HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 29, 27392-27399, July 20, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/29/27392    most recent M101650200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Christenson, L. K. Articles by Strauss, J. F. Search for Related Content PubMed PubMed Citation Articles by Christenson, L. K. Articles by Strauss, J. F., III Social Bookmarking                      What's this?

Quantitative Analysis of the Hormone-induced Hyperacetylation of Histone H3 Associated with the Steroidogenic Acute Regulatory Protein Gene Promoter^*

Lane K. Christenson^§, Richard L. Stouffer^¶, and Jerome F. Strauss III

From the  Center for Research on Reproduction and Women's Health, University of Pennsylvania, Philadelphia, Pennsylvania 19104-6142 and the ^¶ Division of Reproductive Sciences, Oregon Regional Primate Research Center, Beaverton, Oregon 97006

Received for publication, February 21, 2001, and in revised form, May 7, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Transcriptional regulation of steroidogenic acute regulatory protein (StAR) determines adrenal and gonadal cell steroidogenesis. Chromatin immunoprecipitation assays were combined with quantitative real-time polymerase chain reaction to assess histone acetylation associated with the StAR promoter. MA-10 cells treated with 8-bromo-cAMP had increased acetylated histone H3 associated with the proximal (but not distal) StAR promoter, nascent StAR transcripts, and progesterone production within 15 min, whereas StAR mRNA increased at 30 min. At 360 min, steroidogenesis remained elevated, but mRNA, nascent RNA, and StAR promoter-associated H3 acetylation all declined. StAR promoter-associated H4 acetylation was unchanged by 8-bromo-cAMP treatment of MA-10 cells. In vivo analysis of macaque and human granulosa cells showed that luteinization was associated with increased StAR promoter-associated H3 acetylation. We conclude that acetylation of H3 (but not H4) associated with the proximal promoter is associated with StAR gene transcription, that chromatin modification occurs in discrete regions of the promoter, that the initial steroidogenic response to 8-bromo-cAMP occurs prior to increased StAR mRNA accumulation, and that MA-10 cell StAR gene transcription and promoter-associated H3 acetylation are biphasic during a 6-h treatment period. The union of the chromatin immunoprecipitation assay with quantitative real-time polymerase chain reaction described and validated here should enhance the analysis of gene expression.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The translocation of cholesterol from the relatively sterol-rich outer mitochondrial membrane to the relatively cholesterol-poor inner mitochondrial membrane is the rate-limiting step in steroid synthesis (1). Steroidogenic acute regulatory protein (StAR)¹ plays an integral role in this cholesterol translocation as evidenced by experiments of nature (2) and mouse gene knockout studies (3). In the absence of functional StAR protein, gonadal and adrenal steroidogenesis is markedly impaired and unmetabolized cholesterol accumulates as sterol esters in cytoplasmic lipid droplets. The conservation of StAR protein structure and expression patterns in steroidogenic tissues of piscine, avian, amphibian, and mammalian species testifies to the importance of this protein in steroid synthesis (4).

Studies of StAR gene expression (mRNA) in gonadal and adrenal cells revealed that the steroidogenic capacity of these cells is tightly linked to the abundance of StAR transcripts (5). Analysis of StAR promoter function in human (6-9), domestic animal (10, 11), and rodent (12-15) cells revealed the importance of a variety of transcription factor response elements (SF-1, C/EBP, SREBP-1a, GATA-4, DAX-1, and Sp-1) within the first 250 bases of the promoter proximal to the TATA box that influence basal and/or hormone-dependent (cAMP) StAR gene transcription. Transcription factor binding and analysis of mutant promoter constructs confirmed a role for many of these factors in StAR gene activity (6-16).

Covalent modifications of histones and remodeling of chromatin structure are thought to play a critical role in the regulation of gene transcription (17, 18). The highly basic N-terminal histone tails that project away from the core histone complex play a key role in higher order chromatin structure and in interactions of histones with other chromatin-associated regulatory proteins (19-21). The reversible post-translational modifications of the histone N terminus include ADP-ribosylation, glycosylation, methylation, phosphorylation, and the best documented modification, acetylation (22, 23). Acetylation neutralizes the positive charge on lysines located at the N terminus of histones H3 and H4 and was originally thought to allow the proteins to dissociate from the negatively charged DNA, thereby allowing the DNA to interact with transcription factors and the transcriptional machinery (24). However, more recent studies indicate that acetylation, while facilitating transcription, can do so without displacement of the N-terminal tail domains from the DNA. Moreover, recent in vivo studies indicate that the histone N terminus is a highly structured domain that is primarily involved in protein-protein interactions. Acetylation of the histones increases the -helical character of the N-terminal domains (25). This structural change may influence the interactions of histones with other chromatin proteins, ultimately leading to the destabilization of the higher order chromatin folding (26). Acetylation and other post-translational modifications have been proposed to represent a "histone code" that might determine the sequence and nature of protein interactions that facilitate transcription and/or DNA replication (23). However, this interesting hypothesis has yet to be critically evaluated through experimentation.

A link between histone acetylation and gene transcription has been suspected for many years (reviewed in Ref. 17). The discovery that coactivator proteins possess histone acetyltransferase activity provided direct evidence for an important role for histone acetylation and transcriptional regulation (27). It is postulated that DNA-binding proteins recruit transcriptional coactivators that acetylate the histones associated with the gene promoter, allowing access of and/or recruitment of other proteins (e.g. TATA-binding proteins, RNA polymerase II, etc.) to the DNA to promote transcription. Thus, histone acetylation could be thought of as an excellent marker of gene activity. Conversely, histone deacetylases are thought to be involved in the silencing of gene transcription.

A recently developed method to identify remodeled chromatin using reversible formaldehyde cross-linking of proteins and DNA and antibodies to immunoprecipitate DNA associated with acetylated histones or chromatin associated with specific transcription factors has provided new insights into the early events of transcriptional regulation. However, the previously described chromatin immunoprecipitation (ChIP) assays have been largely qualitative or at best semiquantitative in nature, limiting the assay output to an all-or-nothing readout (28-31). The studies described here demonstrate for the first time that acetylation of histone H3 (but not histone H4) associated with the proximal region of the StAR promoter is associated with the transcriptional activity of that gene. We also describe a sensitive and reproducible method for quantitation of promoter activity (i.e. histone acetylation) linking the ChIP assay to quantitative real-time PCR analysis of the promoter element in the StAR gene. This marriage of methodologies will allow quantification of the activity of multiple genes under in vivo conditions.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Cell Collection and Culture-- The mouse Leydig tumor cell line MA-10 (a generous gift from Dr. Mario Ascoli) was studied because of its consistent steroidogenic response to cAMP stimulation and the associated rapid increase in StAR mRNA accumulation (5). MA-10 cells were cultured in Waymouth medium supplemented with 15% horse serum and 50 µg/ml gentamycin as previously described (32). Cells (0.75-1.5 × 10⁶/10-cm dish) were cultured for 2 days before experiments were initiated. On the day of the experiment, the serum-supplemented medium was aspirated, and the cells were washed twice in phosphate-buffered saline, followed by addition of serum-free Waymouth medium. The cells were then exposed to 8-bromo-cAMP (8-Br-cAMP) for 15, 30, 60, 180, or 360 min. An aliquot of medium was taken for determination of progesterone concentrations, followed by either formaldehyde fixation of the cells (ChIP analysis) or addition of Trizol reagent (Life Technologies, Inc.) for RNA collection

Non-luteinized (i.e. cells collected before the administration of an ovulatory dose of gonadotropins) and luteinized granulosa cells were obtained from adult rhesus monkeys (Macaca mulatta) (33). The monkeys used in these experiments were maintained at the Oregon Regional Primate Research Center, and all animal protocols were approved by the Center's Animal Care and Use Committee in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Adult female monkeys exhibiting regular menstrual cycles received twice daily injections of recombinant human follicle-stimulating hormone (30 IU; Laboratoires Serono SA, Aubonne, Switzerland) for 6 days, followed by 2 days of combined recombinant human follicle-stimulating hormone (30 IU) and recombinant human luteinizing hormone (30 IU; Laboratoires Serono SA) to promote the development of multiple preovulatory follicles (33). Antide, a gonadotropin-releasing hormone antagonist (0.8 mg/kg of body weight/day; Laboratoires Serono SA), was administered to block endogenous surges of pituitary gonadotropins (33). The macaque granulosa cells were obtained by follicle aspiration during laparoscopy either the morning after the last follicle-stimulating hormone and luteinizing hormone treatment (non-luteinized granulosa cells) or 27 h after administration of an ovulatory dose of recombinant human chorionic gonadotropin (hCG) (1000 IU; Laboratoires Serono SA) (luteinized granulosa cells). This protocol has been used widely to provide granulosa cells that are morphologically and biochemically characterized as either luteinized (cell hypertrophy, presence of lipid vesicles, enhanced steroid synthesis, etc.) or not (non-luteinized) (33-35). The follicular aspirates were processed as previously described (34); the resulting granulosa cell preparations were resuspended in Ham's F-10 medium containing bovine serum albumin (1 g/liter); and cell numbers were determined using a hemocytometer. The granulosa cell preparations were divided into ~1 × 10⁶ cell aliquots, brought to a 5-ml volume of Ham's F-10 and bovine serum albumin containing 1% formaldehyde, and fixed for 10 min at 37 °C. Aliquots were then stored at 150 °C until ChIP analysis was performed.

Human granulosa cells were obtained from the University of Pennsylvania's in vitro fertilization program as approved by the Institutional Review Board. The cells were processed immediately as previously described (36). Briefly, human granulosa cells were isolated from the follicular aspirates by centrifugation, followed by the removal of contaminating red blood cells by centrifugal separation using Ficoll reagent. The granulosa cell layer was washed twice in Ham's F-12 medium, followed by fixation with formaldehyde (see ChIP assay below).

Chromatin Immunoprecipitation-- We used a modification of the technique described by Kuo and Allis (37) for ChIP. Briefly, formaldehyde (Fisher) was added directly to the cell culture medium (MA-10) or to the suspended human/macaque granulosa cell isolates at a final concentration of 1% for 10-15 min (37 °C) to cross-link DNA and its associated proteins. Cells were washed once in phosphate-buffered saline before scraping (plated cells) or resuspending (freshly isolated cells) cells in phosphate-buffered saline containing protease inhibitors (1 µg/ml pepstatin A, 1 µg/ml leupeptin, 1 µg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride). Additionally, in several experiments, we determined whether addition of the histone deacetylase inhibitors trichostatin A (3 µM) and sodium butyrate (10 mM) to the lysis and dilution buffers would enhance the ability to detect acetylated histones. Cells were resuspended in lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl, pH 8.1) containing protease inhibitors before sonication with a 2-mm probe for three 10-s bursts at setting 1 of a Heat Systems-Ultrasonics Model W-220F Cell Disruptor. The resulting supernatant contained ~200-1000-base pair DNA fragments. Five µl of the supernatant was saved as input DNA, and the remainder was diluted 1:10 in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, and 16.7 mM Tris-HCl) containing protease inhibitors. Samples were then processed immediately or stored at 150 °C for later ChIP analysis. The chromatin solution was cleared with a salmon sperm DNA/protein A-agarose 50% gel slurry (Upstate Biotechnology, Inc., Lake Placid, NY) for 30 min before overnight incubation (4 °C) with 5 µg of rabbit polyclonal anti-human acetylated histone H3 or H4 antibodies (Upstate Biotechnology, Inc.). The anti-acetylated H3 antibody recognizes acetylated lysines 9, 14, 18, and 23 on human histone H3, whereas the anti-acetylated H4 antibody recognizes acetylated lysines 5, 8, 12, and 16 on human histone H4. Both antibodies recognize all acetylated forms of these proteins and cross-react with the appropriate mouse histones. Nonimmune rabbit serum and addition of no antibody were used for negative controls. After immunoprecipitation, the salmon sperm DNA/protein A-agarose slurry was added and incubated for 1 h. The chromatin-antibody/protein A-agarose complexes were washed sequentially, three times each (3 min on a rocker plate), in low salt, high salt, lithium chloride, and Tris/EDTA buffers (37), followed by two treatments with freshly made elution buffer (1% SDS and 50 mM NaHCO₃). The elutes were pooled; NaCl was added to a 10 mM final concentration; and the mixture was heated at 65 °C for 4 h to reverse the formaldehyde cross-links. Additionally, the DNA input sample cross-links were reversed in a similar manner. The samples were digested with proteinase K for 1 h at 45 °C. DNA from the samples was obtained by phenol/chloroform extraction and ethanol precipitation. DNA pellets were then resuspended in 25 µl of sterile water, and 1-µl aliquots were used in the PCRs.

Quantitative Real-time PCR-- Primers and the probes for the analysis of the human, monkey, and mouse StAR promoter elements were designed with the Primer Express software package that accompanies the Applied Biosystems Model 7700 sequence detector (PerkinElmer Life Sciences). The sequence of the rhesus monkey StAR promoter was determined by sequentially sequencing monkey genomic DNA from the translational start site using a primer derived from the human StAR sequence. The probe and primers were selected to include the proximal promoter where a large number of the described transcriptional response elements reside (bases 68 to 136). The forward primer (CGGCCAAAGCAGCAGTGT, bases 136 to 119) and the fluorescent labeled probe (FAM-AGGCAATCGCTCTATCCTTGACCCCTTC-TAMRA, bases 117 to 90) for the human and monkey StAR promoters were identical (see Fig. 4), whereas the reverse primer ((T/C)GCCATCACTCACTGTGCA, bases 68 to 86) differed at base 68 (T instead of C).

The mouse forward primer (AGAGGGTCAAGGATGGAATGATT, bases 88 to 110), reverse primer (CAGTCTGCTCCCTCCCACC, bases 153 to 135), and probe (FAM-CCTCATCCTGCAGTGCTGGCCA-TAMRA, bases 112 to 133) combination was also chosen to reside in the same general region as that of the human proximal StAR promoter probe. A second primer combination was also designed to recognize a region of the mouse promoter far upstream (~3500 bases upstream of the transcriptional start site) from the proximal StAR promoter as a control. The single PCR product generated by the forward primer (TAGCTGCAGGCCACAGGTT, bases 3568 to 3550) and reverse primer (CCCCGTGTGTTTCTGAGATGT, bases 3492 to 3512) was detected by SyBr green reagent. The real-time PCR used 900 nM each primer and 200 nM probe and the TaqMan Universal Master Mix (Applied Biosystems). Primer concentrations for the SyBr green reactions were determined empirically.

In the case of the human and monkey proximal StAR promoter site, a nested PCR protocol or increased cycle numbers (i.e. 60) were necessary to detect the immunoprecipitated StAR gene DNA. In the first PCR, each human/monkey sample was run in triplicate using primers (forward, GTTTCTGAGCCTCATTTCCAG, bases 332 to 312; and reverse, GCTGAAGGCTGTGCATCATC, bases 33 to 52) that flanked the real-time PCR product. This original PCR was then analyzed in duplicate in the subsequent real-time PCR. To verify that the first PCR amplification did not affect the validity of the real-time PCR, five sets of samples were run in triplicate for 5, 10, and 15 cycles. The differences in the number of cycles detected during the real-time PCR run were 4.72 and 4.60, respectively, demonstrating that the first PCR did not adversely affect the quantitative real-time PCR. Additionally, later tests confirmed that when increased cycle numbers were used in the real-time PCR, we achieved similar results. The MA-10 cell samples (1 µl) were analyzed in triplicate in the sequence detector directly.

Quantitative Real-time Reverse Transcriptase-PCR-- Five µg of total RNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI) for 30 min at 37 °C before reverse transcription with Moloney murine leukemia virus reverse transcriptase (Promega) as described by the manufacturer. The resulting cDNA was diluted 100-fold in sterile water, and aliquots were subjected to quantitative real-time PCR. The forward (CCGGAGCAGAGTGGTGTCA) and reverse (GCCAGTGGATGAAGCACCAT) primers were designed to span an intron splice site (intron 5) with the Primer Express software package. The DNA-intercalating SyBr green reagent was used for detection of the reverse transcriptase-PCR product. Optimization of the PCR indicated that 30 nM each primer should be used in each 25-µl reaction. Agarose gel electrophoresis indicated the presence of a single PCR product. To account for differences in starting material, the rodent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers and probe reagents from Applied Biosystems were used as described by the manufacturer. The experimental and GAPDH PCRs were done in separate tubes in triplicate, and the average threshold cycle (C_T) for the triplicate was used in all subsequent calculations. The coefficient of variation among the triplicates was 1.22 ± 0.27%.

Real-time PCR Quantitation of Nascent StAR RNA-- StAR precursor RNA was quantified by real-time PCR as a measure of active StAR gene transcription taking place in the MA-10 cells following 8-Br-cAMP treatment. A mouse StAR-specific reverse transcriptase primer (CCTCCCCAACCCACACTCAC) that recognizes only intronic sequence (intron 1) was used to generate the StAR cDNA. The real-time PCR primers (forward primer, GAACAACCCTTGAGCACCTCAG; and reverse primer, CCAACCCACACTCACCTTTCAT) were designed to detect a 76-base pair amplicon overlapping the splice site between exon 1 and intron 1. To limit the possibility of detection of genomic DNA, the 5 µg of total RNA was subjected to DNase treatment before reverse transcription as previously described.

Progesterone Assays-- Media samples were assayed using progesterone Coat-A-Count tubes and reagents (Diagnostic Products Corp., Los Angeles, CA) as described by the manufacturer.

Data Analysis-- The relative differences among the treatment groups were determined using the C_T method as outlined in the Applied Biosystems protocol for reverse transcriptase-PCR. A C_T value was calculated for each sample using the C_T value for GAPDH to account for loading differences in the reverse transcriptase-PCRs and the C_T values for the input DNA samples to normalize the ChIP assay results. A C_T value was then calculated by subtracting the C_T for the control from each treatment (i.e. time, cell type) C_T within an experiment. The C_T values were converted to -fold differences compared with the control by raising 2 to the C_T power. To analyze the nascent StAR RNA levels, the C_T levels were generated using the GAPDH C_T values. S.D. values for the GAPDH/input/experimental C_T were determined and used to calculate the S.D. and subsequently the S.E. for the -fold change as described (46).

Statistical tests were performed using the JMP 3.1.5 computer program (SAS Institute Inc., Cary, NC). Heterogeneity of variance was tested using the Bartlett's test; log transformation of the data (log_x) was performed prior to analysis. In the MA-10 experiments, one-way analysis of variance was used to analyze the effect of cAMP treatment over time. Tukey-Kramer mean separation tests were performed for comparison between the means. Results were considered significant if p values were <0.05 and are expressed as means ± S.E.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

8-Br-cAMP-induced Modification of Chromatin Associated with the StAR Promoter in MA-10 Cells: Association with StAR Gene Transcription, mRNA Abundance, and Steroidogenesis-- MA-10 mouse Leydig tumor cells, a clonal steroidogenic line, are known to respond rapidly to tropic stimulation by cAMP analogs with a marked increase in steroid secretion in association with increased expression of StAR (38). Progesterone production over time following 8-Br-cAMP (1 mM) treatment is depicted in Fig. 1A. There was a marked increase in progesterone synthesis within 15 min of exposure to 8-Br-cAMP, with little change during the subsequent 15 min of incubation. There was a further increase in MA-10 cell progesterone synthesis (p < 0.05) at 60 and 180 min after 8-Br-cAMP-treatment, rising modestly to the highest mean level at 360 min. Basal progesterone concentrations (15-360 min) in the medium remained unchanged throughout the 360-min time period. In a single experiment, a 5-min time point was examined, and there was no difference in steroid synthesis when 8-Br-cAMP-treated cells were compared with the basal group (data not shown).

View larger version (11K): [in this window] [in a new window]   Fig. 1.   Steroidogenesis, nascent StAR transcripts, and StAR mRNA expression in MA-10 cells stimulated with 8-Br-cAMP (1 mM) for 15, 30, 60, 180, and 360 min. A, progesterone output (ng/ml medium) by MA-10 cells. MA-10 basal progesterone production is the mean progesterone concentration found in serum-free medium containing no 8-Br-cAMP following incubation with MA-10 cells for 15-360 min. a-d, means ± S.E. with different letters are different (p < 0.05). B, StAR mRNA expression in MA-10 cells. StAR mRNA quantitative real-time reverse transcriptase-PCR results are expressed as the -fold increases over the levels of StAR expression found in cells not exposed to 8-Br-cAMP (i.e. control) after correction for loading differences (i.e. subtraction of the GAPDH CT; the GAPDH CT values ranged from 17.9 to 19.5 cycles). a-e, means ± S.E. with different letters are different (p < 0.05). C, nascent StAR RNA transcript accumulation in MA-10 cells following stimulation with 8-Br-cAMP (1 mM) for 15-360 min. Nascent StAR RNA levels were determined by quantitative real-time reverse transcriptase-PCR using an intronic primer for the reverse transcription after RQ1 RNase-free DNase treatment of the RNA to eliminate possible genomic DNA contaminants. The StAR precursor RNA results are expressed as -fold increases over the levels of StAR expression found in cells not exposed to 8-Br-cAMP (i.e. control) after correction for loading differences (i.e. subtraction of the GAPDH CT). a-c, means ± S.E. with different letters are different (p < 0.05).

Changes in levels of StAR mRNA over the 6-h 8-Br-cAMP treatment period are shown in Fig. 1B as the -fold increase over the control (unstimulated) mRNA levels. StAR transcripts were detected in unstimulated MA-10 cells (time 0-360) by reverse transcriptase-PCR, yielding a C_T of ~33, whereas GAPDH exhibited a C_T of ~18. StAR mRNA abundance remained unchanged at 15 min and was 3.9-fold greater (p < 0.05) after 30 min of 8-Br-cAMP treatment. StAR mRNA levels continued to increase progressively through the first 180 min of 8-Br-cAMP treatment, peaking at a 150-fold increase in StAR mRNA levels over control, before declining at the 360-min time point.

Fig. 1C illustrates the relative abundance of nascent StAR transcripts compared with control cells during the 6-h 8-Br-cAMP treatment period. Nascent StAR transcripts were elevated 12-fold over control values (p < 0.05) within 15 min of 8-Br-cAMP treatment, increased progressively over the first 60 min, and plateaued at 180 min before declining markedly at 360 min of treatment. As expected from the precursor-product relationship, the nascent StAR transcript abundance rose before processed StAR mRNA and subsequently declined to a greater extent than the processed StAR transcripts. Despite the fall in nascent StAR transcripts and StAR mRNA, MA-10 steroidogenesis remained elevated at 360 min, presumably reflecting the continued synthesis of StAR from existing mRNA.

Fig. 2A illustrates the results from the ChIP analysis for histone H3 acetylation associated with the proximal and distal StAR promoters in MA-10 cells. Quantitative PCR results for the proximal region of the murine StAR promoter indicated that within 15 min of 8-Br-cAMP treatment, there was an ~4-fold enhancement of the amount of immunoprecipitated StAR promoter DNA with the rabbit polyclonal anti-acetylated H3 antibody (Fig. 2A). The level of immunoprecipitated StAR promoter DNA remained elevated (i.e. 4-7.5-fold) over that observed in the control during the first 180 min of 8-Br-cAMP exposure. Acetylated H3 associated with the StAR promoter then declined at the 360-min time point to a level not different from that in the control (time 0) cells. In contrast to the results with the anti-acetylated H3 antibody, immunoprecipitation with nonimmune rabbit serum yielded no difference between the control and 8-Br-cAMP-treated cells within an experiment (data not shown). Additionally, the "no-antibody" controls had no detectable fluorescent signal within the 40-cycle limit used in these PCRs, and inclusion of the histone deacetylase inhibitors sodium butyrate and trichostatin A had no effect on the level of histone acetylation observed in the control and 8-Br-cAMP-treated cells. ChIP analysis of the anti-acetylated H3 antibody-immunoprecipitated chromatin for the region of the StAR promoter ~3500 bases upstream of the transcriptional start site failed to detect differences between the control and 8-Br-cAMP-treated cells (Fig. 2A). However, we did detect more StAR DNA following ChIP analysis with the anti-acetylated H3 antibody compared with nonimmune serum, suggesting that a basal level of acetylation of the distal promoter occurs in this region. Our observations indicated that acetylation of H3 bound to the proximal promoter was associated with the initial rise and subsequent fall in the production of nascent StAR transcripts and thus StAR gene transcription. However, the pattern of H3 acetylation did not perfectly mirror the changes in nascent StAR transcripts, which increased in a stepwise fashion after 8-Br-cAMP exposure, whereas H3 acetylation did not.

View larger version (25K): [in this window] [in a new window]   Fig. 2.   Association of the proximal and distal StAR promoters with acetylated histone H3 (A) or H4 (B) following exposure of MA-10 cells to 8-Br-cAMP (1 mM) for 15, 30, 60, 180, and 360 min. ChIP assays were quantified by real-time PCR using a probe specific to the mouse proximal StAR promoter or with SyBr green detection of the distal StAR promoter. A, anti-acetylated H3 results for the proximal and distal StAR promoters are expressed as the -fold increase over the levels detected in the control cells after correcting for differences in the amount of starting (input) chromatin material. a-c, means ± S.E. for the proximal StAR promoter with different letters are different (p < 0.05). No differences were detected for the distal StAR promoter. B, no differences in anti-acetylated H4 immunoprecipitable StAR promoter was detected for the proximal or distal StAR promoter following 8-Br-cAMP exposure.

ChIP analysis of the MA-10 cell lysates with an anti-acetylated H4 antibody failed to detect differences in the amount of immunoprecipitated proximal or distal StAR promoter DNA between the control and 8-Br-cAMP treatment groups (Fig. 2B). The real-time PCR results did indicate that the StAR promoter was associated with acetylated H4 to a greater degree (mean C_T = ~29) than when nonimmune serum (mean C_T = ~37) was used in the ChIP analysis.

In a non-steroidogenic mouse cell line (3T3 cells) that does not express the endogenous StAR gene, we failed to detect immunoprecipitable StAR promoter DNA with the anti-acetylated H3 antibody (Table I). The threshold cycle for the StAR promoter was >40 cycles, whereas the C_T for the input controls for these same samples (C_T ~ 20) was similar to that found in the MA-10 cells, indicating that similar amounts of chromatin material were available for immunoprecipitation. Thus, we could conclude that the proximal StAR gene promoter is not associated with modified chromatin in a cell line in which the StAR gene is silent.

Chromatin Modification Associated with the StAR Gene Promoter during Luteinization of Primate Granulosa Cells-- Prior to the ovulatory surge of gonadotropins, granulosa cell StAR expression is low or non-detectable (33). After luteinization prompted by the ovulatory gonadotropin surge, the granulosa cells exhibit a dramatic increase in StAR mRNA and capacity to synthesize progesterone (33, 39). To carry out ChIP analysis of macaque granulosa cells, we first determined the sequence of the macaque StAR promoter. Comparison of the monkey and human proximal StAR promoters and the locations of the primers and real-time probe are shown in Fig. 3. The monkey and human proximal StAR promoters (bases 341/339 to 1) are 95.3% identical. Likewise, the sequence of the 5'-untranslated region (bases +1 to +151/+131) is also highly conserved (95.4%), but there are an additional 20 bases in the human versus macaque sequence. The known transcription factor response elements (SF-1, C/EBP, SREBP, YY1, and GATA-4) found in the human proximal StAR promoter sequence are 100% conserved between the macaque and human sequences, with the exception of the Sp-1 site found in the human promoter (bases 157 to 151) (9). The full-length macaque StAR promoter sequence determined (1311 base pairs) has been deposited in the GenBank^TM/EBI Data Bank under accession number AY007224.

View larger version (79K): [in this window] [in a new window]   Fig. 3.   Sequence comparison of rhesus monkey (M. mulatta) and human StAR proximal promoter elements. The shaded bases are identical in the monkey and human StAR promoters. Overall, the monkey and human proximal StAR promoters (bases 341/339 to 1) are 95.3% identical. The real-time PCR primer sequences are marked by large open arrows, and the TaqMan probe is indicated by the dark shaded sequence. The arrows under the sequence mark the external PCR primer sequences used in the nested PCR protocol. The TATA-like box is boxed (bases 24 to 20). The known transcriptional response elements in the human promoter (SF-1, bases 43 to 36 and 105 to 96; C/EBP, bases 51 to 42 and 122 to 111; SREBP, bases 81 to 70; YY1, bases 73 to 70; and GATA-4, bases 63 to 59) are 100% conserved in the macaque sequence, with the exception of the Sp-1 site at bases 157 to 151. The complete sequence (total of 1311 bases) can be found in the GenBankTM/EBI Data Bank under accession number AY007224.

The quantitative real-time PCR results for the acetylated H3 ChIP analysis in macaque granulosa cells isolated before and after in vivo administration of an ovulatory dose of recombinant hCG are illustrated in Fig. 4. Fig. 4A depicts representative acetylated H3 ChIP/quantitative real-time PCR amplification plots for the proximal StAR promoter in non-luteinized and luteinized granulosa cells and corresponding chromatin inputs. The non-luteinized ChIP sample took approximately seven cycles more to cross the threshold line than the luteinized sample after correction for chromatin input differences. This approximately seven-cycle difference represents an ~120-fold difference between the amount of acetylated H3 associated with the proximal StAR promoter of luteinized versus non-luteinized granulosa cells.

View larger version (19K): [in this window] [in a new window]   Fig. 4.   ChIP/quantitative real-time PCR results for the acetylated histone H3 ChIP analysis in macaque granulosa cells isolated before and after the in vivo administration of an ovulatory dose of recombinant hCG. A, representative acetylated H3 ChIP/quantitative real-time PCR amplification plots (triplicates) for non-luteinized granulosa cells (NLGC), luteinized granulosa cells (LGC), and corresponding color-matched chromatin inputs (duplicates shown for clarity). The y axis (Rn) represents the change in the emission intensity of the reporter dye divided by the emission intensity of a passive reference dye after subtraction of the base line (i.e. early cycles of PCR prior to detectable levels of template). The x axis represents the PCR cycle number. The CT is determined by drawing a perpendicular line from the threshold line to the x axis at the point where the amplification line crosses the threshold line. B, association of acetylated H3 with the StAR promoter in monkey granulosa cells collected before (non-luteinized; n = 2) and after (luteinized; n = 3) treatment of the monkeys with an ovulatory dose of recombinant hCG during a standard in vitro fertilization protocol. The individual results (means ± S.D.) for the five animals after correction for loading differences are shown as a -fold increase in comparison with one of the non-luteinized granulosa cell experiments. The -fold (x) differences in the amount of PCR product for the three luteinized cell preparations are shown within each bar.

The individual ChIP/quantitative real-time PCR results (means ± S.D.) for the five animals are shown in Fig. 4B as -fold increases in comparison with one of the non-luteinized granulosa cell experiments. In vivo exposure of macaque granulosa cells to hCG resulted in a large (32-206-fold) increase in the amount of immunoprecipitated StAR promoter. Comparison of the real-time PCR results for the no-antibody/rabbit nonimmune serum controls and the anti-acetylated H3 antibody ChIP analysis for the StAR promoter in non-luteinized cells indicated that the anti-acetylated H3 antibody was able to pull down >25-fold more StAR promoter than the controls (data not shown). Similar ChIP analyses with no-antibody/rabbit nonimmune serum controls indicated that the differences in the amount of immunoprecipitated StAR promoter between the controls and anti-acetylated H3 antibody for the luteinized granulosa cells were >600-fold.

Chromatin immunoprecipitation of acetylated H3 associated with the StAR promoter in human granulosa cells collected from four different patients undergoing in vitro fertilization procedures is shown in Fig. 5. Comparison of the anti-acetylated H3 antibody results with those obtained with the nonimmune serum and no-antibody controls (data not shown) indicated that anti-acetylated H3 antibody preferentially associated with the human proximal StAR promoter element.

View larger version (21K): [in this window] [in a new window]   Fig. 5.   Association of acetylated histone H3 with the proximal StAR promoter in human granulosa cells collected after hCG stimulation during a standard in vitro fertizilation protocol. The individual results (means ± S.D.) for four patients after correction for loading differences are shown as a -fold increase over those observed for the nonimmune serum controls. Ab, antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

There has been a concerted effort by several laboratories to understand the hormonal/cAMP-dependent regulation of StAR gene expression to unlock the mysteries surrounding regulation of steroidogenesis. Our experiments illustrate for the first time that increased StAR promoter-associated histone H3 acetylation is associated with StAR gene activation as indicated by accumulation of nascent StAR transcripts and processed StAR mRNA. These studies also demonstrate for the first time the hormonal (hCG) regulation of gene promoter activity (i.e. acetylation) in a whole animal model system, whereby periovulatory monkey granulosa cells were collected before and after an ovulatory dose of gonadotropin. Finally, these experiments describe for the first time the combination of the ChIP procedure and quantitative real-time PCR, allowing for a sensitive, reproducible, and unbiased measure of protein association with gene promoter elements under in vivo conditions. Previously, ChIP assays have been based on semiquantitative analysis usually involving the examination of PCR products at a fixed cycle number, followed by densitometry of the radioactive band or ethidium bromide-stained DNA, or they were purely qualitative in nature (28-31). The experimental method described here greatly improves the quantitative nature of the ChIP procedure and should allow for a more accurate assessment of differences in protein-DNA interaction and the monitoring of heterogeneity of cellular responses within a natural chromatin environment. Using a nested PCR strategy, the sensitivity and specificity of this assay can be increased.

Tropic hormone-stimulated steroidogenesis is dependent on the expression and function of the StAR protein. In these studies, we show for the first time that acetylation of H3 associated with the StAR promoter is temporally linked to the cAMP-dependent increases in StAR gene expression in MA-10 mouse Leydig cells. Conversely, 8-Br-cAMP treatment of MA-10 cells failed to influence the acetylation of H4 associated with the StAR gene promoter. Differential acetylation of the core histones is not a unique attribute of the StAR promoter. Indeed, several recent studies using the same antibodies employed in our ChIP analysis have exhibited differential association of acetylated H3 or H4 with other gene promoters under conditions known to activate the gene (29, 30). ChIP analysis of the p21^waf1 gene promoter was recently shown to be associated with increased H3 acetylation, whereas H4 acetylation did not change under conditions that regulate the cell cycle-dependent expression of p21^waf1. Similarly, the low density lipoprotein receptor and 3-hydroxy-3-methylglutaryl-CoA reductase promoters also exhibit preferential acetylation of H3 under conditions known to activate these genes (30). In contrast to these observations, viral infection stimulates both H3 and H4 acetylation of the interferon- gene promoter (31), whereas four estrogen-responsive genes (pS2, EB1, c-myc, and CTD) were shown to exhibit preferential acetylation of H4 versus H3 following estrogen treatment of the cells (23-26).

The acetylation of H3 associated the StAR promoter was region-specific in that 8-Br-AMP stimulation caused hyperacetylation of only the proximal promoter. Moreover, the cAMP analog did not promote H3 acetylation in a context where the StAR gene is silent. These observations demonstrate the apparent regional selectivity of chromatin modification as well as underscore the association between histone acetylation and gene activity. However, because these experiments examined only a small region of the proximal promoter, we cannot exclude the possibility of acetylation of histones bound to other portions of the StAR gene or address the significance of such modifications regarding StAR gene transcription.

Treatment of MA-10 cells with the protein kinase A agonist 8-Br-cAMP increased steroid output by these cells within 15 min. The ~30-fold increase in progesterone output at the 15-min time point preceded the increase in StAR mRNA by 15 min, suggesting that the increased steroid synthesis either was independent of StAR mRNA accumulation or was the result of a post-transcriptional/translational event (e.g. translational regulation or phosphorylation of the StAR protein). Previous studies with MA-10 cells demonstrated that inhibition of transcription with actinomycin D blocked StAR mRNA expression and new protein production and caused a 75-80% decline in steroidogenic output by these cells at all time points (30-240 min) after exposure to hCG or dibutyryl-cAMP (5). The inability to completely inhibit steroidogenesis is consistent with the notion that StAR function is modulated by a co- or post-translational modification, as originally suggested by Orme-Johnson and co-workers (40). Indeed, these investigators demonstrated that phosphorylation of a mitochondrial protein, later identified as StAR, was temporally associated with the acute effects of ACTH/hCG/dibutyryl-cAMP on steroidogenesis in adrenal, Leydig, and luteal cells (40-42). In a more direct analysis of the role of StAR phosphorylation, Arakane et al. (43) demonstrated that mutation of the human StAR protein at serine 195 or 194 in mouse StAR reduced StAR-dependent pregnenolone production by ~50%. Although the initial increase in steroidogenesis is evidently not the result of increased StAR mRNA levels, the subsequent large increase in steroid production occurring after 15 min of exposure to 8-Br-cAMP is linked to the accumulation of StAR mRNA.

It is notable that StAR gene transcription as monitored by levels of nascent StAR transcripts declined between 180 and 360 min of 8-Br-cAMP stimulation despite the continued presence of 1 mM 8-Br-cAMP in the culture fluid. The concomitant decline in H3 acetylation between 180 and 360 min suggests that H3 acetylation may be required for cAMP-dependent StAR gene expression. We have recently found that cAMP activates the ERK signaling cascade in ovarian cells, resulting in a reduction of StAR protein levels and inhibition of steroidogenesis (44). These findings suggest that a strong tropic signal elicits a concomitant counterbalancing response that limits the magnitude or duration of the cellular reaction to the stimulus. It is possible that the ERK signaling pathway reduces StAR gene transcription through repressors of StAR gene expression such as DAX-1 (45) or possibly by promoting recruitment of histone deacetylases to the proximal StAR promoter, reversing the chromatin modifications that support transcription.

Substantial differences in H3 acetylation of the StAR gene promoter between rhesus monkey non-luteinized and luteinized granulosa cells compared with control and 8-Br-cAMP-treated MA-10 cells were detected in this study. This observation is likely due to differences in basal expression of the StAR gene in these two different cell types. The StAR gene is essentially silent in non-luteinized granulosa cells as evidenced by low/non-detectable StAR mRNA (33) and consistent with the detection of low levels of H3 acetylation in the proximal StAR promoter. This may be the result of expression of the StAR gene in a limited number of granulosa cells within the periovulatory follicle. The luteinization process stimulated by in vivo administration of gonadotropins induces transcription of StAR in the full cohort of granulosa cells. This dramatic change in the number of transcriptionally active cells accounts for the large differences between the non-luteinized and luteinized granulosa cells. In contrast, MA-10 cells exhibit basal StAR gene transcription under control conditions; and therefore, the induction of StAR promoter activity following exposure to 8-Br-cAMP is limited.

The development of the ChIP technique to assay protein-DNA interactions in an in vivo context was a major advance in the study of transcriptional regulation. We have now joined this method with quantitative real-time PCR, allowing the procedure to yield quantitative observations regarding protein (i.e. histone)-DNA interaction at specific sites within gene promoters. This method should permit investigators to quantitate changes in gene activity in tissues where transcriptional responses occur dyssynchronously in component cells. With the recent development of new fluorescent dyes for probe labeling, it is possible to examine multiple targets in a single PCR, expanding the capacity of the ChIP/quantitative real-time PCR technique to examine the in vivo protein-DNA interactions. For example, comparisons of proximal and distal StAR promoter chromatin could be made simultaneously, eliminating variation in results due to loading differences. Alternatively, simultaneous examination of multiple target genes using different fluorescent probes could be accomplished. Finally, with immunoprecipitating antibodies that specifically interact with transcription factors/coactivators in a chromatin environment, the ChIP/quantitative real-time PCR technique could be used to identify the specific factors involved and the order in which these factors associate with the gene promoter to induce gene transcription.

	ACKNOWLEDGEMENTS

We thank Dr. Mario Ascoli for the gift of MA-10 cells. We also thank Dr. Jennifer Wood for comments and suggestions regarding this manuscript and Judy Wood for help with preparation of the manuscript.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants HD06274 (to J. F. S.), HD20869 (to R. L. S.), SCCPRR U54 HD18185 (Art Core), and RR00163.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AY007224.

^§ To whom correspondence should be addressed: Center for Research on Reproduction and Women's Health, University of Pennsylvania, 1349 Biomedical Research Bldg. II/III, 421 Curie Blvd., Philadelphia, PA 19104-6142. Tel.: 215-898-0147; Fax: 215-573-5408; E-mail: lchriste@mail.med.upenn.edu.

Published, JBC Papers in Press, May 9, 2001, DOI 10.1074/jbc.M101650200

	ABBREVIATIONS

The abbreviations used are: StAR, steroidogenic acute regulatory protein; ChIP, chromatin immunoprecipitation; PCR, polymerase chain reaction; Br, bromo; hCG, human chorionic gonadotropin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; C_T, threshold cycle; ACTH, adrenocorticotropic hormone; ERK, extracellular signal-regulated kinase.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. M Seneda, M. Godmann, B. D Murphy, S. Kimmins, and V. Bordignon Developmental regulation of histone H3 methylation at lysine 4 in the porcine ovary Reproduction, June 1, 2008; 135(6): 829 - 838. [Abstract] [Full Text] [PDF]

				S. Priyanka and R. Medhamurthy Characterization of cAMP/PKA/CREB signaling cascade in the bonnet monkey corpus luteum: expressions of inhibin-{alpha} and StAR during different functional status Mol. Hum. Reprod., June 1, 2007; 13(6): 381 - 390. [Abstract] [Full Text] [PDF]

				M. A. Lazzaro, D. Pepin, N. Pescador, B. D. Murphy, B. C. Vanderhyden, and D. J. Picketts The Imitation Switch Protein SNF2L Regulates Steroidogenic Acute Regulatory Protein Expression during Terminal Differentiation of Ovarian Granulosa Cells Mol. Endocrinol., October 1, 2006; 20(10): 2406 - 2417. [Abstract] [Full Text] [PDF]

				Z. T. Ruiz-Cortes, S. Kimmins, L. Monaco, K. H. Burns, P. Sassone-Corsi, and B. D. Murphy Estrogen Mediates Phosphorylation of Histone H3 in Ovarian Follicle and Mammary Epithelial Tumor Cells via the Mitotic Kinase, Aurora B Mol. Endocrinol., December 1, 2005; 19(12): 2991 - 3000. [Abstract] [Full Text] [PDF]

				R. Rusovici, Y. Y. Hui, and H. A. LaVoie Epidermal Growth Factor-Mediated Inhibition of Follicle-Stimulating Hormone-Stimulated StAR Gene Expression in Porcine Granulosa Cells Is Associated with Reduced Histone H3 Acetylation Biol Reprod, April 1, 2005; 72(4): 862 - 871. [Abstract] [Full Text] [PDF]

H. Duan, C. A. Heckman, and L. M. Boxer Histone Deacetylase Inhibitors Down-Regulate bcl-2 Expression and Induce Apoptosis in t(14;18) Lymphomas Mol. Cell. Biol., March 1, 2005; 25(5): 1608 - 1619. [Abstract] [Full Text] [PDF]