|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 276, Issue 30, 27981-27988, July 27, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, January 18, 2001, and in revised form, May 25, 2001
The rat
transporter rCNT1 is the archetype of a family of concentrative
nucleoside transporters (CNTs) found both in eukaryotes and in
prokaryotes. In the present study we have used antibodies to
investigate the subcellular distribution and membrane topology of this
protein. rCNT1 was found to be expressed predominantly in the
brush-border membranes of the polarized epithelial cells of rat jejunum
and renal cortical tubules and in the bile canalicular membranes of
liver parenchymal cells, consistent with roles in the absorption of
dietary nucleosides, of nucleosides in the glomerular filtrate, or of
nucleosides arising from the action of extracellular nucleotidases,
respectively. The effect of endoglycosidase F treatment on wild-type
and mutant rCNT1 expressed in Xenopus oocytes revealed that
the recombinant transporter could be glycosylated at either or both of
Asn605 and Asn643, indicating that its C
terminus is extracellular. In contrast, potential
N-glycosylation sites introduced near the N terminus, or
between putative transmembrane (TM) helices 4 and 5, were not glycosylated. The deduced orientation of the N terminus in the cytoplasm was confirmed by immunocytochemistry on intact and
saponin-permeabilized Chinese hamster ovary cells expressing
recombinant rCNT1. These results, in conjunction with extensive
analyses of CNT family protein sequences using predictive algorithms,
lead us to propose a revised topological model, in which rCNT1
possesses 13 TM helices with the hydrophilic N-terminal and C-terminal
domains on the cytoplasmic and extracellular sides of the membrane,
respectively. Furthermore, we show that the first three TM helices,
which are absent from prokaryote CNTs, are not essential for
transporter function; truncated proteins lacking these helices, derived
either from rCNT1 or from its human homolog hCNT1, were found to retain significant sodium-dependent uridine transport activity
when expressed in oocytes.
Nucleoside transport across cell membranes plays important roles
both in prokaryotic and in eukaryotic organisms. For example, uptake is
essential for nucleotide synthesis via salvage pathways in cells, such
as mammalian bone marrow cells and many protozoan parasites of mammals,
which lack de novo biosynthetic pathways (1, 2). In humans,
transporters also provide the route of cellular uptake of many
nucleoside analog drugs used in anti-viral or anti-cancer therapies (1,
3). By modulating levels of extracellular adenosine, nucleoside
transport also plays a key role in regulating many physiological
processes in mammals, including coronary vasodilatation, renal
vasoconstriction, lipolysis, and platelet aggregation (4).
Transport in mammals is mediated both by Na+-independent
(equilibrative
(e)1) and by
Na+-dependent (concentrative (c))
processes (1, 2, 5, 6). Equilibrative transport processes are found in
most cell types (1, 2). They exhibit similar broad substrate
selectivities for purine and pyrimidine nucleosides but can be divided
into two classes, designated es and ei, by virtue
of their respective sensitivity and insensitivity to inhibition by
nanomolar concentrations of
NBMPR2
(nitrobenzylthioinosine or
6-((4-nitrobenzyl)thio)-9- cDNA clones encoding proteins that mediate cit,
cif, and cib transport have been isolated
recently from a number of mammalian species (7-12). These
~650-residue proteins comprise a single family of transporters,
unrelated to the equilibrative transporter family of mammals or to
other known transporter families, which we have designated the CNT
(concentrative nucleoside transporter) family. Members of the family
with cit-type activity are designated CNT1, those with
cif-type activity are designated CNT2, and those with
cib-type activity are designated CNT3. Genome sequencing projects have revealed that CNT family members are present in other
eukaryotes, including Drosophila melanogaster and
Caenorhabditis elegans, and also in prokaryotes. The best
characterized example of a bacterial CNT family member is the
Escherichia coli nucleoside transporter NupC, which differs
from its eukaryote homologs not only in being considerably smaller
(~400 residues) but also in catalyzing the symport of nucleosides
with protons rather than with sodium ions (13).
The existence of multiple CNT family members in mammals presumably
reflects a variety of physiological roles for these transporters. Gaining a better understanding of these roles will require a knowledge not only of the detailed kinetic properties of the transporters, but
also of their tissue and subcellular distributions. Northern blotting
analyses have shown the expression of CNT1 and CNT2 mRNAs in many
tissues (1), but in most cases it is uncertain whether these findings
reflect the presence of physiologically significant amounts of
transport proteins; results from Western blotting have so far revealed
the presence of the rat cit-type transporter rCNT1 in liver,
kidney, and intestine, and the cif-type transporter rCNT2 in
liver and kidney (14, 15). Similarly, although site-directed mutagenesis experiments are beginning to reveal regions of the transporters which may be involved in substrate recognition (16, 17),
their interpretation is very much dependent upon a knowledge of the
arrangement of the proteins in the membrane. Initial hydropathic analysis of the cit-type transporter rCNT1 from rat jejunum,
which was then the only eukaryote CNT family member to have been
identified, tentatively suggested that this protein possessed between
10 and 14 transmembrane (TM) The aim of the present investigation was to gain a greater
understanding of both the physiological roles and the
structure-function relationships of a eukaryotic CNT protein. To this
end polyclonal antibodies were raised against fragments of the rat
cit-type transporter, rCNT1. The tissue and subcellular
distributions of the transporter were assessed in a range of rat
tissues by Western blotting and immunocytochemistry. Transporter
topology was investigated by using the antibodies to detect recombinant
rCNT1 following its production in CHO cells or in Xenopus
oocytes. In combination with endoglycosidase F treatment, production in
the latter system enabled us to assess the glycosylation status both of
the wild-type transporter and of a series of glycosylation mutants. The
resultant information, together with topological analysis of multiple
CNT family protein sequences now available, has allowed us to predict a
much refined model for the arrangement of rCNT1 in the membrane.
Creation and Removal of Potential Glycosylation
Sites--
Glycosylation sites were introduced into or removed from
rCNT1 using a Quik-ChangeTM site-directed mutagenesis kit (Stratagene) and the plasmid pQQH (7) as template. After mutagenesis of the
potential glycosylation sites at Asn605 and/or
Asn643, BamHI-XbaI cassettes (477 base pairs) encoding the mutated C-terminal region of the
protein were used to replace the corresponding region in pQQH, yielding
the constructs pSRH3 (N605T), pSRH4 (N643T) and pSRH5 (N605T/N643T).
Similarly, after mutation of Gln6 to Thr to introduce a
potential glycosylation site in the N-terminal region of the protein at
Asn4, a 532-base pair NdeI-EcoNI
fragment bearing the Q6T mutation was used to replace the corresponding
region of pSRH5, yielding the construct designated pSRH22.
Potential N-linked glycosylation sites were also introduced
into rCNT1 by insertion of the 33-residue extracellular loop of human
GLUT4, which contains the site of glycosylation of this transporter at
Asn57 (18). To generate this loop, oligonucleotide primers
were used to amplify by polymerase chain reaction the region encoding
residues 46-78 from human GLUT4 cDNA and to incorporate the
flanking KpnI sites. The latter were used to insert the loop
region into a unique KpnI site that had been introduced by
mutagenesis immediately downstream of the nucleotides encoding
Arg200 of rCNT1 in pSRH5. The presence of KpnI
sites flanking the insert introduced a glycine-threonine sequence at
each end of the GLUT4 sequence, yielding an insert that was 37 residues long.
Construction of N-terminal Truncations of rCNT1 (rCNT1/5'D3) and
hCNT1 (hCNT1/5'D3)--
cDNAs for wild-type rCNT1 and hCNT1
(GenBankTM accession U62968) were subcloned into the vector
pGEM-HE (19) for enhanced expression in Xenopus oocytes.
Deletion of the regions encoding the first 173 residues of rCNT1 and
the first 174 residues of hCNT1 was performed by a deletion polymerase
chain reaction strategy using Pfu DNA polymerase. The
forward primer (ATATGAATTCATGCAGCGGCCTGAGCAGCT) was
designed to contain a start codon (underlined) as well as an insert
sequence corresponding to the site of truncation. Because of sequence
identity between rCNT1 and hCNT1 in this region, the same primer
was used to construct both rCNT1/5'D3 and hCNT1/5'D3. The reverse
primer corresponded to a region within the vector multiple cloning site (AAGGATCCCCGGGGAATTGATCTGCCAAAGTTG).
In Vitro Transcription and Expression in Xenopus
Oocytes--
Plasmid DNAs were linearized with XbaI (for
plasmids encoding wild-type rCNT1 and glycosylation site mutants) or
NheI (for wild-type and truncated rCNT1 and hCNT1 in
pGEM-HE) and then transcribed with T7 polymerase using the mMESSAGE
mMACHINETM (Ambion) transcription system. Production of
recombinant transporters in Xenopus oocytes and
[14C]uridine uptake assays was then performed as
described previously (7, 20). For preparation of membranes, oocytes
were lysed at 0 °C by repeated pipetting in 7.5 mM
Na2HPO4, 1 mM EDTA, pH 7.4, containing 0.1 mM phenylmethylsulfonyl fluoride. After
centrifugation for 5 min at 500 × g to remove nuclei,
membranes in the supernatant were collected, and subsequently washed
twice, by centrifugation at 16,000 × g for 30 min at
4 °C.
Enzymic Deglycosylation--
Membranes (10 µg of total
protein) from Xenopus oocytes expressing wild-type and
mutant nucleoside transporters were suspended in 50 µl of 100 mM sodium acetate, pH 7.2, containing 50 mM
EDTA, 0.2% octyl Transient Transfections--
For heterologous expression in
CHO-K1 cells pDAH1 was constructed by subcloning rCNT1 cDNA into
pcDNA3 (InvitrogenTM) as an EcoRI-XbaI
fragment from pSRH1, a derivative of pQQH from which an
EcoRI site internal to the rCNT1 coding region had been
silently removed by site-directed mutagenesis of Glu27
(GAA Preparation of Antibodies--
Antibodies against synthetic
peptides corresponding to residues 46-67 and 505-524 of rCNT1
(designated anti-rCNT146-67 and
anti-rCNT1505-524) were raised in rabbits and affinity
purified using procedures described previously (21). Antiserum was also
prepared against a glutathione S-transferase (GST) fusion
protein bearing residues 21-78 of rCNT1, prepared using the vector
pGEX-KT (22). The antibodies (designated anti-rCNT121-78)
were purified by passage of the antiserum through a column of immobilized GST (Pierce) followed by adsorption to the fusion protein
immobilized on CNBr-activated Sepharose CL-4B.
Preparation of Membranes from Rat Tissues--
Tissues from male
rats were homogenized at 4 °C in 250 mM sucrose, 100 mM sodium phosphate, pH 7.5, containing 1 mM
EDTA, 2 µg/ml aprotonin, 1 mM benzamidine, 10 µM leupeptin, 0.1 mM phenylmethylsulfonyl fluoride, and 10 µg/ml pepstatin A. After removal of nuclei and unbroken cells by low speed centrifugation, crude membrane fractions were prepared by centrifugation for l h at 100,000 × g.
Western Blotting and Immunocytochemistry--
For Western
blotting, protein samples were electrophoresed on SDS and 10%
polyacrylamide gels, electroblotted onto nitrocellulose, incubated with
2 µg/ml primary antibody overnight and then with horseradish
peroxidase-conjugated goat anti-rabbit secondary antibody (Roche
Molecular Biochemicals). Blots were developed with chemiluminescent substrate (Roche Molecular Biochemicals).
For immunocytochemical investigation of liver and small intestine,
tissues were embedded in Tissue-Tek® O.C.T. Compound and frozen in
isopentane. Cryostat sections (8 µm) on VectabondTM-coated slides
were air dried for 1 h and then fixed with acetone for 3 min at
room temperature. After incubation for 1 h with 5% bovine serum
albumin in PBS containing 0.1% Tween 20 they were incubated overnight
at 4 °C with either anti-rCNT1505-524 serum or
preimmune serum, at a dilution of 1:100. Sections were incubated
subsequently for 1 h with goat anti-rabbit IgG FITC-conjugate (Sigma), washed, then mounted in Vectashield® medium.
For immunocytochemical investigation of kidney, the organ was perfused
with PBS followed by 4% paraformaldehyde in PBS until the tissue
surface was blanched evenly. After overnight incubation in 0.5 M sucrose at 4 °C sections were quenched by incubation with 1 mg/ml sodium tetraborohydride and blocked using an avidin/biotin blocking kit (Vector Laboratories). Sections were stained as described above, except that anti-rCNT121-78 was used at a
concentration of 2.2 µg/ml followed by biotinylated goat anti-rabbit
IgG (Sigma) in combination with fluorescein isothiocyanate-conjugated ExtravidinTM (Sigma) to amplify the signal. Parallel sections were stained with 10 µg/ml control rabbit IgG or with antiserum raised against GST or against residues 477-492 of rat GLUT1, each at a
dilution of 1:400.
For immunocytochemical investigations of heterologously expressed
rCNT1, transfected CHO-K1 cells were fixed for 20 min in 4%
paraformaldehyde in PBS, quenched with 100 mM glycine in
PBS, then blocked with 6% normal goat serum in PBS for 45 min. Cells were then incubated for 2 h with 10 µg/ml
anti-rCNT145-67 in PBS containing 1% normal goat serum
(antibody buffer) with or without 0.1% saponin. After subsequent
washing with PBS, they were incubated for 30 min with a goat
anti-rabbit IgG fluorescein isothiocyanate-conjugate in antibody buffer
with or without saponin, then washed and mounted as described above.
Confocal microscopy was performed for all samples using an inverted
Nikon Diaphot TMD fitted with a Leica confocal laser.
Computer Predictions of Membrane Topology--
The locations of
TM helices in CNT family members were predicted by analysis of
individual amino acid sequences using the hidden Markov model procedure
of Sonnhammer et al. as implemented in the computer program
TMHMM (version 1.0) (23). In addition, multiple sequence alignments
were analyzed for putative TM helices using the TMAP procedure of
Persson and Argos (24) and the neural network approach (PHDhtm) of Rost
et al. (25). Analyses were performed on the following 18 members of the concentrative nucleoside transporter family:
rCNT1 (GenBankTM accession U10279), hCNT1 (U62968), pkCNT1
(AF009673), rCNT2 (U25055), mCNT2 (AF079853), hCNT2 (AF036109), hfCNT (AF132298), F27E11.1 (AF016413), F27E11.2 (AF016413), NUPC_HELPY
(AE000623), YUTK_BACSU (Z99120), YEIM_HAEIN (Swiss-Prot accession
P44742), YEIM_ECOLI (P33024), YEIJ_ECOLI (P33021), YXJA_BACSU (P42312),
NUPC_ECOLI (P33031), NUPC_BACSU (P39141), NUPC_STREP (open reading
frame present in contig 188 from the Streptococcus pyogenes
genome sequencing project, Oklahoma University).
Tissue Distribution of rCNT1--
To investigate the distribution
of rCNT1 in rat tissues, polyclonal antibodies
(anti-rCNT1505-524) were raised against a synthetic
peptide corresponding to the region containing residues 505-524 of the
protein. This region is hydrophilic and exhibits only 60% identity to
the homologous transporter rCNT2. The specificity of
anti-rCNT1505-524 was confirmed by its ability to
recognize recombinant rCNT1 and hCNT1 (85% identical in sequence in
this region) but not rCNT2 or hCNT2 on Western blots of membranes from
Xenopus oocytes producing these proteins (Fig.
1 and data not shown). Western blotting
of membrane fractions prepared from eight rat tissues showed strongly immunoreactive bands with an apparent size between 60 and 66 kDa in
small intestine, kidney, and liver, but essentially no immunoreactivity of heart, skeletal muscle, spleen, or testis membranes (Fig.
2). A faint cross-reactive band with an
apparent size of ~120 kDa was observed in brain; the identity of the
corresponding protein, which was not visible in other tissues, is
unclear. The presence of rCNT1 in kidney and liver confirmed the
findings of other workers (14). Identical blots of small intestine,
kidney, and liver membranes incubated with control rabbit IgG showed no
immunoreactivity, confirming the specificity of the reaction (data not
shown).
Subcellular Distribution of rCNT1--
The subcellular location of
rCNT1 was examined by confocal immunofluorescence microscopy.
Preliminary experiments revealed that paraformaldehyde fixation
prevented recognition of the transporter by
anti-rCNT1505-524; however, frozen tissue sections, fixed
with acetone postsectioning, retained immunoreactivity and so were used
for studies of intestine and liver. Specificity of rCNT1 staining was
indicated by the absence of staining when preimmune serum was used
(Fig. 3, insets).
Intestine--
In sections of rat jejunum, strong staining for
rCNT1 was observed at the brush-border membrane of the absorptive
epithelial cells, whereas no staining was apparent on the basolateral
membranes (Fig. 3, A and B). Staining of the
absorptive epithelial cells was apparent from the base of the crypts of
Lieberkuhn to the tips of the villi, but was absent from the goblet
cells. The location of rCNT1 is consistent with the reported presence
of both cit- and cif-type sodium-linked
nucleoside transport processes in rat and human brush-border membrane
vesicles (26, 27). In contrast, nucleoside (formycin B) transport
across the basolateral membrane of rabbit jejunal cells lacks sodium
dependence and is probably mediated by an es-type
transporter (28). The abundance of rCNT1 at the enterocyte brush
border, revealed by immunocytochemistry, suggests its involvement in
the absorption of luminal nucleosides derived from the diet and from
cells shed from the villus tip. Although enterocytes have been reported
in some studies to possess the capacity for de novo
nucleotide synthesis, the energetically favorable salvage pathways are
likely to be of particular importance for such rapidly dividing cells
(29).
Liver--
In liver, rCNT1 was found only in the hepatic
parenchymal cells and was restricted to the bile canalicular membranes,
being absent from the basolateral membranes (Fig. 3C). The
liver is the main nondietary source of nucleosides for cells, such as
leukocytes and bone marrow cells, which lack de novo purine
nucleotide biosynthetic pathways (30). Nucleoside transporters in the
canalicular membrane may reduce physiologically undesirable losses of
nucleosides in bile. Such nucleosides may either be released directly
into bile or generated by degradation of released nucleotides by
nucleoside triphosphate diphosphohydrolases and 5'-nucleotidase, which
in hepatocytes are most abundant in the canalicular membrane (31). Although kinetic studies with canalicular membrane vesicles have provided evidence for the presence of a cif-type adenosine
transport process (31, 32), the presence of cit-type
processes has not been reported previously. Whether rCNT1 functions for
the uptake both of pyrimidine nucleosides and adenosine across the
canalicular membrane remains unclear; although the protein transports
uridine and adenosine with similar affinity, its turnover number for
adenosine is much lower than that for uridine (11).
Sodium-dependent adenosine transport is reportedly absent
from hepatocyte basolateral membrane vesicles (32), although
sodium-dependent uridine transport has been described (33),
and these membranes have been shown by Western blotting to be enriched
in the cif-type nucleoside transporter rCNT2 (14).
Interestingly, partially purified basolateral membranes were reported
to be impoverished in rCNT1 relative to unfractionated hepatocyte
membranes (14), an observation consistent with our demonstration by
immunocytochemistry that this transporter is confined to the bile
canalicular domain of hepatocytes.
Kidney--
To preserve tissue morphology it was necessary to fix
the kidney by perfusion with paraformaldehyde, precluding use of
anti-rCNT1505-524 for immunocytochemistry. Instead,
anti-rCNT121-78 antibodies were employed. These yielded a
pattern of staining on Western blots of rat tissues essentially
identical to that observed for anti-rCNT1505-524 (data not
shown) but were capable of recognizing the transporter in
paraformaldehyde-fixed tissue. Their specificity was confirmed by the
absence of immunoreactivity in sections incubated either with anti-GST
antiserum or with control rabbit IgG (Fig. 3). Immunoreactivity was
found only on the brush-border surface of epithelial cells in cortical
tubules (arrow in Fig. 3D), a distinctive
location that was apparent from a comparison with the staining pattern observed using antibodies against the glucose transporter GLUT1, which
is known to be confined to the basolateral membranes of cortical
tubular cells (Fig. 3F, arrow) (34). The observed
subcellular location of rCNT1 is consistent with the kinetic
demonstration of both cit- and cif-type
nucleoside transport activities in rat renal brush-border membrane
preparations (35). In this location the transporter is likely to play
an important role in purine conservation, via reabsorption of filtered
nucleosides, and may also influence other physiologically important
phenomena because adenosine is known to exert potent effects on many
aspects of renal function including vasoconstriction and renin release
(36).
Glycosylation States of rCNT1 and hCNT1--
Although rCNT1 was
originally predicted not to be N-glycosylated (7), the
differences in the electrophoretic mobility of the immunoreactive
material observed in samples from different rat tissues and the
broadness of the immunoreactive bands in intestinal and kidney samples
(Fig. 2) suggested that the transporter was glycosylated. To assess
this possibility, recombinant rCNT1 and hCNT1 produced in
Xenopus oocytes were subjected to treatment with
endoglycosidase F. In both cases, the electrophoretic mobility of the
bands stained with anti-rCNT1505-524 on Western blots was
increased such that their apparent molecular mass decreased from
~60-63 kDa (in some experiments two closely spaced bands could be
resolved; see Fig. 5) to 56 kDa (Fig. 1). Interestingly,
endoglycosidase treatment also increased the intensity of the
immunoreactive bands, suggesting not only that both proteins were
glycosylated but also that the presence of N-linked
oligosaccharide interfered with recognition by the antibodies.
The polypeptide sequence of rCNT1 contains three potential
N-linked glycosylation sites, at asparagines 543, 605, and
643. Asn543 is located in a hydrophobic segment of the
sequence which is predicted to be membrane-spanning and so is unlikely
to be glycosylated. To determine whether one or both of the other two
potential glycosylation sites were glycosylated, Asn605 and
Asn643 were mutated individually and simultaneously to
threonine residues. Neither the single (N605T or N643T) nor the double
(N605T/N643T) mutants showed apparent differences in uridine transport
activity compared with wild-type rCNT1 when expressed in
Xenopus oocytes; mediated uridine uptake activities were
123.5 ± 10.9, 109.6 ± 8.5, and 90.6 ± 9.4% of
wild-type values, respectively. This observation suggested that all
three mutant proteins were inserted correctly into oocyte membranes.
Western blot analysis of the mutant rCNT1 molecules after their
production in Xenopus oocytes indicated that the mutations had changed the electrophoretic mobility of the proteins (Fig. 4). Although the wild-type rCNT1 migrated
as two closely spaced, major bands with apparent molecular masses of 63 and 60 kDa, mutation of either asparagine 605 or 643 caused the
resulting recombinant transporters (N605T, N643T) to migrate as a
single major band with an apparent molecular mass of 60 kDa. However,
these mutants proved still to be glycosylated because treatment with
endoglycosidase F increased their electrophoretic mobility further,
such that they migrated with an apparent molecular mass of 56 kDa,
identical to that of the deglycosylated wild-type rCNT1. Moreover,
simultaneous mutation of both residues resulted in a transporter
(N605T/N643T) that was unaffected by treatment with endoglycosidase F
and migrated with an apparent molecular mass of 56 kDa, identical to
that of the deglycosylated wild-type transporter. A more rapidly
migrating species with an apparent molecular mass of 50 kDa was also
evident on Western blots of deglycosylated rCNT1 samples. The relative amounts of this and of the 56-kDa species varied between experiments (cf. Figs. 1 and 5), and it is
possible that these bands represent different conformers of the
deglycosylated transporter in SDS. Similar behavior is exhibited by
other hydrophobic membrane proteins, including the mammalian glucose
transporter GLUT1 which, after enzymic deglycosylation, migrates as
46-kDa and 38-kDa species (37).
Probing rCNT1 Topology via Introduction of Novel Glycosylation
Motifs--
The results described above showed that the C-terminal
region of rCNT1 is glycosylated and thus must be exposed at the
extracellular face of the plasma membrane. If the transporter spans the
membrane an even number of times, the N terminus would similarly be
exposed at the extracellular surface of the plasma membrane rather than at the cytosolic surface as originally predicted (7). To distinguish between these possible locations for the N terminus, Gln6
was mutated to Thr in the aglyco mutant (N605T/N643T) of rCNT1, thereby
introducing a potential glycosylation site at Asn4. The
mutant protein N605T/N643T/Q6T retained 41.3 ± 9.0% of the uridine transport activity of the wild-type protein when produced in
Xenopus oocytes, suggesting that it was inserted properly
into the oocyte membrane during biosynthesis; however, unlike the
wild-type transporter its mobility on SDS-polyacrylamide gel
electrophoresis was unaffected by treatment with endoglycosidase F,
indicating that the potential glycosylation site at Asn4
had not become glycosylated (Fig. 5); migration of both the mutant and
deglycosylated wild-type rCNT1 as doublets probably reflects the
presence of a conformer not completely unfolded by SDS.
Lack of glycosylation at Asn4 is consistent with a
cytoplasmic location of the N terminus, as originally predicted for
rCNT1 (7). Additional information about the protein topology in the N-terminal half of the transporter sequence was sought by introducing another potential glycosylation site in the predicted cytoplasmic loop
connecting TM4 and TM5 (residues 198-204), a region that contains four
contiguous positively charged residues (KHHR) and so is likely to be
exposed at the membrane surface. Because of the predicted shortness of
the endogenous loop, the potential glycosylation site was introduced in
the form of a 37-residue segment containing the N-linked
glycosylation site of human GLUT4. This GLUT4 exofacial loop region has
previously been used successfully for glycosylation-scanning
mutagenesis studies of the topology of human GLUT1 (38). It was
inserted after Arg200 in the middle of the TM4-5 loop of
the aglyco mutant (N605T/N643T) of rCNT1, immediately after the stretch
of positively charged residues, to place the relevant asparagine
residue sufficiently far from the flanking TM helices to act as an
efficient glycosylation acceptor site (39). The recombinant mutant
protein (N605T/N643T/200 Probing rCNT1 Topology Using Site-specific Antibodies--
The
observation that an rCNT1 mutant (N605T/N643T/Q6T) bearing a potential
N-glycosylation site at Asn4 was not
glycosylated when produced in Xenopus oocytes suggested that
the protein N terminus was cytoplasmically exposed. To obtain direct
evidence for this topology, CHO-K1 cells were transiently transfected
with a pCDNA3 construct encoding rCNT1 and then subjected to
immunocytochemistry using anti-rCNT146-67 antibodies. As
shown in Fig. 6A, strong
staining was evident in the plasma membrane when paraformaldehyde-fixed
cells were incubated with antibody in the presence of saponin, which
permeabilizes membranes. In contrast, little staining was evident in
cells treated with antibody in the absence of saponin (Fig.
6B). The specificity of the antibodies was demonstrated by
the lack of staining of permeabilized nontransfected cells (Fig.
6C). These results confirm that the N-terminal region of
rCNT1 is cytoplasmically oriented.
Computer Predictions of the Membrane Topology of Concentrative
Nucleoside Transporters--
Demonstration that the C-terminal region
of rCNT1 is extracellular and that the N-terminal region is cytoplasmic
conflicted with the original prediction (7) that this transporter
possesses an even number of TM helices. These findings, together with
the recent identification of many related eukaryotic and prokaryotic CNTs, prompted a reanalysis of rCNT1 and its homologs using more sophisticated computer algorithms designed to predict membrane protein
topology. Two of the algorithms employed (TMAP (24) and PHDhtm (25)),
perform TM helix predictions on multiple sequence alignments, thereby
significantly improving the accuracy of prediction. The third
algorithm, TMHMM, predicts both the locations and orientations of TM
The results of applying these predictive methods to 18 members of the
CNT family are summarized in Fig. 7. The
N-terminal regions of the nine eukaryotic transporters examined were
predicted by the TMHMM algorithm to be cytoplasmic, a finding
consistent with the experimental evidence for the cytoplasmic location
of the N terminus of rCNT1. In contrast, the N-terminal regions of the
nine prokaryotic transporters examined were predicted to be extracellular. These results are consistent with absence in the prokaryotic transporters of the region corresponding to residues 1-175
of rCNT1, which is strongly predicted by all three algorithms to
contain three TM helices (TM helices 1-3; Fig. 7). An extracellular location for the N termini of the prokaryote proteins is also consistent with the "positive-inside rule" (40) because the hydrophilic region following the first putative TM helix of these transporters carries a large positive charge.
All three algorithms predicted the presence in both prokaryotic and
eukaryotic transporters of an additional nine shared TM helices (Fig.
7, TM helices 4-6 and 8-13) in the region corresponding to residues
175-600 of rCNT1. Prediction by the TMAP algorithm that the putative
helices labeled 8 and 9 form a single TM helix probably reflects the shortness of the hydrophilic region linking them
(Fig. 8).
The locations of the 12 TM helices within rCNT1 predicted by
application of the three algorithms described above match closely with
12 of those originally proposed by Huang et al. (7) on the
basis of hydropathic analysis. However, if the N and C termini of rCNT1
lie on opposite sides of the membrane, the transporter must contain
either one or possibly three additional TM helices. The most likely
location for an additional TM helix is the region corresponding to
residues 290-330 of rCNT1. Although a TM helix was not predicted by
the TMAP or PHDhtm algorithm, it was strongly predicted by the TMHMM
algorithm in several of the eukaryotic CNT proteins (e.g.
mCNT2) and weakly predicted in others, including rCNT1 (Fig. 7,
open rectangle on the rCNT1 helix prediction). The presence
of a TM helix at this location (Fig. 7, TM helix 7) would
result in a transporter with 13 membrane-spanning helices and a
topology compatible with the experimentally determined locations of the
N and C termini of rCNT1. A diagram of the revised 13-TM helix topology
is shown in Fig. 8. Although a 15-TM helix topology would also be
compatible with the experimental results and cannot be excluded, the
additional two TM helices were not strongly predicted by any of the
algorithms. For example, neither the TMAP nor PHDhtm algorithm
predicted a TM helix corresponding to that tentatively identified as TM
helix 6 by Huang et al. (7) (Fig. 7, TM helix 6'), and a TM helix in this region was predicted by the
TMHMM algorithm for only 3 out of the 18 CNT sequences used in the
analyses. Similarly, a TM helix in the region corresponding to residues 480-510 in rCNT1 was only weakly predicted, and in just a few of the
sequences, by the TMHMM algorithm (Fig. 7, open rectangle on
the rCNT1 helix prediction).
Role of the N-terminal Region of Eukaryote CNTs--
The eukaryote
CNTs are considerably larger proteins than their prokaryote homologs.
In particular, they possess an extensive N-terminal hydrophilic domain
that, as described above, we have shown to be intracellular, followed
by three predicted TM helices that are absent from the prokaryote
transporters. Moreover, the eukaryote and prokaryote transporters
differ in their ion dependence; all of the vertebrate CNTs
characterized so far have been shown to be sodium symporters (1, 2, 6),
whereas the archetypical prokaryote CNT, NupC from E. coli,
is a proton symporter (13). To investigate the functional significance,
if any, of these structural differences between prokaryote and
eukaryote CNTs we therefore examined the effects of truncating rCNT1
and its human homolog hCNT1. The first 173 or 174 residues,
respectively, of these proteins, corresponding to the hydrophilic
N-terminal region and first three putative TM helices (Fig. 8), were
removed by a polymerase chain reaction deletion strategy. Fig.
9 shows that the activities of the
truncated proteins, designated rCNT1/5'D3 and hCNT1/5'D3, respectively,
were reduced by ~97 and 94% compared with their respective wild-type
counterparts. Nonetheless, they clearly retained significant uridine
transport activity when expressed in Xenopus oocytes. It
therefore appears that despite their presence in transporters from
eukaryotes as divergent as nematodes and mammals, neither the
intracellular N-terminal domain nor the first three putative TM helices
of these CNTs are essential for nucleoside transport activity.
Moreover, the fact that the residual activities of rCNT1/5'D3 and
hCNT1/5'D3 were abolished when sodium ions in the transport medium were
replaced by choline (Fig. 9) indicates that these regions of the
eukaryote CNTs are also not essential for the sodium dependence of
transport. Their functional role(s) therefore remain unclear.
Conclusions--
The subcellular locations of rCNT1 revealed in
the present study suggest that this protein plays important roles in
the absorption of dietary nucleosides, in their reabsorption from the
glomerular filtrate, and in their retrieval from bile. Although
pyrimidine nucleosides are likely to be physiologically the most
important substrates, rCNT1 can also transport adenosine, albeit with
lower efficiency. Transport may therefore also be important in
regulating adenosine-mediated physiological processes.
To understand the molecular mechanism of nucleoside transport, it will
be important to elucidate the three-dimensional structure of the
transporter and to identify the regions involved in substrate recognition. As a first step toward this goal, in the present study we
have investigated the topology of the protein in the membrane and have
shown that, in contrast to previous predictions, the protein spans the
membrane an odd number of times. The most likely number of
membrane-spanning helices is 13, but we do not exclude a 15-TM helix
model. Interestingly, the prokaryote transporters, which lack the first
three putative TM helices of their eukaryotic counterparts, are thus
predicted to span the membrane an even number of times, most likely 10. If so, both their N and C termini would be located on the extracellular
side of the cytoplasmic membrane. This topology contrasts with the
prediction from genomic analyses that membrane protein topologies with
cytoplasmic N and C termini are strongly preferred in most organisms so
far examined (41).
Although the additional TM helices required in a 15-TM helix model for
rCNT1, and other eukaryote CNTs are not strongly predicted by any of
the computer algorithms employed, this may reflect the fact that these
algorithms are intrinsically poor at detecting TM helices possessing
hydrophilic/charged residues. Such helices might well be involved in
forming the substrate translocation pathways of transporters. It is
perhaps noteworthy that the two regions identified as potential
additional TM helices in a 15-TM helix model contain highly conserved
sequence motifs:
(G/A/S)XX(I/V)XXX(L/I)XYXXXGXXFVFG (residues 235-254 of rCNT1) and
(A/G)XXXGXKXXXNEFVAYXXLXXY
(residues 486-507 of rCNT1), respectively. Whatever their location,
this high sequence conservation suggests that these regions represent secondary structural elements. Current research in our laboratories is
aimed at probing the topology of the C-terminal half of rCNT1 and of
the homologous bacterial nucleoside transporter NupC, to ascertain
whether or not these regions lie outside or in the membrane.
We thank J. Smith for providing
sections of perfused rat kidney.
*
This work was supported by the Medical Research Council and
the Biotechnology and Biological Sciences Research Council of the
United Kingdom, the National Cancer Institute of Canada, with funds
from the Canadian Cancer Society, the Alberta Cancer Board, and the
Natural Sciences and Engineering Research Council of Canada.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present address: Endocrine-Metabolism Division, Dept. of Medicine,
Dartmouth Medical School, Hanover, NH 03755-3844.
§§
To whom correspondence should be addressed. Tel.:
44-113-233-3173; Fax: 44-113-233-3167; E-mail:
s.a.baldwin@leeds.ac.uk.
Published, JBC Papers in Press, May 25, 2001, DOI 10.1074/jbc.M100518200
1
The abbreviations used in transporter acronyms
are: e, equilibrative; c, concentrative;
s and i, sensitive and insensitive to inhibition
by NBMPR, respectively; f, formycin B (nonmetabolized purine
nucleoside); t, thymidine; g, guanosine;
b, broad selectivity.
2
Other abbreviations used are: NBMPR,
nitrobenzylthioinosine
(6-((4-nitrobenzyl)thio)-9-
Subcellular Distribution and Membrane Topology of the Mammalian
Concentrative Na+-Nucleoside Cotransporter rCNT1*
§,,,
,,
, and§§
School of Biochemistry and Molecular
Biology, University of Leeds, Leeds LS2 9JT, the United Kingdom,
Institute of Cell and Molecular Biology, University of
Edinburgh, Edinburgh EH9 3JR, United Kingdom, and the Membrane
Transport Research Group, Departments of ¶ Physiology and
** Oncology (Cross Cancer Institute), University of Alberta, Edmonton,
Alberta T6G 2H7, Canada
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-D-ribofuranosylpurine) (1, 2,
5). In contrast the concentrative transport processes, which have been
functionally identified in specialized tissues such as intestinal and
renal epithelia, liver, and choroid plexus, are typically insensitive
to NBMPR and have been divided into three major classes on the basis of
their permeant selectivities (1, 2). The cit
(concentrative, insensitive to NBMPR and accepts
thymidine as a permeant) processes accept pyrimidine
nucleosides and adenosine, although the latter is a poor substrate. The
cif (concentrative, insensitive to
NBMPR and accepts formycin B as a permeant) processes accept
purine nucleosides and uridine. The cib
(concentrative, insensitive to NBMPR, accepts a
broad range of permeants) processes accept both purine and
pyrimidine nucleosides. A number of minor, NBMPR-sensitive,
concentrative transport processes have also been identified (2, 6).
-helices, and it was predicted that
both the N and C termini of the protein were located on the cytoplasmic side of the membrane (7). However, no direct evidence for this topology
has so far been presented, and no predictions of the topology of the
now extended CNT family, including shorter bacterial members, have been made.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-D-glucopyranoside, and 1%
2-mercaptoethanol. They were then incubated overnight at 22 °C with
or without 0.125 unit of endoglycosidase F/N-glycosidase F
(Roche Molecular Biochemicals).
GAG). CHO-K1 cells were transfected using
LipofectAMINETM (Life Technologies, Inc.) according to the
manufacturer's instructions.
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
View larger version (36K):
[in a new window]
Fig. 1.
Effects of endoglycosidase F (endo
F) treatment on the electrophoretic mobility of recombinant
rCNT1 and hCNT1. Membranes were prepared from oocytes injected
with water (lanes A and B) or with 10 ng of
mRNA encoding rCNT1 (lanes C and D) or hCNT1
(lanes E and F). After treatment with (+) or
without ( 
) endoglycosidase F, samples (5 µg of protein) were
subjected to SDS-polyacrylamide gel electrophoresis, electroblotted
onto nitrocellulose paper, and then stained with 2 µg/ml
affinity-purified anti-rCNT1505-524. The mobilities of
standard proteins of known molecular mass are indicated by the
arrows.
View larger version (10K):
[in a new window]
Fig. 2.
Western blot analysis of the distribution of
rCNT1 in rat tissues. 70-µg samples of membranes prepared from
rat brain (B), heart (H), small intestine
(I), kidney (K), liver (L), skeletal
muscle (M), spleen (S), and testis (T)
were subjected to SDS-polyacrylamide gel electrophoresis,
electroblotted onto nitrocellulose paper, and then stained with 2 µg/ml affinity-purified anti-rCNT1505-524. The
mobilities of standard proteins of known molecular mass are indicated
by the arrows.
View larger version (58K):
[in a new window]
Fig. 3.
Immunolocalization of rCNT1 in tissue
sections. Panels A and B, low and high
magnifications of rat jejunum section stained with affinity-purified
anti-rCNT1505-524 or preimmune serum (insets).
The brush-border membrane is indicated by the arrow.
Panel C, rat liver sections stained with the same antisera.
A hepatic parenchymal cell is outlined, and the
arrow indicates the bile canalicular membrane. Panels
D-G, rat kidney sections stained with affinity-purified
anti-rCNT21-78 (D), antiserum against GST alone
(E), antiserum against the C-terminal region (residues
477-492) of rat GLUT1 (F), or control rabbit IgG
(G). Arrows in panels D and
F indicate the brush-border and basolateral surfaces of a
cortical tubule, respectively. Bar, 25 µm.
View larger version (36K):
[in a new window]
Fig. 4.
Effects of endoglycosidase F (endo
F) treatment on the electrophoretic mobilities of
recombinant wild-type rCNT1 and the rCNT1 glycosylation site mutants
N605T, N643T, and N605T/N643T. Membranes were prepared from
oocytes injected with 10 ng of mRNA encoding rCNT1 (lanes
A and B) or the mutants N605T (lanes C and
D), N643T (lanes E and F), or
N605T/N643T (lanes G and H), or with water
(lanes I and J). After treatment with (+) or
without ( ) endoglycosidase F, Western blots of samples (5 µg of
protein) were stained with 2 µg/ml affinity-purified
anti-rCNT1505-524. The mobilities of standard proteins of
known molecular mass are indicated by the arrows on the
right, and the apparent molecular masses of the four major
protein bands visible on the blot are indicated on the
left.
View larger version (39K):
[in a new window]
Fig. 5.
Effects of endoglycosidase F (endo
F) treatment on the electrophoretic mobilities of
recombinant wild-type rCNT1 and the rCNT1 glycosylation-site mutants
N605T/N643T/Q6T and N605T/N643T/200 
GLUT4.
Membranes were prepared from oocytes injected with 10 ng of mRNA
encoding wild-type rCNT1 (lanes A and B) or the
mutants N605T/N643T/Q6T (lanes C and D) or
N605T/N643T/200GLUT4 (lanes E and F). After
treatment with (+) or without () endoglycosidase F, Western blots of
samples (5 µg of protein) were stained with 2 µg/ml
affinity-purified anti-rCNT1505-524. The mobilities of
standard proteins of known molecular mass are indicated by the
arrows.
GLUT4) retained 64.6 ± 10.0% of the
uridine transport activity of the recombinant wild-type protein when
produced in Xenopus oocytes, suggesting that it was inserted
properly into the oocyte membrane during biosynthesis. However, like
the Q6T mutant, its mobility on SDS-polyacrylamide gel electrophoresis
was unaffected by treatment with endoglycosidase F, indicating that the
introduced glycosylation site was not glycosylated (Fig. 5). This
result is compatible with the original prediction (7) that the region
containing residues 198-204 of rCNT1 is exposed at the cytoplasmic
surface of the oocyte membrane.
View larger version (27K):
[in a new window]
Fig. 6.
Orientation of the N terminus of
rCNT1. CHO cells on glass coverslips were transfected with
(panels A and B) or without (panel C)
the plasmid pDAH1, encoding rCNT1. Two days after transfection, cells
were fixed in paraformaldehyde and stained with
anti-rCNT146-67 in the presence (panels A and
C) or absence (panel B) of 0.1% saponin to
permeabilize the plasma membrane. Bound primary antibodies were
visualized using goat anti-rabbit IgG fluorescein isothiocyanate
conjugate. Bar, 25 µm.
-helices in individual sequences using a seven-state hidden mark of
model for membrane proteins (23).
View larger version (19K):
[in a new window]
Fig. 7.
TM helix predictions for the CNT family of
transporters. Computer predictions of membrane topology were
performed on 18 members of the CNT protein family as described under
"Experimental Procedures." The solid line represents the
sequence of rCNT1, with the locations of natural or introduced
(potential) glycosylation sites indicated by the arrows. The
locations of the 13 segments predicted in the present study to be TM
helices are shown as the open, numbered boxes
along the sequence, whereas the approximate locations of insertions and
deletions in the aligned sequences of 18 members of the CNT family are
shown by triangles. Beneath the representation of rCNT1 the
locations of TM helices predicted by analysis of the aligned sequences
by the TMAP and PHDhtm methods are illustrated as black
rectangles. The results of analysis of the rCNT1 sequence using
the TMHMM algorithm are also included: cross-hatched
rectangles indicate regions strongly predicted to be TM,
open rectangles indicate regions weakly predicted to be
membrane-spanning. The locations of TM helices predicted by Huang
et al. (7) are also indicated by cross-hatched
rectangles.
View larger version (42K):
[in a new window]
Fig. 8.
Topographical model of rCNT1. Potential
membrane-spanning -helices are numbered, and the
endogenous sites of N-glycosylation are indicated by
asterisks. Sites at which glycosylation motifs were
introduced (Asn4 and Arg200) and at which rCNT1
was truncated are indicated by arrows. Hatched
and open boxes indicate the regions against which antibodies
were raised. The positions of basic (Arg, Lys, His), acidic (Asp, Glu),
and polar but uncharged residues (Ser, Thr, Gln, Asn) are indicated by
open circles (
) containing plus (+)
signs, open circles () containing
minus () signs and by darkened
circles (
), respectively.
View larger version (10K):
[in a new window]
Fig. 9.
Effect of N-terminal deletions of hCNT1 and
rCNT1 on transport activity. Uridine uptake was measured in
transport buffer containing either 100 mM sodium chloride
(solid bars) or 100 mM choline chloride
(open bars). Oocytes were injected with water or with 20 ng
of RNA transcript encoding wild-type h/rCNT1 or truncated versions of
these proteins lacking the first 174 or 173 residues, respectively.
Uptakes were measured over a period of 1 h because of the low
activity of the truncated transporters relative to that of the
wild-type proteins. Values are means ± S.E. for 10-12
oocytes.
ACKNOWLEDGEMENT
FOOTNOTES
Heritage Scientist of the Alberta Heritage Foundation for
Medical Research.
-D-ribofuranosylpurine); CNT,
concentrative nucleoside transporter; TM, transmembrane; CHO, Chinese
hamster ovary; GLUT, glucose transporter; GST, glutathione
S-transferase; PBS, phosphate-buffered saline; contig, group
of overlapping clones.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
1.
Baldwin, S. A.,
Mackey, J. R.,
Cass, C. E.,
and Young, J. D.
(1999)
Mol. Med. Today
5,
216-224
2.
Cass, C. E.,
Young, J. D.,
Baldwin, S. A.,
Cabrita, M. A.,
Graham, K. A.,
Griffiths, M.,
Jennings, M. L.,
Mackey, J. R.,
Ng, A. M. L.,
Ritzel, M. W. L.,
Vickers, M. F.,
and Yao, S. Y. M.
(1999)
in
Membrane Transporters as Drug Targets
(Amidon, G. L.
, and Sadée, W., eds)
, pp. 313-352, Plenum Publishing Corp., New York
3.
Mackey, J. R.,
Baldwin, S. A.,
Young, J. D.,
and Cass, C. E.
(1998)
Drug Resist. Updates
1,
310-324
4.
Shryock, J. C.,
and Belardinelli, L.
(1997)
Am. J. Cardiol.
79,
2-10
5.
Griffith, D. A.,
and Jarvis, S. M.
(1996)
Biochim. Biophys. Acta
1286,
153-181
6.
Wang, J.,
Schaner, M. E.,
Thomassen, S.,
Su, S. F.,
Piquettemiller, M.,
and Giacomini, K. M.
(1997)
Pharm. Res. (N. Y.)
14,
1524-1532
7.
Huang, Q.-Q.,
Yao, S. Y. M.,
Ritzel, M. W. L.,
Paterson, A. R. P.,
Cass, C. E.,
and Young, J. D.
(1994)
J. Biol. Chem.
269,
17757-17760
8.
Che, M.,
Ortiz, D. F.,
and Arias, I. M.
(1995)
J. Biol. Chem.
270,
13596-13599
9.
Ritzel, M. W. L.,
Yao, S. Y. M.,
Ng, A. M. L.,
Mackey, J. R.,
Cass, C. E.,
and Young, J. D.
(1998)
Mol. Membr. Biol.
15,
203-211
10.
Ritzel, M. W. L.,
Yao, S. Y. M.,
Huang, M.-Y.,
Elliott, J. F.,
Cass, C. E.,
and Young, J. D.
(1997)
Am. J. Physiol.
272,
C707-C714
11.
Yao, S. Y. M.,
Ng, A. M. L.,
Ritzel, M. W. L.,
Gati, W. P.,
Cass, C. E.,
and Young, J. D.
(1996)
Mol. Pharmacol.
50,
1529-1535
12.
Ritzel, M. W. L.,
Ng, A. M. L.,
Yao, S. Y. M.,
Graham, K.,
Loewen, S. K.,
Smith, K. M.,
Ritzel, R. G.,
Mowles, D. A.,
Carpenter, P.,
Chen, X.-Z.,
Karpinski, E.,
Hyde, R. J.,
Baldwin, S. A.,
Cass, C. E.,
and Young, J. D.
(2001)
J. Biol. Chem.
276,
2914-2927
13.
Craig, J. E.,
Zhang, Y.,
and Gallagher, M. P.
(1994)
Mol. Microbiol.
11,
1159-1168
14.
Felipe, A.,
Valdes, R.,
del Santo, B.,
Lloberas, J.,
Casado, J.,
and Pastor-Anglada, M.
(1998)
Biochem. J.
330,
997-1001
15.
Hamilton, S. R.,
Yao, S. Y. M.,
Ingram, J.,
Henderson, P. J. F.,
Gallagher, M. P.,
Cass, C. E.,
Young, J. D.,
and Baldwin, S. A.
(1997)
J. Physiol. (Lond.)
499,
P50-P51
16.
Wang, J.,
and Giacomini, K. M.
(1999)
J. Biol. Chem.
274,
2298-2302
17.
Loewen, S. K.,
Ng, A. M. L.,
Yao, S. Y. M.,
Cass, C. E.,
Baldwin, S. A.,
and Young, J. D.
(1999)
J. Biol. Chem.
274,
24475-24484
18.
Fukumoto, H.,
Kayano, T.,
Buse, J. B.,
Edwards, Y.,
Pilch, P. F.,
Bell, G. I.,
and Seino, S.
(1989)
J. Biol. Chem.
264,
7776-7779
19.
Liman, E. R.,
Tytgat, J.,
and Hess, P.
(1992)
Neuron
9,
861-871
20.
Huang, Q. Q.,
Harvey, C. M.,
Paterson, A. R.,
Cass, C. E.,
and Young, J. D.
(1993)
J. Biol. Chem.
268,
20613-20619
21.
Davies, A.,
Ciardelli, T. L.,
Lienhard, G. E.,
Boyle, J. M.,
Whetton, A. D.,
and Baldwin, S. A.
(1990)
Biochem. J.
266,
799-808
22.
Hakes, D. J.,
and Dixon, J. E.
(1992)
Anal. Biochem.
202,
293-298
23.
Sonnhammer, E. L. L.,
von Heijne, G.,
and Krogh, A.
(1998)
in
Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology
(Glasgow, J.
, Littlejohn, T.
, Major, F.
, Lathrop, R.
, Sankoff, D.
, and Sensen, C., eds)
, pp. 175-182, AAAI Press, Menlo Park, CA
24.
Persson, B.,
and Argos, P.
(1994)
J. Mol. Biol.
237,
182-192
25.
Rost, B.,
Fariselli, P.,
and Casadio, R.
(1996)
Protein Sci.
5,
1704-1718
26.
Iseki, K.,
Sugawara, M.,
Fujiwara, T.,
Naasani, I.,
Kobayashi, M.,
and Miyazaki, K.
(1996)
Biochim. Biophys. Acta
1278,
105-110
27.
Patil, S. D.,
and Unadkat, J. D.
(1997)
Am. J. Physiol.
35,
G1314-G1320
28.
Roden, M.,
Paterson, A. R.,
and Turnheim, K.
(1991)
Gastroenterology
100,
1553-1562
29.
Young, J. D.,
Cheeseman, C. I.,
Mackey, J. R.,
Cass, C. E.,
and Baldwin, S. A.
(2000)
in
Gastrointestinal Transport
(Barrett, K. E.
, and Donowitz, M., eds)
, pp. 329-378, Academic Press, San Diego
30.
Murray, A. W.
(1971)
Annu. Rev. Biochem.
40,
811-826
31.
Che, M.,
Nishida, T.,
Gatmaitan, Z.,
and Arias, I. M.
(1992)
J. Biol. Chem.
267,
9684-9688
32.
Moseley, R. H.,
Jarose, S.,
and Permoad, P.
(1991)
Am. J. Physiol.
261,
G716-G722
33.
Ruiz-Montasell, B.,
Javier-Casado, F.,
Felipe, A.,
and Pastor-Anglada, M.
(1992)
J. Membr. Biol.
128,
227-233
34.
Thorens, B.,
Lodish, H. F.,
and Brown, D.
(1990)
Am. J. Physiol.
259,
C286-C294
35.
Le Hir, M.
(1990)
Renal. Physiol. Biochem.
13,
154-161
36.
Kaiser, S. M.,
and Quinn, R. J.
(1999)
Drug Discov. Today
4,
542-551
37.
Haspel, H. C.,
Birnbaum, M. J.,
Wilk, E. W.,
and Rosen, O. M.
(1985)
J. Biol. Chem.
260,
7219-7225
38.
Hresko, R. C.,
Kruse, M.,
Strube, M.,
and Mueckler, M.
(1994)
J. Biol. Chem.
269,
20482-20488
39.
Popov, M.,
Tam, L. Y.,
Li, J.,
and Reithmeier, R. F.
(1997)
J. Biol. Chem.
272,
18325-18332
40.
von Heijne, G.
(1992)
J. Mol. Biol.
225,
487-494
41.
Krogh, A.,
Larsson, B.,
von Heijne, G.,
and Sonnhammer, E. L.
(2001)
J. Mol. Biol.
305,
567-580
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. D. Slugoski, K. M. Smith, A. M. L. Ng, S. Y. M. Yao, E. Karpinski, C. E. Cass, S. A. Baldwin, and J. D. Young Conserved Glutamate Residues Glu-343 and Glu-519 Provide Mechanistic Insights into Cation/Nucleoside Cotransport by Human Concentrative Nucleoside Transporter hCNT3 J. Biol. Chem., June 19, 2009; 284(25): 17266 - 17280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Slugoski, A. M. L. Ng, S. Y. M. Yao, C. C. Lin, R. Mulinta, C. E. Cass, S. A. Baldwin, and J. D. Young Substituted Cysteine Accessibility Method Analysis of Human Concentrative Nucleoside Transporter hCNT3 Reveals a Novel Discontinuous Region of Functional Importance within the CNT Family Motif (G/A)XKX3NEFVA(Y/M/F) J. Biol. Chem., June 19, 2009; 284(25): 17281 - 17292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Slugoski, K. M. Smith, R. Mulinta, A. M. L. Ng, S. Y. M. Yao, E. L. Morrison, Q. O. T. Lee, J. Zhang, E. Karpinski, C. E. Cass, et al. A Conformationally Mobile Cysteine Residue (Cys-561) Modulates Na+ and H+ Activation of Human CNT3 J. Biol. Chem., September 5, 2008; 283(36): 24922 - 24934. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. Slugoski, A. M. L. Ng, S. Y. M. Yao, K. M. Smith, C. C. Lin, J. Zhang, E. Karpinski, C. E. Cass, S. A. Baldwin, and J. D. Young A Proton-mediated Conformational Shift Identifies a Mobile Pore-lining Cysteine Residue (Cys-561) in Human Concentrative Nucleoside Transporter 3 J. Biol. Chem., March 28, 2008; 283(13): 8496 - 8507. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. G. Knutson, H. Wang, C. J. Rizzo, and L. J. Marnett Metabolism and Elimination of the Endogenous DNA Adduct, 3-(2-Deoxy- -D-erythropentofuranosyl)-pyrimido[1,2-{alpha}]purine-10(3H)-one, in the Rat J. Biol. Chem., December 14, 2007; 282(50): 36257 - 36264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Y. M. Yao, A. M. L. Ng, M. D. Slugoski, K. M. Smith, R. Mulinta, E. Karpinski, C. E. Cass, S. A. Baldwin, and J. D. Young Conserved Glutamate Residues Are Critically Involved in Na+/Nucleoside Cotransport by Human Concentrative Nucleoside Transporter 1 (hCNT1) J. Biol. Chem., October 19, 2007; 282(42): 30607 - 30617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. Damaraju, A. N. Elwi, C. Hunter, P. Carpenter, C. Santos, G. M. Barron, X. Sun, S. A. Baldwin, J. D. Young, J. R. Mackey, et al. Localization of broadly selective equilibrative and concentrative nucleoside transporters, hENT1 and hCNT3, in human kidney Am J Physiol Renal Physiol, July 1, 2007; 293(1): F200 - F211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Loffler, J. C. Morote-Garcia, S. A. Eltzschig, I. R. Coe, and H. K. Eltzschig Physiological Roles of Vascular Nucleoside Transporters Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 1004 - 1013. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Smith, M. D. Slugoski, S. K. Loewen, A. M. L. Ng, S. Y. M. Yao, X.-Z. Chen, E. Karpinski, C. E. Cass, S. A. Baldwin, and J. D. Young The Broadly Selective Human Na+/Nucleoside Cotransporter (hCNT3) Exhibits Novel Cation-coupled Nucleoside Transport Characteristics J. Biol. Chem., July 8, 2005; 280(27): 25436 - 25449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Smith, A. M. L. Ng, S. Y. M. Yao, K. A. Labedz, E. E. Knaus, L. I. Wiebe, C. E. Cass, S. A. Baldwin, X.-Z. Chen, E. Karpinski, et al. Electrophysiological characterization of a recombinant human Na+-coupled nucleoside transporter (hCNT1) produced in Xenopus oocytes J. Physiol., August 1, 2004; 558(3): 807 - 823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. Gray, L. M. Mangravite, R. P. Owen, T. J. Urban, W. Chan, E. J. Carlson, C. C. Huang, M. Kawamoto, S. J. Johns, D. Stryke, et al. Functional and Genetic Diversity in the Concentrative Nucleoside Transporter, CNT1, in Human Populations Mol. Pharmacol., March 1, 2004; 65(3): 512 - 519. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. R. Fortna, A. S. Crystal, V. A. Morais, D. S. Pijak, V. M.-Y. Lee, and R. W. Doms Membrane Topology and Nicastrin-enhanced Endoproteolysis of APH-1, a Component of the {gamma}-Secretase Complex J. Biol. Chem., January 30, 2004; 279(5): 3685 - 3693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Zhang, F. Visser, M. F. Vickers, T. Lang, M. J. Robins, L. P.C. Nielsen, I. Nowak, S. A. Baldwin, J. D. Young, and C. E. Cass Uridine Binding Motifs of Human Concentrative Nucleoside Transporters 1 and 3 Produced in Saccharomyces cerevisiae Mol. Pharmacol., December 1, 2003; 64(6): 1512 - 1520. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. F. Knight, D. M. Bader, and J. R. Backstrom Membrane Topology of Bves/Pop1A, a Cell Adhesion Molecule That Displays Dynamic Changes in Cellular Distribution during Development J. Biol. Chem., August 29, 2003; 278(35): 32872 - 32879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Crystal, V. A. Morais, T. C. Pierson, D. S. Pijak, D. Carlin, V. M.-Y. Lee, and R. W. Doms Membrane Topology of {gamma}-Secretase Component PEN-2 J. Biol. Chem., May 23, 2003; 278(22): 20117 - 20123. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Pawelczyk, M. Podgorska, and M. Sakowicz The Effect of Insulin on Expression Level of Nucleoside Transporters in Diabetic Rats Mol. Pharmacol., January 1, 2003; 63(1): 81 - 88. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Y. Yao, A. M. Ng, S. K. Loewen, C. E. Cass, S. A. Baldwin, and J. D. Young An ancient prevertebrate Na+-nucleoside cotransporter (hfCNT) from the Pacific hagfish (Eptatretus stouti) Am J Physiol Cell Physiol, July 1, 2002; 283(1): C155 - C168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Szkotak, A. M. L. Ng, J. Sawicka, S. A. Baldwin, S. F. P. Man, C. E. Cass, J. D. Young, and M. Duszyk Regulation of K+ current in human airway epithelial cells by exogenous and autocrine adenosine Am J Physiol Cell Physiol, December 1, 2001; 281(6): C1991 - C2002. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Sundaram, S. Y. M. Yao, J. C. Ingram, Z. A. Berry, F. Abidi, C. E. Cass, S. A. Baldwin, and J. D. Young Topology of a Human Equilibrative, Nitrobenzylthioinosine (NBMPR)-sensitive Nucleoside Transporter (hENT1) Implicated in the Cellular Uptake of Adenosine and Anti-cancer Drugs J. Biol. Chem., November 21, 2001; 276(48): 45270 - 45275. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |