Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M007192200 on October 18, 2000

J. Biol. Chem., Vol. 276, Issue 3, 2098-2107, January 19, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/3/2098    most recent
M007192200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lochowska, A.
Right arrow Articles by Hryniewicz, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lochowska, A.
Right arrow Articles by Hryniewicz, M. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Functional Dissection of the LysR-type CysB Transcriptional Regulator

REGIONS IMPORTANT FOR DNA BINDING, INDUCER RESPONSE, OLIGOMERIZATION, AND POSITIVE CONTROL*

Anna Lochowska, Roksana Iwanicka-Nowicka, Danuta Plochocka, and Monika M. HryniewiczDagger

From the Institute of Biochemistry and Biophysics, Polish Academy of Sciences, 02-106 Warsaw, Poland

Received for publication, August 8, 2000, and in revised form, October 17, 2000



    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

CysB is a tetrameric LysR-type transcriptional regulator that acts as an activator of cys regulon genes and as an autorepressor. Positive control of cys genes requires the presence of the inducer N-acetylserine. Following random and site-directed mutagenesis of the cysB gene, 20 CysB variants were isolated. Six single amino acid substitutions within the N terminus of CysB abolished the DNA-binding ability of the protein. Seven mutations in the central region of CysB affected its response to the inducer. Four of these CysB mutants retained repressing activity, but lost their activating function in vivo. Their DNA binding characteristics were consistent with an inability to respond to acetylserine by a qualitative change in the DNA-protein interaction. Three of the single residue substitutions resulted in constitutive activity of CysB. The electrophoretic mobility of the complex formed by one of the CysBc variants with the cysP promoter suggested a dimeric state of this protein. Characteristics of six truncated CysB variants lacking 5-30 C-terminal residues indicated the involvement of the C terminus in the DNA binding, oligomerization, and stability of CysB. The single substitution Y27G resulted in the CysBpc variant, able to bind DNA and to respond to the inducer by a qualitative change in the DNA-protein complex, but defective in the positive control of the cysP promoter.



    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

LysR-type transcriptional regulators (LTTRs),1 initially reported by Henikoff et al. (1), compose probably the largest family of prokaryotic regulatory proteins. Since the last systematic review (2), in which some 50 LTTRs were mentioned, the family has expanded to over 100 members identified in diverse bacterial genera. In Escherichia coli K12, the overall repertoire of DNA-binding transcriptional regulators, estimated as 314 proteins (3), includes 45 LTTRs (18 known and 27 predicted). All LTTRs investigated so far are DNA-binding proteins that positively regulate transcription of target genes, and most of them also repress their own expression. The common family features are the similar size of the molecule (between 300 and 350 amino acids), the formation of either homodimers or homotetramers, the presence of the helix-turn-helix (HTH) motif in the N-terminal region, and the requirement for a small molecule that acts as coinducer (2). The homology between LTTRs is generally high, suggesting their evolution from a common distant ancestor and the possibility of their similar tertiary structure. The highest sequence similarity exists within the 66 N-terminal amino acids, containing a HTH motif and proposed to function as a DNA-binding domain. The central region of the LysR-type proteins shows the lowest sequence homology between family members. Mutational studies performed on some proteins suggest that two subdomains of this region (amino acids 95-173 and 196-206) can be engaged in coinducer recognition/response (2, 4-6). The regions involved in multimerization of LTTRs are not well defined. Some experimental results obtained for NahR (7), AmpR (8), and OxyR (9) indicate involvement of the C-terminal domain in oligomer formation. Several LysR-type proteins, including CysB, have been suggested to interact with the C-terminal domain of the RNA polymerase alpha -subunit (10). However, to date, no study has clarified the details of the putative contact(s) of any LTTR with the RNA polymerase. Structural characterization of LysR-type proteins has been delayed by the fact that many of the family members are insoluble when overexpressed and difficult to obtain in highly purified form.

CysB, a LysR family member, is an essential positive factor for activity of most cys genes engaged in the assimilatory sulfate pathway via cysteine biosynthesis (see Ref. 11 for a review). High-level expression of these genes, composing the cysteine regulon, requires, in addition to CysB, the presence of an inducer (N-acetyl-L-serine) and sulfur limitation. CysB acts also as a repressor of its own gene (12, 13). The interactions of CysB with responsive promoter regions are unusually complex (11, 14). DNA regions identified as "CysB-binding sites" show poor sequence homology. In general, they share a configuration of imperfect dyad symmetry between 19-bp half-sites, but the number, spacing, and arrangement of half-sites vary in particular promoters. Wild-type CysB is a tetramer of identical 36-kDa subunits in solution (15), and it also binds to DNA as a tetramer (16). In positively regulated promoters (i.e. cysK and cysP), CysB binds in the absence of inducer and occupies a large DNA region including three half-sites (16-18). This mode of DNA-protein interaction results in DNA bending by ~100o and is unfavorable for transcriptional activation of the promoter. N-Acetylserine is thought to induce a conformational change in CysB; this change allows the protein to interact preferentially with "activatory sites," composed of two half-sites spaced by 1-2 bp and localized just upstream of the -35 regions of the cysJ, cysK, and cysP promoters. The stable interaction of the CysB tetramer with a unique activatory site is critical for transcriptional activation of the promoter, and it may be required for RNA polymerase recruitment. In the cysB promoter, CysB protects the DNA region overlapping the RNA polymerase-binding site that results in repression of transcription (13). In this case, acetylserine reduces binding of CysB to DNA, thereby releasing the repression of the cysB gene. Sulfur limitation required for high-level expression of cys genes in vivo can be explained by the fact that sulfide and thiosulfate act as anti-inducers, competing with N-acetylserine for the CysB activator (18, 19). In addition, cysteine is an inhibitor of serine transacetylase, the enzyme required for acetylserine biosynthesis.

CysB is an attractive representative of LTTRs to study the structure/function relationship for several reasons. First, the molecular basis of the interaction of CysB with cys gene promoters, including DNA bending and inducer response, is relatively well understood. This offers the tool for in vitro comparisons of properties of CysB mutants versus the wild-type protein. Second, the CysB protein is so far the only family member whose cofactor-binding domain (amino acids 88-324) has been crystallized and subjected to three-dimensional analysis (20). The structure of the dimer formed by CysB monomer fragments (amino acids 88-324) has shed some light on protein surfaces composing an inducer- and anti-inducer-binding cavity. However, the structure lacking the 87 N-terminal amino acids provide little information about the overall organization of the native tetrameric protein. Third, in some promoters of E. coli, including the tau promoter (21) and the ssu promoter (22), CysB acts in conjunction with another LysR-type activator, Cbl, which itself is highly homologous to CysB (23). The molecular basis of cooperation of these two proteins is not yet understood. A systematic mutational analysis of CysB might give further insight into the structure of this protein and related LysR family members and provide a valuable complement to the information gained from physicochemical studies. Here we describe the properties of several CysB variants resulting from single amino acid substitutions in the N-terminal and central regions of the protein as well as those resulting from C-terminal truncations. On the basis of the effects of these mutations on the repressing and activating functions of CysB in vivo and the DNA binding characteristics of selected CysB mutants in vitro, we discuss regions of the protein involved in DNA binding, inducer response, oligomerization, and possible RNA polymerase recruitment.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Bacterial Strains and Growth Conditions-- The E. coli strains and basic plasmids used in this study are listed in Table I. All strains were grown at 37 °C in either LB medium or sulfur-free minimal medium (24) supplemented with glucose (0.2%), tryptophan (4 µg/ml), and a sulfur source. Sulfate (0.5 mM) was used as a sulfur source in solid media, and L-djenkolic acid (1 mM) served as non-repressing sulfur source in liquid media for beta -galactosidase assays. When required, the growth media contained ampicillin (100 µg/ml), chloramphenicol (20 µg/ml), or kanamycin (50 µg/ml). The solid media (LB agar with X-gal or MacConkey/lactose agar) were used for selection of transformants of the desired phenotype.

DNA Manipulations-- Plasmid DNA preparation, restriction enzyme digestion, and transformation were performed according to published procedures (25). Plasmid DNA was purified with QIAGEN midi-columns. Restriction endonucleases, DNA-modifying enzymes, and Taq polymerase were purchased from Life Technologies, Inc. and Promega and were used according to the manufacturers' recommendations. The dideoxy chain termination method (26) was used to sequence the cysB region from plasmid templates. Most sequences were obtained using an ABI PRISM 377 DNA sequencer, and some plasmids were sequenced manually using a sequencing kit and alpha -35S-dATP (both from Amersham Pharmacia Biotech).

Construction of the Delta cysB Mutant-- Deletion within the cysB gene was created by excision of the 821-bp NruI/HpaI fragment encompassing the promoter region and 216 codons of the cysB open reading frame (see Fig. 1) from plasmid pMH148, containing the 2.8-kilobase pair EcoRI/EcoRV fragment of pJOH2 cloned in pUC18 EcoRI/HincII. The deletion was tagged by insertion of a Kanr cassette excised from pUC4KIXX as a 1.35-kilobase SmaI fragment. The resulting plasmid, pMH161, was linearized and transformed into E. coli JC7623. Kanr Aps transformants were selected, and correct replacement of the cysB gene in the genomic DNA was confirmed by PCR analysis. The Delta cysB::kan mutation was transferred to other E. coli strains (see Table I) by P1-mediated transduction.

Oligonucleotides and Plasmid Constructions-- The 3'-coordinates indicated for all cysB-specific oligonucleotides used in this study are consistent with those of the published cysB sequence (27), where +1 indicates A in the ATG start codon. Nucleotides that had been changed to create restriction sites, stop codons, or specific mutations are shown in boldface. Primers ECCB3 (CCCAAGCTTTTTTTCTTCACACCTATACA-3', -123) and ECCB4 (CATGCATGCGGTAATTAGACACTACTT-3', +1101, complementary strand) were used for PCR amplification of the wild-type E. coli cysB gene from the pJOH1 plasmid. The fragment obtained was cleaved with HindIII/SphI and inserted into pBR322 HindIII/SphI to give plasmid pMH147. Plasmids pMH189, pMH191, pMH193, pMH195, pMH222, pMH223, pMH224, pMH225, pMH226, pMH228, and pMH229 are derivatives of pMH147 obtained by random mutagenesis and contain point mutations within cysB (see Table II). Plasmids pMH190, pMH192, pMH194, pMH196, and pMH197 were obtained from pMH189, pMH191, pMH193, pMH195, and pMH147, respectively, by excision of the HindIII/SphI fragments (containing the cysB region) and their insertion into HindIII/SphI-cleaved pACYC184. Primers ECCB8 (GGAATTCTAAGTGGATGGTTTAACA-3', +1) and ECCB9 (AAACTGCAGGCGGTAATTAGACAC-3', +1106, complementary strand) served to amplify the promoterless cysB gene on the pJOH1 template, and the PCR product was cleaved with EcoRI/PstI and placed under the ptrc promoter in pTrc99A cleaved with EcoRI/PstI to give plasmid pMH199. Plasmid pMH199 served for overproduction of WT CysB. To overproduce CysB mutant proteins, plasmids pMH200, pMH201, pMH202, pMH203, and pMH205 were obtained by replacement of the 653-bp SmaI/BamHI fragment (see Fig. 1) of pMH199 with the SmaI/BamHI fragments excised from plasmids pMH189, pMH191, pMH193, pMAH01, and pMAH2, respectively. To construct C-terminally truncated CysB variants, oligonucleotide ECCB13 (TTACGTCCGGTTAGGGC-3', +712) was used as an upper primer, and oligonucleotides ECCB14 (AAACTGCAGTTATTAATCAACGACATCACGCGT-3', +886, complementary strand), ECCB15 (AAACTGCAGTTAAGAGCGCAATGCGAC-3', +910, complementary strand), and ECCB16 (AAACTGCAGTTATATATCTTTAAACATG-3', +942, complementary strand) were used as lower primers for PCR amplification of 3'-terminal fragments of cysB from the pJOH1 template. The PCR fragments were cleaved with BamHI-PstI and ligated with the pMH199 fragment obtained by excision of the 3'-portion of the WT cysB region (as a 377-bp BamHI/PstI fragment) to give plasmids pMH214, pMH215, and pMH217 (serving for overproduction of the corresponding CysB mutant proteins). Plasmids pMH231, pMH232, and pMH233 were obtained by replacement of the BamHI/SphI fragment of pMH147 (containing the 3'-portion of WT cysB) with the BamHI/SphI fragments excised from pMH214, pMH217, and pMH215, respectively. Other plasmids carrying truncated cysB (pMH218, pMH219, and pMH230) were obtained as follows. The BamHI/PstI fragment of pMH199 (containing the 3'-portion of WT cysB) was inserted into pUC19, and the insert was amplified by PCR with pUC-specific forward and reverse primers under mutagenic conditions (28). The PCR product was cleaved with BamHI/SphI and ligated with pMH147 devoid of the corresponding BamHI/SphI region. The ligation mixture was transformed into the EC2549 strain, and the transformants unable to grow on minimal sulfate plates were selected (3 of ~2000) and used to recover the corresponding plasmids. Mutations resulting in C-terminal truncations of CysB are listed in Table II. To introduce the Y27G substitution into CysB, primers ECCB8 and ECCB19 (GATCCCGGGTTGTGAGGTACCAAGTCCTTCCGC-3', +67, complementary strand) were used for PCR amplification of DNA fragment from the pJOH1 template. The fragment obtained was cleaved with EcoRI/SmaI and used to replace the corresponding 113-bp EcoRI/SmaI fragment (see Fig. 1) of pMH199 to give plasmid pMH235. Plasmid pMH303, containing the translational fusion cysB'::'lacZ, was constructed as follows. The 450-bp BamHI/SmaI fragment (see Fig. 1), containing the cysB promoter and 30 codons of the cysB open reading frame, was excised from pJOH1 and inserted into pUC18 BamHI/HincII. The cysB region was recovered as a BamHI/PstI fragment and inserted into pNM482 cleaved with BamHI/PstI to give pMH302. The cysB'::'lacZ region was excised from pMH302 as a 5.5-kilobase EcoRI/StuI fragment and cloned in the low-copy vector pHSG576 cleaved with EcoRI/SmaI to give pMH303. Primers ECCB3 and ECCB11 (GTGCTTGCCGCTTCGGGA-3', +148, complementary strand) served to amplify the cysB promoter fragment from the pJOH1 template for DNA binding assays.

Primers ECCP1 (ATTGATGGCGGCAGCACACT) and ECCP2 (GACCAGCGCGAGTGAGTTCT, complementary strand) were used to amplify the cysP promoter region (from positions -321 to +72 relative to the transcription start site) from the pMH1822 template.

Random Mutagenesis of cysB-- Mutagenesis with hydroxylamine was carried out essentially as described (29). Briefly, ~1 µg of purified pMH147 was mixed with 50 µl of solution containing freshly prepared 1 M hydroxylamine, 50 mM sodium pyrophosphate, 100 mM NaCl, and 2 mM EDTA (pH 7.0) and incubated at 75 °C for 45 min. The samples were dialyzed extensively against Tris/EDTA buffer (pH 7.6), and DNA was precipitated with ethanol and used to transform the EC2266 strain. Plasmid pMH147 was also used to transform the E. coli mutator strain mutD5. The transformants obtained were rinsed off the plates, and the plasmid DNA was re-isolated and used to transform the EC2266 strain. Transformants were screened for the desired phenotype on LB agar plates containing X-gal or on MacConkey/lactose agar plates.

Enzyme Assays-- beta -Galactosidase activities were assayed in cells taken from mid-log phase cultures grown on minimal medium with L-djenkolic acid as a derepressing sulfur source according to the method of Miller (30) with o-nitrophenyl galactoside as a substrate. Duplicate assays were performed for each culture and were repeated at least three times.

Preparation of CysB-overproducing Extracts-- E. coli extracts were prepared from strain DH5alpha containing plasmid pMH199 (WT cysB) or plasmids (derivatives of pTrc99A) encoding mutant alleles of cysB. Transformed cells were grown on LB/ampicillin, and isopropyl-beta -D-thiogalactopyranoside was added (0.5 mM final concentration) in the early exponential phase (A600 = 0.15). Growth was continued for a further 2 h, and cells were harvested and resuspended in buffer A (50 mM Tris-Cl (pH 7.5), 1 mM disodium EDTA, and 1 mM phenylmethylsulfonyl fluoride). Cell suspensions were sonicated on ice, and cellular debris was removed by centrifugation at 16,000 × g for 30 min at 4 °C. The supernatants were fractionated by streptomycin sulfate precipitation and ammonium sulfate precipitation as described previously (15), and fractions precipitated with ammonium sulfate (229 mg/ml) were dissolved in buffer A. All preparations in which the CysB protein was successfully overproduced served as a source of CysB proteins in DNA binding experiments. Highly purified CysB protein from Salmonella typhimurium (obtained from N. M. Kredich) was used as a reference for the E. coli WT CysB preparation in DNA binding and transcription runoff experiments.

DNA Binding Assays-- DNA fragments containing the cysP and cysB promoter regions were generated by PCR (see "Oligonucleotides and Plasmid Construction"), 5'-labeled with [gamma -32P]ATP using T4 polynucleotide kinase (Promega), and purified with QIAquick spin columns (QIAGEN). Conditions for binding reactions and electrophoretic mobility shift assay (EMSA) were essentially as described (17). Briefly, the reaction mixtures (20 µl) contained ~10 ng of labeled DNA fragment and 50 ng of sonicated calf thymus DNA (to reduce nonspecific binding) in CysB buffer consisting of 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 100 mM KCl, 1 mM dithiothreitol, and 100 µg/ml bovine serum albumin. Incubation (5 min at 37 °C) was initiated by including a given amount of CysB preparation and O-acetyl-L-serine where indicated. Samples were separated on 5% acrylamide/bisacrylamide (82:1) vertical gels in 0.05 M Tris borate/EDTA buffer (pH 8.3) for 1.5 h at 10 V/cm, and the radiolabeled bands were visualized by autoradiography. Although N-acetyl-L-serine is a better inducer of CysB-dependent transcriptional activation than O-acetyl-L-serine, the latter was shown to function better in EMSA experiments (19). The differences between the two are mostly operational and have been discussed in detail previously (14); the inducer is referred to as acetylserine below.

In Vitro Transcription Runoff Assay-- The DNA fragment containing the E. coli cysP promoter used as a template for in vitro transcription was the same as that used for DNA binding experiments. Transcription initiation complexes were formed in 20-µl mixtures containing ~20 ng of template DNA, the indicated amounts of purified S. typhimurium or E. coli CysB preparations and O-acetyl-L-serine or N-acetyl-L-serine, 1 µg of nuclease-free E. coli RNA polymerase (Amersham Pharmacia Biotech) in CysB buffer containing 0.1 mM ATP. After 5 min at 37 °C, transcription elongation was started by adding 2 µl of a solution containing 20 µM [alpha -32P]CTP (200 Ci/mmol), 2 mM ATP, 2 mM GTP, 2 mM UTP, and 0.5 mg/ml sodium heparin. After another 5 min at 37 °C, the reaction was terminated by the addition of 0.2 ml of 10 mM disodium EDTA containing 50 µg/ml yeast tRNA. Ethanol-precipitated radiolabeled transcripts were analyzed on sequencing gels.

Molecular Modeling-- The homology model of E. coli CysB has been built on the basis of the crystal structure of CysB from Klebsiella aerogenes (fragment 88-324; Protein Data Bank code 1AL3) by simple replacement of different residues and energy minimization using consistent valence force field (CVFF) force field as implemented in DISCOVER Version 2.3.5 (MSI/Biosym, San Diego, CA). N-Acetyl-L-serine has been inserted in the CysB structure according to Tyrrell et al. (20).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Isolation and Initial Characterization of Random cysB Mutants-- Assuming that the lack of positive control function of CysB can result from mutations impairing DNA-binding ability, inducer response, or RNA polymerase contacts, we used the cysPT'::lacZ cysB strain (EC2266) (Table I) for selection of cysB mutants contained on plasmids. Since the expression of beta -galactosidase in EC2266 is under the control of the CysB-dependent cysP promoter, the strain yielded white colonies on LB agar plates containing X-gal and dark-blue colonies in the presence of plasmid pMH147 carrying WT cysB. After transformation of EC2266 with several samples of mutagenized pMH147, 32 white or pale-blue transformant colonies were selected. To determine the location and nature of the mutations, the cysB genes contained on plasmids were sequenced entirely. This allowed us to exclude mutants resulting from generation of an early termination codon within the cysB open reading frame (with the exception of the Q5Ter mutant, which served as a control in some experiments) and several mutants resulting from identical nucleotide change. Ten plasmids containing cysB with mutations that caused single residue substitutions within the CysB protein (Table II) were analyzed further. None of these plasmids complemented the Cys- phenotype of two cysB strains tested (Table II). To distinguish between repressing and non-repressing cysB mutants, the corresponding plasmids were screened for their ability to affect the expression of the translational cysB'::'lacZ fusion, encoded by the low-copy number plasmid pMH303 in the Delta cysB background (EC2549 strain). As shown in Table II, the presence of WT cysB reduced the expression of beta -galactosidase in this strain to ~4%. Decreased levels of cysB'::'lacZ expression (2.6-5.6%) were also observed with four plasmids encoding CysB variants M160I, T196I, A244V, and A247E. The same mutants cloned in pACYC184 reduced to ~5% the expression of the chromosomal fusion cysB'::Mud1(Ap,lacZ) in strain EC1171 (data not shown). We concluded that repressing CysB proteins M160I, T196I, A244V, and A247E (positions of mutations shown in Fig. 1) expressed from these plasmids retained a DNA-binding ability. The remaining six CysB variants with single residue substitutions in the N-terminal portion of the protein (region 11-48 containing the HTH motif and its close vicinity; see Fig. 1) were defective to various extents in the repression of the cysB'::'lacZ fusion (Table II). These variants were therefore assumed to be impaired in DNA binding. The repressing activities of plasmids carrying cysB mutants were also measured in strain EC1250 containing pMH303. The beta -galactosidase activity in this strain represents partially repressed level of cysB'::'lacZ expression resulting from the activity of chromosomally encoded WT CysB; this value has been estimated as ~2.5 times lower than that in the EC2549 strain containing pMH303. The presence of plasmids encoding some of the non-repressing CysB variants (E11K, S20L, and T22I) in the pMH303-containing EC1250 strain resulted in elevation of the cysB'::'lacZ expression to 230-270% of the level characteristic for the strain (Table II). The effect observed could be consistent with the assumption of negative dominance of CysB proteins expressed from plasmids over chromosomally encoded WT CysB. In contrast, a plasmid expressing no CysB (Q5Ter mutant) and plasmids encoding CysB variants I48T, L44T, and E41K showed no such dominant-negative effect, as they did not change the level of cysB'::'lacZ expression in EC1250. We noticed that all four repressing and three non-repressing (E11K, S20L, and T22I) variants expressed from multicopy plasmids converted the wild-type strain EC1250 to the Cys- phenotype (Table II). We also checked three representative mutants of this group cloned in middle-copy plasmids (derivatives of pACYC184) for their effect on the expression of the chromosomal cysPT'::lacZ fusion in the EC2256 strain, WT for cysB. As shown in Fig. 2, plasmids carrying those cysB mutants markedly reduced beta -galactosidase levels in EC2256, confirming the dominant-negative effects of mutant proteins expressed from plasmids over the WT CysB protein produced by the cell. Knowing that WT CysB is a tetramer, the trans-dominance of the multicopy CysB mutant forms may be explained by titration of WT CysB monomers and formation of inactive mixed hetero-oligomers. Therefore, it seems that none of the mutations altering residues 11, 20, 22, 160, 196, 244, and 247 abolished the oligomerization ability of CysB. In contrast, CysB variants E41K, L44R, and I48T expressed from plasmids did not confer the Cys- phenotype to the EC1250 strain and had no effect on expression of the cysB'::'lacZ fusion in the pMH303-containing EC1250 strain (Table II). Therefore, mutations in region 41-48 of CysB could affect oligomerization of the protein (see also "Discussion").


                              
View this table:
[in this window]
[in a new window]
 
Table I
Bacterial strains and plasmids
Only vectors and basic plasmids are listed. Details for construction of plasmids carrying cysB genes with point mutations and 3'-terminal truncations are described under "Materials and Methods." Relevant cysB mutants investigated in this study are listed in Table II.


                              
View this table:
[in this window]
[in a new window]
 
Table II
Summary of characteristics of cysB mutants



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1.   Distribution of the CysB mutations investigated in this study. The position of the HTH motif (residues 18-38) in CysB (residues 1-324) is indicated according to Ostrowski et al. (27). Regions proposed to be involved in the inducer response of some LTTRs (2) are shown as gray boxes, and such an additional region found for CysB is shown as a black box. The positions of the C-terminal truncations (removing 5, 16, 19, 23, 26, and 30 residues) are indicated by vertical bars. The upper part of this figure presents our interpretation of the functional regions of CysB drawn on the basis of defects caused by particular mutations. The chromosomal region containing cysB with restriction sites (positions relative to A of the ATG start codon of cysB) relevant for construction of the plasmids used in this study is shown below. Restriction sites that were introduced by PCR are shown in brackets.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   Dominant-negative effect of cysB mutants in the cysB+ strain. Expression of the chromosomal cysPT'::lacZ fusion was measured as beta -galactosidase activity in the EC2256 strain in the presence cysB mutants on plasmids (derivatives of pACYC184) pMH190 (CysB A244V), pMH192 (CysB A247E), pMH194 (CysB T196I), and pMH197 (WT CysB).

Construction and Phenotypic Characterization of C-terminally Truncated CysB Mutants-- The collection of CysB mutants isolated by random mutagenesis lacked representatives with changes in the C-terminal part of the protein. According to the structural model of the CysB dimer (20), 33 C-terminal amino acids (positions 292-324) form the loop exposed to the surface containing two helices. Therefore, this domain might be important for the overall structure of the native CysB molecule and its function. To pursue the possible effects of C-terminal mutations, we employed several approaches to construct mutated and/or truncated forms of CysB (see "Oligonucleotides and Plasmid Construction"). Six plasmids were obtained that encoded CysB variants lacking 5, 16, 19, 23, 26, or 30 C-terminal residues of the WT protein. Among these, only the CysB K320Ter variant conferred the Cys+ phenotype to both cysB-negative strains tested, EC2275 and EC2549. CysB K320Ter showed also significant repressing activity in relation to the cysB'::'lacZ fusion in the Delta cysB strain, and it was able to activate the cysPT'::lacZ fusion to the level observed with WT CysB (Table II). Therefore, it appears that CysB K320Ter, lacking 5 C-terminal residues, retained sufficient activity for all CysB functions in vivo. All further truncated CysB variants (lacking 16-30 C-terminal residues) were apparently not fully functional since plasmids carrying the corresponding cysB mutant genes did not complement the Cys- phenotype of the Delta cysB strain EC2549. Among these, the CysB protein lacking 16 C-terminal amino acids (CysB N309Ter) showed a reduced repressing activity but almost wild-type positive control activity in vivo as measured with the cysB'::'lacZ fusion in the pMH303-containing EC2549 strain and with the cysPT'::lacZ fusion in the EC2559 strain, respectively. All further truncated CysB variants displayed no repressing activity and significantly reduced positive control function in the same tests (Table II). However, plasmids encoding CysB variants lacking 19-30 C-terminal amino acids showed a curious complementation activity in strain EC2275 (cysB), observed as the appearance of a few transformant colonies over the background of abortive growth on minimal plates with sulfate. The presence of these plasmids in strain EC2266 (cysPT'::lacZ cysB) resulted in the appearance of a mixed population of transformants on MacConkey/lactose solid medium, seen as a few red colonies on the overall white background of bacterial growth. Because of this type of growth, beta -galactosidase activities of EC2266 with these plasmids could not be reliably established. The cysB mutation, present in both the EC2275 and EC2266 strains, derives from the NK1 strain, in which it was identified as the single substitution I33N (37). It seems that some arrangement of subunits between CysB I33N and C-terminally truncated CysB variants allows formation of a protein able to positively control the cysP promoter. Our attempts to overproduce CysB mutants lacking >16 C-terminal residues for in vitro experiments failed, which may suggest an instability of these CysB variants. It is therefore possible that the C terminus contributes to the overall stability of the protein, and the instability of the C-terminally truncated CysB variants might explain the observed abortive complementation of the CysB I33N mutation.

DNA Binding Characteristics of Repressing and Constitutive CysB Variants-- E. coli WT CysB and those CysB mutants that displayed repressing activity in vivo were cloned in the pTrc99A vector and overexpressed, and obtained extracts were fractionated as described under "Materials and Methods." The extent of CysB overproduction in particular preparations was estimated by SDS-polyacrylamide gel electrophoresis (Fig. 3). The DNA binding characteristics of the E. coli WT CysB preparation used in this work (referred to as E. coli WT CysB) were tested by EMSAs with a 393-bp DNA fragment containing the E. coli cysP promoter region (pcysP). The complexes formed by E. coli WT CysB with pcysP, shown in Fig. 4A, could be identified by strict correspondence to those formed by highly purified S. typhimurium CysB, analyzed in detail previously (16, 18). When a single CysB tetramer binds to pcysP, it induces DNA bending of ~100° in the absence of acetylserine and of ~50° in its presence, giving rise to "slow" (C1s) and "fast" (C1f) primary complexes, respectively. The C1f (fast) primary complex represents a preferential interaction of the CysB tetramer with the single activatory site located just upstream of the -35 region of the promoter. The inducer responsiveness of CysB can therefore be monitored by EMSA as a qualitative (mobility) and quantitative (amount) alteration of the primary complex (Fig. 4A, compare lanes 2 and and lanes 5 and 6). We used EMSA to test three non-repressing CysB variants (A244V, A247E, and T196I) for DNA binding characteristics with pcysP. The results of this analysis showed that all three proteins formed complexes with pcysP (Fig. 4, B and C), but the mobilities of C1 complexes were unaffected by acetylserine. For CysB variants A244V and T196I, these mobilities were exactly the same as that of WT CysB in the absence of inducer (Fig. 4, B, compare lanes 3 and 5-7; and C, compare lanes 3 and 8-10). In the case of CysB A247E, the C1 complex showed an intermediate mobility between slow and fast, irrespective of the presence of acetylserine (Fig. 4C, lanes 5-7), although the amount of complex was higher with the inducer. It should be stressed that none of the tested mutants, T196I, A244V, and A247E, was able to respond to the inducer by a qualitative change in the DNA-protein complex (reflected by complex mobility), which is critical for transcriptional activation of the promoter by WT CysB. Defects in inducer responsiveness observed in DNA binding studies correlated with the inability of corresponding CysB mutants to activate expression of the cysP promoter (as the cysPT'::lacZ fusion) in vivo. Earlier studies on the autoregulatory function of S. typhimurium CysB (19) revealed that acetylserine reduces the affinity of the protein for a particular "repressory" binding site in the cysB promoter region. We have shown by EMSA (Fig. 5) that interaction of E. coli WT CysB with pcysB displayed the same characteristics, i.e. there was less complex formed by a given amount of CysB in the presence of acetylserine than in its absence. In contrast, CysB mutant derivatives T196I, A244V, and A247E formed similar amounts of complex with the cysB promoter fragment, irrespective of the presence of inducer. This result further confirmed the involvement of CysB residues 196, 244, and 247 in response to the inducer and the non-inducible character of the T196I, A244V, and A247E variants.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3.   Overproduction of E. coli WT CysB and CysB mutants as estimated by SDS-polyacrylamide gel electrophoresis. Cell extracts enriched with particular CysB variants are shown as follows: lane 1, WT CysB (overproduced from plasmid pMH199); lane 2, CysB A244V (plasmid pMH200); lane 3, CysB A247E (plasmid pMH201); lane 4, CysB T196I (plasmid pMH202); lane 5, control extract with no CysB (vector pTrc99A); lane 6, CysB N309Ter (plasmid pMH217); lane 7, CysB Y27G (plasmid pMH235); lane 8, CysBc A227D (plasmid pMH203); lane 9, CysBc Y164N (plasmid pMH205); lane 10, molecular mass markers (in kDa). 44 µg (lanes 1, 3-5, and 7-9) or 25 µg (lanes 2 and 6) of total protein were loaded on the gel. Arrowheads indicate the positions of full-length CysB and truncated CysB (lane 6).



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4.   Binding of CysB protein variants to the cysP promoter region as measured by EMSA. The 5'-labeled 393-bp DNA fragment extending from positions -321 to +72 relative to the transcription start site of cysP was incubated with the indicated amounts of particular CysB preparations (CysB-enriched protein extracts shown in Fig. 3) and 10 mM O-acetyl-L-serine (OAS) where indicated. Use of O-acetyl-L-serine instead N-acetyl-L-serine is explained under "Materials and Methods." Mixtures were run on 5% polyacrylamide gels, and the radiolabeled bands were visualized by autoradiography. A, DNA binding characteristics of wild-type E. coli CysB (wtE.c.) and purified S. typhimurium CysB (wtS.t.); B-E, DNA binding of E. coli WT CysB and CysB variants with the indicated mutations. Primary complexes (C1s (slow), C1f (fast), and C1f* (super fast)) and secondary complexes (C2) are described under "Results." No shifted band was detected with a control extract obtained from cells containing vector pTrc99A (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 5.   Binding of CysB protein variants to the cysB promoter region in EMSA. The 5'-labeled 308-bp DNA fragment containing the E. coli cysB promoter region (from positions -143 to +165 relative to the translation start codon) was used as a probe. Experimental conditions are identical to those described in the legend to Fig. 4. OAS, O-acetyl-L-serine.

We also analyzed three cysB mutants obtained previously in our laboratory and characterized as causing constitutive expression of sulfite reductase and O-acetylserine sulfhydrylase in E. coli (32). Sequencing of these mutants (cysBc301, cysBc302, and cysBc303) identified the single amino acid substitutions A227D, Y164N, and Y197S, respectively, in encoded proteins (Fig. 1 and Table II). Plasmids carrying cysBc mutants displayed wild-type repressing and activating functions in vivo in tests summarized in Table II, but they conferred constitutive (not inhibited by cysteine) expression of the cysPT'::lacZ fusion in strain EC2266 (data not shown). Two of the CysBc variants, Y164N and A227D, were overproduced, and they were characterized in EMSA with the cysP promoter fragment. The CysBc Y164N protein formed a fast primary complex (C1f) with pcysP in the absence of acetylserine, and the mobility of this complex corresponded exactly to that of the complex formed by WT CysB in the presence of inducer (Fig. 4D, compare lanes 4 and 5). It therefore seems that CysBc Y164N was able to adapt the conformation suitable to interact with an activatory site in pcysP without the aid of the inducer. However, an influence of acetylserine on CysBc Y164N could be noticed as a quantitative effect on C1 complex formation and a further subtle increase in complex mobility (Fig. 4D, compare lanes 5 and 6). This result suggests that CysB Y164N, albeit active in vivo without the inducer, can still respond to it. It is possible that acetylserine induces some conformational change in CysBc Y164N allowing formation of a complex in which DNA is bent less than in the fast complex formed by WT CysB. The complex formed by the other CysBc variant, A227D, showed an unexpectedly higher electrophoretic mobility than complexes formed by WT CysB and CysBc Y164N (Fig. 4D, lanes 7 and 8), and acetylserine affected neither the mobility of this "super fast" complex (C1f*) nor its amount. A secondary complex formed by CysBc A227D was detected (Fig. 4, D, lane 8; and E, lane 5), whose mobility was comparable to that of WT CysB without inducer. The secondary complex (C2) formed by WT CysB is shown in Fig. 4D (lane 3), and a similar C2 complex formed by the CysB T196I variant is shown in Fig. 4C (lane 9). As established by previous stoichiometry studies (16), the C2 complex of WT CysB results from binding of two CysB tetramers in two separate binding sites within pcysP. Considering the differences in mobility between complexes formed by the A227D variant and those of WT CysB, it is tempting to conclude that the A227D protein might bind DNA as a dimer, forming a super fast primary complex.

Among the C-terminally truncated CysB variants, CysB K320Ter was not tested further, as its phenotypic characteristics were similar to those of WT CysB. Of further truncated CysB mutants, only one, CysB N309Ter, could be overproduced to an amount sufficient for DNA binding experiments. The corresponding extract enriched with CysB N309Ter was tested in EMSA using the cysP promoter. As shown in Fig. 4E (lanes 7-9), this protein was able to bind pcysP, forming a complex of much higher mobility than that of WT CysB. Interestingly, the mobility of this super fast complex (C1f*) was comparable to that of the complex formed by CysBc A227D. The plasmid encoding CysB N309Ter (and other plasmids encoding truncated CysB variants) displayed no dominant-negative effect on the Cys phenotype of WT strain EC1250 (Table II) and did not reduce the beta -galactosidase level in the EC2256 strain (data not shown). The lack of a dominant-negative effect on WT CysB in vivo can be most easily explained by an oligomerization defect in CysB N309Ter and the other C-terminally truncated variants. Consequently, we can hypothesize that CysB N309Ter and CysBc A227D bound DNA as dimers because complexes formed by these proteins with the cysP promoter displayed a similar mobility (see also "Discussion"). However, in contrast to CysBc A227D, CysB N309Ter could not perform all functions of WT CysB in vivo, as it was unable to complement the cysteine requirement of the Delta cysB mutant strain.

Construction and Characteristics of the Putative CysBpc Mutant-- One of the objectives of this study was to identify single amino acid substitution(s) in CysB that result in the loss of transcriptional activation of the cys promoter, but not loss of both DNA binding and inducer response. By these criteria, none of the cysB mutants described above could be regarded as defective specifically in "positive control" function. In one of the attempts to isolate a CysBpc mutant (where pc is positive control), we took advantage of the recent study on LysR-type GcvA protein (36) suggesting that single residue substitutions F31L and F31A in the recognition helix of the HTH motif are responsible specifically for the positive control function of GcvA. Since Phe31 of GcvA corresponds to Tyr27 of CysB in alignment of the putative HTH regions of these proteins, we introduced the mutation changing Tyr27 of CysB to Gly by site-directed mutagenesis (see "Oligonucleotides and Plasmid Construction"). The plasmid expressing CysB Y27G showed the wild-type level of repression of the cysB'::'lacZ fusion, but was not able to activate the expression of the cysPT'::lacZ fusion (Table II). The Y27G variant was overproduced and used for DNA binding assay with the cysP promoter fragment. As shown in Fig. 6A, CysB Y27G was able to bind the cysP promoter region, giving rise to slow (C1s) and fast (C1f) primary complexes seen in the absence (lanes 6 and 7) and presence (lanes 8 and 9) of acetylserine, respectively. Therefore, the Y27G mutation apparently did not abolish the ability of CysB to respond to the inducer by a qualitative change in the DNA-protein complex. The mobilities of the slow and fast primary complexes formed by CysB Y27G were, however, different than those of the respective complexes formed with WT CysB; the similar differences concerned also migration of secondary complexes (C2). The reason for this discrepancy is not clear at present, and some differences in overall tertiary structure between WT CysB and the Y27G variant may be only hypothesized. To further characterize the CysB Y27G protein, we tested its activity versus WT CysB in a transcription runoff assay with the cysP promoter. At first, we compared the activity of the E. coli WT CysB preparation (used in all DNA binding tests in this study) with that of purified S. typhimurium CysB. As shown in Fig. 6B, the synthesis of identical transcripts was stimulated with both CysB preparations in the presence of O-acetylserine. The sizes of two major runoff products, 73 and 66 nucleotides, corresponded to transcription start sites at positions -1 and +6, respectively, relative to the major in vivo start site of the E. coli cysP promoter. The appearance of multiple transcripts in the runoff experiment using the E. coli cysP promoter region is not surprising, as it was also observed with the S. typhimurium cysP promoter, in which two major runoff products (corresponding to transcription start sites at positions -2 and +5 relative to the in vivo transcription start site) and several minor products were synthesized (18). In contrast to WT CysB, the CysB Y27G mutant protein showed very low activity in an analogous runoff assay (Fig. 6B). It should be noted that CysB Y27G was even more active than WT CysB in the DNA binding assay (Fig. 6A) when both preparations were used at equal protein concentrations. We therefore assume that the lack of activity of Y27G in the transcription assay in vitro could not result from an inadequate protein amount or its low stability. On the basis of these data, we conclude that the Y27G mutation abolished the positive control function of CysB, leaving the DNA-binding and inducer response functions unaffected.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 6.   Comparison of the DNA binding and transcriptional characteristics of WT CysB and the CysB Y27G variant. A, shown is the binding of WT CysB and the CysB Y27G mutant protein to the cysP promoter region as measured by EMSA. Conditions of the experiment are similar to those described in the legend to Fig. 4. B, transcription runoff assays were performed with the cysP promoter (fragment -321 to +72), the indicated amounts (µg/ml) of CysB proteins (wild-type purified S. typhimurium CysB (wt S.t.) and extracts enriched with WT E. coli CysB (wt E.c.) or CysB Y27G), and 10 mM O-acetyl-L-serine (OAS) or 1 mM N-acetyl-L-serine (NAS) where indicated. Transcripts were sized according to the sequencing reaction performed with the pMH1822 template and the 5'-32P-labeled primer ECCP2 (lanes A, C, G, and T).



    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we analyzed the properties of 20 newly isolated CysB mutants to define roles of particular protein regions (see Fig. 1 for proposed functional map of CysB).

Regions Important for DNA Binding-- In addition to the previously identified mutations S34R (14) and I33N (37), six new mutations were obtained that are clustered in region 11-48. All of these mutations impaired the ability of CysB to negatively autoregulate and also to activate the cysP promoter. Therefore, it seems clear that the predicted helix-turn-helix motif (residues 18-38) of CysB (13) and its close vicinity are crucial for the DNA-binding function. Most of the N-terminal residues identified in CysB as important for DNA binding are highly conserved among LTTRs. It was proposed (9) that highly conserved amino acids contact conserved base pairs of a generic TN11A motif present in the binding sites for most LTTRs (38). Some CysB residues (i.e. Glu11 and Thr22) are poorly conserved in other LysR family members; these residues may therefore confer the specificity of DNA-CysB interactions. We found that a C-terminal region of CysB may be also critical for the DNA-binding function, as removal of 19-30 C-terminal residues resulted in loss of repressing ability of the protein in vivo. The possible involvement of the C-terminal region in DNA binding places CysB in one subclass of LTTRs along with AmpR (8), NahR (7), and OxyR (9), in contrast to other subclass of LTTRs, i.e. MetR (39) and Nac (40), which tolerate substantial C-terminal truncations. The role of the C-terminal end of CysB in DNA binding may be indirect, as truncations of 19 and more residues apparently affect the stability of the protein and possibly its oligomerization state (see below).

Regions Involved in Inducer Recognition/Response-- It was shown previously that substitutions T149M/P and W166R result in constitutive or partially constitutive activity of CysB, respectively (41). We have identified seven additional residues of CysB (Fig. 1) that may contribute to inducer binding and response. Non-inducible CysB variants were unable to respond to the inducer, acetylserine, by the conformational change that allows the transition of the slow DNA-protein complex to the fast complex, of which only the latter represents the structure required for transcriptional activation of the cysP promoter (16, 18). The interaction of these CysB variants with the cysB promoter region was also unaffected by acetylserine, in contrast to wild-type CysB, whose binding to pcysB was inhibited by the inducer. One of the constitutive CysB variants examined in this study (CysBc Y164N) formed the fast complex with the cysP promoter region independently of the presence of inducer. The characteristics of this mutant correlated well with those described for CysBc T149M (41). More interestingly, the other CysBc variant, A227D, formed a super fast complex with the cysP promoter, suggesting a different oligomerization state of this mutant protein compared with that of WT CysB. Although attempting to evaluate the nature of the super fast complex is speculative without stoichiometry data, two arguments allow us to favor the possibility that the protein binds DNA as a dimer. First, a similar super fast complex was also observed with the CysB N309Ter variant, whose other characteristics suggested an oligomerization defect. Second, another LysR family protein, OxyR, may serve as a precedent, as its wild-type form is tetrameric, but the constitutive A233V variant binds DNA as a dimer (9). The fact that CysBc A227D was fully functional in vivo also suggests that the tetrameric structure of CysB may be nonessential for the activatory function of the protein.

Four mutations affecting the response of CysB to acetylserine fit in regions 95-173 and 196-206, respectively (Fig. 1), suggested to be responsible for the inducer response in several LTTRs (2). Three remaining mutations were localized closer to the C-terminal part of the protein. The importance of this additional region (residues 227-255) for inducer recognition/response is also illustrated by mutations described more recently for OxyR (constitutive variants A233V/T and G253K) (4) and NahR (variant R248C) (5). The amino acid residues whose substitution results in either non-inducible or constitutively active CysB variants are presented in the model of E. coli CysB (Fig. 7). As can be seen, all these residues (perhaps with the exception of Met160) are localized in the neighborhood of the cavity, which is believed to be an acetylserine-binding pocket (20).



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 7.   Model of E. coli CysB monomer fragment 88-324 showing residues important for inducer recognition/response. The inducer N-acetyl-L-serine was inserted in the presented structure according to Tyrrell et al. (20) and is shown in ball and stick representation in green. Residues identified in this study whose mutations led to non-inducible CysB proteins are indicated in blue. Residues whose alterations resulted in constitutive activity of CysB are shown in yellow; among these, residues 149 and 166 investigated previously (41) are also included.

We performed molecular modeling to compare the structure of the WT CysB dimer with that of either non-inducible or constitutive CysB variants. However, the observed differences were not of essential meaning, so one cannot expect fundamental structural changes in the protein caused by the particular mutations studied in this work.

Regions Important for Oligomerization-- The standard test for negative trans-dominance (42) is frequently used to identify residues involved in oligomerization of multimeric transcriptional regulators. Examples of LysR family members, NahR (7), OxyR (9), and GcvA (36), also suggest the correlation between the oligomerization defect and the inability of the mutant protein to exert a dominant-negative effect (also called a "poisoning effect") on the activity of the wild-type counterpart produced by the cell. For CysB, the negative dominance was clearly seen with some non-repressing (non-binding) variants (with mutations in region 11-22) as well as with non-inducible variants (Fig. 1). In contrast, three non-repressing mutants (substitutions in region 41-48) and all of the C-terminally truncated CysB variants did not display a dominant-negative effect. One truncated CysB variant (CysB N309Ter) bound to the cysP promoter, and the mobility of the resulting primary complex was consistent with a dimeric rather than a tetrameric form of the protein. The most likely interpretation of these findings indicates the involvement of the 16 C-terminal residues in oligomerization of CysB (as was also suggested for OxyR and NahR), but also the importance of a region encompassing Leu41-Ile48. It is tempting to speculate that region 41-48, composing part of the DNA-binding domain, is important for appropriate contacts between two CysB monomers whose HTH motifs interact directly with dyadic activatory binding sites. An alternative explanation for the lack of a dominant-negative effect of the E41K, L44L, and I48T variants assumes that the mutant proteins possess the ability to oligomerize, but that mixed CysB oligomers are still functional (i.e. the wild-type monomers are dominant to the mutant monomers with respect to DNA binding). Another suggestion emerging from our study is that interactions between subunits within the CysB tetramer may be affected by an interaction with the inducer. Such a possibility is inferred by the characteristics of the CysBc A227D variant, most probably dimeric as discussed earlier. A model proposed for WT CysB (37) assumed that C-terminal portions of the four subunits maintain the tetramer in an inactive state and that acetylserine disrupts these contacts to release the protein surface for interaction with the RNA polymerase. The characteristics of the CysBc A227D variant would be consistent with this model if one assumes that the A227D mutation disrupts C-terminal contacts between subunits and that the resulting protein is active without an inducer. It has to be pointed out that if both CysBc A227D and CysB N309Ter bind DNA as dimers, the arrangement of subunits in these dimers may not be equivalent. The electrophoretic mobilities of the primary complexes formed by these proteins with the cysP promoter were similar but not identical, and the N309Ter variant (in contrast to CysBc A227D) apparently was not active with all CysB-dependent cys gene promoters in vivo, as it was unable to complement the Delta cysB mutant. Perhaps the characteristics of the above CysB variants closely resemble those of dimeric OxyR mutants, for which the possibility of dimerization via either the "dimerization domain" or the "tetramerization domain" was suggested (9).

Region Involved in the Positive Control Function-- The single amino acid substitution Y27G in CysB (Fig. 1) resulted in a phenotype expected for a CysBpc mutant: the Y27G protein was able to bind DNA and to respond to the inducer by a qualitative change in the DNA-protein complex, but it was still defective in transcriptional activation. These results confirm that an additional function beyond DNA binding and bending (more precisely, inducer-dependent release of DNA bending caused by CysB alone) is required for CysB to act as a transcriptional activator. By its characteristics, the CysB Y27G variant corresponds to the GcvApc F31L/A mutants (36), raising the possibility that in LysR-type proteins, an "activation patch" composes part of the N-terminal HTH region. A similar position of the putative activating region (within or nearby the HTH motif of the DNA-binding domain) was demonstrated for transcriptional regulators belonging to other families, i.e. lambda cI (43) and FIS (44) proteins.

CysB protein is likely to contact the C-terminal domain of the RNA polymerase alpha -subunit, as the rpoA341 mutation, changing K271E in the alpha -peptide, specifically affects CysB-dependent expression of the cysPTWA operon (45). It is possible that recruitment of RNA polymerase by CysB involves a direct protein-protein contact between the C-terminal domain of the RNA polymerase alpha -subunit and the putative activating region of CysB, in which Thr27 seems to be essential.

In conclusion, the results of this study highlight the regions of CysB that are critical for DNA binding, inducer response, oligomerization, and positive control and demonstrate that these functions can be genetically separated. Further work will continue to focus on the purification and detailed biochemical characterization of selected CysB variants for better recognition of CysB subunit interactions. Isolation of additional mutants for further characterization of the CysB activating region is also in progress.


    ACKNOWLEDGEMENTS

We thank Anne-Lise Haenni and Piotr Ceglowski for critical reading of the manuscript. We also thank N. M. Kredich for the kind gift of purified S. typhimurium CysB protein.


    FOOTNOTES

* This work was supported in parts by grants from the Polish State Committee for Scientific Research (Projects 6P04A03614 and 6P04A05216).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Inst. of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5A, 02-106 Warsaw, Poland. Tel.: 48-22-659-60-72 (ext. 1310); Fax: 48-39-12-16-23 or 48-22-658-46-36; E-mail: monikah@ibbrain.ibb.waw.pl.

Published, JBC Papers in Press, October 18, 2000, DOI 10.1074/jbc.M007192200


    ABBREVIATIONS

The abbreviations used are: LTTRs, LysR-type transcriptional regulators; HTH, helix-turn-helix; bp, base pair(s); X-gal, 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside; PCR, polymerase chain reaction; WT, wild-type; EMSA, electrophoretic mobility shift assay.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES


1. Henikoff, S. G., Haughn, J. M., Calvo, J. M., and Wallace, J. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 6602-6606
2. Schell, M. (1993) Annu. Rev. Microbiol. 47, 597-626
3. Perez-Rueda, E., and Collado-Vides, J. (2000) Nucleic Acids Res. 28, 1838-1847
4. Kullik, I., Toledano, M. B., Tartaglia, L. A., and Storz, G. (1995) J. Bacteriol. 177, 1275-1284
5. Cebolla, A., Sousa, C., and de Lorenzo, V. (1997) J. Biol. Chem. 272, 3986-3992
6. Jørgensen, C., and Dandanell, G. (1999) J. Bacteriol. 181, 4397-4403
7. Schell, M. A., Brown, P. H., and Raju, S. (1990) J. Biol. Chem. 265, 3844-3850
8. Bartowsky, E., and Normark, S. (1991) Mol. Microbiol. 5, 1715-1725
9. Kullik, I., Stevens, J., Toledano, M. B., and Storz, G. (1995) J. Bacteriol. 177, 1285-1291
10. Ishihama, A. (1993) J. Bacteriol. 175, 2483-2489
11. Kredich, N. M. (1996) in Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C. , Curtiss, R., III , Ingraham, J. L. , Lin, E. C. C. , Low, K. B. , Magasanik, B. , Reznikoff, W. S. , Riley, M. , Schaechter, M. , and Umbarger, H. E., eds), 2nd Ed. , pp. 514-527, American Society for Microbiology, Washington, D. C.
12. Jagura-Burdzy, G., and Hulanicka, D. (1981) J. Bacteriol. 147, 744-751
13. Ostrowski, J., and Kredich, N. M. (1991) J. Bacteriol. 173, 2212-2218
14. Kredich, N. M. (1992) Mol. Microbiol. 20, 2747-2753
15. Miller, B. E., and Kredich, N. M. (1987) J. Biol. Chem. 262, 6006-6009
16. Hryniewicz, M. M., and Kredich, N. M. (1994) J. Bacteriol. 176, 3673-3682
17. Monroe, R. S., Ostrowski, J., Hryniewicz, M. M., and Kredich, N. M. (1990) J. Bacteriol. 172, 6919-6929
18. Hryniewicz, M. M., and Kredich, N. M. (1991) J. Bacteriol. 173, 5876-5886
19. Ostrowki, J., and Kredich, N. M. (1990) J. Bacteriol. 172, 779-785
20. Tyrrell, R., Verschueren, K. H. G., Dodson, E. J., Murshudov, G. N., Addy, C., and Wilkinson, A. J. (1997) Structure 5, 1017-1032
21. van der Ploeg, J., Iwanicka-Nowicka, R., Kertesz, M. A., Leisinger, T., and Hryniewicz, M. M. (1997) J. Bacteriol. 179, 7671-7678
22. van der Ploeg, J., Iwanicka-Nowicka, R., Bykowski, T., Hryniewicz, M. M., and Leisinger, T. (1999) J. Biol. Chem. 274, 29358-29365
23. Iwanicka-Nowicka, R., and Hryniewicz, M. M. (1995) Gene (Amst.) 166, 11-17
24. van der Ploeg, J. R., Weiss, M. A., Saller, E., Nashimoto, H., Saito, N., Kertesz, M. A., and Leisinger, T. (1996) J. Bacteriol. 178, 5438-5446
25. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. E., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1987) Current Protocols in Molecular Biology , Wiley-Interscience, New York
26. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467
27. Ostrowski, J., Jagura-Burdzy, G., and Kredich, N. M. (1987) J. Biol. Chem. 262, 5999-6005
28. Grob, P., Kahn, D., and Guiney, D. G. (1997) J. Bacteriol. 179, 5398-5406
29. Sikorski, R. S., and Boeke, J. D. (1991) Methods Enzymol. 194, 314-317
30. Miller, J. H. (ed) (1992) A Short Course in Bacterial Genetics , pp. 268-274, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
31. Kushner, S. R., Nagaishi, H., Templin, A., and Clark, A. J. (1971) Proc. Natl. Acad. Sci. U. S. A. 68, 824-827
32. Hryniewicz, M. M., Palucha, A., and Hulanicka, M. D. (1988) J. Gen. Microbiol. 134, 763-769
33. Fijalkowska, I. J., and Schaaper, R. M. (1995) J. Bacteriol. 177, 5979-5986
34. Minton, N. P. (1984) Gene (Amst.) 31, 269-273
35. Takeshita, S., Sato, M., Toba, M., Masahashi, W., and Hashimoto-Gotoh, T. (1987) Gene (Amst.) 61, 63-74
36. Jourdan, A. D., and Stauffer, G. V. (1998) J. Bacteriol. 180, 4865-4871
37. Colyer, T. C., and Kredich, N. M. (1994) Mol. Microbiol. 13, 797-805
38. Goethals, K., Van Montagu, M., and Holsters, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 1646-1650
39. Maxon, M. E., Wigboldus, J., Brot, N., and Weissbach, H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 7076-7079
40. Muse, W. B., and Bender, R. A. (1999) J. Bacteriol. 181, 934-940
41. Colyer, T. C., and Kredich, N. M. (1996) Mol. Microbiol. 21, 247-256
42. Shamah, S. M., and Stiles, C. D. (1995) Methods Enzymol. 254, 567-576
43. Whipple, F. W., Ptashne, M., and Hochshild, A. (1997) J. Mol. Biol. 265, 261-265
44. Gosink, K. K., Gaal, T., Bokal, A. J., IV, and Gourse, R. L. (1996) J. Bacteriol. 178, 5182-5187
45. Giffard, P. M., and Booth, I. R. (1988) Mol. Gen. Genet. 214, 148-152


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
J. Kim, J. Oh, O. Choi, Y. Kang, H. Kim, E. Goo, J. Ma, T. Nagamatsu, J. S. Moon, and I. Hwang
Biochemical Evidence for ToxR and ToxJ Binding to the tox Operons of Burkholderia glumae and Mutational Analysis of ToxR
J. Bacteriol., August 1, 2009; 191(15): 4870 - 4878.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Sainsbury, L. A. Lane, J. Ren, R. J. Gilbert, N. J. Saunders, C. V. Robinson, D. I. Stuart, and R. J. Owens
The structure of CrgA from Neisseria meningitidis reveals a new octameric assembly state for LysR transcriptional regulators
Nucleic Acids Res., May 27, 2009; (2009) gkp445v1.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
G. Isak and M. Ryden-Aulin
Hypomodification of the Wobble Base in tRNAGlu, tRNALys, and tRNAGln Suppresses the Temperature-Sensitive Phenotype Caused by Mutant Release Factor 1
J. Bacteriol., March 1, 2009; 191(5): 1604 - 1609.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
S. E. Maddocks and P. C. F. Oyston
Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins
Microbiology, December 1, 2008; 154(12): 3609 - 3623.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
R. Iwanicka-Nowicka, A. Zielak, A. M. Cook, M. S. Thomas, and M. M. Hryniewicz
Regulation of Sulfur Assimilation Pathways in Burkholderia cenocepacia: Identification of Transcription Factors CysB and SsuR and Their Role in Control of Target Genes
J. Bacteriol., March 1, 2007; 189(5): 1675 - 1688.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M.-F. Hullo, S. Auger, O. Soutourina, O. Barzu, M. Yvon, A. Danchin, and I. Martin-Verstraete
Conversion of Methionine to Cysteine in Bacillus subtilis and Its Regulation
J. Bacteriol., January 1, 2007; 189(1): 187 - 197.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. L. Smart and C. E. Bauer
Tetrapyrrole Biosynthesis in Rhodobacter capsulatus Is Transcriptionally Regulated by the Heme-Binding Regulatory Protein, HbrL
J. Bacteriol., February 15, 2006; 188(4): 1567 - 1576.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S.-J. Yang, K. C. Rice, R. J. Brown, T. G. Patton, L. E. Liou, Y. H. Park, and K. W. Bayles
A LysR-Type Regulator, CidR, Is Required for Induction of the Staphylococcus aureus cidABC Operon
J. Bacteriol., September 1, 2005; 187(17): 5893 - 5900.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. Burguiere, J. Fert, I. Guillouard, S. Auger, A. Danchin, and I. Martin-Verstraete
Regulation of the Bacillus subtilis ytmI Operon, Involved in Sulfur Metabolism
J. Bacteriol., September 1, 2005; 187(17): 6019 - 6030.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. N. Erwin, S. Nakano, and P. Zuber
Sulfate-Dependent Repression of Genes That Function in Organosulfur Metabolism in Bacillus subtilis Requires Spx
J. Bacteriol., June 15, 2005; 187(12): 4042 - 4049.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Z. Zhang, G. Gosset, R. Barabote, C. S. Gonzalez, W. A. Cuevas, and M. H. Saier Jr.
Functional Interactions between the Carbon and Iron Utilization Regulators, Crp and Fur, in Escherichia coli
J. Bacteriol., February 1, 2005; 187(3): 980 - 990.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
N. Golic, M. Schliekelmann, M. Fernandez, M. Kleerebezem, and R. van Kranenburg
Molecular characterization of the CmbR activator-binding site in the metC-cysK promoter region in Lactococcus lactis
Microbiology, February 1, 2005; 151(2): 439 - 446.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Rousseau, E. Gueguen, G. Duval-Valentin, and M. Chandler
The helix-turn-helix motif of bacterial insertion sequence IS911 transposase is required for DNA binding
Nucleic Acids Res., February 23, 2004; 32(4): 1335 - 1344.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
K. L. Farmer and M. S. Thomas
Isolation and Characterization of Burkholderia cenocepacia Mutants Deficient in Pyochelin Production: Pyochelin Biosynthesis Is Sensitive to Sulfur Availability
J. Bacteriol., January 15, 2004; 186(2): 270 - 277.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
M. Jovanovic, M. Lilic, D. J. Savic, and G. Jovanovic
The LysR-type transcriptional regulator CysB controls the repression of hslJ transcription in Escherichia coli
Microbiology, December 1, 2003; 149(12): 3449 - 3459.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Feng, Q. Li, H.-L. Hu, X.-C. Chen, and G.-F. Hong
Inactivation of the nod box distal half-site allows tetrameric NodD to activate nodA transcription in an inducer-independent manner
Nucleic Acids Res., June 15, 2003; 31(12): 3143 - 3156.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Zaim and A. M. Kierzek
The structure of full-length LysR-type transcriptional regulators. Modeling of the full-length OxyR transcription factor dimer
Nucleic Acids Res., March 1, 2003; 31(5): 1444 - 1454.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
I. Guillouard, S. Auger, M.-F. Hullo, F. Chetouani, A. Danchin, and I. Martin-Verstraete
Identification of Bacillus subtilis CysL, a Regulator of the cysJI Operon, Which Encodes Sulfite Reductase
J. Bacteriol., September 1, 2002; 184(17): 4681 - 4689.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Akakura and S. C. Winans
Mutations in the occQ Operator That Decrease OccR-induced DNA Bending Do Not Cause Constitutive Promoter Activity
J. Biol. Chem., May 3, 2002; 277(18): 15773 - 15780.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
M. Fernandez, M. Kleerebezem, O. P. Kuipers, R. J. Siezen, and R. van Kranenburg
Regulation of the metC-cysK Operon, Involved in Sulfur Metabolism in Lactococcus lactis
J. Bacteriol., January 1, 2002; 184(1): 82 - 90.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
J. A. Quan, B. L. Schneider, I. T. Paulsen, M. Yamada, N. M. Kredich, and M. H. Saier Jr
Regulation of carbon utilization by sulfur availability in Escherichia coli and Salmonella typhimurium
Microbiology, January 1, 2002; 148(1): 123 - 131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Akakura and S. C. Winans
Constitutive Mutations of the OccR Regulatory Protein Affect DNA Bending in Response to Metabolites Released from Plant Tumors
J. Biol. Chem., February 15, 2002; 277(8): 5866 - 5874.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/3/2098    most recent
M007192200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lochowska, A.
Right arrow Articles by Hryniewicz, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lochowska, A.
Right arrow Articles by Hryniewicz, M. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement