression by histones, as suggested elsewhere (59, 60). The 40%
decrease of transcription observed for plasmids with two Rap1p DNA-binding sites in histone-depleted conditions may indicate a
specific enhancement of transcriptional response mediated by the
presence of histones (61). However, it may rather result from the
profound pleiotropic changes occurring upon histone depletion (12). One
way or another, the results showed that the tandemly arranged sites of
the plasmids were affected by histone depletion oppositely to plasmids
with single or no sites.
The effect of the hrs1 mutation suggests that
transcription of plasmids with Rap1p DNA-binding sites is repressed by
a second mechanism involving the RNA polymerase II mediator complex.
This inhibition was stronger for constructs with single sites than for
constructs with two sites. Therefore, we propose that the apparent
synergistic activation through contiguous Rap1p DNA-binding sites (RPG
effect excluded) may also reflect that single Rap1p molecules do not
overcome a putative Hrs1p-mediated repressive effect. This effect seems
more specific than that of histone H4 depletion, since it did not
affect UAS-less CYC1 promoter constructs (15). In any case,
the construct pRPG2d still showed a strong synergistic effect over
constructs with single sites, as well as its characteristic orientation
dependence in the hrs1 strain, indicating that the Hrs1p
was not a determinant to the RPG effect.
Transcription from all our constructs was compromised in genetic
backgrounds lacking the SWI/SNF complex. In agreement with the data
obtained under histone-depleted conditions, synergism between adjacent
TEL or RPG sequences was particularly sensitive to the loss of the
SWI/SNF complex, whereas activation through single sites was less
affected. A simple hypothesis is that adjacent sites recruit the
SWI/SNF complex and that this recruitment would be inefficient for
single sites. In chromatin-depleted conditions, the need for chromatin
remodeling complexes would be much reduced; consistently, the
efficiency of Rap1p for activation was also reduced. However, the RPG
effect was present in all the chromatin-altered backgrounds we assayed.
We thus propose that it is caused by the cooperative interaction
between adjacent Rap1p/UASrpg complexes and some component(s) of the
transcriptional machinery, irrespective of the structure of chromatin.
The mechanisms of transactivation by Rap1p were further elucidated by
the analysis of C-terminal Rap1p deletions. The main activation domain
of Rap1p corresponds to amino acids 629-690 (the Act domain (25, 26)).
Our data suggest that the Tox domain (amino acids 597-629) may also
encompass a secondary activation domain. Its deletion decreased
activation from all constructs, especially of pTEL2d, pTEL2r, and
pRPG2r plasmids, which lost all their synergistic potential. In this
regard, the Rap1 Tox strain resembles swi1 or
snf2 strains, which also presented a reduced
synergism for the same constructs. A suitable explanation would be that
the Tox domain functions as a recognition motif for chromatin
remodeling factors, like the SWI/SNF complex, and that this is the main
trans-activation function of Rap1p-TEL complexes. As mentioned above,
we suggest that this function is only fulfilled when two Rap1p
molecules are bound to DNA. The link of Rap1p to chromatin remodeling
machines via the Tox domain may be relevant for both transcriptional
activation and repression (62, 63). Yeast cells in which Rap1 Tox is
the only source of Rap1p show high RAP1 expression, which is
probably repressed by its genomic product Rap1p (4, 25). Although the
effect of this deletion on the transcription of other genes has not
been reported, the Tox domain probably plays some key role in the cell,
which becomes lethal when the amount of Rap1p in the cell exceeds a
given value (32, 33).
The Rap1 Sil allele was unique for many reasons. After an extensive
search for mutations suppressing the RPG effect, we failed to find a
mutant where activation through adjacent UASrpgs became orientation-independent or where their activity was similar to that of
telomeric sequences.4 On the contrary, all
chromatin-related mutations (and the Tox deletion) had the opposite
effect, i.e. they exacerbated the functional difference
between pRPG2d and the rest of the constructs. Yet, in the Rap1 Sil
background, the RPG effect was extended to adjacent telomeric
sequences, the activation from which became
orientation-dependent. A simple explanation of these results is
provided by the following model: the RPG effect was due to a particular
activation domain of Rap1p, which interacted with certain component(s)
of the transcriptional machinery. This interaction requires at least
two Rap1p molecules bound to the promoter and is
orientation-dependent. The Sil domain, or one of the
proteins it binds, would preclude or mask this activation in Rap1p-TEL
complexes. We have previously proposed that the Rap1p DNA-binding
domain requires a structural transition in order to accommodate to
UASrpg sequences (6). This structural change may affect the C-terminal
domain of the protein and decisively alter the Sil domain, preventing
it from masking the activation domain of Rap1p. This should be
independent of the SIR complex, because deletion of the SIR4
gene did not affect transcription of these reporters. These results are
consistent with the reported data which show that deletion of the Rap1p
C-terminal domain (similar to our Rap1 Sil allele) has broader
effects on gene transcription than mutations of any of the SIR
genes.2 Recent reports show that binding of Rap1p to
different telomeric-like DNA sequences, although divergent from the
canonical site, does not require gross structural changes in the Rap1p
DNA-binding domain (8, 9). These results are consistent with the idea that these changes are specific to Rap1p-UASrpg complexes.
The characteristics of the transcriptional induction by Rap1p,
including the RPG effect, may be central to the functions of Rap1p
in vivo. Our analysis of yeast promoters encompassing Rap1p DNA-binding sites showed a strong bias for UASrpg-type sites at ribosomal gene promoters, where Rap1p probably behaves as a true activator. In about 50% of the cases, these genes show an arrangement of UASrpg sites similar to that of our pRPG2d plasmid (50). Note the
good conservation of position T8, although the functional significance
of this finding is unknown (6). It may reflect additional control
levels that have not been detected. Our results suggest that RPG
sequences are evolutionarily favored in rp promoters, because
the RPG effect may determine their characteristic high expression.
Replacement of RPG sequences by telomeric ones significantly decreases
expression. In the rest of the promoters, the RPG effect seems not to
be relevant, since no special bias for any combination of "C" or
"T" was found at the two positions examined. This may be related to
the postulated functions of Rap1p as chromatin opening factor (3, 59,
60) or as a facilitator of Gcr1p binding to DNA (65). In telomeres, the
presence of Rap1p molecules in an active configuration may be
incompatible with the silencing role of Rap1p in subtelomeric genes.
The above-mentioned profound effects of the Rap1 C allele on the
expression of subtelomeric genes may merely reflect the physiological
relevance of the non-active (TEL) configuration of Rap1p.
Our studies show that Rap1p can be added to the list of transcriptional
factors whose transcriptional potential is allosterically affected by
the DNA sequence to which they bind (34, 57, 66-68). Most of these
factors are vertebrate nuclear receptors, but there is at least another
possible example from yeast, the heme-activated Hap1p factor (64). Our
study differs from these in that we have defined genetic correlations
between structurally distinct Rap1p-DNA complexes and genes involved in
various aspects of transcription regulation. The modulation of Rap1p
transcription activity by its DNA cognate binding sequence implies a
shift between chromatin-dependent and chromatin-independent
mechanisms of transcriptional activation, and it is linked to specific
domains of the Rap1p protein and to several epistatic gene groups. This
analysis may elucidate the behavior of transcription factors like
Rap1p, which can play various and even contradictory roles within the
same cell in the same metabolic conditions.
 |
ACKNOWLEDGEMENTS |
We thank A. Aguilera, S. Chávez
(Universidad de Sevilla, Sevilla, Spain), J. Pérez-Martín
(Centro Nacional de Biotecnología, CNB-CSIC, Madrid, Spain), A. Chambers (University of Nottingham, Nottingham, UK), and M. Grunstein
(Department of Biology, UCLA) for the yeast strains and plasmids, in
some cases unpublished. We also thank J. Roca (IBMB-CSIC, Barcelona,
Spain) for advice on the disruption the URA3 gene in the
SCR101 strain. We also thank A. Aguilera, S. Chávez, J. Pérez-Martín, and A. Chambers for useful advice. We thank
M. A. Martínez-Balbás (IBMB-CSIC) for revision of
the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by Grants PB95-0433 and
PB98-0469 from the Ministerio de Educación y Cultura (Spain).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Recipient of a fellowship from the Ministère d'Education (Morocco).
§
To whom correspondence should be addressed: Dept. de Biologia
Molecular i Cellular, Institut de Biologia Molecular de Barcelona, Center d'Investigació i Desenvolupament, Consejo Superior de Investigaciones Científicas, Jordi Girona, 18.08034 Barcelona, Spain. Tel. 34 93 4006157; Fax: 34 93 2045904; E-mail:
bpcbmc@cid.csic.es.
Published, JBC Papers in Press, May 17, 2001, DOI 10.1074/jbc.M101746200
2
For additional information see the
following web page: web.wi.mit.edu/young/chromatin/.
3
F.-Z. Idrissi and B. Piña, unpublished results.
4
F.-Z. Idrissi, N. Garcia-Reyero, J. B. Fernandez-Larrea, and B. Piña, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
Rap1p, repressor
activator protein 1;
bp, base pair;
rp, ribosomal protein;
UAS, upstream activator sequence.
 |
REFERENCES |
| 1.
|
Shore, D.
(1994)
Trends Genet.
10,
408-412
|
| 2.
|
Gilson, E.,
and Gasser, S. M.
(1995)
in
Nucleic Acids and Molecular Biology
(Eckstein, F.
, and Lilley, D. M. J., eds), Vol. 9
, pp. 308-327, Springer-Verlag, Berlin-Heidelberg
|
| 3.
|
Morse, R. H.
(2000)
Trends Genet.
16,
51-54
|
| 4.
|
Graham, I. R.,
and Chambers, A.
(1994)
Nucleic Acids Res.
22,
124-30
|
| 5.
|
Idrissi, F.-Z.,
Fernandez-Larrea, J. B.,
and Piña, B.
(1998)
J. Mol. Biol.
284,
925-935
|
| 6.
|
Idrissi, F. Z.,
and Piña, B.
(1999)
Biochem. J.
341,
477-482
|
| 7.
|
Koenig, P.,
Giraldo, R.,
Chapman, L.,
and Rhodes, D.
(1996)
Cell
85,
125-136
|
| 8.
|
Taylor, H. O. B.,
O'Reilly, M.,
Leslie, A. G. W.,
and Rhodes, D.
(2000)
J. Mol. Biol.
303,
693-707
|
| 9.
|
Wahlin, J.,
and Cohn, M.
(2000)
Nucleic Acids Res.
28,
2292-2301
|
| 10.
|
Gilson, E.,
Roberge, M.,
Giraldo, R.,
Rhodes, D.,
and Gasser, S. M.
(1993)
J. Mol. Biol.
231,
293-310
|
| 11.
|
McDonnell, D. P.,
Nawaz, Z.,
and O'Malley, B. W.
(1991)
Mol. Cell. Biol.
11,
4350-4355
|
| 12.
|
Han, M.,
and Grunstein, M.
(1988)
Cell
55,
1137-1145
|
| 13.
|
Kim, U.-J.,
Han, M.,
Kayne, P.,
and Grunstein, M.
(1988)
EMBO J.
7,
2211-2219
|
| 14.
|
Wyrick, J. J.,
Holstege, F. C. P.,
Jennings, E. G.,
Causton, H. C.,
Shore, D.,
Grunstein, M.,
Lander, E. S.,
and Young, R. A.
(1999)
Nature
402,
418-421
|
| 15.
|
Piruat, J. I.,
Chavez, S.,
and Aguilera, A.
(1997)
Genetics
147,
1585-1594
|
| 16.
|
Myers, L.,
Gustafsson, C.,
Hayashibara, K.,
Brown, P.,
and Kornberg, R.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
67-72
|
| 17.
|
Bjorklund, S.,
and Kim, Y. J.
(1996)
Trends Biochem. Sci.
21,
335-337
|
| 18.
|
Tabtiang, R. K.,
and Herskowitz, I.
(1998)
Mol. Cell. Biol.
18,
4707-4718
|
| 19.
|
Workman, J. L.,
and Kingston, R. E.
(1998)
Annu. Rev. Biochem.
67,
545-579
|
| 20.
|
Sudarsanam, P.,
Iyer, V. R.,
Brown, P. O.,
and Winston, F.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
3364-3369
|
| 21.
|
Holstege, F. C.,
Jennings, E. G.,
Wyrick, J. J.,
Lee, T. I.,
Hengartner, C. J.,
Green, M. R.,
Golub, T. R.,
Lander, E. S.,
and Young, R. A.
(1998)
Cell
95,
717-728
|
| 22.
|
Krebs, J. E.,
Fry, C. J.,
Samuels, M. L.,
and Peterson, C. L.
(2000)
Cell
102,
587-598
|
| 23.
|
Cote, J.,
Quinn, J.,
Workman, J. L.,
and Peterson, C. L.
(1994)
Science
265,
53-60
|
| 24.
|
Kwon, H.,
Imbalzano, A. N.,
Khavari, P. A.,
Kingston, R. E.,
and Green, M. R.
(1994)
Nature
370,
477-481
|
| 25.
|
Graham, I.,
Haw, R. A.,
Spink, K. G.,
Halden, K. A.,
and Chambers, A.
(1999)
Mol. Cell. Biol.
19,
7481-7490
|
| 26.
|
Hardy, C. F.,
Balderes, D.,
and Shore, D.
(1992)
Mol. Cell. Biol.
12,
1209-1217
|
| 27.
|
Buck, S. W.,
and Shore, D.
(1995)
Genes Dev.
9,
370-384
|
| 28.
|
Hardy, C. F.,
Sussel, L.,
and Shore, D.
(1992)
Genes Dev.
6,
801-814
|
| 29.
|
Culotta, V. C.,
Howard, W. R.,
and Liu, X. F.
(1994)
J. Biol. Chem.
269,
25295-25302
|
| 30.
|
Moretti, P.,
Freeman, K.,
Coodly, L.,
and Shore, D.
(1994)
Genes Dev.
8,
2257-2269
|
| 31.
|
Wotton, D.,
and Shore, D.
(1997)
Genes Dev.
11,
748-760
|
| 32.
|
Freeman, K.,
Gwadz, M.,
and Shore, D.
(1995)
Genetics
141,
1253-1262
|
| 33.
|
Chambers, A.
(1996)
Mol. Microbiol.
22,
449-458
|
| 34.
|
Wood, J. R.,
Greene, G. L.,
and Nardulli, A. M.
(1998)
Mol. Cell. Biol.
18,
1927-1934
|
| 35.
|
Gonçalves, P.,
Maurer, K.,
van Nieuw Amerongen, G.,
Bergkamp-Steffens, K.,
Mager, W.,
and Planta, R.
(1996)
Mol. Microbiol.
19,
535-543
|
| 36.
|
Gartenberg, M.,
and Wang, J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11461-11465
|
| 37.
|
Boeke, J.,
Trueheart, J.,
Natsoulis, G.,
and Fink, G.
(1987)
Methods Enzymol.
154,
164-175
|
| 38.
|
Hahn, S.,
Hoar, E.,
and Guarente, L.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
8562-8566
|
| 39.
|
Guarente, L.,
and Mason, T.
(1983)
Cell
32,
1279-1286
|
| 40.
|
Rose, M.,
and Botstein, D.
(1983)
J. Mol. Biol.
170,
883-904
|
| 41.
|
Giardina, C.,
and Lis, J. T.
(1995)
Mol. Cell. Biol.
15,
2737-2744
|
| 42.
|
van Helden, J.,
Andre, B.,
and Collado-Vides, J.
(2000)
Yeast
16,
177-187
|
| 43.
|
Ball, C. A.,
Dolinski, K.,
Dwight, S. S.,
Harris, M. A.,
Issel-Tarver, L.,
Kasarskis, A.,
Scafe, C. R.,
Sherlock, G.,
Binkley, G.,
Jin, H.,
Kaloper, M.,
Orr, S. D.,
Schroeder, M.,
Weng, S.,
Zhu, Y.,
Botstein, D,
and Cherry, J. M.
(2000)
Nucleic Acids Res.
28,
77-80
|
| 44.
|
Quandt, K.,
Frech, K.,
Karas, K.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
23,
4878-4884
|
| 45.
| Deleted in proof
|
| 46.
|
Cherry, J. M.,
Adler, C.,
Ball, C.,
Chervitz, S. A.,
Dwight, S. S.,
Hester, E. T.,
Jia, Y.,
Juvik, G.,
Roe, T.,
Schroeder, M.,
Weng, S.,
and Botstein, D.
(1998)
Nucleic Acids Res.
26,
73-80
|
| 47.
|
Vignais, M. L.,
Huet, J.,
Buhler, J. M.,
and Sentenac, A.
(1990)
J. Biol. Chem.
265,
14669-14674
|
| 48.
|
Liang, S. D.,
Marmorstein, R.,
Harrison, S. C.,
and Ptashne, M.
(1996)
Mol. Cell. Biol.
16,
3773-3780
|
| 49.
|
Woudt, L. P.,
Mager, W. H.,
Nieuwint, R. T. M.,
Wassenaar, G. M.,
van der Kuyl, A. C.,
Murre, J. J.,
Hoekman, M. F. M.,
Brockhoff, P. G. M.,
and Planta, R. J. P.
(1987)
Nucleic Acids Res.
15,
6037-6048
|
| 50.
|
Lascaris, R. F.,
Mager, W. H.,
and Planta, R. J.
(1999)
Bioinformatics
15,
267-277
|
| 51.
|
Mangelsdorf, D. J.,
Thummel, C.,
Beato, M.,
Herrlich, P.,
Schutz, G.,
Umesono, K.,
Blumberg, B.,
Kastner, P.,
Mark, M.,
Chambon, P.,
and Evans, R. M.
(1995)
Cell
83,
835-839
|
| 52.
|
Rauscher, F.,
Voulalas, P.,
Franza, B.,
and Curran, T.
(1988)
Genes Dev.
2,
1687-1699
|
| 53.
|
Adams, C. C.,
and Workman, J. L.
(1995)
Mol. Cel. Biol.
15,
1405-1421
|
| 54.
|
Lin, Y. S.,
Carey, M.,
Ptashne, M.,
and Green, M. R.
(1990)
Nature
345,
359-361
|
| 55.
|
Carey, M.,
Lin, Y. S.,
Green, M. R.,
and Ptashne, M.
(1990)
Nature
345,
361-364
|
| 56.
|
Ptashne, M.,
and Gann, A.
(1997)
Nature
386,
569-577
|
| 57.
|
Lefstin, J. A.,
Thomas, J. R.,
and Yamamoto, K. R.
(1994)
Genes Dev.
8,
2842-2856
|
| 58.
|
Chavez, S.,
Candau, R.,
Truss, M.,
and Beato, M.
(1995)
Mol. Cell. Biol.
15,
6987-6998
|
| 59.
|
Devlin, C.,
Tice-Baldwin, K.,
Shore, D.,
and Arndt, K. T.
(1991)
Mol. Cell. Biol.
11,
3642-3651
|
| 60.
|
Yu, L.,
and Morse, R. H.
(1999)
Mol. Cell. Biol.
19,
5279-5288
|
| 61.
|
Chavez, S.,
and Beato, M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2885-2890
|
| 62.
|
Enomoto, S.,
and Berman, J.
(1998)
Genes Dev.
12,
219-232
|
| 63.
|
Kaufman, P. D.,
Kobayashi, R.,
and Stillman, B.
(1997)
Genes Dev.
11,
345-357
|
| 64.
|
Ha, N.,
Helauer, K.,
and Turcotte, B.
(1996)
Nucleic Acids Res.
24,
1453-1459
|
| 65.
|
Lopez, M. C.,
Smerage, J. B.,
and Baker, H. V.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
14112-14117
|
| 66.
|
Lefstin, J. A.,
and Yamamoto, K. R.
(1998)
Nature
392,
885-888
|
| 67.
|
Carr, M. D.,
Wollborn, U.,
McIntosh, P. B.,
Frenkiel, T. A.,
McCormick, J. E.,
Bauer, C. J.,
Klempnauer, K. H.,
and Feeney, J.
(1996)
Eur. J. Biochem.
235,
721-735
|
| 68.
|
Schwabe, J. W.,
Chapman, L.,
and Rhodes, D.
(1995)
Structure
3,
201-213
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Bendjennat and P. A. Weil
The Transcriptional Repressor Activator Protein Rap1p Is a Direct Regulator of TATA-binding Protein
J. Biol. Chem.,
March 28, 2008;
283(13):
8699 - 8710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Fourel, T. Miyake, P.-A. Defossez, R. Li, and E. Gilson
General Regulatory Factors (GRFs) as Genome Partitioners
J. Biol. Chem.,
October 25, 2002;
277(44):
41736 - 41743.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|