|
Originally published In Press as doi:10.1074/jbc.M102872200 on May 22, 2001
J. Biol. Chem., Vol. 276, Issue 28, 26122-26131, July 13, 2001
The Role of CDP in the Negative Regulation of
CXCL1 Gene Expression*
Chaitanya
Nirodi ,
Jessie
Hart ,
Punita
Dhawan ,
Nam-sung
Moon§,
Alain
Nepveu§, and
Ann
Richmond ¶
From the ¶ Department of Veterans Affairs,
Nashville, Tennessee 37212, Vanderbilt University
School of Medicine, Department of Cancer Biology,
Nashville, Tennessee 37232, and the § Molecular Oncology
Group, McGill University, Montreal, Quebec H3A 1A1, Canada
Received for publication, April 2, 2001, and in revised form, May 20, 2001
 |
ABSTRACT |
The CXC chemokine, melanoma growth stimulatory
activity/growth-regulated protein, CXCL1 is an important modulator of
inflammation, wound healing, angiogenesis, and tumorigenesis.
Transcription of CXCL1 is regulated through several cis-acting elements
including Sp1, NF- B, and an element that lies immediately upstream
of the NF- B element, the immediate upstream region (IUR). A
transcription element data base search indicated that the IUR element
contains a binding site for the transcriptional repressor, human
CUT homeodomain protein/CCAAT displacement protein (CDP). It is
shown here that in electrophoretic mobility shift assays, complexes
obtained with the IUR oligonucleotide probe are supershifted by
anti-CDP antibodies and that a CDP polypeptide containing a high
affinity DNA binding domain binds to the sequence GGGATCGATC in the IUR
element. In Southwestern blot analyses, oligonucleotides containing the
wild-type IUR sequence, but not a mutant oligonucleotide with
substitutions in the GGGATCGATC sequence, bind a 170-180-kDa protein.
Furthermore, overexpression of the CDP protein blocks CXCL1
promoter activity in reporter gene assays, whereas overexpression of an
antisense CDP construct leads to a significant increase in
CXCL1 promoter activity. Mutations in the IUR element,
which map in the putative CDP-binding site, inhibit the binding of CDP
to the IUR element and favor increased transcription from the
CXCL1 promoter. Based on these results, we propose that
transcriptional regulation of the CXCL1 gene is mediated in
part by CDP, which could play an important role in inflammatory
processes and tumorigenesis.
 |
INTRODUCTION |
The melanoma growth stimulatory activity/growth-regulated protein
, recently designated as CXC ligand 1 (CXCL1),1 plays an important
role in wound healing, inflammation, and tumorigenesis (1-5). The
CXCL1 gene is not constitutively expressed in normal retinal
pigment epithelial cells (RPE) but can be induced by cytokines such as
interleukin-1 (IL-1) and tumor necrosis factor- and bacterial products such as lipopolysaccharide. In contrast, Hs294T malignant melanoma cells exhibit high, constitutive levels of CXCL1 mRNA and
protein. IL-1 treatment of Hs294T cells does not significantly increase
the already elevated transcription of the gene, although it does appear
to stabilize CXCL1 mRNA (6).
Transcription of the CXCL1 gene is regulated largely through
a 306-bp minimal promoter situated immediately upstream of the transcription start site. The four cis-acting elements comprising the
minimal promoter include a TATA box ( 25 to 30 bp), an
NF- B-binding site ( 67 to 77 bp), an AT-rich HMGI(Y)-binding
element nested within the NF- B site, an immediate upstream region
(IUR) ( 78 to 96 bp), and a GC-rich SP1-binding site ( 117 to 128
bp) (7, 8). In RPE cells, IL-1 induction results in increased nuclear levels of NF- B p65 (RelA) and NF- B p50 subunits (9). This is a
consequence of an IL-1-induced activation of the I B kinases (IKK1/IKK2) and subsequent phosphorylation, ubiquitination, and degradation of the IKK substrate, I B. In Hs294T cells,
constitutively high nuclear levels of the p50 and p65/RelA proteins can
be correlated with constitutive activity of IKK1/IKK2 and enhanced
degradation of the I B protein (10). The NF- B element therefore
represents a crucial, inducible component of the putative CXCL1 enhanceosome.
The IUR is an ~20-bp sequence that is located immediately upstream of
the NF- B element in the CXCL1 promoter. Previously, we
demonstrated that in addition to the NF- B, the IUR element is
essential for basal as well as cytokine-induced expression of the
CXCL1 gene. In particular, point mutations within a putative TCGAT motif of the IUR element abolished basal and IL-1-induced transcription in reporter gene assays with RPE and Hs294T cells (8).
Furthermore, in electrophoretic mobility shift assays (EMSA), these
mutations blocked the ability of this element to compete with a
constitutive, IUR-specific complex in RPE and Hs294T nuclear extracts.
UV cross-linking and Southwestern blot analyses revealed that at least
one protein having a relative molecular size of 115 kDa bound the IUR
element in a sequence-specific manner (5). Purification of the 115-kDa
IUR-specific protein by oligonucleotide affinity chromatography
revealed its identity as the poly(A)DP-ribose polymerase (PARP) and
demonstrated that it plays a role in the activation of the
CXCL1 promoter (11).
In this study, the CXCL1 promoter was analyzed within a
transcriptional element data base (Transfac) using a web-based search engine, the Transcription Element String Search (TESS). The search identified the CXCL1 IUR element as a putative binding site for the
human CCAAT displacement protein (CDP) that is highly homologous to the
Drosophila CUT protein. Genetic studies first identified the
CUT locus as an important determinant of cell type specificity in Drosophila melanogaster (12-14). The human CDP is
a homeodomain protein that is composed of an N-terminal, coiled-coiled
domain, three highly homologous ~70 amino acid long CUT repeat
domains, a C-terminal homeodomain, and two transcription repression
domains (12, 15). The three CUT repeats and the homeodomain bind
DNA with differing affinities. However, high affinity sequence-specific DNA binding requires the cooperation of at least two domains, in
particular CUT Repeat 3 and the homeodomain (16-20). A
consensus binding site for the CDP protein was identified by polymerase chain reaction-mediated site selection and was specified by the sequence (T/G)ATCGAT(C/A) (18, 19). CDP is an active repressor of cell
cycle-dependent or differentiation-specific genes including gp91-phox, (21), p21WAF1/CIP1/SDI1 (22), osteocalcin
(23), thymidine kinase (24), cystic fibrosis related trans-conductance
receptor (25), and c-myc (26). CDP also regulates the
immunoglobulin heavy chain enhancer as a component of the factor
NF-µNR (27). CDP has been shown to interact with accessory factors
such as cyclin A and p107 retinoblastoma-related protein to form
proliferation-specific complexes (28). Similar complexes containing
CDP, cyclin A, and polyoma virus large T antigen have been causally
related to development of uterine leiomyomas (29).
Here, the IUR element of the CXCL1 promoter has been further
characterized. The data indicate that the IUR can bind a protein having
a molecular size of 170 kDa and that this protein is the 170-kDa CDP.
In EMSAs, recombinant CDP polypeptides bound the IUR element in a
sequence-selective fashion. In co-transfection experiments,
overexpression of the CDP protein inhibited CXCL1 promoter
activity, whereas overexpression of antisense CDP mRNA induced
CXCL1 promoter activity 5-fold over the control. These results indicate that the transcription of the CXCL1 gene is
negatively regulated by the CCAAT displacement protein.
 |
MATERIALS AND METHODS |
Cell Lines and Treatments--
Hs294T melanoma cells are a
continuous cell line established from a human melanoma metastatic to
the lymph node. These cells were obtained from American Type Culture
Collection (Manassas, VA). RPE cells are normal retinal pigment
epithelial cells that were cultured by Dr. Glenn Jaffe from the North
Carolina Organ Donor and Eye Bank within 24 h of death (30). RPE
and Hs294T cells were cultured as described previously (9).
Reporter and Expression Vectors--
The CXCL1
minimal promoter region ( 306 to +45 bp), which was originally
constructed in a CAT reporter system (7), was inserted in the pGL2
Basic vector (Promega, Madison, WI). The mutant reporter mIUR.Luc was
generated by using the GeneEditor in vitro site-directed
mutagenesis system (Promega, Madison, WI). The mutagenic
oligonucleotide employed for this purpose had the sequence:
5'-cgggaATGaCctggaactccgggaatttccctggcc-3'. Uppercase letters represent nucleotide replacements in the GGGATCGATC motif of
the IUR element, which is underscored. The reporter vectors, p2RT.Luc,
p2mRT.Luc, and p2dRT.Luc, were generated by inserting XhoI/HindIII-flanked oligonucleotides in the
XhoI and HindIII sites of pGL2. The
oligonucleotide sequence for the wild-type reporter construct, 2 RT.Luc, was
5'-tcgaggggatcgatctggaactccgggatcgatctggaactcctggcccgggggctccgggctttccagccccaaccatgcataaaaggaagctta-3'. The underscored letters represent the GGGATCGATC motif of the IUR
element. The oligonucleotide sequence for the mutant reporter 2dRT.Luc
was
tcgagcctcgatctggaactcctcgatctggaactccggatgctggcccgggggctccgggctttccagccccaaccatgcataaaaggaagctta-3'. The underscored letters represent the truncated IUR motif in
which the 5'-GGGA sequence has been deleted. An expression vector
containing the full-length CDP cDNA in the sense orientation
(pMX.HSCDP) and another with the CDP cDNA in the antisense
orientation (pMXASCDP) were previously described (19, 20). All reporter
and expression constructs were confirmed by sequencing.
Reagents--
Monoclonal and polyclonal antibodies raised
against the CDP protein as well as recombinant CDP polypeptides have
been characterized previously, and the specificity of these antibodies
to the various domains of the CDP protein has been demonstrated
(31).
Electrophoretic Mobility Shift Assays--
Nuclear
extracts were prepared as described previously. All extracts contained
a 1× concentration of Complete protease inhibitor mixture
(Roche Molecular Biochemicals). The 2R oligonucleotide, 5'-gggatcgatctggaactccgggatcgatctggaactcc-3', was radiolabeled by
extension of an annealed primer, 5'-ggagttccagatc-3'. The probe 2mR had
the oligonucleotide sequence
5'-gggaagtacctggaactccgggaagtacctggaactcc-3' and was primed by an oligonucleotide primer, 5'-ggagttccaggta-3'. (Underscored letters represent the nucleotide replacements in the
GGGATCGATC motif of the IUR element.) The probe 2dR,
5'-cctcgatctggaactcctcgatctggaactccggatgc-3', was primed with
5'-gcatccggagttcca-3'. The primed oligonucleotide probes were then
radiolabeled with the Klenow fragment of Escherichia coli
DNA polymerase, dNTPs, and [ -32P]dCTP. The probe
containing the NF- B-binding site 5'-agttgaggggactttcccaggc-3' was
from Promega (Madison, WI) and was radiolabeled using T4 polynucleotide kinase and [ -32P]ATP. A typical binding reaction
involved a 15-min preincubation with 10 µg of nuclear extract, 2 µg
of the nonspecific competitor poly(dI·dC), 200 ng of single-stranded
oligonucleotide, 20 mM Hepes-NaOH (pH 7.6), 100 mM NaCl, 1 mM dithiothreitol, 2% glycerol, followed by a 20-min incubation with 50,000 cpm (40 fmol) of
radiolabeled probe. In oligonucleotide competitions, 1000-fold molar
excess of cold, double-stranded oligonucleotide was added to the
preincubation mix. In some oligonucleotide competition experiments, the
CDP-binding site oligonucleotide (wCDP) used had the upper-strand
sequence, 5'-aaaagaagcttatcgataccgt-3'. Mutations in the
CDP-binding site, previously shown to affect binding to the CDP DNA
binding domains (18), were included in the oligonucleotide (mCDP) that
had the following sequence, 5'-aaaagaagcttatTCataccgt-3'.
Underscored letters represent the core CDP-binding motif, and
uppercase letters indicate the nucleotide replacements in this
sequence. In supershift analyses, antibodies raised against CDP domains
other than the DNA binding domain (W, A, N) were added after the
binding reaction and incubated for an additional 10 min at room
termperature prior to electrophoresis. In cases where the antibody was
against the CDP DNA binding domain (AK), the antibody was
included in the preincubation reaction. The concentration of antibody
in each EMSA reaction was 2 µg/10 µg nuclear extract. Complexes
were resolved by electrophoresis for 2 h at 170 V on a 4% native,
polyacrylamide gel, which was later dried and processed for
autoradiography. In cases where purified CDP polypeptides were used,
the reaction mixture contained no cold competitor, and the complexes
were resolved on a 6% native acrylamide gel.
Southwestern and Western Blot Analysis--
Nuclear extracts (25 µg) were heated at 90 °C for 3 min in 50 mM Tris·Cl
(pH 6.8), 100 mM dithiothreitol, 2% SDS, and 10% glycerol, resolved on 4% stacking, 8% resolving SDS-polyacrylamide gel, and electrophoretically transferred to nitrocellulose membranes (Bio-Rad). For Southwestern analysis, membranes were rocked for 15 min
in PBS, blocked for 4 h at room temperature with buffer A (20 mM Hepes-NaOH, 50 mM NaCl, 12.5 mg/ml skim milk
powder, 2.5 mg/ml bovine serum albumin, 100 µg/ml native salmon sperm DNA), and incubated overnight at room temperature in up to 2 ml of
buffer A + 107 cpm (8-10 pmol) of radiolabeled probe.
Probes used were either 2R, 2mR, or 2dR which are described under the
"Electrophoretic Mobility Shift Assays." Membranes were subjected
to three washes of 15 min each at room termperature in a buffer
containing 20 mM Hepes-NaOH, 50 mM NaCl, 1 g/liter skim milk powder, and 0.025% Nonidet P-40, prior to drying and autoradiography.
For Western analysis, following transfer, membranes were blocked in
Tris-buffered saline containing 0.05% Tween 20 and 5% skim milk
(TBST) and probed with rabbit polyclonal anti-CDP antibody at a
dilution of 1:2500 (0.8 µg/ml) using standard procedures. The
specificity of this antibody has been demonstrated previously (31). The
signal was visualized by enhanced chemiluminescence (ECL) assay
(Amersham Pharmacia Biotech) according to the manufacturer's recommendations.
Transient Transfection and Reporter Activity Assay--
Hs294T
or RPE cells were plated in 60-mm dishes at a density of 2 × 105. The following day, cells at nearly 70% confluency
were transfected using the LipofectAMINE/Plus method (Life
Technologies, Inc.) with 1 µg of the reporter construct pGL2.CXCL1,
pGL2mIUR, pGL2.2mRT, or pGL2.2RT, and whenever necessary, 1 µg of the
CDP expression vector either pMXHSCDP or the CDP antisense construct
pMXASCDP. In addition, all samples received 1 µg of pCMV- -gal. The
total amount of DNA was kept constant by supplementing with either pGL2 or pUC19 vector DNA. Cells were harvested 48 h after transfection, and luciferase activity was measured using the luciferase assay system
(Promega, Madison, WI) and Monolight 2010 Luminometer (Analytical Luminescence Laboratory, San Diego, CA). All values were normalized to
-galactosidase expression to correct for transfection efficiency. Each experiment was performed 3-6 times, with 3-4 different plasmid preparations. Each time the samples were in duplicate. The transfection efficiency of the sense and antisense CDP constructs was about 45-60%. Mean values and standard deviation was determined from 3 to 6 separate experiments. Student's paired t test p
values were determined using Microsoft Excel.
 |
RESULTS |
Sequence Analysis of the CXCL1 Promoter Reveals a Putative Binding
Site for the CCAAT Displacement Protein--
The immediate upstream
region (IUR) has been described previously as essential for CXCL1
transcription. It has been shown earlier that this element contains a
TCGAT motif, which is essential for binding to a 115-kDa protein. The
factor binding to this element has been purified by oligonucleotide
affinity chromatography and has been identified by mass
spectroscopy/matrix-assisted laser desorption ionization spectroscopy
as PARP (11). In this report we show that the IUR binds a second
transcription factor that has specificity to the GGGATCGATC motif of
the IUR element and negatively regulates CXCL1 gene transcription.
In order to identify putative transcription factor-binding sites
in the IUR element ( 96 to 78 nt) of the CXCL1 promoter, we employed a web-based search engine, TESS
(www.cbil.upenn.edu/tess) (32), and analyzed the sequence corresponding
to 130 bp to +20 of the minimal CXCL1 promoter (Fig.
1). In particular, our objective was to
identify putative transcription factor-binding sites within the
sequence extending from 96 to 78 nt (underscored letters
in Fig. 1) which we designate here as sequence R. The search was
restricted to a maximum of 20% mismatch within an element length of 6 nucleotides or greater. As a negative control, a mutant promoter
sequence with replacements in the TCGAT motif of the IUR element was
also used. Fig. 1 describes the sequences identified in the 130 to
+20 nt region by the TESS search. In addition to the previously
characterized Sp1 and NF- B sites, an 8-nt sequence ( 94 to 87 nt)
located within the IUR element exhibited a 100% match with the
putative binding site for the transcriptional repressor, CDP. The
CDP-binding site was not detected by a similar search of the mutant
promoter sequence in which the TCGAT motif was altered. The consensus
sequence for the CDP-binding element is (T/G)ATCGAT(C/A). This
consensus sequence perfectly matches the GATCGATC motif in the IUR
element. Other putative sites identified by the search included binding
sites for the transcription factors, Sp1, C/EBP , opaque-1, and
dorsal. In particular, putative Sp1, opaque, and C/EBP sites were detected within the 100 to 77-nt region of the
CXCL1 promoter.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Transcription element string search of the
CXCL1 promoter. The sequence contained within
nucleotides 130 and +20 nt of the CXCL1 promoter was
analyzed using a web-based search engine (TESS). The sequence extending
from 96 to 78 nt has been underscored and is designated
here as sequence R. Bold arrows indicate
transcription factor-binding sites identified by TESS that have a high
likelihood of occurrence with minimum number of mismatched bases.
Broken arrows represent sites that had a greater degree of
mismatches with the CXCL1 promoter sequence and are
therefore predicted to be less likely to occur. The direction of the
arrow indicates the sense or the antisense strand of the
CXCL1 promoter that scored a hit. The putative CDP-binding
site as identified by TESS is located between the nucleotides 94 and
87 and is indicated by . The lightface arrow indicates
the initiation site for CXCL1 transcription.
|
|
The IUR Binds a 170-kDa Protein--
We first examined
sequence-specific binding to the IUR element. Fig.
2A describes the nucleotide
sequence 96 to 67 nt of the CXCL1 promoter.
Uppercase letters represent the 20-bp IUR element, which we
designate here as sequence R. Lowercase letters represent
the adjacent NF- B element. The TCGAT motif is
underscored. Oligonucleotide probes containing a single copy
of the sequence R showed weak binding in electrophoretic mobility shift
assays. However, probes containing two tandem copies of sequence R
showed significantly stronger binding (data not shown). Fig.
2A shows the sequence of the oligonucleotide probes 2R and
2mR used in binding experiments in this study. The oligonucleotide
probe 2R contains two tandem copies of the wild-type IUR sequence. The oligonucleotide probe 2mR contains multiple nucleotide replacements in
the TCGAT motif each indicated by an asterisk. The
underscored letters indicate the TCGAT motif.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2.
The IUR element binds two proteins, p170 and
p80. A, sequences of the 96 to 67 nt of the
CXCL1 promoter and the oligonucleotide probes, 2R and 2mR,
are shown. Uppercase letters in the CXCL1
promoter sequence represent the IUR element, and lowercase
letters show the adjacent NF- B-binding site. The sequence
underscored in probes 2R and 2mR represents the TCGAT motif
between nucleotides 93 and 89 in the CXCL1 promoter.
Asterisks below the 2mR sequence indicate
nucleotide replacements in the TCGAT motif. B, EMSA. RPE
nuclear extracts were incubated with the 2R probe (lanes
1-3) or the 2mR probe (lanes 4-6). Two distinct
complexes migrating as a doublet are obtained with the 2R probe.
Complexes were competed with 1000-fold molar excess of cold 2R or 2mR
oligonucleotides as indicated above the panel.
Arrows indicate the mobility of the two IUR-specific
complexes. C, Southwestern blot analysis. Molecular size
markers (lanes 1 and 3) or 25 µg of nuclear
extract from RPE cells (lanes 2 and 4) were
separated on an 8% reducing SDS-PAGE gel, trans-blotted to
nitrocellulose membranes, and probed with either 2R (lanes 1 and 2) or 2mR (lanes 3 and 4) probes.
Arrows indicate migration of proteins bound to the
respective probes. Lines indicate bands of a molecular size
marker. D, Western blot analysis. 30 µg of RPE nuclear
extract were separated on an 8% SDS-polyacrylamide gel, transferred to
nitrocellulose membranes, and probed with an antibody against the
C-terminal domain of the CDP protein. B-D are
representatives of >4 independent experiments.
|
|
In Fig. 2B, sequence-specific binding to the 2R and 2mR
oligonucleotides is examined. Nuclear extract from RPE cells was
analyzed by electrophoretic mobility shift assay on 4% native
acrylamide gels (Fig. 2B) for binding to
32P-labeled oligonucleotides corresponding to the 2R
(lanes 1-3) or the 2mR sequence (lanes 4-6).
Two specific complexes were generated by the 2R probe but not the 2mR
probe (Fig. 2B, compare lanes 1 and
4). The 2R-specific complexes were then competed with
1000-fold molar excess of cold oligonucleotide corresponding to either
the wild-type (2R) or the mutant (2mR) sequences. The complexes with the 2R probe were resistant to competitions with 1000-fold molar excess
of the oligonucleotide 2mR (Fig. 2B, lane 2) but were
completely eliminated by a similar excess of the 2R oligonucleotide.
Since the only difference between the two oligonucleotide probes is the
sequence of the TCGAT motif, the results of this experiment indicate
that these complexes are specific to the TCGAT motif of the IUR element.
In order to determine the relative molecular sizes of the factors
interacting with the 2R probe, nuclear extract from RPE cells was
examined for binding to the 2R oligonucleotide probe using Southwestern
blot analysis. RPE nuclear extracts were first resolved on an 8%
SDS-polyacrylamide gel and transferred to nitrocellulose membranes, and
the blots were incubated with 32P-labeled 2R probe. Similar
blots probed with the 2mR oligonucleotide probe served as a negative
control. Results of such an experiment are represented in Fig.
2C. The 2R oligonucleotide bound to two distinct proteins
having relative molecular sizes of 170 and 80 kDa (lane 2).
However, when probed with the 2mR oligonucleotide, no binding was
detected in these extracts (lane 4). The results are
consistent with data from the EMSA experiment in which the 2R
oligonucleotide was bound by two specific complexes, whereas the 2mR
oligonucleotide probe failed to bind any complex. The data together
indicate that binding of both polypeptides appears to be specific to
the TCGAT motif of the IUR element because mutations in this motif
appear to block binding to the IUR element.
Results from a transcription element search indicated that the IUR
element contained a binding site for the CDP, which has a molecular
size of 170-180 kDa. One of the proteins that bound to the 2R
oligonucleotide probe also migrated with a relative molecular size of
170 kDa. We next examined the expression of CDP in RPE nuclear extracts
using anti-CDP antibody in order to verify the presence of CDP in RPE
nuclear extracts and determine the relationship of the two proteins
p170 and p80 that bound to the 2R probe in Southwestern blot analysis.
We reasoned that if the antibody detected only the 170-kDa polypeptide
then the 80-kDa polypeptide was unrelated to CDP and distinct from it.
However, if it recognized both polypeptides it would mean that the 80 kDa polypeptide was either a cleavage product of the 170-kDa CDP or antigenically similar to it. We examined RPE nuclear extracts by
Western blot analysis using anti-CDP antibodies. In Fig. 2D, RPE extracts were first electrophoresed on an 8% SDS-acrylamide gel
and transferred to nitrocellulose membrane, and the blots were
incubated with antibodies raised against the C-terminal domain of the
CDP protein. The data indicate that anti-CDP antibody detected two
polypeptides with molecular sizes 170 and 80 kDa in RPE nuclear extracts, a result that closely resembled the binding data from the
Southwestern blot analysis using the 2R oligonucleotide probe in Fig.
2C. Taken together, results from the TESS analysis and the
Southwestern and the Western blot assays suggest the possibility that
the 80-kDa polypeptide may be a specific cleavage product of the
170-kDa CDP protein or an alternatively spliced product of the CDP
gene, analogous to the 76-kDa CDP spliced product, CASP (33).
The Consensus Sequence for the CCAAT Displacement Protein
(CDP)-binding Site Competes with Binding to the 2R Probe--
If CDP
indeed binds to the IUR element, we reasoned that it should be present
in the complexes associated with the 2R oligonucleotide probe in EMSA.
Furthermore, recombinant CDP should be able to bind specifically the 2R
oligonucleotide probe in EMSA. We employed three approaches to test
whether CDP is a constituent of the 2R complexes in EMSA. First, the
effect of competition with wild-type and mutant CDP-binding site
oligonucleotides on complexes generated with the probe 2R was examined.
Second, we tested whether recombinant polypeptides corresponding to
specific domains of the CDP protein possessed the ability to bind
selectively the IUR element. Third, we tested the effect of antibodies
raised against different domains of the CDP protein on complexes
generated with the 2R probe. Based on the work of Harada et
al. (19) a high affinity CDP-binding site was selected as a
potential competitor. Sequences for this oligonucleotide and its
corresponding mutant are described under "Materials and Methods."
Fig. 3A shows a non-scaled
schematic representation of the human CDP and the recombinant
polypeptides corresponding to the two DNA binding domains of the
protein. Fig. 3B shows the sequences of the three
oligonucleotide probes used in this experiment. In addition to the 2mR
mutant, we used a third oligonucleotide probe, 2dR, which lacked the
96- to 93-nt sequence 5'-GGGA-3'. The underscored
letters represent the TCGAT motif of the IUR element. In Fig.
3C, complexes generated with 2R (lanes 1-3) were
competed with a 1000-fold molar excess of oligonucleotides that
contained either the consensus CDP-binding site (lane 3) or
a specific mutant of that site (lane 2). The wild-type
CDP-binding sequence, but not the mutant CDP sequence, diminished the
complexes obtained with this probe but had no significant effect on
complexes generated with an oligonucleotide probe containing an
NF- B-binding site (lanes 5 and 6), suggesting
that both complexes associated with probe 2R contain the CCAAT
displacement protein.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
The CDP binds the IUR element of the
CXCL1 promoter. A, the CDP protein is
schematically represented and is not according to scale. The protein
contains a coiled-coil (CC) domain and three CUT
repeats CR1, CR2, and CR3, in addition to a
homeodomain DNA-binding region (HD-DBD) and a C'-terminal,
trans-repression domain (REP). Polypeptides corresponding to
two different DNA binding domains, one comprising CR1 and CR2
(C1C2) and the other comprising CR3 and HD-DBD
(C3HD), were used in this study. B, sequences of
oligonucleotide probes. The probe 2R contains two tandem copies of the
20-bp IUR element. Mutant 2mR contains multiple nucleotide replacements
in the TCGAT motif, which are indicated by an asterisk
below. The mutant 2dR contains a truncated IUR sequence in 2 tandem repeats. The mutation involves deletion of the 5'-GGGA-3'
sequence corresponding to the region between nucleotides 97 and 94
of the CXCL1 IUR element. The deleted nucleotides are indicated by
dashes. Underscored letters in all three
oligonucleotide sequences represent the TCGAT motif of the IUR element.
C, oligonucleotide competition. Complexes obtained in EMSA
with the 2R oligonucleotide probe were competed with a 1000-fold molar
excess of oligonucleotides containing either the mutant (lane
2) or wild-type-binding site sequence (lane 3) and were
resolved on a 4% native polyacrylamide gel. The sequences for the
wild-type CDP or the mutant CDP oligonucleotides are described under
"Materials and Methods." Arrows indicate the two
complexes that are observed with the 2R probe. D, EMSA.
Radiolabeled probes 2R (lanes 1 and 4), 2mR
(lanes 2 and 5), or 2dR (lanes 3 and
6) were incubated with polypeptides comprising CUT
repeat-3 homeodomain (C3HD, lanes 1-3) or
CUT repeat 1-Cut repeat 2 (C1C2, lanes
4-6), and the complexes were analyzed by EMSA on a 4% native
polyacrylamide gel. Arrows indicate the sequence-selective
complexes formed by the 2R probe with the C3HD polypeptide. Data shown
here are representative of >3 independent experiments.
|
|
These observations were followed by exploring the ability of various
sub-domains of the CDP protein to bind the 2R probe. A sub-domain of
CDP comprising the CUT repeat 3 and homeodomain (C3HD) (Fig. 4A)
was demonstrated to have high affinity, sequence selective binding to
the (T/G)ATCGAT(C/A) motif, whereas a sub-domain spanning CUT
repeats 1 and 2 (C1C2) was unable to bind this
sequence (19, 20). Our next objective was to examine whether the
C3HD polypeptide exhibited sequence-selective binding to
the 2R probe. We selected the C1C2 polypeptide
as a negative control for sequence-specific binding to the 2R probe as
this domain was reported to exhibit only low affinity and sequence
non-selective DNA-binding properties (19). EMSA in Fig. 3D
shows that the C3HD sub-domain produced two distinct
complexes with the 2R but not with the 2mR or the 2dR probes. The data
indicate that the high affinity, sequence-specific binding exhibited by
the C3HD polypeptide requires not only the TCGAT motif of
the IUR element but also the GGG sequence at the 5' end of the motif
5'-GGGATCGATC-3'. In contrast to the sequence-selective binding
exhibited by the C3HD subdomain, the polypeptide,
C1C2, failed to bind any of the three probes.
These results are consistent with the reported binding properties of
the two subdomains. The two band pattern generated by C3HD
is probably a consequence of the protein binding one or both the copies
of the IUR element in the 2R probe.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
Complexes specific to the IUR element contain
the CCAAT displacement protein. A, the CDP protein is
schematically represented and is not according to scale. Antibodies
against various epitopes in the protein used in this study are
indicated. mab, monoclonal antibody. B, in EMSA
with RPE nuclear extracts, reaction mixtures with either the 2R probe
(lanes 1-7) or a probe (NF- B) representing the consensus
NF- B-binding site (lanes 8-12) contained monoclonal
antibodies (mAB) against various domains of the CDP binding
as indicated above each panel or a nonspecific rabbit IgG
(lanes 2 and 9) as a control. The
arrows indicate the mobility of the supershifted
complexes.
|
|
Anti-CDP Antibodies Recognize Complexes Generated by the 2R
Sequence--
Next, the effect of antibodies against various domains
of the CDP protein (shown in Fig. 4A) was examined in
supershift analyses with the 2R probe. In experiments represented in
Fig. 4B, the 2R-specific complexes were generated in nuclear
extracts from RPE cells by EMSA. EMSA reactions were incubated with
specific antibodies raised against various domains of the CDP protein. Almost all the anti-CDP antibodies either eliminated the retarded complexes or produced a supershifted complex. In contrast a nonspecific antibody did not affect the migration of the complexes (Fig. 4B, lane 2). In particular, monoclonal antibodies against the
CUT Repeat 3 alone (mAB: A, lane 4),
trans-repression domain of the CDP protein (mAB: W,
lane 5), or a region adjacent to the trans-repression domain
(mAB: N, lane 6) generated distinct supershifted
complexes, whereas monoclonal antibodies raised against the
homeodomain, DNA-binding region of CDP (mAB: AK, lane
3), or a polyclonal antibody against the entire C-terminal
domain, which included the C3HD domain (anti-C', lane
7), virtually eliminated the two complexes associated with the 2R
probe. The antibodies had no effect on complexes associated with the
consensus NF- B element (lanes 8-12). In addition,
antibodies against the other transcription factors such as Sp1, Sp3,
c-Jun, c-Fos, and C/EBP had no significant effect on these complexes
(data not shown). Similar results were obtained with nuclear extracts
from Hs294T melanoma cells, HEK293, and HeLa cells (data not shown).
These data clearly demonstrate that CDP is a constituent of the
specific complex bound to the IUR element.
CDP Transcriptionally Represses CXCL1 Promoter Activity--
To
determine whether CDP transcriptionally regulates the CXCL1
promoter, the effects of CDP overexpression in transient transfection and reporter gene assays (Fig. 5) were
examined. RPE cells (Fig. 5A) or Hs294T cells (Fig.
5B) were co-transfected with expression constructs of the
CDP protein in either the sense or the antisense direction along with
luciferase reporter constructs, driven by either the 306-bp wild-type
CXCL1 promoter or a mutant CXCL1 promoter that
had replacements in the TCGAT motif of the IUR sequence. Forty eight h
after transfection, cells were harvested. Western blot analysis of RPE
cell lysates (Fig. 5A) with an anti-CDP antibody (top
panel) showed that cells transfected with the CDP construct in the
sense orientation (Fig. 5A, lane 2) had at least
2-3-fold higher levels of the 170-kDa CDP protein as compared with
lysates from untransfected cells (compare lanes 1 and
2). In contrast, in cells transfected with the antisense CDP
construct, almost no CDP protein was detected, indicating that the
antisense CDP RNA efficiently ablated CDP levels in these cells
(compare lanes 1 and 3). Of the two polypeptides,
p170 and p80, detected by the anti-CDP antibody (Fig. 2D),
only the 170-kDa protein is shown in this experiment. An antibody
against a 115 constitutive nuclear protein, PARP, showed no differences
in the levels of PARP with overexpression of either construct (Fig.
5A, bottom panel). Cell lysates from the above
transfectants were assayed for luciferase activity. The results
indicate that overexpression of CDP in RPE cells did not significantly
affect the low basal activity of the CXCL1 promoter (Fig.
5B). However, an almost 50% inhibition of the
constitutively high basal CXCL1 promoter activity in Hs294T cells was observed. Overexpression of the CDP sense construct clearly
inhibited the CXCL1 promoter in Hs294T cells (Fig.
5C). Expression of the CDP gene in the antisense direction,
however, led to a striking 4-5-fold increase in transcription from the CXCL1 promoter in both cell lines. The results indicate that
a decrease in CDP levels particularly in RPE cells relieves
CDP-mediated repression of the CXCL1 promoter in these
cells.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 5.
The CDP represses the CXCL1
promoter in reporter assays. A, Western blot
(WB) analysis. RPE cells were transfected with pCMV- -gal,
a reporter construct containing the wild-type CXCL1 promoter
(CXCL1.Luc) and either the pGL2 vector (lane 1) or an
expression construct containing the CDP cDNA in either the sense
(lane 2) or antisense (lanes 3) direction. Whole
cell extracts were then made as described under "Materials and
Methods." 20 µg of whole cell lysate from each sample were then
separated on 8% SDS-polyacrylamide gels, transferred to nitrocellulose
membranes, and probed with an antibody raised against either the
C-terminal domain of the CDP protein (top panel) or a
115-kDa constitutively expressed nuclear protein, PARP (bottom
panel). For reporter assays, RPE cells (B) or Hs294T
cells (C) were co-transfected with pCMV- -gal and a
reporter construct containing either the wild-type CXCL1
promoter (CXCL1.Luc) or a mutant promoter
(mIUR.Luc) that contained the multiple replacements in the
TCGAT motif of the IUR element. The replacements were the same as in the 2mR oligonucleotide probe, shown in Figs. 2 and 3. Cells
also received expression constructs containing the CDP cDNA in
either the sense or the antisense orientation. Data shown here are from
a representative of six independent experiments. Error bars
indicate S.D. values. Luciferase activity values obtained with the
antisense construct alone were found to be significantly different than
those with the empty vector as determined by Student's paired
t test, and p value was found to be <0.01,
indicated by an asterisk.
|
|
The results with the mutant promoter having replacements in the TCGAT
motif are intriguing. Oligonucleotide probes with replacements in the
TCGAT motif fail to generate 2R-specific CDP containing complexes in
EMSA and do not bind the 170- and 80-kDa proteins in Southwestern blot
assays (Fig. 2, B and C). Overexpression of CDP
represses CXCL1 promoter activity in luciferase assays in
Hs294T cells, and overexpression of the antisense CDP construct leads
to a 4-5-fold increase in transcription from the CXCL1
promoter in RPE cells (Fig. 5B) and 2-2.5-fold in Hs294T
cells (Fig. 5C). If CDP-mediated events at the IUR element
are indeed eliminated by this mutation, then one could expect that the
TCGAT mutation would relieve CDP-mediated repression of the
CXCL1 promoter and allow an increase in promoter activity
compared with the wild-type promoter.
We considered several possibilities to address this question. First,
the consensus sequence for CDP binding is considerably degenerate. It
is possible that while the mR mutation is effective in eliminating CDP
binding in EMSAs and Southwestern assays, it may only partially affect
CDP binding in an in vivo situation. A second possibility is
that reduction in the levels of the CDP protein by antisense RNA
overexpression could affect expression of other trans-acting factors
involved in the regulation of the CXCL1 promoter, notably
the Rel family of transcription factors. A TESS of the relA
promoter reveals a putative binding site for the CDP repressor,
although there is no evidence in the literature linking the two
proteins. A third possibility is that the IUR element may contain a
binding site for a second protein, which could be an activator of CXCL1
transcription, and the TCGAT mutant may have blocked binding to both
the 170-kDa protein as well as the activator protein. In support of the
last assumption, previous studies from our laboratory demonstrated that
the TCGAT motif of the IUR element is crucial to the binding of the
115-kDa protein poly(A)DP-ribose polymerase that has a distinct
positive role in the transcriptional activation of the CXCL1
promoter (11).
The IUR element of the CXCL1 promoter extends from 96 to
78 nt. The sequence between positions 96 and 87 nt,
5'-GGGATCGATC-3', contains a binding site for the transcriptional
repressor CDP. Our next objective was to generate a mutant sequence of
the IUR, which more effectively eliminated IUR-CDP interactions
in vivo. We considered a mutant oligonucleotide in which the
first four nucleotides 5'-GGGA-3' of the IUR motif 5'-GGGATCGATC-3' are
deleted. We designate this sequence 2dR. The 2dR sequence is a
significant departure from the consensus CDP-binding site. The 2dR
sequence failed to bind the high affinity DNA binding
(C3HD) domain of the CDP protein (Fig. 3C, lane
2). In an EMSA experiment with RPE extracts, this sequence did not
generate a complex or compete with complexes generated by the 2R
sequence (Fig. 6A). In
Southwestern blot analysis (Fig. 6B), the 2R oligonucleotide
probe, containing the wild-type IUR sequence, bound a 170- and an
80-kDa polypeptide in RPE nuclear extracts. The mutant 2dR
oligonucleotide failed to bind either of the two polypeptides detected
by the 2R sequence.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6.
CDP-mediated repression of reporter gene
expression can be relieved by mutations in the IUR element.
A, EMSA. Nuclear extracts from RPE cells were incubated with
either the radiolabeled oligonucleotide probe 2R (lanes
1-6) or the radiolabeled probe 2dR. The reaction mixes contained
a 1000-fold molar excess of the cold competing oligonucleotides 2R,
2mR, or 2dR as indicated in the panel above the gel. Complexes were resolved on a 4% native
polyacrylamide gel. In this particular case, the free probe was run out
to obtain a better resolution of the complexes. B,
Southwestern blot assay. 30 µg of RPE nuclear extract was resolved on
an 8% SDS-polyacrylamide gel, transferred to nitrocellulose membranes,
and probed with radiolabeled oligonucleotide probes 2R (left
panel) or 2dR (right panel). Relative mobility of
molecular size standards is indicated on the left of each
panel. C, reporter assays. RPE cells were transfected with
pCMV. -gal and a luciferase reporter construct that contained either
the 2R oligonucleotide and TATA box (2RT.Luc) or the 2dR
oligonucleotide and TATA box (2dRT.Luc). Results shown here
are representative of three independent, qualitatively similar
experiments. Error bars indicate standard deviation.
Luciferase activity values obtained with the 2RT.Luc construct were
significantly different from values obtained with the 2dRT.Luc
construct, and p value was found to be <0.01, indicated by
an asterisk. D, RPE cells were co-transfected
with pCMV- -gal, either 2RT.luc or 2dRT.Luc reporter constructs, and
an expression construct containing the CDP cDNA in either the sense
(sense CDP) or the antisense (AS-CDP) orientation. The
results shown are representative of 3 independent experiments.
Error bars indicate S.D. values obtained in three
experiments. The luciferase activity values obtained with the 2RT.Luc
and the antisense CDP construct were significantly different from those
containing the the 2RT.Luc and empty vector. The p value was
found to be <0.01 (indicated by an asterisk). No
such differences were observed when a similar comparison was made for
values obtained with the 2dRT.Luc construct.
|
|
By having confirmed that the 2dR sequence did not bind the 170- and
80-kDa polypeptides interacting with the wild-type (2R) sequence, our
next objective was to evaluate the effects of the dR mutation on
reporter gene activity. In order to rule out the possibility that
effects of the antisense CDP overexpression on CXCL1 activity may
involve other transcriptional regulators of the CXCL1 gene,
we generated luciferase reporter constructs driven by a basic
transcriptional module containing only the CXCL1 TATA box and two
copies of either the R sequence (2RT.Luc) or the dR sequence
(2dRT.Luc). In Fig. 6C, RPE cells were transfected with pCMV- GAL and either 2RT.Luc or 2dRT.Luc, and luciferase activity was
measured after 48 h. Relative light unit values obtained were normalized for -galactosidase expression. The 2RT.Luc construct was
expressed at levels 3-4-fold higher than the 2dRT.Luc construct (p < 0.01, Student paired t test). Taken
together with the data from binding experiments in Fig. 6, A
and B, the results from the reporter assay using the 2RT and
2dRT constructs strongly suggest that in RPE cells the wild-type IUR
sequence represses reporter gene activity, and this repression can be
relieved by mutations, such as the dR mutation, which effectively block
the binding of CDP to this element.
If the dR mutation indeed abolishes CDP-IUR interactions, then
overexpression of the CDP cDNA in the sense or the antisense direction should have absolutely no effect on transcription directed by
the 2dR oligonucleotide. To verify whether this is indeed the case, we
examined the effect of CDP overexpression on reporter activity driven
by either the 2RT.Luc or the 2dRT.Luc promoters. RPE cells were
co-transfected with either the 2RT.Luc or 2dRT.Luc constructs along
with expression constructs of the CDP cDNA in either the sense or
the antisense orientation. Luciferase activity was measured 48 h
after transfection. Results in Fig. 6D are representative of
three separate experiments, each performed in duplicate. The results
indicate promoter activity of the 2dRT.Luc construct was found to be at
least 5-fold higher than that of the 2RT.Luc construct (p < 0.01, Student paired t test).
Overexpression of CDP sense or antisense CDP constructs had no effect
on this high level of expression (p < 0.01, Student
paired t test). In striking contrast to effects on the
2dRT.Luc construct, co-transfection with the antisense CDP construct
led to a nearly 4-fold stimulation of the 2RT.Luc promoter activity,
(p < 0.01, Student paired t test), clearly
demonstrating that CDP-mediated repression of the 2RT construct
occurred outside the context of the CXCL1 promoter and was
not due to the neighboring NF- B or Sp1 elements in the
CXCL1 promoter. The high transcriptional activity of the
2dRT.Luc construct relative to the 2RT.Luc construct also points to the
possibility that this sequence could harbor a positive cis-acting
element. This concept is consistent with our earlier observations that mutations in the TCGAT motif significantly inhibited basal as well as
cytokine-induced transcription (8) and our observation that this motif
has binding site for PARP which is associated with transcriptional
activation of the CXCL1 promoter (11).
Reduction in levels of the CDP function by antisense overexpression
clearly seems to relieve trans-repression at the CXCL1 wild-type promoter. In fact, this effect closely resembles the effect
of the mutation dR, which also relieves repression of reporter gene
expression. Results from these experiments suggest negative regulatory
roles for the CDP protein. The data indicate that the IUR element of
the CXCL1 promoter contains a negative regulatory sequence,
which binds the 170-kDa transrepressor CDP.
Findings in this study raise the possibility that CDP may play a role
in repression of basal CXCL1 transcription in normal cells. In cases
where the CXCL1 gene is overexpressed, such as in malignant
melanoma, CDP-mediated trans-repression could be a potential target for
de-regulation of the CXCL1 gene. We explored the possibility
that binding of the CDP protein to the IUR element is reduced in Hs294T
melanoma cells in comparison to normal RPE cells. Nuclear extracts from
normal, NHEM, and malignant melanoma, Hs294T, SKMEL5, WM115, and A375
cells were bound to the 2R oligonucleotide probe in an EMSA experiment
(Fig. 7A). Similarly,
IUR-specific binding was compared between nuclear extracts from normal
RPE and melanoma SKMEL5 cells (Fig. 7B). Both normal and
melanoma nuclear extracts produced similar binding patterns with the 2R probe. There were no consistent differences in CDP binding between the
normal and melanoma nuclear extracts. When examined by Western blot
analysis using an anti-CDP antibody, nuclear extracts from two RPE and
five melanoma cell lines showed no striking differences in CDP levels
between the cell types (data not shown). It is likely that the
trans-repression activity of this protein may be altered in melanoma
cells presumably by post-translational modification of the protein.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 7.
CDP binding activity in normal and melanoma
cells. A, nuclear extracts from 1 normal,
NHEM, and four melanoma cell lines, Hs294T, SKMEL5,
WM115, and A375, were incubated with the 2R probe, and
complexes were resolved on a 4% acrylamide gel. Arrows
indicate 2R-specific complexes. B, nuclear extracts from RPE
T476 and SKMEL5 cells were probed for binding to the 2R probe in an
EMSA experiment. Complexes were resolved on a 4% acrylamide gel.
Arrows indicate 2R-specific complexes.
|
|
 |
DISCUSSION |
The 170-kDa CCAAT Displacement Protein Binds Specifically to the
IUR Element and Negatively Regulates Expression of the CXCL1
Gene--
In experiments described here, the role of the IUR element
in the regulation of the CXCL1 gene is examined. In this
report, we describe specific binding to the IUR sequence, sequence R
( 96 to 78 nt). The data indicate that the GGGATCGATC motif in the IUR element contains the binding site for two polypeptides, 170 and 80 kDa, interacting with the IUR element of the CXCL1 promoter.
Sequence analysis and transcription element data base search revealed
that the CXCL1 IUR element could be a potential binding site for the
human CDP. We present several lines of evidence to support this
conclusion. Supershift analysis with anti-CDP antibodies, EMSA with
recombinant CDP polypeptides, together with reporter gene assays using
sense and antisense CDP expression constructs demonstrate that CDP
binds the IUR element and represses the CXCL1 promoter in
transient transfection assays.
CDP has a relative molecular size of 170 kDa. This is comparable to the
size of the IUR-specific 170-kDa protein, which requires an intact
GATCGATC motif for binding. In this context, the nature of the
80-kDa polypeptide is somewhat unclear. Both the 170-kDa protein
as well as the 80-kDa IUR-specific proteins appear to have identical
specificities to the GGGATCGATC sequence of the IUR element. In
Southwestern assays, binding to both proteins is lost when the TCGAT
motif is altered (mR) or the 5'-GGG sequence is deleted (dR). In
Western blot assays, an anti-CDP antibody detects two polypeptides (170 and 80 kDa) in RPE nuclear extracts. This pattern resembles the
Southwestern blot profiles observed with the 2R oligonucleotide. It is
possible that the 80-kDa polypeptide may be cleavage product of
the 170-kDa protein. A second possibility is that the 80-kDa
polypeptide may represent the 76-kDa alternatively spliced product of
CDP, CASP (33). The binding of the 170-kDa protein to the 2R probe or
the anti-CDP antibody is consistently reproduced across several
different cell lines and employing different batches of nuclear
extracts. In contrast, the 80-kDa polypeptide is not consistently
observed in Southwestern assays with the 2R probe or in Western blots
probed with anti-CDP antibodies. We also observed no correlation
between the presence and absence of the 80-kDa IUR-binding polypeptide
and CXCL1 expression. The physiological relevance of the 80-kDa protein
in terms of its activity as a DNA binding transcriptional repressor
remains to be determined.
Trans-repression by CDP Can Occur Outside the Context of the CXCL1
Promoter--
In reporter gene assays, constructs containing two
copies of sequence R show a striking decrease in promoter activity when compared with similar constructs containing two copies of the dR
sequence. This result has three important implications. First, the IUR
element contains a negative regulatory sequence. Transcriptional activity of the 2dRT.Luc promoter, which lacks the 5'-GGGA sequence, is
3-4-fold higher than that of the 2RT.Luc promoter. This increase in
transcriptional activity could be due to a loss of repressor-binding site. Moreover, a similar increase in transcriptional activity is
observed with the wild-type 2RT.Luc construct when levels of the CDP
protein are ablated by the antisense CDP overexpression. The data
indicate that the GGGATCGATC motif of the IUR element is a binding site
for the 170-kDa, trans-repressor, CDP. Second, CDP-mediated
trans-repression of the CXCL1 promoter is independent of the
Sp1, NF- B, or HMGI(Y)-binding sites in the CXCL1
promoter. This point is supported by the observation that a
transcriptional module that lacks these sites, 2RT.Luc, is responsive
to CDP ablation by antisense CDP overexpression and exhibits an
activity that is at least 3-4-fold higher than that observed in the
absence of the antisense CDP construct. Third, the increased
transcriptional activity of the 2dR construct may involve a positive
cis-acting element contained within the 93- to 88-nt region of the
IUR element. Support for the involvement of a trans-activator
interacting with the IUR element comes from a recent report in which we
identified sequence-specific binding of a 115-kDa transcriptional
co-activator, PARP, to the IUR element, and interactions of this
protein require the TCGAT motif of the element (11). Since interactions
with the 170-kDa CDP protein also require the TCGAT motif, this
sequence may be a potential region of overlap between the binding sites for the two proteins.
Negative Regulation of the CXCL1 Promoter by CDP--
The
CXCL1 promoter, under the control of five cis-acting
elements including the Sp1, IUR, NF- B, HMGI(Y), and TATA box-binding sites, is a template for a multiprotein complex, the CXCL1
enhanceosome. Trans-repression by CDP is thought to involve either
promoter occlusion, by preventing binding to other adjacent or
overlapping cis-acting elements, or by active repression (25, 35). Both these mechanisms may be involved in the regulation of the
CXCL1 promoter. Results from transient transfection and
reporter gene assays suggest that CDP actively represses the
CXCL1 promoter within the context of the minimal
CXCL1 promoter, or outside it. It is possible that
CDP-mediated repression may also involve displacement of other
trans-activating factors that bind to the CXCL1 promoter, such as NF- B, Sp1, HMGI(Y), PARP, or factors contributing to the
stability of the CXCL1 enhanceosome. However, we have no direct evidence at this time to support this hypothesis.
Interestingly, Nourbakhsh et al. (34) have identified
a novel, negative regulatory cis-acting element downstream to the NF- B-binding site in the promoter of the IL-8 gene, which is referred to as CXCL8, based on a recently adopted system of
nomenclature (1). This element controls the basal as well IL-1-induced
expression of the CXCL8 gene in cooperation with the NF- B
element contiguous with it (34). The IUR element in the
CXCL1 promoter may have an analogous function in basal and
IL-I-induced expression of the gene. Negative regulation appears to be
an important control mechanism for promoters of cytokine genes such as
IL-2 (36), IL-3 (37), IL-4 (38, 39), IFN- (40), IFN- , IFN-
(41), tumor necrosis factor- (42), and CXCL8 (34).
Enhanceosome models for cytokine gene expression, analogous to the
CXCL1 paradigm, have been proposed for the regulation of IL-6 and CXCL8
(IL-8) promoters (43). Both promoters have binding sequences for
NF- B, C/EBP, and the TATA box. The strongest promoter activation
relies on the p65 NF- B subunit, which specifically recruits
CREB-binding protein (CBP/p300) to the site. Engagement of CBP/p300 in
the enhanceosome and its histone acetylase activity have been proposed to stabilize the enhanceosome and stimulate transcription from these
promoters (43). In an independent study, CDP has been shown to interact
physically with CBP/p300 and is a target for acetylation at specific
residues near the homeodomain (44). These models strongly implicate
antagonistic roles for CBP/p300 and CDP in the regulation of IL-6 and
CXCL8 transcription, although direct involvement of CDP in regulation
of either promoter has not been established. Transcription repression
by CDP may also involve its ability to recruit a histone deacetylase
activity, HDAC1, leading to deacetylation of histones, a phenomenon
consistent with transcriptionally inert chromatin (25). Similar
interactions between NF- B, CBP/p300, and CDP may be involved in the
regulation of CXCL1 gene regulation.
The Potential Role of CDP in Chronic Inflammation and
Melanoma--
The relevance of the IUR-binding factor, CDP, is of
potential interest in disorder states such as chronic inflammatory
conditions and malignant melanoma, where constitutive overexpression of
the CXCL1 gene contributes to disease etiology. Interactions
of CDP with the IUR cis-acting element may allow for tight repression of the CXCL1 gene. The loss or displacement of CDP may be an
important phenomenon in the short term induction of the
CXCL1 gene, usually associated with acute inflammatory
responses, or in the constitutive, high level expression of CXCL1
observed in chronic inflammatory processes, tumorigenesis, and
malignant melanoma.
We have examined levels and binding profiles of CDP in two normal and
five melanoma cell lines by Western blot, EMSA, and Southwestern blot
analyses. We have not observed any consistent differences in the levels
of the CDP protein or IUR-specific binding of CDP between the cell
types. We postulate that trans-repression of the CXCL1
promoter by CDP may be regulated at the level of post-translational
modification of the CDP protein. CDP-mediated trans-repression is
regulated by de-phosphorylation of the CDP protein, and this occurs in
a cell stage-specific manner. To determine whether or not activity of
this protein is altered in malignant melanoma cells, a detailed
analysis of CDP-phosphorylation, IUR-specific binding, and CXCL1
trans-repression by CDP in cell-stage synchronized cells will be
necessary. Insights from these investigations may uncover a
relationship between CDP and progression of malignant melanoma.
 |
ACKNOWLEDGEMENTS |
We thank Hamid Haghnegahdar, Neepa Ray, Ben
Johnston, Amy Pruitt, Yingchun Yu, and Linda Horton for excellent
technical assistance. We thank Steve Hann and Roland Stein for their
thoughtful comments on the manuscript.
 |
FOOTNOTES |
*
This work was supported by NCI Grant CA 56704 from the
National Institutes of Health (to A. R.), a Senior Career Scientist award (to A. R.) from the Department of Veterans Affairs, an
Historically Black Colleges and Universities/Department of
Veterans Affairs grant, and NCI Grant CA 68485 from the National
Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
615-343-7777; Fax: 615-343-4539; E-mail:
ann.richmond@mcmail.vanderbilt.edu.
Published, JBC Papers in Press, May 22, 2001, DOI 10.1074/jbc.M102872200
 |
ABBREVIATIONS |
The abbreviations used are:
CXCL1, CXC ligand 1;
CXCL8, CXC ligand 8 or interleukin 8;
IUR, immediate upstream region;
IL, interleukin;
RPE, retinal pigment epithelial;
CDP, CCAAT
displacement protein;
CBP, CREB-binding protein, CREB, cAMP-responsive
element-binding protein;
C/EBP, CCAAT enhancer-binding protein;
EMSA, electrophoretic mobility shift assay;
NF, nuclear factor;
bp, base
pair;
nt, nucleotide;
TESS, Transcription Element String Search;
PARP, poly(A)DP-ribose polymerase.
 |
REFERENCES |
| 1.
|
Murphy, P. M.,
Baggiolini, M.,
Charo, I. F.,
Hebert, C. A.,
Horuk, R.,
Matsushima, K.,
Miller, L. H.,
Oppenheim, J. J.,
and Power, C. A.
(2000)
Pharmacol. Rev.
52,
145-176
|
| 2.
|
Balentien, E.,
Mufson, B. E.,
Shattuck, R. L.,
Derynck, R.,
and Richmond, A.
(1991)
Oncogene
6,
1115-1124
|
| 3.
|
Rennekampff, H. O.,
Hansbrough, V. W.,
Keissig, V.,
Dore, C.,
Sticherling, M.,
and Schroeder, J. M.
(2000)
J. Surg. Res.
93,
41-54
|
| 4.
|
Hosaka, S.,
Akahoshi, T.,
Wada, C.,
and Kondo, H.
(1994)
Clin. Exp. Immunol.
97,
451-457
|
| 5.
|
Luan, J.,
Shattuck-Brandt, R.,
Haghnegahdar, H.,
Owen, J. D.,
Strieter, R.,
Burdick, M.,
Nirodi, C.,
Beauchamp, D.,
Johnson, K. N.,
and Richmond, A.
(1997)
J. Leukocyte Biol.
62,
588-597
|
| 6.
|
Shattuck, R. L.,
Wood, L. D.,
Jaffe, G. J.,
and Richmond, A.
(1994)
Mol. Cell. Biol.
14,
791-802
|
| 7.
|
Wood, L. D.,
Farmer, A. A.,
and Richmond, A.
(1995)
Nucleic Acids Res.
23,
4210-4219
|
| 8.
|
Wood, L. D.,
and Richmond, A.
(1995)
J. Biol. Chem.
270,
30619-30626
|
| 9.
|
Shattuck-Brandt, R. L.,
and Richmond, A.
(1997)
Cancer Res.
57,
3032-3039
|
| 10.
|
Devalaraja, M. N.,
Wang, D. Z.,
Ballard, D. W.,
and Richmond, A.
(1999)
Cancer Res.
59,
1372-1377
|
| 11.
|
Nirodi, C. S.,
NagDas, S.,
Gygi, S.,
Olson, G.,
Aebersold, R.,
and Richmond, A.
(2001)
J. Biol. Chem.
276,
9366-9374
|
| 12.
|
Blochlinger, K.,
Bodmer, R.,
Jack, J.,
Jan, L. Y.,
and Jan, Y. N.
(1988)
Nature
333,
629-635
|
| 13.
|
Ludlow, C.,
Choy, R.,
and Blochlinger, K.
(1996)
Dev. Biol.
178,
149-159
|
| 14.
|
Johnston, L. A.,
Ostrow, B. D.,
Jasoni, C.,
and Blochlinger, K.
(1998)
Genetics
149,
131-142
|
| 15.
|
Neufeld, E. J.,
Skalnik, D. G.,
Lievens, P. M.,
and Orkin, S. H.
(1992)
Nat. Genet.
1,
50-55
|
| 16.
|
Andres, V.,
Chiara, M. D.,
and Mahdavi, V.
(1994)
Genes Dev.
8,
245-257
|
| 17.
|
Harada, R.,
Dufort, D.,
Denis-Larose, C.,
and Nepveu, A.
(1994)
J. Biol. Chem.
269,
2062-2067
|
| 18.
|
Aufiero, B.,
Neufeld, E. J.,
and Orkin, S. H.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
7757-7761
|
| 19.
|
Harada, R.,
Berube, G.,
Tamplin, O. J.,
Denis-Larose, C.,
and Nepveu, A.
(1995)
Mol. Cell. Biol.
15,
129-140
|
| 20.
|
Moon, N. S.,
Berube, G.,
and Nepveu, A.
(2000)
J. Biol. Chem.
275,
31325-31334
|
| 21.
|
Luo, W.,
and Skalnik, D. G.
(1996)
J. Biol. Chem.
271,
18203-18210
|
| 22.
|
Coqueret, O.,
Berube, G.,
and Nepveu, A.
(1998)
EMBO J.
17,
4680-4694
|
| 23.
|
van Gurp, M. F.,
Pratap, J.,
Luong, M.,
Javed, A.,
Hoffmann, H.,
Giordano, A.,
Stein, J. L.,
Neufeld, E. J.,
Lian, J. B.,
Stein, G. S.,
and Van Wijnen, A. J.
(1999)
Cancer Res.
59,
5980-5988
|
| 24.
|
Kim, E. C.,
Lau, J. S.,
Rawlings, S.,
and Lee, A. S.
(1997)
Cell Growth Differ.
8,
1329-1338
|
| 25.
|
Li, S.,
Moy, L.,
Pittman, N.,
Shue, G.,
Aufiero, B.,
Neufeld, E. J.,
LeLeiko, N. S.,
and Walsh, M. J.
(1999)
J. Biol. Chem.
274,
7803-7815
|
| 26.
|
Miller, H.,
Asselin, C.,
Dufort, D.,
Yang, J. Q.,
Gupta, K.,
Marcu, K. B.,
and Nepveu, A.
(1989)
Mol. Cell. Biol.
9,
5340-5349
|
| 27.
|
Wang, Z.,
Goldstein, A.,
Zong, R. T.,
Lin, D.,
Neufeld, E. J.,
Scheuermann, R. H.,
and Tucker, P. W.
(1999)
Mol. Cell. Biol.
19,
284-295
|
| 28.
|
Van Wijnen, A. J.,
Cooper, C.,
Odgren, P.,
Aziz, F.,
De Luca, A.,
Shakoori, R. A.,
Giordano, A.,
Quesenberry, P. J.,
Lian, J. B.,
Stein, G. S.,
and Stein, J. L.
(1997)
J. Cell. Biochem.
66,
512-523
|
| 29.
|
Webster, M. A.,
Martin-Soudant, N.,
Nepveu, A.,
Cardiff, R. D.,
and Muller, W. J.
(1998)
Oncogene
16,
1963-1972
|
| 30.
|
Jaffe, G. J.,
Richmond, A.,
VanLe, L.,
Cheng, Q. C.,
Shattuck, R. L.,
Wong, F.,
and Roberts, W.
(1993)
Investig. Ophthalmol. Vis. Sci.
34,
2776-2785
|
| 31.
|
Coqueret, O.,
Berube, G.,
and Nepveu, A.
(1996)
J. Biol. Chem.
271,
24862-24868
|
| 32.
|
Schug, J,
and Overton, G. C.
(1997)
TESS: Transcription Element Search Software on the WWW, Technical Report CBIL-TR-1997-1001-v0,0
, of the Computational Biology and Informatics Laboratory, School of Medicine, University of Pennsylvania
|
| 33.
|
Lievens, P. M. J.,
Tufarelli, C.,
Donady, J. J.,
Stagg, A.,
and Neufeld, E. J.
(1997)
Gene (Amst.)
197,
73-81
|
| 34.
|
Nourbakhsh, M.,
Kalble, S.,
Dorrie, A.,
Hauser, H.,
Resch, K.,
and Kracht, M.
(2001)
J. Biol. Chem.
276,
4501-4508
|
| 35.
|
Mailly, F.,
Berube, G.,
Harada, R.,
Mao, P. L.,
Phillips, S.,
and Nepveu, A.
(1996)
Mol. Cell. Biol.
16,
5346-5357
|
| 36.
|
Romano-Spica, V.,
Georgiou, P.,
Suzuki, H.,
Papas, T. S.,
and Bhat, N. K.
(1995)
J. Immunol.
154,
2724-2732
|
| 37.
|
Engeland, K.,
Andrews, N. C.,
and Mathey-Prevot, B.
(1995)
J. Biol. Chem.
270,
24572-24579
|
| 38.
|
Li-Weber, M.,
Davydov, I. V.,
Krafft, H.,
and Krammer, P. H.
(1994)
J. Immunol.
153,
4122-4133
|
| 39.
|
Li-Weber, M.,
Krafft, H.,
and Krammer, P. H.
(1993)
J. Immunol.
151,
1371-1382
|
| 40.
|
Lopez, S.,
Reeves, R.,
Island, M. L.,
Bandu, M. T.,
Christeff, N.,
Doly, J.,
and Navarro, S.
(1997)
J. Biol. Chem.
272,
22788-22799
|
| 41.
|
Thanos, D.,
Gregoriou, M.,
Stravopodis, D.,
Liapaki, K.,
Makatounakis, T.,
and Papamatheakis, J.
(1993)
Nucleic Acids Res.
21,
6010-6019
|
| 42.
|
Fong, C. L.,
Siddiqui, A. H.,
and Mark, D. F.
(1994)
Nucleic Acids Res.
22,
1108-1114
|
| 43.
|
Vanden Berghe, W.,
De Bosscher, K.,
Boone, E.,
Plaisance, S.,
and Haegeman, G.
(1999)
J. Biol. Chem.
274,
32091-32098
|
| 44.
|
Li, S.,
Aufiero, B.,
Schiltz, R. L.,
and Walsh, M. J.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
7166-7171
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
W. Yan and X. Chen
Identification of GRO1 as a Critical Determinant for Mutant p53 Gain of Function
J. Biol. Chem.,
May 1, 2009;
284(18):
12178 - 12187.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Cadieux, R. Harada, M. Paquet, O. Cote, M. Trudel, A. Nepveu, and M. Bouchard
Polycystic Kidneys Caused by Sustained Expression of Cux1 Isoform p75
J. Biol. Chem.,
May 16, 2008;
283(20):
13817 - 13824.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Li, E. Wang, S. Dutta, J. S. Lau, S.-w. Jiang, K. Datta, and D. Mukhopadhyay
Protein Kinase C-Mediated Modulation of FIH-1 Expression by the Homeodomain Protein CDP/Cut/Cux
Mol. Cell. Biol.,
October 15, 2007;
27(20):
7345 - 7353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Wen, S. F. Giardina, D. Hamming, J. Greenman, E. Zachariah, M. D. Bacolod, H. Liu, J. Shia, P. S. Amenta, F. Barany, et al.
GRO{alpha} Is Highly Expressed in Adenocarcinoma of the Colon and Down-Regulates Fibulin-1.
Clin. Cancer Res.,
October 15, 2006;
12(20):
5951 - 5959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Sztul and V. Lupashin
Role of tethering factors in secretory membrane traffic
Am J Physiol Cell Physiol,
January 1, 2006;
290(1):
C11 - C26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-J. Huang, J.-G. Chang, S.-C. Wu, and K.-B. Choo
Negative Transcriptional Modulation and Silencing of the Bi-exonic Rnf35 Gene in the Preimplantation Embryo: BINDING OF THE CCAAT-DISPLACEMENT PROTEIN/Cux TO THE UNTRANSLATED EXON 1 SEQUENCE
J. Biol. Chem.,
September 2, 2005;
280(35):
30681 - 30688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jing, J.-H. Yen, and D. Ganea
A Novel Signaling Pathway Mediates the Inhibition of CCL3/4 Expression by Prostaglandin E2
J. Biol. Chem.,
December 31, 2004;
279(53):
55176 - 55186.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Kaul-Ghanekar, A. Jalota, L. Pavithra, P. Tucker, and S. Chattopadhyay
SMAR1 and Cux/CDP modulate chromatin and act as negative regulators of the TCR{beta} enhancer (E{beta})
Nucleic Acids Res.,
September 15, 2004;
32(16):
4862 - 4875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Truscott, L. Raynal, P. Premdas, B. Goulet, L. Leduy, G. Berube, and A. Nepveu
CDP/Cux Stimulates Transcription from the DNA Polymerase {alpha} Gene Promoter
Mol. Cell. Biol.,
April 15, 2003;
23(8):
3013 - 3028.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dhawan and A. Richmond
Role of CXCL1 in tumorigenesis of melanoma
J. Leukoc. Biol.,
July 1, 2002;
72(1):
9 - 18.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|