|
Originally published In Press as doi:10.1074/jbc.M007192200 on October 18, 2000
J. Biol. Chem., Vol. 276, Issue 3, 2098-2107, January 19, 2001
Functional Dissection of the LysR-type CysB Transcriptional
Regulator
REGIONS IMPORTANT FOR DNA BINDING, INDUCER RESPONSE,
OLIGOMERIZATION, AND POSITIVE CONTROL*
Anna
Lochowska,
Roksana
Iwanicka-Nowicka,
Danuta
Plochocka, and
Monika M.
Hryniewicz
From the Institute of Biochemistry and Biophysics, Polish Academy
of Sciences, 02-106 Warsaw, Poland
Received for publication, August 8, 2000, and in revised form, October 17, 2000
 |
ABSTRACT |
CysB is a tetrameric LysR-type transcriptional
regulator that acts as an activator of cys regulon genes
and as an autorepressor. Positive control of cys genes
requires the presence of the inducer N-acetylserine.
Following random and site-directed mutagenesis of the cysB
gene, 20 CysB variants were isolated. Six single amino acid
substitutions within the N terminus of CysB abolished the DNA-binding
ability of the protein. Seven mutations in the central region of CysB
affected its response to the inducer. Four of these CysB mutants
retained repressing activity, but lost their activating function
in vivo. Their DNA binding characteristics were consistent with an inability to respond to acetylserine by a qualitative change in
the DNA-protein interaction. Three of the single residue substitutions
resulted in constitutive activity of CysB. The electrophoretic mobility
of the complex formed by one of the CysBc variants with the
cysP promoter suggested a dimeric state of this protein.
Characteristics of six truncated CysB variants lacking 5-30 C-terminal
residues indicated the involvement of the C terminus in the DNA
binding, oligomerization, and stability of CysB. The single
substitution Y27G resulted in the CysBpc variant, able to
bind DNA and to respond to the inducer by a qualitative change in the
DNA-protein complex, but defective in the positive control of the
cysP promoter.
 |
INTRODUCTION |
LysR-type transcriptional regulators
(LTTRs),1 initially reported
by Henikoff et al. (1), compose probably the largest family of prokaryotic regulatory proteins. Since the last systematic review
(2), in which some 50 LTTRs were mentioned, the family has expanded to
over 100 members identified in diverse bacterial genera. In
Escherichia coli K12, the overall repertoire of DNA-binding transcriptional regulators, estimated as 314 proteins (3), includes 45 LTTRs (18 known and 27 predicted). All LTTRs investigated so far are
DNA-binding proteins that positively regulate transcription of target
genes, and most of them also repress their own expression. The common
family features are the similar size of the molecule (between 300 and
350 amino acids), the formation of either homodimers or homotetramers,
the presence of the helix-turn-helix (HTH) motif in the N-terminal
region, and the requirement for a small molecule that acts as coinducer
(2). The homology between LTTRs is generally high, suggesting their
evolution from a common distant ancestor and the possibility of
their similar tertiary structure. The highest sequence similarity
exists within the 66 N-terminal amino acids, containing a HTH motif and
proposed to function as a DNA-binding domain. The central region of the
LysR-type proteins shows the lowest sequence homology between family
members. Mutational studies performed on some proteins suggest that two
subdomains of this region (amino acids 95-173 and 196-206) can be
engaged in coinducer recognition/response (2, 4-6). The regions
involved in multimerization of LTTRs are not well defined. Some
experimental results obtained for NahR (7), AmpR (8), and OxyR (9)
indicate involvement of the C-terminal domain in oligomer formation.
Several LysR-type proteins, including CysB, have been suggested to
interact with the C-terminal domain of the RNA polymerase -subunit
(10). However, to date, no study has clarified the details of the
putative contact(s) of any LTTR with the RNA polymerase. Structural
characterization of LysR-type proteins has been delayed by the fact
that many of the family members are insoluble when overexpressed and
difficult to obtain in highly purified form.
CysB, a LysR family member, is an essential positive factor for
activity of most cys genes engaged in the assimilatory
sulfate pathway via cysteine biosynthesis (see Ref. 11 for a review). High-level expression of these genes, composing the cysteine
regulon, requires, in addition to CysB, the presence of an inducer
(N-acetyl-L-serine) and sulfur limitation. CysB
acts also as a repressor of its own gene (12, 13). The interactions of
CysB with responsive promoter regions are unusually complex (11, 14).
DNA regions identified as "CysB-binding sites" show poor sequence
homology. In general, they share a configuration of imperfect dyad
symmetry between 19-bp half-sites, but the number, spacing, and
arrangement of half-sites vary in particular promoters. Wild-type CysB
is a tetramer of identical 36-kDa subunits in solution (15), and it
also binds to DNA as a tetramer (16). In positively regulated promoters (i.e. cysK and cysP), CysB binds in
the absence of inducer and occupies a large DNA region including three
half-sites (16-18). This mode of DNA-protein interaction results in
DNA bending by ~100o and is unfavorable for
transcriptional activation of the promoter. N-Acetylserine
is thought to induce a conformational change in CysB; this change
allows the protein to interact preferentially with "activatory
sites," composed of two half-sites spaced by 1-2 bp and localized
just upstream of the 35 regions of the cysJ, cysK, and cysP promoters. The stable interaction
of the CysB tetramer with a unique activatory site is critical for
transcriptional activation of the promoter, and it may be required for
RNA polymerase recruitment. In the cysB promoter, CysB
protects the DNA region overlapping the RNA polymerase-binding site
that results in repression of transcription (13). In this case,
acetylserine reduces binding of CysB to DNA, thereby releasing
the repression of the cysB gene. Sulfur limitation required
for high-level expression of cys genes in vivo
can be explained by the fact that sulfide and thiosulfate act as
anti-inducers, competing with N-acetylserine for the CysB activator (18, 19). In addition, cysteine is an inhibitor of serine
transacetylase, the enzyme required for acetylserine biosynthesis.
CysB is an attractive representative of LTTRs to study the
structure/function relationship for several reasons. First, the molecular basis of the interaction of CysB with cys gene
promoters, including DNA bending and inducer response, is relatively
well understood. This offers the tool for in vitro
comparisons of properties of CysB mutants versus the
wild-type protein. Second, the CysB protein is so far the only family
member whose cofactor-binding domain (amino acids 88-324) has been
crystallized and subjected to three-dimensional analysis (20). The
structure of the dimer formed by CysB monomer fragments (amino acids
88-324) has shed some light on protein surfaces composing an inducer-
and anti-inducer-binding cavity. However, the structure lacking the 87 N-terminal amino acids provide little information about the overall
organization of the native tetrameric protein. Third, in some promoters
of E. coli, including the tau promoter (21) and
the ssu promoter (22), CysB acts in conjunction with another
LysR-type activator, Cbl, which itself is highly homologous to CysB
(23). The molecular basis of cooperation of these two proteins is not
yet understood. A systematic mutational analysis of CysB might give
further insight into the structure of this protein and related LysR
family members and provide a valuable complement to the information
gained from physicochemical studies. Here we describe the properties of
several CysB variants resulting from single amino acid substitutions in the N-terminal and central regions of the protein as well as those resulting from C-terminal truncations. On the basis of the effects of
these mutations on the repressing and activating functions of CysB
in vivo and the DNA binding characteristics of selected CysB
mutants in vitro, we discuss regions of the protein involved in DNA binding, inducer response, oligomerization, and possible RNA
polymerase recruitment.
 |
MATERIALS AND METHODS |
Bacterial Strains and Growth Conditions--
The E. coli strains and basic plasmids used in this study are listed in
Table I. All strains were grown at 37 °C in either LB medium or
sulfur-free minimal medium (24) supplemented with glucose (0.2%),
tryptophan (4 µg/ml), and a sulfur source. Sulfate (0.5 mM) was used as a sulfur source in solid media, and
L-djenkolic acid (1 mM) served as
non-repressing sulfur source in liquid media for -galactosidase
assays. When required, the growth media contained ampicillin (100 µg/ml), chloramphenicol (20 µg/ml), or kanamycin (50 µg/ml). The
solid media (LB agar with X-gal or MacConkey/lactose agar) were used
for selection of transformants of the desired phenotype.
DNA Manipulations--
Plasmid DNA preparation, restriction
enzyme digestion, and transformation were performed according to
published procedures (25). Plasmid DNA was purified with QIAGEN
midi-columns. Restriction endonucleases, DNA-modifying enzymes, and
Taq polymerase were purchased from Life Technologies, Inc.
and Promega and were used according to the manufacturers'
recommendations. The dideoxy chain termination method (26) was used to
sequence the cysB region from plasmid templates. Most
sequences were obtained using an ABI PRISM 377 DNA sequencer, and some
plasmids were sequenced manually using a sequencing kit and
-35S-dATP (both from Amersham Pharmacia Biotech).
Construction of the cysB Mutant--
Deletion within the
cysB gene was created by excision of the 821-bp
NruI/HpaI fragment encompassing the promoter
region and 216 codons of the cysB open reading frame (see
Fig. 1) from plasmid pMH148, containing the 2.8-kilobase pair
EcoRI/EcoRV fragment of pJOH2 cloned in pUC18
EcoRI/HincII. The deletion was tagged by
insertion of a Kanr cassette excised from pUC4KIXX as a
1.35-kilobase SmaI fragment. The resulting plasmid, pMH161,
was linearized and transformed into E. coli JC7623.
Kanr Aps transformants were selected, and
correct replacement of the cysB gene in the genomic DNA was
confirmed by PCR analysis. The
cysB::kan mutation was transferred
to other E. coli strains (see Table I) by P1-mediated transduction.
Oligonucleotides and Plasmid Constructions--
The
3'-coordinates indicated for all cysB-specific
oligonucleotides used in this study are consistent with those of the
published cysB sequence (27), where +1 indicates A in the
ATG start codon. Nucleotides that had been changed to create
restriction sites, stop codons, or specific mutations are shown in
boldface. Primers ECCB3
(CCCAAGCTTTTTTTCTTCACACCTATACA-3', 123) and
ECCB4 (CATGCATGCGGTAATTAGACACTACTT-3', +1101,
complementary strand) were used for PCR amplification of the
wild-type E. coli cysB gene from the pJOH1 plasmid. The
fragment obtained was cleaved with HindIII/SphI
and inserted into pBR322 HindIII/SphI to give plasmid pMH147. Plasmids pMH189, pMH191, pMH193, pMH195, pMH222, pMH223, pMH224, pMH225, pMH226, pMH228, and pMH229 are derivatives of
pMH147 obtained by random mutagenesis and contain point mutations within cysB (see Table II). Plasmids pMH190, pMH192, pMH194,
pMH196, and pMH197 were obtained from pMH189, pMH191, pMH193, pMH195, and pMH147, respectively, by excision of the
HindIII/SphI fragments (containing the
cysB region) and their insertion into
HindIII/SphI-cleaved pACYC184. Primers ECCB8
(GGAATTCTAAGTGGATGGTTTAACA-3', +1) and ECCB9
(AAACTGCAGGCGGTAATTAGACAC-3', +1106, complementary strand) served to amplify the promoterless cysB gene on the
pJOH1 template, and the PCR product was cleaved with
EcoRI/PstI and placed under the ptrc
promoter in pTrc99A cleaved with EcoRI/PstI to
give plasmid pMH199. Plasmid pMH199 served for overproduction of WT
CysB. To overproduce CysB mutant proteins, plasmids pMH200, pMH201,
pMH202, pMH203, and pMH205 were obtained by replacement of the 653-bp
SmaI/BamHI fragment (see Fig. 1) of pMH199 with the SmaI/BamHI fragments excised from plasmids
pMH189, pMH191, pMH193, pMAH01, and pMAH2, respectively. To construct
C-terminally truncated CysB variants, oligonucleotide ECCB13
(TTACGTCCGGTTAGGGC-3', +712) was used as an upper primer, and
oligonucleotides ECCB14 (AAACTGCAGTTATTAATCAACGACATCACGCGT-3', +886, complementary strand), ECCB15 (AAACTGCAGTTAAGAGCGCAATGCGAC-3',
+910, complementary strand), and ECCB16
(AAACTGCAGTTATATATCTTTAAACATG-3', +942, complementary
strand) were used as lower primers for PCR amplification of 3'-terminal
fragments of cysB from the pJOH1 template. The PCR fragments
were cleaved with BamHI-PstI and ligated with the
pMH199 fragment obtained by excision of the 3'-portion of the WT
cysB region (as a 377-bp BamHI/PstI
fragment) to give plasmids pMH214, pMH215, and pMH217 (serving for
overproduction of the corresponding CysB mutant proteins). Plasmids
pMH231, pMH232, and pMH233 were obtained by replacement of the
BamHI/SphI fragment of pMH147 (containing the
3'-portion of WT cysB) with the
BamHI/SphI fragments excised from pMH214, pMH217,
and pMH215, respectively. Other plasmids carrying truncated
cysB (pMH218, pMH219, and pMH230) were obtained as follows.
The BamHI/PstI fragment of pMH199 (containing the
3'-portion of WT cysB) was inserted into pUC19, and the
insert was amplified by PCR with pUC-specific forward and reverse
primers under mutagenic conditions (28). The PCR product was cleaved with BamHI/SphI and ligated with pMH147 devoid of
the corresponding BamHI/SphI region. The ligation
mixture was transformed into the EC2549 strain, and the transformants
unable to grow on minimal sulfate plates were selected (3 of ~2000)
and used to recover the corresponding plasmids. Mutations resulting in
C-terminal truncations of CysB are listed in Table II. To introduce the
Y27G substitution into CysB, primers ECCB8 and ECCB19
(GATCCCGGGTTGTGAGGTACCAAGTCCTTCCGC-3', +67, complementary
strand) were used for PCR amplification of DNA fragment from the pJOH1
template. The fragment obtained was cleaved with
EcoRI/SmaI and used to replace the corresponding 113-bp EcoRI/SmaI fragment (see Fig. 1) of pMH199
to give plasmid pMH235. Plasmid pMH303, containing the translational
fusion cysB'::'lacZ, was constructed as
follows. The 450-bp BamHI/SmaI fragment (see Fig.
1), containing the cysB promoter and 30 codons of the
cysB open reading frame, was excised from pJOH1 and inserted
into pUC18 BamHI/HincII. The cysB
region was recovered as a BamHI/PstI fragment and
inserted into pNM482 cleaved with BamHI/PstI to
give pMH302. The cysB'::'lacZ region
was excised from pMH302 as a 5.5-kilobase EcoRI/StuI fragment and cloned in the low-copy
vector pHSG576 cleaved with EcoRI/SmaI to give
pMH303. Primers ECCB3 and ECCB11 (GTGCTTGCCGCTTCGGGA-3', +148,
complementary strand) served to amplify the cysB promoter
fragment from the pJOH1 template for DNA binding assays.
Primers ECCP1 (ATTGATGGCGGCAGCACACT) and ECCP2 (GACCAGCGCGAGTGAGTTCT,
complementary strand) were used to amplify the cysP promoter
region (from positions 321 to +72 relative to the transcription start
site) from the pMH1822 template.
Random Mutagenesis of cysB--
Mutagenesis with hydroxylamine
was carried out essentially as described (29). Briefly, ~1 µg of
purified pMH147 was mixed with 50 µl of solution containing freshly
prepared 1 M hydroxylamine, 50 mM sodium
pyrophosphate, 100 mM NaCl, and 2 mM EDTA (pH
7.0) and incubated at 75 °C for 45 min. The samples were dialyzed
extensively against Tris/EDTA buffer (pH 7.6), and DNA was precipitated
with ethanol and used to transform the EC2266 strain. Plasmid pMH147 was also used to transform the E. coli mutator strain
mutD5. The transformants obtained were rinsed off the
plates, and the plasmid DNA was re-isolated and used to transform the
EC2266 strain. Transformants were screened for the desired phenotype on
LB agar plates containing X-gal or on MacConkey/lactose agar plates.
Enzyme Assays--
-Galactosidase activities were assayed in
cells taken from mid-log phase cultures grown on minimal medium with
L-djenkolic acid as a derepressing sulfur source according
to the method of Miller (30) with o-nitrophenyl galactoside
as a substrate. Duplicate assays were performed for each culture and
were repeated at least three times.
Preparation of CysB-overproducing Extracts--
E.
coli extracts were prepared from strain DH5 containing plasmid
pMH199 (WT cysB) or plasmids (derivatives of pTrc99A)
encoding mutant alleles of cysB. Transformed cells were
grown on LB/ampicillin, and
isopropyl- -D-thiogalactopyranoside was added (0.5 mM final concentration) in the early exponential phase
(A600 = 0.15). Growth was continued for a
further 2 h, and cells were harvested and resuspended in buffer A
(50 mM Tris-Cl (pH 7.5), 1 mM disodium EDTA,
and 1 mM phenylmethylsulfonyl fluoride). Cell suspensions were sonicated on ice, and cellular debris was removed by
centrifugation at 16,000 × g for 30 min at 4 °C.
The supernatants were fractionated by streptomycin sulfate
precipitation and ammonium sulfate precipitation as described
previously (15), and fractions precipitated with ammonium sulfate (229 mg/ml) were dissolved in buffer A. All preparations in which the CysB
protein was successfully overproduced served as a source of CysB
proteins in DNA binding experiments. Highly purified CysB protein from
Salmonella typhimurium (obtained from N. M. Kredich)
was used as a reference for the E. coli WT CysB preparation
in DNA binding and transcription runoff experiments.
DNA Binding Assays--
DNA fragments containing the
cysP and cysB promoter regions were generated by
PCR (see "Oligonucleotides and Plasmid Construction"), 5'-labeled
with [ -32P]ATP using T4 polynucleotide kinase
(Promega), and purified with QIAquick spin columns (QIAGEN). Conditions
for binding reactions and electrophoretic mobility shift assay (EMSA)
were essentially as described (17). Briefly, the reaction mixtures (20 µl) contained ~10 ng of labeled DNA fragment and 50 ng of sonicated
calf thymus DNA (to reduce nonspecific binding) in CysB buffer
consisting of 40 mM Tris-HCl (pH 8.0), 10 mM
MgCl2, 100 mM KCl, 1 mM
dithiothreitol, and 100 µg/ml bovine serum albumin. Incubation (5 min
at 37 °C) was initiated by including a given amount of CysB
preparation and O-acetyl-L-serine where
indicated. Samples were separated on 5% acrylamide/bisacrylamide
(82:1) vertical gels in 0.05 M Tris borate/EDTA buffer (pH
8.3) for 1.5 h at 10 V/cm, and the radiolabeled bands were
visualized by autoradiography. Although N-acetyl-L-serine is a better inducer of
CysB-dependent transcriptional activation than
O-acetyl-L-serine, the latter was shown to
function better in EMSA experiments (19). The differences between the two are mostly operational and have been discussed in detail previously (14); the inducer is referred to as acetylserine below.
In Vitro Transcription Runoff Assay--
The DNA fragment
containing the E. coli cysP promoter used as a template for
in vitro transcription was the same as that used for DNA
binding experiments. Transcription initiation complexes were formed in
20-µl mixtures containing ~20 ng of template DNA, the indicated
amounts of purified S. typhimurium or E. coli
CysB preparations and O-acetyl-L-serine or
N-acetyl-L-serine, 1 µg of nuclease-free
E. coli RNA polymerase (Amersham Pharmacia Biotech) in CysB
buffer containing 0.1 mM ATP. After 5 min at 37 °C,
transcription elongation was started by adding 2 µl of a solution
containing 20 µM [ -32P]CTP (200 Ci/mmol), 2 mM ATP, 2 mM GTP, 2 mM
UTP, and 0.5 mg/ml sodium heparin. After another 5 min at 37 °C, the
reaction was terminated by the addition of 0.2 ml of 10 mM
disodium EDTA containing 50 µg/ml yeast tRNA. Ethanol-precipitated
radiolabeled transcripts were analyzed on sequencing gels.
Molecular Modeling--
The homology model of E. coli
CysB has been built on the basis of the crystal structure of CysB from
Klebsiella aerogenes (fragment 88-324; Protein Data Bank
code 1AL3) by simple replacement of different residues and energy
minimization using consistent valence force field (CVFF) force
field as implemented in DISCOVER Version 2.3.5 (MSI/Biosym, San Diego,
CA). N-Acetyl-L-serine has been inserted in the
CysB structure according to Tyrrell et al. (20).
 |
RESULTS |
Isolation and Initial Characterization of Random cysB
Mutants--
Assuming that the lack of positive control function of
CysB can result from mutations impairing DNA-binding ability, inducer response, or RNA polymerase contacts, we used the
cysPT'::lacZ cysB strain (EC2266)
(Table I) for selection of
cysB mutants contained on plasmids. Since the expression of
-galactosidase in EC2266 is under the control of the
CysB-dependent cysP promoter, the strain yielded
white colonies on LB agar plates containing X-gal and dark-blue
colonies in the presence of plasmid pMH147 carrying WT cysB.
After transformation of EC2266 with several samples of mutagenized
pMH147, 32 white or pale-blue transformant colonies were selected. To
determine the location and nature of the mutations, the cysB
genes contained on plasmids were sequenced entirely. This allowed us to
exclude mutants resulting from generation of an early termination codon
within the cysB open reading frame (with the exception of
the Q5Ter mutant, which served as a control in some experiments) and
several mutants resulting from identical nucleotide change. Ten
plasmids containing cysB with mutations that caused single
residue substitutions within the CysB protein (Table
II) were analyzed further. None of these
plasmids complemented the Cys phenotype of two
cysB strains tested (Table II). To distinguish between
repressing and non-repressing cysB mutants, the
corresponding plasmids were screened for their ability to affect the
expression of the translational
cysB'::'lacZ fusion, encoded by the
low-copy number plasmid pMH303 in the cysB background
(EC2549 strain). As shown in Table II, the presence of WT
cysB reduced the expression of -galactosidase in this
strain to ~4%. Decreased levels of cysB'::'lacZ expression (2.6-5.6%)
were also observed with four plasmids encoding CysB variants M160I,
T196I, A244V, and A247E. The same mutants cloned in pACYC184 reduced to
~5% the expression of the chromosomal fusion
cysB'::Mud1(Ap,lacZ) in
strain EC1171 (data not shown). We concluded that repressing CysB
proteins M160I, T196I, A244V, and A247E (positions of mutations shown
in Fig. 1) expressed from these plasmids
retained a DNA-binding ability. The remaining six CysB variants with
single residue substitutions in the N-terminal portion of the protein
(region 11-48 containing the HTH motif and its close vicinity; see
Fig. 1) were defective to various extents in the repression of the
cysB'::'lacZ fusion (Table II). These
variants were therefore assumed to be impaired in DNA binding. The
repressing activities of plasmids carrying cysB mutants were
also measured in strain EC1250 containing pMH303. The -galactosidase
activity in this strain represents partially repressed level of
cysB'::'lacZ expression resulting from
the activity of chromosomally encoded WT CysB; this value has been estimated as ~2.5 times lower than that in the EC2549 strain
containing pMH303. The presence of plasmids encoding some of the
non-repressing CysB variants (E11K, S20L, and T22I) in the
pMH303-containing EC1250 strain resulted in elevation of the
cysB'::'lacZ expression to 230-270%
of the level characteristic for the strain (Table II). The effect
observed could be consistent with the assumption of negative dominance
of CysB proteins expressed from plasmids over chromosomally encoded WT
CysB. In contrast, a plasmid expressing no CysB (Q5Ter mutant) and
plasmids encoding CysB variants I48T, L44T, and E41K showed no such
dominant-negative effect, as they did not change the level of
cysB'::'lacZ expression in EC1250. We
noticed that all four repressing and three non-repressing (E11K, S20L,
and T22I) variants expressed from multicopy plasmids converted the
wild-type strain EC1250 to the Cys phenotype (Table II).
We also checked three representative mutants of this group cloned in
middle-copy plasmids (derivatives of pACYC184) for their effect on the
expression of the chromosomal
cysPT'::lacZ fusion in the EC2256
strain, WT for cysB. As shown in Fig.
2, plasmids carrying those
cysB mutants markedly reduced -galactosidase levels in
EC2256, confirming the dominant-negative effects of mutant proteins
expressed from plasmids over the WT CysB protein produced by the cell.
Knowing that WT CysB is a tetramer, the trans-dominance of
the multicopy CysB mutant forms may be explained by titration of WT
CysB monomers and formation of inactive mixed hetero-oligomers.
Therefore, it seems that none of the mutations altering residues 11, 20, 22, 160, 196, 244, and 247 abolished the oligomerization ability of
CysB. In contrast, CysB variants E41K, L44R, and I48T expressed from
plasmids did not confer the Cys phenotype to the EC1250
strain and had no effect on expression of the
cysB'::'lacZ fusion in the
pMH303-containing EC1250 strain (Table II). Therefore, mutations in
region 41-48 of CysB could affect oligomerization of the protein (see
also "Discussion").
View this table:
[in this window]
[in a new window]
|
Table I
Bacterial strains and plasmids
Only vectors and basic plasmids are listed. Details for construction of
plasmids carrying cysB genes with point mutations and
3'-terminal truncations are described under "Materials and
Methods." Relevant cysB mutants investigated in this study
are listed in Table II.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1.
Distribution of the CysB mutations
investigated in this study. The position of the HTH motif
(residues 18-38) in CysB (residues 1-324) is indicated according to
Ostrowski et al. (27). Regions proposed to be involved in
the inducer response of some LTTRs (2) are shown as gray
boxes, and such an additional region found for CysB is shown as a
black box. The positions of the C-terminal truncations
(removing 5, 16, 19, 23, 26, and 30 residues) are indicated by
vertical bars. The upper part of this figure presents our
interpretation of the functional regions of CysB drawn on the basis of
defects caused by particular mutations. The chromosomal region
containing cysB with restriction sites (positions relative
to A of the ATG start codon of cysB) relevant for
construction of the plasmids used in this study is shown below.
Restriction sites that were introduced by PCR are shown in
brackets.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 2.
Dominant-negative effect of cysB
mutants in the cysB+ strain.
Expression of the chromosomal
cysPT'::lacZ fusion was measured as
-galactosidase activity in the EC2256 strain in the presence
cysB mutants on plasmids (derivatives of pACYC184) pMH190
(CysB A244V), pMH192 (CysB A247E), pMH194 (CysB T196I), and pMH197 (WT
CysB).
|
|
Construction and Phenotypic Characterization of C-terminally
Truncated CysB Mutants--
The collection of CysB mutants isolated by
random mutagenesis lacked representatives with changes in the
C-terminal part of the protein. According to the structural model of
the CysB dimer (20), 33 C-terminal amino acids (positions 292-324)
form the loop exposed to the surface containing two helices. Therefore, this domain might be important for the overall structure of the native
CysB molecule and its function. To pursue the possible effects of
C-terminal mutations, we employed several approaches to construct
mutated and/or truncated forms of CysB (see "Oligonucleotides and
Plasmid Construction"). Six plasmids were obtained that encoded CysB
variants lacking 5, 16, 19, 23, 26, or 30 C-terminal residues of the WT
protein. Among these, only the CysB K320Ter variant conferred the
Cys+ phenotype to both cysB-negative strains
tested, EC2275 and EC2549. CysB K320Ter showed also significant
repressing activity in relation to the
cysB'::'lacZ fusion in the
cysB strain, and it was able to activate the
cysPT'::lacZ fusion to the level
observed with WT CysB (Table II). Therefore, it appears that CysB
K320Ter, lacking 5 C-terminal residues, retained sufficient activity
for all CysB functions in vivo. All further truncated CysB
variants (lacking 16-30 C-terminal residues) were apparently not fully
functional since plasmids carrying the corresponding cysB
mutant genes did not complement the Cys phenotype of the
cysB strain EC2549. Among these, the CysB protein lacking
16 C-terminal amino acids (CysB N309Ter) showed a reduced repressing
activity but almost wild-type positive control activity in
vivo as measured with the
cysB'::'lacZ fusion in the
pMH303-containing EC2549 strain and with the
cysPT'::lacZ fusion in the EC2559
strain, respectively. All further truncated CysB variants displayed no repressing activity and significantly reduced positive control function
in the same tests (Table II). However, plasmids encoding CysB variants
lacking 19-30 C-terminal amino acids showed a curious complementation
activity in strain EC2275 (cysB), observed as the appearance
of a few transformant colonies over the background of abortive growth
on minimal plates with sulfate. The presence of these plasmids in
strain EC2266 (cysPT'::lacZ cysB)
resulted in the appearance of a mixed population of transformants on
MacConkey/lactose solid medium, seen as a few red colonies on the
overall white background of bacterial growth. Because of this type of
growth, -galactosidase activities of EC2266 with these plasmids
could not be reliably established. The cysB mutation,
present in both the EC2275 and EC2266 strains, derives from the NK1
strain, in which it was identified as the single substitution I33N
(37). It seems that some arrangement of subunits between CysB I33N and C-terminally truncated CysB variants allows formation of a protein able
to positively control the cysP promoter. Our attempts to overproduce CysB mutants lacking >16 C-terminal residues for in vitro experiments failed, which may suggest an instability of these CysB variants. It is therefore possible that the C terminus contributes to the overall stability of the protein, and the
instability of the C-terminally truncated CysB variants might explain
the observed abortive complementation of the CysB I33N mutation.
DNA Binding Characteristics of Repressing and Constitutive
CysB Variants--
E. coli WT CysB and
those CysB mutants that displayed repressing activity
in vivo were cloned in the pTrc99A vector and overexpressed, and obtained extracts were fractionated as described under "Materials and Methods." The extent of CysB overproduction in particular preparations was estimated by SDS-polyacrylamide gel electrophoresis (Fig. 3). The DNA binding characteristics
of the E. coli WT CysB preparation used in this work
(referred to as E. coli WT CysB) were tested by EMSAs with a
393-bp DNA fragment containing the E. coli cysP promoter
region (pcysP). The complexes formed by E. coli WT
CysB with pcysP, shown in Fig.
4A, could be identified by
strict correspondence to those formed by highly purified S. typhimurium CysB, analyzed in detail previously (16, 18). When a
single CysB tetramer binds to pcysP, it induces DNA bending of
~100° in the absence of acetylserine and of ~50° in its
presence, giving rise to "slow" (C1s) and "fast" (C1f) primary
complexes, respectively. The C1f (fast) primary complex
represents a preferential interaction of the CysB tetramer with the
single activatory site located just upstream of the 35 region of the
promoter. The inducer responsiveness of CysB can therefore be monitored
by EMSA as a qualitative (mobility) and quantitative (amount)
alteration of the primary complex (Fig. 4A, compare
lanes 2 and 4 and lanes 5 and
6). We used EMSA to test three non-repressing CysB variants
(A244V, A247E, and T196I) for DNA binding characteristics with
pcysP. The results of this analysis showed that all three
proteins formed complexes with pcysP (Fig. 4, B and
C), but the mobilities of C1 complexes were unaffected by
acetylserine. For CysB variants A244V and T196I, these mobilities were
exactly the same as that of WT CysB in the absence of inducer (Fig. 4,
B, compare lanes 3 and 5-7; and
C, compare lanes 3 and 8-10). In the
case of CysB A247E, the C1 complex showed an intermediate mobility
between slow and fast, irrespective of the presence of acetylserine
(Fig. 4C, lanes 5-7), although the amount of
complex was higher with the inducer. It should be stressed that none of
the tested mutants, T196I, A244V, and A247E, was able to respond to the
inducer by a qualitative change in the DNA-protein complex
(reflected by complex mobility), which is critical for transcriptional
activation of the promoter by WT CysB. Defects in inducer
responsiveness observed in DNA binding studies correlated with the
inability of corresponding CysB mutants to activate expression of the
cysP promoter (as the cysPT'::lacZ fusion) in
vivo. Earlier studies on the autoregulatory function of S. typhimurium CysB (19) revealed that acetylserine reduces the
affinity of the protein for a particular "repressory" binding site in the cysB promoter region. We have shown by
EMSA (Fig. 5) that interaction of
E. coli WT CysB with pcysB displayed the same
characteristics, i.e. there was less complex formed by a
given amount of CysB in the presence of acetylserine than in its
absence. In contrast, CysB mutant derivatives T196I, A244V, and A247E
formed similar amounts of complex with the cysB promoter
fragment, irrespective of the presence of inducer. This result further
confirmed the involvement of CysB residues 196, 244, and 247 in
response to the inducer and the non-inducible character of the T196I,
A244V, and A247E variants.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 3.
Overproduction of E. coli WT
CysB and CysB mutants as estimated by SDS-polyacrylamide gel
electrophoresis. Cell extracts enriched with particular CysB
variants are shown as follows: lane 1, WT CysB (overproduced
from plasmid pMH199); lane 2, CysB A244V (plasmid pMH200);
lane 3, CysB A247E (plasmid pMH201); lane 4, CysB
T196I (plasmid pMH202); lane 5, control extract with no CysB
(vector pTrc99A); lane 6, CysB N309Ter (plasmid pMH217);
lane 7, CysB Y27G (plasmid pMH235); lane 8,
CysBc A227D (plasmid pMH203); lane 9,
CysBc Y164N (plasmid pMH205); lane 10, molecular
mass markers (in kDa). 44 µg (lanes 1, 3-5,
and 7-9) or 25 µg (lanes 2 and 6)
of total protein were loaded on the gel. Arrowheads indicate
the positions of full-length CysB and truncated CysB (lane
6).
|
|

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 4.
Binding of CysB protein variants to the
cysP promoter region as measured by EMSA. The
5'-labeled 393-bp DNA fragment extending from positions 321 to +72
relative to the transcription start site of cysP was
incubated with the indicated amounts of particular CysB preparations
(CysB-enriched protein extracts shown in Fig. 3) and 10 mM
O-acetyl-L-serine (OAS) where
indicated. Use of O-acetyl-L-serine instead
N-acetyl-L-serine is explained under
"Materials and Methods." Mixtures were run on 5% polyacrylamide
gels, and the radiolabeled bands were visualized by autoradiography.
A, DNA binding characteristics of wild-type E. coli CysB (wtE.c.) and purified S. typhimurium CysB (wtS.t.); B-E, DNA binding
of E. coli WT CysB and CysB variants with the indicated
mutations. Primary complexes (C1s (slow), C1f (fast), and C1f* (super
fast)) and secondary complexes (C2) are described under "Results."
No shifted band was detected with a control extract obtained
from cells containing vector pTrc99A (data not shown).
|
|

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 5.
Binding of CysB protein variants to the
cysB promoter region in EMSA. The 5'-labeled
308-bp DNA fragment containing the E. coli cysB promoter
region (from positions 143 to +165 relative to the translation start
codon) was used as a probe. Experimental conditions are identical to
those described in the legend to Fig. 4. OAS,
O-acetyl-L-serine.
|
|
We also analyzed three cysB mutants obtained previously in
our laboratory and characterized as causing constitutive expression of
sulfite reductase and O-acetylserine sulfhydrylase in
E. coli (32). Sequencing of these mutants
(cysBc301,
cysBc302, and
cysBc303) identified the single amino
acid substitutions A227D, Y164N, and Y197S, respectively, in encoded
proteins (Fig. 1 and Table II). Plasmids carrying
cysBc mutants displayed wild-type repressing and
activating functions in vivo in tests summarized in Table
II, but they conferred constitutive (not inhibited by cysteine)
expression of the cysPT'::lacZ fusion in strain EC2266 (data not shown). Two of the CysBc
variants, Y164N and A227D, were overproduced, and they were
characterized in EMSA with the cysP promoter fragment. The
CysBc Y164N protein formed a fast primary complex (C1f)
with pcysP in the absence of acetylserine, and the mobility of
this complex corresponded exactly to that of the complex formed by WT
CysB in the presence of inducer (Fig. 4D, compare
lanes 4 and 5). It therefore seems that
CysBc Y164N was able to adapt the conformation suitable to
interact with an activatory site in pcysP without the aid of
the inducer. However, an influence of acetylserine on CysBc
Y164N could be noticed as a quantitative effect on C1 complex formation
and a further subtle increase in complex mobility (Fig. 4D,
compare lanes 5 and 6). This result suggests that
CysB Y164N, albeit active in vivo without the inducer, can
still respond to it. It is possible that acetylserine induces some
conformational change in CysBc Y164N allowing formation of
a complex in which DNA is bent less than in the fast complex formed by
WT CysB. The complex formed by the other CysBc variant,
A227D, showed an unexpectedly higher electrophoretic mobility than
complexes formed by WT CysB and CysBc Y164N (Fig.
4D, lanes 7 and 8), and acetylserine
affected neither the mobility of this "super fast" complex (C1f*)
nor its amount. A secondary complex formed by CysBc A227D
was detected (Fig. 4, D, lane 8; and
E, lane 5), whose mobility was comparable to that
of WT CysB without inducer. The secondary complex (C2) formed by WT
CysB is shown in Fig. 4D (lane 3), and a similar
C2 complex formed by the CysB T196I variant is shown in Fig.
4C (lane 9). As established by previous
stoichiometry studies (16), the C2 complex of WT CysB results from
binding of two CysB tetramers in two separate binding sites within
pcysP. Considering the differences in mobility between
complexes formed by the A227D variant and those of WT CysB, it is
tempting to conclude that the A227D protein might bind DNA as a dimer,
forming a super fast primary complex.
Among the C-terminally truncated CysB variants, CysB K320Ter was not
tested further, as its phenotypic characteristics were similar to those
of WT CysB. Of further truncated CysB mutants, only one, CysB N309Ter,
could be overproduced to an amount sufficient for DNA binding
experiments. The corresponding extract enriched with CysB N309Ter was
tested in EMSA using the cysP promoter. As shown in Fig.
4E (lanes 7-9), this protein was able to bind pcysP, forming a complex of much higher mobility than that of
WT CysB. Interestingly, the mobility of this super fast complex (C1f*)
was comparable to that of the complex formed by CysBc
A227D. The plasmid encoding CysB N309Ter (and other plasmids encoding
truncated CysB variants) displayed no dominant-negative effect on the
Cys phenotype of WT strain EC1250 (Table II) and did not reduce the
-galactosidase level in the EC2256 strain (data not shown). The lack
of a dominant-negative effect on WT CysB in vivo can be most
easily explained by an oligomerization defect in CysB N309Ter and the
other C-terminally truncated variants. Consequently, we can hypothesize
that CysB N309Ter and CysBc A227D bound DNA as dimers
because complexes formed by these proteins with the cysP
promoter displayed a similar mobility (see also "Discussion").
However, in contrast to CysBc A227D, CysB N309Ter could not
perform all functions of WT CysB in vivo, as it was unable
to complement the cysteine requirement of the cysB mutant strain.
Construction and Characteristics of the Putative CysBpc
Mutant--
One of the objectives of this study was to identify single
amino acid substitution(s) in CysB that result in the loss of
transcriptional activation of the cys promoter, but not loss
of both DNA binding and inducer response. By these criteria, none of
the cysB mutants described above could be regarded as
defective specifically in "positive control" function. In one of
the attempts to isolate a CysBpc mutant (where pc is
positive control), we took advantage of the recent study on LysR-type
GcvA protein (36) suggesting that single residue substitutions F31L and
F31A in the recognition helix of the HTH motif are responsible
specifically for the positive control function of GcvA. Since
Phe31 of GcvA corresponds to Tyr27 of CysB in
alignment of the putative HTH regions of these proteins, we introduced
the mutation changing Tyr27 of CysB to Gly by site-directed
mutagenesis (see "Oligonucleotides and Plasmid Construction"). The
plasmid expressing CysB Y27G showed the wild-type level of repression
of the cysB'::'lacZ fusion, but was not
able to activate the expression of the
cysPT'::lacZ fusion (Table II). The
Y27G variant was overproduced and used for DNA binding assay with the
cysP promoter fragment. As shown in Fig.
6A, CysB Y27G was able to bind
the cysP promoter region, giving rise to slow (C1s) and fast
(C1f) primary complexes seen in the absence (lanes 6 and
7) and presence (lanes 8 and 9) of acetylserine, respectively. Therefore, the Y27G mutation apparently did
not abolish the ability of CysB to respond to the inducer by a
qualitative change in the DNA-protein complex. The mobilities of the
slow and fast primary complexes formed by CysB Y27G were, however,
different than those of the respective complexes formed with WT CysB;
the similar differences concerned also migration of secondary complexes
(C2). The reason for this discrepancy is not clear at present, and some
differences in overall tertiary structure between WT CysB and the Y27G
variant may be only hypothesized. To further characterize the CysB Y27G
protein, we tested its activity versus WT CysB in a
transcription runoff assay with the cysP promoter. At first,
we compared the activity of the E. coli WT CysB preparation (used in all DNA binding tests in this study) with that of purified S. typhimurium CysB. As shown in Fig. 6B, the
synthesis of identical transcripts was stimulated with both CysB
preparations in the presence of O-acetylserine. The sizes of
two major runoff products, 73 and 66 nucleotides, corresponded to
transcription start sites at positions 1 and +6, respectively,
relative to the major in vivo start site of the E. coli cysP promoter. The appearance of multiple
transcripts in the runoff experiment using the E. coli cysP
promoter region is not surprising, as it was also observed with the
S. typhimurium cysP promoter, in which two major runoff products (corresponding to transcription start sites at positions 2
and +5 relative to the in vivo transcription start site) and several minor products were synthesized (18). In contrast to WT CysB,
the CysB Y27G mutant protein showed very low activity in an analogous
runoff assay (Fig. 6B). It should be noted that CysB Y27G
was even more active than WT CysB in the DNA binding assay (Fig.
6A) when both preparations were used at equal protein concentrations. We therefore assume that the lack of activity of Y27G
in the transcription assay in vitro could not result from an
inadequate protein amount or its low stability. On the basis of these
data, we conclude that the Y27G mutation abolished the positive control
function of CysB, leaving the DNA-binding and inducer response
functions unaffected.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 6.
Comparison of the DNA binding and
transcriptional characteristics of WT CysB and the CysB Y27G
variant. A, shown is the binding of WT CysB and the
CysB Y27G mutant protein to the cysP promoter region as
measured by EMSA. Conditions of the experiment are similar to those
described in the legend to Fig. 4. B, transcription runoff
assays were performed with the cysP promoter (fragment 321
to +72), the indicated amounts (µg/ml) of CysB proteins (wild-type
purified S. typhimurium CysB (wt S.t.) and
extracts enriched with WT E. coli CysB (wt E.c.)
or CysB Y27G), and 10 mM
O-acetyl-L-serine (OAS) or 1 mM N-acetyl-L-serine
(NAS) where indicated. Transcripts were sized according to
the sequencing reaction performed with the pMH1822 template and the
5'-32P-labeled primer ECCP2 (lanes A,
C, G, and T).
|
|
 |
DISCUSSION |
In this study, we analyzed the properties of 20 newly isolated
CysB mutants to define roles of particular protein regions (see Fig. 1
for proposed functional map of CysB).
Regions Important for DNA Binding--
In addition to the
previously identified mutations S34R (14) and I33N (37), six new
mutations were obtained that are clustered in region 11-48. All of
these mutations impaired the ability of CysB to negatively autoregulate
and also to activate the cysP promoter. Therefore, it seems
clear that the predicted helix-turn-helix motif (residues 18-38) of
CysB (13) and its close vicinity are crucial for the DNA-binding
function. Most of the N-terminal residues identified in CysB as
important for DNA binding are highly conserved among LTTRs. It was
proposed (9) that highly conserved amino acids contact conserved base
pairs of a generic TN11A motif present in the binding sites
for most LTTRs (38). Some CysB residues (i.e.
Glu11 and Thr22) are poorly conserved in other
LysR family members; these residues may therefore confer the
specificity of DNA-CysB interactions. We found that a C-terminal region
of CysB may be also critical for the DNA-binding function, as removal
of 19-30 C-terminal residues resulted in loss of repressing ability of
the protein in vivo. The possible involvement of the
C-terminal region in DNA binding places CysB in one subclass of LTTRs
along with AmpR (8), NahR (7), and OxyR (9), in contrast to other
subclass of LTTRs, i.e. MetR (39) and Nac (40), which
tolerate substantial C-terminal truncations. The role of the C-terminal
end of CysB in DNA binding may be indirect, as truncations of 19 and
more residues apparently affect the stability of the protein and
possibly its oligomerization state (see below).
Regions Involved in Inducer Recognition/Response--
It was shown
previously that substitutions T149M/P and W166R result in constitutive
or partially constitutive activity of CysB, respectively (41). We have
identified seven additional residues of CysB (Fig. 1) that may
contribute to inducer binding and response. Non-inducible CysB variants
were unable to respond to the inducer, acetylserine, by the
conformational change that allows the transition of the slow
DNA-protein complex to the fast complex, of which only the latter
represents the structure required for transcriptional activation of the
cysP promoter (16, 18). The interaction of these CysB
variants with the cysB promoter region was also unaffected
by acetylserine, in contrast to wild-type CysB, whose binding to
pcysB was inhibited by the inducer. One of the constitutive
CysB variants examined in this study (CysBc Y164N) formed
the fast complex with the cysP promoter region independently
of the presence of inducer. The characteristics of this mutant
correlated well with those described for CysBc T149M (41).
More interestingly, the other CysBc variant, A227D, formed
a super fast complex with the cysP promoter, suggesting a
different oligomerization state of this mutant protein compared with
that of WT CysB. Although attempting to evaluate the nature of the
super fast complex is speculative without stoichiometry data, two
arguments allow us to favor the possibility that the protein binds DNA
as a dimer. First, a similar super fast complex was also observed with
the CysB N309Ter variant, whose other characteristics suggested an
oligomerization defect. Second, another LysR family protein, OxyR, may
serve as a precedent, as its wild-type form is tetrameric, but the
constitutive A233V variant binds DNA as a dimer (9). The fact that
CysBc A227D was fully functional in vivo also
suggests that the tetrameric structure of CysB may be nonessential for
the activatory function of the protein.
Four mutations affecting the response of CysB to acetylserine fit in
regions 95-173 and 196-206, respectively (Fig. 1), suggested to be
responsible for the inducer response in several LTTRs (2). Three
remaining mutations were localized closer to the C-terminal part of the
protein. The importance of this additional region (residues 227-255)
for inducer recognition/response is also illustrated by mutations
described more recently for OxyR (constitutive variants A233V/T and
G253K) (4) and NahR (variant R248C) (5). The amino acid residues whose
substitution results in either non-inducible or constitutively active
CysB variants are presented in the model of E. coli CysB
(Fig. 7). As can be seen, all these
residues (perhaps with the exception of Met160) are
localized in the neighborhood of the cavity, which is believed to be an
acetylserine-binding pocket (20).

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 7.
Model of E. coli CysB
monomer fragment 88-324 showing residues important for inducer
recognition/response. The inducer
N-acetyl-L-serine was inserted in the presented
structure according to Tyrrell et al. (20) and is shown in
ball and stick representation in green. Residues identified
in this study whose mutations led to non-inducible CysB proteins are
indicated in blue. Residues whose alterations resulted in
constitutive activity of CysB are shown in yellow; among
these, residues 149 and 166 investigated previously (41) are also
included.
|
|
We performed molecular modeling to compare the structure of the WT CysB
dimer with that of either non-inducible or constitutive CysB variants.
However, the observed differences were not of essential meaning, so one
cannot expect fundamental structural changes in the protein caused by
the particular mutations studied in this work.
Regions Important for Oligomerization--
The standard test for
negative trans-dominance (42) is frequently used to identify
residues involved in oligomerization of multimeric transcriptional
regulators. Examples of LysR family members, NahR (7), OxyR (9), and
GcvA (36), also suggest the correlation between the oligomerization
defect and the inability of the mutant protein to exert a
dominant-negative effect (also called a "poisoning effect") on the
activity of the wild-type counterpart produced by the cell. For CysB,
the negative dominance was clearly seen with some non-repressing
(non-binding) variants (with mutations in region 11-22) as well as
with non-inducible variants (Fig. 1). In contrast, three non-repressing
mutants (substitutions in region 41-48) and all of the C-terminally
truncated CysB variants did not display a dominant-negative effect. One
truncated CysB variant (CysB N309Ter) bound to the cysP
promoter, and the mobility of the resulting primary complex was
consistent with a dimeric rather than a tetrameric form of the protein.
The most likely interpretation of these findings indicates the
involvement of the 16 C-terminal residues in oligomerization of CysB
(as was also suggested for OxyR and NahR), but also the importance of a
region encompassing Leu41-Ile48. It is
tempting to speculate that region 41-48, composing part of the
DNA-binding domain, is important for appropriate contacts between two
CysB monomers whose HTH motifs interact directly with dyadic activatory
binding sites. An alternative explanation for the lack of a
dominant-negative effect of the E41K, L44L, and I48T variants assumes
that the mutant proteins possess the ability to oligomerize, but that
mixed CysB oligomers are still functional (i.e. the
wild-type monomers are dominant to the mutant monomers with respect to
DNA binding). Another suggestion emerging from our study is that
interactions between subunits within the CysB tetramer may be affected
by an interaction with the inducer. Such a possibility is inferred by
the characteristics of the CysBc A227D variant, most
probably dimeric as discussed earlier. A model proposed for WT CysB
(37) assumed that C-terminal portions of the four subunits maintain the
tetramer in an inactive state and that acetylserine disrupts these
contacts to release the protein surface for interaction with the RNA
polymerase. The characteristics of the CysBc A227D variant
would be consistent with this model if one assumes that the A227D
mutation disrupts C-terminal contacts between subunits and that the
resulting protein is active without an inducer. It has to be pointed
out that if both CysBc A227D and CysB N309Ter bind DNA as
dimers, the arrangement of subunits in these dimers may not be
equivalent. The electrophoretic mobilities of the primary complexes
formed by these proteins with the cysP promoter were similar
but not identical, and the N309Ter variant (in contrast to
CysBc A227D) apparently was not active with all
CysB-dependent cys gene promoters in
vivo, as it was unable to complement the cysB mutant. Perhaps the characteristics of the above CysB variants closely
resemble those of dimeric OxyR mutants, for which the possibility of
dimerization via either the "dimerization domain" or the
"tetramerization domain" was suggested (9).
Region Involved in the Positive Control Function--
The single
amino acid substitution Y27G in CysB (Fig. 1) resulted in a phenotype
expected for a CysBpc mutant: the Y27G protein was able to
bind DNA and to respond to the inducer by a qualitative change in the
DNA-protein complex, but it was still defective in transcriptional
activation. These results confirm that an additional function beyond
DNA binding and bending (more precisely, inducer-dependent
release of DNA bending caused by CysB alone) is required for CysB to
act as a transcriptional activator. By its characteristics, the CysB
Y27G variant corresponds to the GcvApc F31L/A mutants (36),
raising the possibility that in LysR-type proteins, an "activation
patch" composes part of the N-terminal HTH region. A similar position
of the putative activating region (within or nearby the HTH motif of
the DNA-binding domain) was demonstrated for transcriptional regulators
belonging to other families, i.e. cI (43) and FIS (44) proteins.
CysB protein is likely to contact the C-terminal domain of the RNA
polymerase -subunit, as the rpoA341 mutation, changing K271E in the -peptide, specifically affects
CysB-dependent expression of the cysPTWA operon
(45). It is possible that recruitment of RNA polymerase by CysB
involves a direct protein-protein contact between the C-terminal domain
of the RNA polymerase -subunit and the putative activating region of
CysB, in which Thr27 seems to be essential.
In conclusion, the results of this study highlight the regions of CysB
that are critical for DNA binding, inducer response, oligomerization,
and positive control and demonstrate that these functions can be
genetically separated. Further work will continue to focus on the
purification and detailed biochemical characterization of selected CysB
variants for better recognition of CysB subunit interactions. Isolation
of additional mutants for further characterization of the CysB
activating region is also in progress.
 |
ACKNOWLEDGEMENTS |
We thank Anne-Lise Haenni and Piotr
Ceglowski for critical reading of the manuscript. We also thank
N. M. Kredich for the kind gift of purified S. typhimurium CysB protein.
 |
FOOTNOTES |
*
This work was supported in parts by grants from the Polish
State Committee for Scientific Research (Projects 6P04A03614 and 6P04A05216).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Inst. of Biochemistry
and Biophysics, Polish Academy of Sciences, Pawinskiego 5A, 02-106 Warsaw, Poland. Tel.: 48-22-659-60-72 (ext. 1310); Fax: 48-39-12-16-23 or 48-22-658-46-36; E-mail: monikah@ibbrain.ibb.waw.pl.
Published, JBC Papers in Press, October 18, 2000, DOI 10.1074/jbc.M007192200
 |
ABBREVIATIONS |
The abbreviations used are:
LTTRs, LysR-type
transcriptional regulators;
HTH, helix-turn-helix;
bp, base pair(s);
X-gal, 5-bromo-4-chloro-3-indolyl -D-galactopyranoside;
PCR, polymerase chain reaction;
WT, wild-type;
EMSA, electrophoretic
mobility shift assay.
 |
REFERENCES |
| 1.
|
Henikoff, S. G.,
Haughn, J. M.,
Calvo, J. M.,
and Wallace, J. C.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
6602-6606
|
| 2.
|
Schell, M.
(1993)
Annu. Rev. Microbiol.
47,
597-626
|
| 3.
|
Perez-Rueda, E.,
and Collado-Vides, J.
(2000)
Nucleic Acids Res.
28,
1838-1847
|
| 4.
|
Kullik, I.,
Toledano, M. B.,
Tartaglia, L. A.,
and Storz, G.
(1995)
J. Bacteriol.
177,
1275-1284
|
| 5.
|
Cebolla, A.,
Sousa, C.,
and de Lorenzo, V.
(1997)
J. Biol. Chem.
272,
3986-3992
|
| 6.
|
Jørgensen, C.,
and Dandanell, G.
(1999)
J. Bacteriol.
181,
4397-4403
|
| 7.
|
Schell, M. A.,
Brown, P. H.,
and Raju, S.
(1990)
J. Biol. Chem.
265,
3844-3850
|
| 8.
|
Bartowsky, E.,
and Normark, S.
(1991)
Mol. Microbiol.
5,
1715-1725
|
| 9.
|
Kullik, I.,
Stevens, J.,
Toledano, M. B.,
and Storz, G.
(1995)
J. Bacteriol.
177,
1285-1291
|
| 10.
|
Ishihama, A.
(1993)
J. Bacteriol.
175,
2483-2489
|
| 11.
|
Kredich, N. M.
(1996)
in
Escherichia coli and Salmonella: Cellular and Molecular Biology
(Neidhardt, F. C.
, Curtiss, R., III
, Ingraham, J. L.
, Lin, E. C. C.
, Low, K. B.
, Magasanik, B.
, Reznikoff, W. S.
, Riley, M.
, Schaechter, M.
, and Umbarger, H. E., eds), 2nd Ed.
, pp. 514-527, American Society for Microbiology, Washington, D. C.
|
| 12.
|
Jagura-Burdzy, G.,
and Hulanicka, D.
(1981)
J. Bacteriol.
147,
744-751
|
| 13.
|
Ostrowski, J.,
and Kredich, N. M.
(1991)
J. Bacteriol.
173,
2212-2218
|
| 14.
|
Kredich, N. M.
(1992)
Mol. Microbiol.
20,
2747-2753
|
| 15.
|
Miller, B. E.,
and Kredich, N. M.
(1987)
J. Biol. Chem.
262,
6006-6009
|
| 16.
|
Hryniewicz, M. M.,
and Kredich, N. M.
(1994)
J. Bacteriol.
176,
3673-3682
|
| 17.
|
Monroe, R. S.,
Ostrowski, J.,
Hryniewicz, M. M.,
and Kredich, N. M.
(1990)
J. Bacteriol.
172,
6919-6929
|
| 18.
|
Hryniewicz, M. M.,
and Kredich, N. M.
(1991)
J. Bacteriol.
173,
5876-5886
|
| 19.
|
Ostrowki, J.,
and Kredich, N. M.
(1990)
J. Bacteriol.
172,
779-785
|
| 20.
|
Tyrrell, R.,
Verschueren, K. H. G.,
Dodson, E. J.,
Murshudov, G. N.,
Addy, C.,
and Wilkinson, A. J.
(1997)
Structure
5,
1017-1032
|
| 21.
|
van der Ploeg, J.,
Iwanicka-Nowicka, R.,
Kertesz, M. A.,
Leisinger, T.,
and Hryniewicz, M. M.
(1997)
J. Bacteriol.
179,
7671-7678
|
| 22.
|
van der Ploeg, J.,
Iwanicka-Nowicka, R.,
Bykowski, T.,
Hryniewicz, M. M.,
and Leisinger, T.
(1999)
J. Biol. Chem.
274,
29358-29365
|
| 23.
|
Iwanicka-Nowicka, R.,
and Hryniewicz, M. M.
(1995)
Gene (Amst.)
166,
11-17
|
| 24.
|
van der Ploeg, J. R.,
Weiss, M. A.,
Saller, E.,
Nashimoto, H.,
Saito, N.,
Kertesz, M. A.,
and Leisinger, T.
(1996)
J. Bacteriol.
178,
5438-5446
|
| 25.
|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. E., Seidman, J. G., Smith, J. A., and Struhl, K.
(eds)
(1987)
Current Protocols in Molecular Biology
, Wiley-Interscience, New York
|
| 26.
|
Sanger, F.,
Nicklen, S.,
and Coulson, A. R.
(1977)
Proc. Natl. Acad. Sci. U. S. A.
74,
5463-5467
|
| 27.
|
Ostrowski, J.,
Jagura-Burdzy, G.,
and Kredich, N. M.
(1987)
J. Biol. Chem.
262,
5999-6005
|
| 28.
|
Grob, P.,
Kahn, D.,
and Guiney, D. G.
(1997)
J. Bacteriol.
179,
5398-5406
|
| 29.
|
Sikorski, R. S.,
and Boeke, J. D.
(1991)
Methods Enzymol.
194,
314-317
|
| 30.
|
Miller, J. H.
(ed)
(1992)
A Short Course in Bacterial Genetics
, pp. 268-274, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 31.
|
Kushner, S. R.,
Nagaishi, H.,
Templin, A.,
and Clark, A. J.
(1971)
Proc. Natl. Acad. Sci. U. S. A.
68,
824-827
|
| 32.
|
Hryniewicz, M. M.,
Palucha, A.,
and Hulanicka, M. D.
(1988)
J. Gen. Microbiol.
134,
763-769
|
| 33.
|
Fijalkowska, I. J.,
and Schaaper, R. M.
(1995)
J. Bacteriol.
177,
5979-5986
|
| 34.
|
Minton, N. P.
(1984)
Gene (Amst.)
31,
269-273
|
| 35.
|
Takeshita, S.,
Sato, M.,
Toba, M.,
Masahashi, W.,
and Hashimoto-Gotoh, T.
(1987)
Gene (Amst.)
61,
63-74
|
| 36.
|
Jourdan, A. D.,
and Stauffer, G. V.
(1998)
J. Bacteriol.
180,
4865-4871
|
| 37.
|
Colyer, T. C.,
and Kredich, N. M.
(1994)
Mol. Microbiol.
13,
797-805
|
| 38.
|
Goethals, K.,
Van Montagu, M.,
and Holsters, M.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
1646-1650
|
| 39.
|
Maxon, M. E.,
Wigboldus, J.,
Brot, N.,
and Weissbach, H.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7076-7079
|
| 40.
|
Muse, W. B.,
and Bender, R. A.
(1999)
J. Bacteriol.
181,
934-940
|
| 41.
|
Colyer, T. C.,
and Kredich, N. M.
(1996)
Mol. Microbiol.
21,
247-256
|
| 42.
|
Shamah, S. M.,
and Stiles, C. D.
(1995)
Methods Enzymol.
254,
567-576
|
| 43.
|
Whipple, F. W.,
Ptashne, M.,
and Hochshild, A.
(1997)
J. Mol. Biol.
265,
261-265
|
| 44.
|
Gosink, K. K.,
Gaal, T.,
Bokal, A. J., IV,
and Gourse, R. L.
(1996)
J. Bacteriol.
178,
5182-5187
|
| 45.
|
Giffard, P. M.,
and Booth, I. R.
(1988)
Mol. Gen. Genet.
214,
148-152
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Kim, J. Oh, O. Choi, Y. Kang, H. Kim, E. Goo, J. Ma, T. Nagamatsu, J. S. Moon, and I. Hwang
Biochemical Evidence for ToxR and ToxJ Binding to the tox Operons of Burkholderia glumae and Mutational Analysis of ToxR
J. Bacteriol.,
August 1, 2009;
191(15):
4870 - 4878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Sainsbury, L. A. Lane, J. Ren, R. J. Gilbert, N. J. Saunders, C. V. Robinson, D. I. Stuart, and R. J. Owens
The structure of CrgA from Neisseria meningitidis reveals a new octameric assembly state for LysR transcriptional regulators
Nucleic Acids Res.,
May 27, 2009;
(2009)
gkp445v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Isak and M. Ryden-Aulin
Hypomodification of the Wobble Base in tRNAGlu, tRNALys, and tRNAGln Suppresses the Temperature-Sensitive Phenotype Caused by Mutant Release Factor 1
J. Bacteriol.,
March 1, 2009;
191(5):
1604 - 1609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. E. Maddocks and P. C. F. Oyston
Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins
Microbiology,
December 1, 2008;
154(12):
3609 - 3623.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Iwanicka-Nowicka, A. Zielak, A. M. Cook, M. S. Thomas, and M. M. Hryniewicz
Regulation of Sulfur Assimilation Pathways in Burkholderia cenocepacia: Identification of Transcription Factors CysB and SsuR and Their Role in Control of Target Genes
J. Bacteriol.,
March 1, 2007;
189(5):
1675 - 1688.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-F. Hullo, S. Auger, O. Soutourina, O. Barzu, M. Yvon, A. Danchin, and I. Martin-Verstraete
Conversion of Methionine to Cysteine in Bacillus subtilis and Its Regulation
J. Bacteriol.,
January 1, 2007;
189(1):
187 - 197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Smart and C. E. Bauer
Tetrapyrrole Biosynthesis in Rhodobacter capsulatus Is Transcriptionally Regulated by the Heme-Binding Regulatory Protein, HbrL
J. Bacteriol.,
February 15, 2006;
188(4):
1567 - 1576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-J. Yang, K. C. Rice, R. J. Brown, T. G. Patton, L. E. Liou, Y. H. Park, and K. W. Bayles
A LysR-Type Regulator, CidR, Is Required for Induction of the Staphylococcus aureus cidABC Operon
J. Bacteriol.,
September 1, 2005;
187(17):
5893 - 5900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Burguiere, J. Fert, I. Guillouard, S. Auger, A. Danchin, and I. Martin-Verstraete
Regulation of the Bacillus subtilis ytmI Operon, Involved in Sulfur Metabolism
J. Bacteriol.,
September 1, 2005;
187(17):
6019 - 6030.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. N. Erwin, S. Nakano, and P. Zuber
Sulfate-Dependent Repression of Genes That Function in Organosulfur Metabolism in Bacillus subtilis Requires Spx
J. Bacteriol.,
June 15, 2005;
187(12):
4042 - 4049.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Zhang, G. Gosset, R. Barabote, C. S. Gonzalez, W. A. Cuevas, and M. H. Saier Jr.
Functional Interactions between the Carbon and Iron Utilization Regulators, Crp and Fur, in Escherichia coli
J. Bacteriol.,
February 1, 2005;
187(3):
980 - 990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Golic, M. Schliekelmann, M. Fernandez, M. Kleerebezem, and R. van Kranenburg
Molecular characterization of the CmbR activator-binding site in the metC-cysK promoter region in Lactococcus lactis
Microbiology,
February 1, 2005;
151(2):
439 - 446.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Rousseau, E. Gueguen, G. Duval-Valentin, and M. Chandler
The helix-turn-helix motif of bacterial insertion sequence IS911 transposase is required for DNA binding
Nucleic Acids Res.,
February 23, 2004;
32(4):
1335 - 1344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Farmer and M. S. Thomas
Isolation and Characterization of Burkholderia cenocepacia Mutants Deficient in Pyochelin Production: Pyochelin Biosynthesis Is Sensitive to Sulfur Availability
J. Bacteriol.,
January 15, 2004;
186(2):
270 - 277.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Jovanovic, M. Lilic, D. J. Savic, and G. Jovanovic
The LysR-type transcriptional regulator CysB controls the repression of hslJ transcription in Escherichia coli
Microbiology,
December 1, 2003;
149(12):
3449 - 3459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Feng, Q. Li, H.-L. Hu, X.-C. Chen, and G.-F. Hong
Inactivation of the nod box distal half-site allows tetrameric NodD to activate nodA transcription in an inducer-independent manner
Nucleic Acids Res.,
June 15, 2003;
31(12):
3143 - 3156.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zaim and A. M. Kierzek
The structure of full-length LysR-type transcriptional regulators. Modeling of the full-length OxyR transcription factor dimer
Nucleic Acids Res.,
March 1, 2003;
31(5):
1444 - 1454.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Guillouard, S. Auger, M.-F. Hullo, F. Chetouani, A. Danchin, and I. Martin-Verstraete
Identification of Bacillus subtilis CysL, a Regulator of the cysJI Operon, Which Encodes Sulfite Reductase
J. Bacteriol.,
September 1, 2002;
184(17):
4681 - 4689.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Akakura and S. C. Winans
Mutations in the occQ Operator That Decrease OccR-induced DNA Bending Do Not Cause Constitutive Promoter Activity
J. Biol. Chem.,
May 3, 2002;
277(18):
15773 - 15780.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fernandez, M. Kleerebezem, O. P. Kuipers, R. J. Siezen, and R. van Kranenburg
Regulation of the metC-cysK Operon, Involved in Sulfur Metabolism in Lactococcus lactis
J. Bacteriol.,
January 1, 2002;
184(1):
82 - 90.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Quan, B. L. Schneider, I. T. Paulsen, M. Yamada, N. M. Kredich, and M. H. Saier Jr
Regulation of carbon utilization by sulfur availability in Escherichia coli and Salmonella typhimurium
Microbiology,
January 1, 2002;
148(1):
123 - 131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Akakura and S. C. Winans
Constitutive Mutations of the OccR Regulatory Protein Affect DNA Bending in Response to Metabolites Released from Plant Tumors
J. Biol. Chem.,
February 15, 2002;
277(8):
5866 - 5874.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|