|
Originally published In Press as doi:10.1074/jbc.M103447200 on May 31, 2001
J. Biol. Chem., Vol. 276, Issue 31, 28710-28718, August 3, 2001
Archaeal Fructose-1,6-bisphosphate Aldolases Constitute a New
Family of Archaeal Type Class I Aldolase*
Bettina
Siebers §,
Henner
Brinkmann¶,
Christine
Dörr ,
Britta
Tjaden ,
Hauke
Lilie ,
John
van der
Oost**, and
Corné H.
Verhees**
From the Department of Microbiology,
Universität Essen, 45117 Essen, the ¶ Institute of
Evolutionary Biology, Department of Biology, Universität
Konstanz, 78547 Konstanz, the Institute of Biotechnology,
Department of Biochemistry and Biotechnology,
Martin-Luther-Universität Halle, 06120 Halle (Saale), Germany,
and the ** Laboratory of Microbiology, Wageningen University,
NL-6703 CT Wageningen, The Netherlands
Received for publication, April 18, 2001, and in revised form, May 30, 2001
 |
ABSTRACT |
Fructose-1,6-bisphosphate (FBP) aldolase activity
has been detected previously in several Archaea. However, no obvious
orthologs of the bacterial and eucaryal Class I and II FBP aldolases
have yet been identified in sequenced archaeal genomes. Based on a recently described novel type of bacterial aldolase, we report on the
identification and molecular characterization of the first archaeal FBP
aldolases. We have analyzed the FBP aldolases of two hyperthermophilic
Archaea, the facultatively heterotrophic Crenarchaeon
Thermoproteus tenax and the obligately heterotrophic Euryarchaeon Pyrococcus furiosus. For enzymatic studies the
fba genes of T. tenax and P. furiosus were expressed in Escherichia coli. The
recombinant FBP aldolases show preferred substrate specificity for FBP
in the catabolic direction and exhibit metal-independent Class I FBP
aldolase activity via a Schiff-base mechanism. Transcript analyses
reveal that the expression of both archaeal genes is induced during
sugar fermentation. Remarkably, the fbp gene of T. tenax is co-transcribed with the pfp gene that codes
for the reversible PPi-dependent
phosphofructokinase. As revealed by phylogenetic analyses, orthologs of
the T. tenax and P. furiosus enzyme appear to
be present in almost all sequenced archaeal genomes, as well as in some
bacterial genomes, strongly suggesting that this new enzyme family
represents the typical archaeal FBP aldolase. Because this new family
shows no significant sequence similarity to classical Class I and II
enzymes, a new name is proposed, archaeal type Class I FBP aldolases
(FBP aldolase Class IA).
 |
INTRODUCTION |
Fructose-1,6-bisphosphate
(FBP)1 aldolase (EC 4.1.2.13)
catalyzes the reversible aldol condensation of glyceraldehyde
3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) yielding FBP.
The enzyme fulfills an amphibolic function being involved in catabolic (glycolysis) as well as anabolic pathways (gluconeogenesis and Calvin
cycle). In spite of this central function in carbohydrate metabolism,
up to now no archaeal genes coding for the respective enzyme activities
have been analyzed.
Two distinct classes of FBP aldolases occur in nature, which differ in
their enzymatic mechanisms (1-4). Class I FBP aldolases form a
Schiff-base intermediate between the carbonyl substrate (FBP and DHAP)
and the -amino group of the active site lysine residue and are
inactivated by borohydride (NaBH4), whereas Class II FBP
aldolases depend on divalent metal ions to stabilize the carbanion
intermediate and are, therefore, inhibited by EDTA. Class II enzymes of
bacterial and eucaryal origin generally form dimers with a subunit
molecular mass of ~40 kDa, whereas the Class I pendants are
heterogeneous. Eucaryal aldolases are homomeric tetramers with a
subunit molecular mass of ~40 kDa, and for bacterial enzymes
oligomeric arrangements from monomer to decamer and subunit molecular
masses of 27-40 kDa have been described (5, 6).
Sequence comparisons of Class I and II FBP aldolases revealed no
detectable sequence homology, suggesting convergent evolution (4, 5,
7-11). The latter is supported by comparisons of available crystal
structures of rabbit muscle Class I and Escherichia coli
Class II FBP aldolases indicating that even though both classes adopt a
common folding topology (( )8 triose-phosphate
isomerase (TIM)-barrel fold) and catalyze identical reactions, they
share no conserved catalytic residues, and the location of their active sites is distinct (12). However, more recent analysis combining sequence, structure, and functional information indicates that many of
the ( )8 (TIM) barrel superfamilies, such as
aldolases, TIMs, and enolases, share a common evolutionary origin
(ancestral / barrel), although they adopt a wide range of
enzymatic functions (13, 14).
The distribution of FBP aldolases during evolution is complex and still
puzzling. Class II aldolases seem to be confined to more simple
organisms such as bacteria and a few unicellular eucaryotes (fungi,
including yeast), whereas Class I FBP aldolases are present in higher
forms of life (animals, higher plants, ferns, and mosses), and only a
few bacteria possess a Class I enzyme, sometimes in addition to a Class
II enzyme. Earlier branching protists studied so far show a marked
diversity of harboring Class I and/or Class II enzymes (for review see
Refs. 5 and 10).
Recently, Thomson et al. (6) described a new type of FBP
aldolase in E. coli, which belongs to Class I aldolases
according to its Schiff-base mechanism but differs significantly from
the other members of this class by its low sequence similarity. The E. coli Class I FBP aldolase was originally mis-annotated in
the E. coli genome as dehydrin (DhnA, dhnA gene)
due to its overall identity (13-20%) to dehydrins in plants, which
are stress proteins that are induced in response to dehydration (6).
Although Class I and Class II FBP aldolase activities have been
demonstrated in Archaea (15-21), no genes encoding classical Class I
or II enzymes have been identified in any of the sequenced archaeal
genomes suggesting that Archaea possess novel types of aldolases that
are either absent or not yet recognized as such in Bacteria and
Eucarya. The latter is supported by initial data base searches of
Galperin et al. (22) who identified gene homologs of the
unusual Class I FBP aldolase gene (dhnA) of E. coli in the sequenced archaeal genomes. However, none of
this archaeal gene products was examined with respect to its enzymatic
function. In order to prove that DhnA homologs in the two major
archaeal kingdoms code for FBP aldolases, we expressed the
dhnA gene homologs of the crenarchaeote Thermoproteus
tenax and the euryarchaeote Pyrococcus furiosus in
E. coli, and we analyzed the function of their gene
products. The two hyperthermophiles differ from each other not only
with respect to phylogeny but also with respect to physiology. T. tenax is a facultative chemoorganotroph (23, 24), and P. furiosus is an obligate chemoorganotroph (25). T. tenax
uses two different pathways for carbohydrate catabolism, i.e. a modified, non-phosphorylative Entner-Doudoroff
pathway and a variant of the reversible Embden-Meyerhof-Parnas pathway (19, 26). The latter is characterized by a
PPi-dependent phosphofructokinase (PPi-PFK) (27), two different glyceraldehyde-3-phosphate
dehydrogenases (28, 29), and a pyruvate kinase with reduced allosteric
potential (30). P. furiosus possesses one catabolic pathway,
a variant of the Embden-Meyerhof-Parnas pathway that differs
significantly from the T. tenax variant (21) and involves an
ADP-dependent glucokinase (31), an
ADP-dependent PFK (32), a canonical
glyceraldehyde-3-phosphate dehydrogenase, and a
ferredoxin-dependent glyceraldehyde-3-phosphate oxidoreductase
(33, 34).
 |
EXPERIMENTAL PROCEDURES |
Chemicals and Plasmids--
DL-GAP was prepared from
monobarium salts of the diethyl acetyl, according to the
manufacturer's instructions (Sigma). All other chemicals and enzymes
were purchased from Sigma, Merck, or Roche Diagnostics GmbH in
analytical grade. For heterologous expression the vectors pET-15b and
pET-24d (Novagen) and for generating antisense mRNA the vector pSPT
19 (Roche Diagnostics GmbH) were used.
Strains and Growth Conditions--
Mass cultures of T. tenax Kra1 (DSM 2078) were grown as described previously (19).
P. furiosus (DSM 3638) was grown in CDM medium as described
previously (35) with the only exception that yeast extract was omitted
and substituted by the individual amino acids (0.25 mM
final concentration). Maltose (10 mM) or pyruvate (40 mM) was added as the primary carbon source. E. coli strains DH5 (Life Technologies, Inc.), XL1Blue
(Stratagene), BL21(DE3), and BL21(DE3)pLysS (Novagen) for cloning and
expression studies were grown under standard conditions (36) following the instructions of the manufacturer.
Enzyme Assay--
The FBP aldolase activity was determined in
catabolic direction (FBP cleavage) at 50 °C in a coupled assay with
glycerol-3-phosphate dehydrogenase (EC 1.1.1.8) and triose-phosphate
isomerase (TIM, EC 5.3.1.1) of rabbit muscle as auxiliary enzymes. For
the T. tenax enzyme the assay (total volume 1 ml) was
performed in 100 mM Tris/HCl (pH 7.0, 50 °C) in the
presence of 0.4 mM NADH, 5 mM FBP, 4 units of
glycerol-3-phosphate dehydrogenase, and 20 units of TIM. Enzymatic
activities were measured by monitoring the increase in absorption at
366 nm ( 50 °C = 3.36 mM 1
cm 1). The assay mixture (1-ml volume) for the P. furiosus FBP aldolase contained 50 mM Tris/HCl (pH
7.0, 50 °C), 0.2 mM NADH, 2.5 mM FBP, 4 units of glycerol-3-phosphate dehydrogenase, and 11 units of TIM. The
absorbance was followed at 340 nm ( = 6.3 mM 1 cm 1).
Reactions were started by addition of the substrate FBP, and the enzyme
concentrations ranged from 2 to 40 µg of protein/ml test volume. To
determine the substrate specificity of the FBP aldolases, the standard
enzyme assay was used substituting FBP by other substrates, such as
fructose 1-phosphate (Fru-1-P). For effector studies citrate was
added to an end concentration of 10 mM in the presence of
half-saturating concentrations of FBP. To test the metal ion
requirement, up to 10 mM EDTA or different metal ions (0.1 and 1 mM) were added to the mixture. Protein concentration was measured according to the method of Bradford (37) using the Bio-Rad
Protein-Assay (Bio-Rad) with BSA as standard.
Active Site Labeling--
To investigate the involvement of a
Schiff-base mechanism, the FBP aldolase of T. tenax (0.09 mg
of protein) was incubated at room temperature in 50 mM
HEPES/KOH (pH 7.5), 100 mM NaBH4 (1 M stock solution in 10 mM NaOH) in the presence
or absence of saturating concentrations (10 mM) of
DL-GAP, DHAP, or FBP (total volume 250 µl). After 10 min
the samples were dialyzed twice against 2 liters of 20 mM
Tris/HCl (pH 8.5, 4 °C; overnight) and assayed for FBP aldolase
activity. The assay was performed at 70 °C using the
non-phosphorylating NAD+-dependent
glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.9) (28) of T. tenax as auxiliary enzyme. The assay (total volume 1 ml) was
performed in 100 mM Tris/HCl (pH 7.0, 70 °C) in the presence of 5 mM NAD+, 5 mM FBP,
and 5 units of NAD+-dependent
glyceraldehyde-3-phosphate dehydrogenase. The increase in absorption
was measured at 366 nm ( 70 °C = 3.15 mM 1 cm 1).
Cloning and Sequencing of the Coding Genes--
The
identification of both genes encoding FBP aldolase (fba) was
based on significant sequence similarity to the recently described
E. coli Class I FBP aldolase (DhnA,
GenBankTM accession number P71295). The
fba gene of T. tenax (EMBL accession number AJ310483) was identified by sequencing the genomic clone (5.2-kb
HindIII fragment) harboring the pfp gene (27).
The P. furiosus gene (GenBankTM accession
number AF368256, NCBI) was identified in the P. furiosus
data base (www.genome.utah.edu).
Expression of the FBP Aldolases in E. coli--
For
expression of the T. tenax FBP aldolase, the coding region
was cloned into pET-15b via two new restriction sites (NcoI and BamHI) introduced by PCR mutagenesis with the primers
FBPA-f (GCTCAAGCATCCATGGCAAA, sense)
and FBPA-rev
(CCCCCGTCAGGGATCCTATC, antisense). The following primer set was designed to amplify the P. furiosus open reading frame in pET-24d (NcoI
and BamHI) and to delete an internal NcoI
restriction site using the PCR-based overlap extension method (38):
BG749 (CGCGCGCGCCATGGAGGCCCCTCAAAATGTTGG, sense), BG750
(CCGTGGTCCATCGCGAAGATTAA, antisense), BG751 (TTAATCTTCGCGATGGACCACGG, sense), and BG688
(GCGCGGATCCTCAAATGAGACCTTCTGCCTTAGC, antisense). The
introduced mutations are shown in boldface, and introduced
NcoI and BamHI restriction sites are underlined.
The sequence of both expression clones was confirmed by sequencing both
strands. Expression of the T. tenax enzyme in E. coli BL21(DE3)pLysS and of the P. furiosus enzyme in
BL21(DE3) was performed following the instructions of the manufacturer (Novagen).
Site-directed Mutagenesis of the P. furiosus FBP
Aldolase--
The active site mutation was introduced in the P. furiosus fba gene using Pfu polymerase in the PCR-based
overlap extension method (38). The following primer set was designed to
introduce mutation K191A: BG827
(AGCAGATATGATAGCGACCTATTGGAC, sense) and BG828
(GTCCAATAGGTCGCTATCATATCTGCT, antisense), the introduced
mutations are shown in boldface.
Purification of Recombinant FBP aldolases of T. tenax and P. furiosus--
For purification of the recombinant T. tenax
enzyme, 10 g of E. coli cells were resuspended in 20 ml
of 100 mM HEPES/KOH (pH 7.5) containing 300 mM
2-mercaptoethanol and passed three times through a French press cell at
150 megapascals. After centrifugation (20,000 × g, 45 min, 4 °C), the crude extract was heat-precipitated (90 °C, 30 min), centrifuged again, and dialyzed overnight against 50 mM HEPES/KOH (pH 7.5) containing 5 mM
dithiothreitol (2-liters volume, 4 °C). The dialyzed fraction was
applied to Q-Sepharose fast-flow (Amersham Pharmacia Biotech)
equilibrated in the same buffer and eluted with a linear salt gradient
of 0-500 mM KCl. Fractions containing the homogeneous
enzyme solution were pooled.
For the purification of the recombinant FBP aldolase from P. furiosus, 3 g of E. coli cells were resuspended in
10 ml of 50 mM Tris/HCl (pH 7.8). The suspension was passed
twice through a French press cell (100 megapascals), and cell debris
was removed by centrifugation (10,000 × g, 20 min,
4 °C). After heat precipitation (70 °C, 30 min) and
centrifugation, the supernatant was filtered through a 0.45-µm filter
and loaded onto a Mono Q HR 5/5 column (Amersham Pharmacia Biotech)
equilibrated in 50 mM Tris/HCl (pH 7.8). Proteins were
eluted by a linear salt gradient of 0-1000 mM NaCl. Active
fractions were pooled, concentrated by microfiltration (Centricon 30, Amicon), and applied to a Superdex 200 prep grade column (Amersham
Pharmacia Biotech), equilibrated in 50 mM Tris/HCl (pH
7.8), 100 mM NaCl. Fractions containing the homogeneous
enzyme were pooled.
Analytical Ultracentrifugation of the T. tenax FBP
Aldolase--
Sedimentation velocity and equilibrium analyses were
conducted using an analytical ultracentrifuge Optima X-LA (Beckman
Instruments, Palo Alto, CA) equipped with double sector cells and an
AnTi 50 rotor. The protein was dissolved in 50 mM HEPES/KOH
(pH 7.5) containing 100 mM KCl and 2 mM
dithiothreitol at a concentration of 0.48 mg of protein/ml.
Sedimentation velocity experiments were performed at 30,000 rpm
(20 °C), and the data were analyzed according to the sedimentation
time derivative method (39). Sedimentation equilibrium was analyzed at
6,000 rpm (20 °C) using the software provided by Beckman
Instruments. Gel filtration experiments were performed as described
previously (27).
Northern Blot Analyses of the T. tenax fba
Transcript--
Preparation of total RNA from auto- and
heterotrophically grown T. tenax cells and Northern blot
analyses were performed as described before (30). Digoxigenin-labeled
antisense mRNA of FBP aldolase and PPi-PFK were
obtained by in vitro transcription from the T7 promoter of
vector pSPT 19 (Roche Diagnostics GmbH). A part of the coding region of
FBP aldolase (502 bp) and the coding region of PPi-PFK
(1011 bp) was cloned into the EcoRI and BamHI restriction sites of the vector by PCR mutagenesis using the primer sets CGAGGAGGGGGAATTCCATA (sense) and
GAAGGTCTTGGGATCCCCCG (antisense) for
FBP aldolase and
GCTGGCCGAGCCTCTGAATTCATGAAGATAG (sense) and
CTAGGCAAAGAGGGATCCGGGGCCTAGC
(antisense) for PPi-PFK. The introduced mutations are shown
in boldface, and the EcoRI and BamHI restriction
sites are underlined.
Primer Extension Analyses--
Primer extension analyses for
T. tenax were performed as described previously (30). To map
the transcription start site of the fba-pfp
transcript the 5'-32P-labeled antisense oligonucleotide
(5'-CCGTGCTCAATGCCGTGG-3', position 72-89 of the fba gene)
was used as primer for cDNA synthesis. For P. furiosus
total RNA was isolated from maltose and pyruvate grown cells as
described previously (40), and the transcription start was determined
with a fluorescence (IRD800)-labeled antisense oligonucleotide
(5'-CAAAGTCCGTAGGGCCGTGC-3' (MWG), position 99-118 of the
fba gene). The primer extension reaction was performed using
the Reverse Transcription System (Promega) according to the
instructions of the manufacturer with the following modifications. Hybridization of total RNA (15 µg) and oligonucleotide (5 pmol) was
performed for 10 min at 68 °C before allowing to cool to room temperature. The reaction (20-µl final volume) was started by addition of dNTPs (1 mM), MgCl2 (5 mM), RNAsin (20 units), and Avian Myeloblastosis
Virus reverse transcriptase (22.5 units). After incubation for 30 min
at 45 °C, the reaction volume was diluted to 50 µl with 10 mM Tris/HCl (pH 8.5), 1 µl of RNase A (5 mg/ml) was
added, and the sample was incubated for 10 min at 37 °C. cDNA
was precipitated with ethanol and dissolved in 3 µl of loading
buffer, and 1 µl was applied to a sequencing gel in parallel with the
sequencing reactions obtained with the same oligonucleotide.
Sequence Retrieval and Phylogenetic Analyses--
Protein
sequences were extracted from GenBankTM and the TIGR
microbial data base using BLAST and first aligned with ClustalW (41);
this alignment was manually refined using the MUST program package
(42). Regions of uncertain alignment and partial sequences were omitted
from the analyses leaving a total of 27 sequences and 172 amino acid
positions. The topology of the phylogenetic tree was inferred using the
PROTML program of the Molphy version 2.3 package (43), starting with
the NJDIST tree using the local rearrangement and the JTT-F options. A
gamma parameter-based maximum likelihood estimate of the branch length
of the tree as well as of the statistical support for internal nodes
(quartet puzzling support values) was performed using the program
puzzle version 5 (44). Distance analyses including 1000 bootstrap
replicates were performed with the MUST package using the Kimura
correction and the neighbor joining method (45). Parsimony bootstrap
analysis was performed using PAUP* with 2000 bootstrap replicates and
10 times random addition (46). Secondary structure prediction was performed using the predictprotein program
(www.embl-heidelberg/predictprotein/) (47, 48).
 |
RESULTS |
Nucleotide Sequence of the fba Genes of T. tenax and P. furiosus--
Both fba genes were identified due to their
sequence similarity with the recently characterized Class I FBP
aldolase from E. coli (DhnA, dhnA gene) (6). The
T. tenax enzyme was identified by sequence analysis of the
genomic clone comprising the pfp gene (5.2-kb
HindIII fragment), which revealed an additional open reading frame of 792 bp (Fig. 1) preceding the
pfp gene (1014 bp) (27). This open reading frame codes for a
polypeptide of 263 amino acid residues with a calculated molecular mass
of 28.7 kDa and showed high overall similarity (26% identity, blast
data base search) to the Class I FBP aldolase (DhnA) of E. coli (6). Strikingly, the coding regions of both T. tenax genes fba and pfp overlap by 1 bp with
the A of the start codon (ATG) of the pfp gene being the
last nucleotide of the triplet encoding the C-terminal valine (GTA) of
the fba gene (Fig. 1). The fba gene of P. furiosus (846 bp) was identified in the P. furiosus
data base by similarity of the translated 31.1-kDa polypeptide (282 amino acid residues) to E. coli DhnA (26% identity, blast
data base search). Contrary to T. tenax, the P. furiosus fba gene is separated from the next neighbored downstream
open reading frame with similarity to agmatinase (speB gene)
by 61 nucleotides and therefore is presumably not organized in an
operon structure (Fig. 1).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Genomic organization and flanking regions of
the P. furiosus fba gene and the T. tenax
fba-pfp operon. Arrows represent the open
reading frames and their orientation. The enlargement shows the
overlapping regions of the fba and pfp gene in
T. tenax, and the respective protein sequence is shown in
bold letters. The fba stop codon is marked by an
asterisk, and the ATG start codon of the pfp gene
is underlined.
|
|
Expression of the fba Genes from T. tenax and P. furiosus in E. coli and Purification of Recombinant FBP Aldolases--
The
fba gene products of T. tenax and P. furiosus were expressed in E. coli, and their FBP
aldolase activity was confirmed for both enzymes using a coupled enzyme
assay. For further biochemical studies both recombinant enzymes were
purified. From 10 g wet cells of recombinant E. coli,
14 mg of homogeneous T. tenax FBP aldolase with a specific
activity of 0.23 units/mg protein (50 °C) and from 3 g wet
cells of recombinant E. coli 5 mg of homogeneous P. furiosus protein with a specific activity of 0.58 units/mg (50 °C) were recovered, respectively.
Enzymatic Properties of the Recombinant FBP Aldolases of T. tenax
and P. furiosus--
The purified, recombinant FBP aldolases of
T. tenax and P. furiosus exhibit Michaelis-Menten
kinetics for FBP in the catabolic (aldol cleavage) direction. The
Km and Vmax values for FBP
were 9 µM and 0.23 units/mg for T. tenax and
3.6 µM and 0.61 units/mg for P. furiosus and
as such were comparable to the E. coli Class I FBP aldolase
(DhnA) (Table I) (6). Like the E. coli enzyme both archaeal FBP aldolases showed additional activity with Fru-1-P, although the much higher Km value for
Fru-1-P (T. tenax 498-fold, P. furiosus 197-fold,
E. coli 1650-fold) of all three enzymes strongly suggests
that FBP is the physiological substrate (Table I). As shown for the FBP
aldolase of T. tenax other sugar phosphates such as fructose
6-phosphate, glucose 6-phosphate, fructose 2,6-bisphosphate, and
6-phosphogluconate (concentration range of 5-10 mM) do not
serve as substrates in the catabolic direction. Both archaeal FBP
aldolases, however, like the E. coli enzyme, were activated
in presence of saturating concentrations of citrate (10 mM)
by a factor of 2.2 and 2.4, respectively (Table I).
View this table:
[in this window]
[in a new window]
|
Table I
Comparative analysis of archaeal type Class I FBP aldolases
Enzyme assays for T. tenax and P. furiosus were
performed at 50 °C.
|
|
The involvement of a Schiff-base mechanism in the FBP aldolase reaction
was examined for the T. tenax enzyme by treating the enzyme
with sodium borohydride in the presence and absence of the substrates
GAP, DHAP, and FBP. The significant reduction of the specific activity
in the presence of the carbonyl substrates DHAP (38% residual
activity) and FBP (29% residual activity) as compared with the
presence of GAP (80% residual activity) and the control, after
NaBH4 treatment (100% activity, 0.8 units/mg protein,
70 °C), accounts for the formation of a Schiff-base in the enzyme
reaction. In accordance with these results, a lysine residue is
conserved at position 177 in the T. tenax sequence (Fig. 4),
which corresponds to the active site Lys-237 (falsely marked as
Lys-236) in the E. coli Class I FBP aldolase (DhnA) (6).
Finally, the observation that neither metal ions such as
Mn2+, Mg2+, Zn2+, Ca2+,
and Fe2+ (concentrations tested, 0.1 and 1 mM)
nor EDTA (concentrations tested, 0.1, 1, and 10 mM) affects
the enzyme activity supports the biochemical classification of the
T. tenax enzyme as a Class I aldolase. As shown in Fig. 4
also the P. furiosus FBP aldolase exhibits the active site
lysine residue (position 191), and the assumed involvement of a
Schiff-base mechanism was supported by site-directed mutagenesis of the
active site lysine to alanine (K191A) resulting in a virtually inactive
mutant enzyme (not shown).
Molecular Mass--
The homogeneous FBP aldolases from
T. tenax and P. furiosus revealed similar subunit
sizes in SDS-polyacrylamide gel electrophoresis of ~30 and 33 kDa,
respectively, thus being in good agreement with the calculated
molecular mass of 28.7 and 31.1 kDa. However, differences between the
two enzymes are obvious concerning their oligomeric state under native
conditions (Table I). Gel filtration experiments revealed for the
recombinant P. furiosus enzyme an apparently uniform
oligomer with a molecular mass of 272 kDa (representing presumably
octamers), whereas for the T. tenax FBP aldolase two different oligomeric forms were identified. As shown by repeated chromatography of the separated oligomers, both forms are convertible to one another. Sedimentation velocity experiments revealed two distinct oligomers with apparent sedimentation coefficients of 9.34 S
and 14.5 S indicating a slow equilibration reaction between the two
forms of the T. tenax FBP aldolase. For the smaller
association form an apparent molecular mass of 237-245 kDa was
determined by sedimentation equilibrium centrifugation suggesting a
stoichiometry of eight monomers per oligomer.
Transcript Analyses--
To determine if the expression of FBP
aldolase of T. tenax and P. furiosus is
controlled at transcriptional levels, we examined the effect of the
carbon source on fbp transcription. Since the juxtaposition
of the fba and pfp gene in T. tenax
suggests an operon organization-specific antisense mRNA probes for
the pfp and fba gene were used to test for the
formation of co-transcripts (Fig. 2).
Northern blot experiments were performed with total RNA from
autotrophically (in the presence of CO2 and H2)
and heterotrophically (in the presence of glucose) grown T. tenax cells. They revealed a strong hybridization signal for both
probes at 1.9 kb and two additional, weaker, probe-specific signals at
1.2 kb for the pfp probe and 0.8 kb for the fba
probe, thus indicating the presence of bicistronic as well as
monocistronic messages. The signals of both probes were much stronger
with mRNA from heterotrophically compared with autotrophically
grown cells (Fig. 2). Densitometric quantification of slot blot
analysis using the pfp probe and different concentrations of
total RNA (10-0.625 µg) from auto- or heterotrophically grown cells
revealed a 6-fold higher transcript abundance in the latter (data not
shown). Also in P. furiosus cells grown on maltose or
pyruvate the transcript level of the fba gene varied
similarly (dot blot analysis, data not shown). Like in T. tenax conditions favoring the catabolic direction (growth on
maltose) induce a higher transcript amount (2-3-fold increase) as
compared with anabolic conditions (growth on pyruvate).

View larger version (80K):
[in this window]
[in a new window]
|
Fig. 2.
Transcript analysis of the T. tenax
fba-pfp operon. Northern blot analysis
with digoxigenin-labeled, fba- and pfp-specific
antisense mRNAs and total RNA (5 µg) from autotrophically
(A) as well as heterotrophically (H) grown cells.
The RNA molecular size standard (left) and the derived
transcript size (arrows, right) are shown.
|
|
For a more accurate assignment of the promoter region in T. tenax and P. furiosus, the transcription starts of the
fba-pfp mRNA and the fba mRNA,
respectively, were determined by primer extension analyses. For the
T. tenax fbp-pfp operon an antisense oligonucleotide binding
at positions 72-89 of the fba gene was used. As shown in
Fig. 3A transcription is
initiated at the adenosine (A) immediately in front of the start codon
(ATG) of the fba gene (position +1). A similar proximity of
transcription and translation start site was already observed for the
pyk gene, coding for the pyruvate kinase of T. tenax (30) and corresponds with the observation that some Archaea
contain a high portion of mRNAs lacking Shine-Dalgano sequences in
front of their coding genes (49, 50). In accordance with the Northern
analyses the amount of copy DNA in the primer extension studies was by
a factor 4.5-7.1 higher in hetero- than in autotrophically grown
T. tenax cells. The transcription start of the P. furiosus fba mRNA (Fig. 3B) was initiated at the
guanosine 10 bp upstream of the ATG start codon (position +1), and in
contrast to T. tenax a putative RBS was identified.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 3.
Determination of transcript start sites and
identification of putative promoter elements. A,
mapping of the transcription start of the T. tenax
fba-pfp operon, and B, the P. furiosus
fba gene by primer extension. The transcripts begin at position +1
(arrow), and the start codon (ATG) is marked by an
asterisk, and the sequence ladder (lanes A, C, G,
and T) is shown. cDNA synthesis for T. tenax
was performed with total RNA from autotrophically (CO2,
lane 1) and heterotrophically (glucose, lane 2)
grown cells and for P. furiosus with total RNA from
pyruvate- (lane 3) and maltose (lane 4)-grown
cells. C, upstream nucleotide sequences of the T. tenax (Tt) fba and pfp gene and
the P. furiosus (Pf) fba gene. The
putative transcription factor B recognition elements (BRE
site), the TATA box promoter elements, and the ribosome-binding sites
(RBS) are marked. The mapped starting points of
transcription are marked by an arrow, and the ATG start
codons are underlined.
|
|
Inspection of the 5'-flanking regions (Fig. 3C) revealed for
the fba genes of T. tenax and P. furiosus AT-rich regions 20-30 nucleotides upstream of their
transcription start sites, which correspond well with the archaeal
promoter consensus sequences (51-53). In T. tenax the TATA
box (crenarchaeal consensus sequence (C/T)TTTTAAA) is centered around
position 25/ 26, and 2 bp ( 30 GA 31) upstream of the TATA box is
the putative transcription factor B recognition element (BRE site,
consensus sequence (A/G)N(A/T)AA(A/T)). A putative ribosome-binding
site (RBS, GGAGG) seems to be absent. In P. furiosus a
putative RBS (GGTGA) is identified at position +1 to +5, and the TATA
box is positioned around 24/ 25, and 2 bp upstream is the putative
purine-rich BRE site (54).
Phylogenetic Analyses--
Data bank searches with the
fba genes of T. tenax and P. furiosus
revealed sequences with apparent similarity to the Class I FBP
aldolases of E. coli (DhnA) in some bacterial and all
archaeal genomes, with the only exception being Thermoplasma
acidophilum. Whereas most of the genomes analyzed contain only a
single dhnA-like gene, Archaeoglobus fulgidus,
Methanococcus jannaschii, Halobacterium sp.
NRC-1, and E. coli possess two paralogous genes (22). This new FBP aldolase family represents a divergent group with sequence similarities as low as about 20% identity (based on the 172-amino acid
core region used for the phylogenetic analyses) between the different
groups. Nevertheless, despite this substantial divergence, the
universal conservation of the active site lysine (Lys-177, T. tenax; Lys-191, P. furiosus; and Lys-237,
E. coli DhnA) and an additional conserved sequence motif
preceding the active site lysine (positions 171-176 T. tenax) as well as three further conserved regions, ranging from
positions 20-27, 98-109, and 199-204 (numbering of T. tenax
fba gene), characterize them unequivocally as homologs of E. coli class I FBP aldolase (DhnA) (Fig.
4).

View larger version (109K):
[in this window]
[in a new window]
|
Fig. 4.
Multiple sequence alignment of archaeal type
Class I FBP aldolases. Boldface letters indicate amino
acid residues used in the phylogenetic analyses. The predicted
secondary structure of the T. tenax enzyme is shown
above the sequences (47, 48). Conserved sequence motifs are
shaded. The predicted phosphate-binding motif of many TIM
barrel proteins is indicated by (P) and the catalytic lysine residue
(Lys-237) determined for the E. coli Class I FBP aldolase
(DhnA) (6) and the P. furiosus enzyme (this study) by an
asterisk. The abbreviations used are as follows (accession
numbers are in parentheses; for bigger nucleotide sequences with
multiple open reading frames, first the protein and then the nucleotide
accession numbers are given): Aa, Aquifex aeolicus (O67506,
AE000745); Dv, Desulfovibrio vulgaris (TIGR); Mt,
Methanobacterium thermoautotrophicum (O26679, AE000840); Af,
Archaeoglobus fulgidus ((1) NP068949, AE001090 and (2)
NP069068, AE001099); Mj, Methanococcus jannaschii ((1)
Q57843, U67492 and (2) Q58980, U67598); Hs, Halobacterium
spec. NRC-1((1) AAG18889, AE004991 and (2) AAG19176, AE005014); Ec, E. coli (DhnA P71295, U73760 and YneB
AAC74590, AE000249); Pm, Pasteurella multocida (AAK03362,
AE006166); Rc, Rhodobacter capsulatus (U57682); Ct,
Chlorobium tepidum (TIGR); Ba, Bacillus anthracis
(TIGR); Ss, Sulfolobus solfataricus (AAK43321, AE006911);
Td, Treponema denticola (TIGR); Pf, Pyrococcus
furiosus (AF368256); Pa, P. abyssi (NP125781,
AL096836); Ph, P. horikoshii (O57840, AP000001); Ap,
Aeropyrum pernix (Q9YG90, AP000058); Tt, T. tenax
(AJ310483); Tf, Thiobacillus ferrooxidans (TIGR); Cht,
Chlamydia trachomatis (O84217, AE001273); Chm, Ch.
muridarum (AAF39333, AE002317); Chp, Ch. pneumoniae
(AAD18430, AE001613); A, Anabaena PCC7120 (AF047044).
|
|
Strikingly, DhnA homologs do not display significant overall similarity
with the members of the classical Class I and Class II FBP aldolases as
deduced from automated sequence comparison programs (e.g.
Blast search). However, by closer inspection, sequence signatures could
be identified resembling the active site region (position 177, T. tenax) and the phosphate-binding motif (position 203-204,
T. tenax) of some members of the ( )8 TIM
barrel superfamilies (13), strongly suggesting that this new family of
Class I FBP aldolases is at least distantly related to classical Class
I FBP aldolases. Moreover, secondary structure predictions (47, 48) performed with the aldolase sequences of T. tenax, P. furiosus, and Sulfolobus solfataricus not only
identified these enzymes as ( )8 barrel proteins but
also locate the functionally important residues at equivalent positions
to the ones found in classical Class I FBP aldolases as well as in
other enzymes of the ( )8 TIM barrel superfamilies
(active site lysine in 6, phosphate binding region at
the end of 7; Fig. 4) (13). From the high conservation
of these key residues we further conclude that the new type of Class I
FBP aldolase generally functions as a Schiff-base aldolase acting on
phosphorylated substrates.
To analyze the phylogenetic relationships between the various DhnA
homologs of Bacteria and Archaea, we aligned 27 sequences of 23 different species and selected a sequence fragment of 172 amino acid
residues (Fig. 4) for construction of phylogenetic trees (Fig.
5). The phylogenetic analyses include the
three mostly used methods (maximum likelihood, maximum parsimony, and
distance-based neighbor joining) and resulted in a complex tree
topology with at least 7 deeply rooting branches. Two of them bear
exclusively bacterial (branch 1B and 4B) or archaeal sequences (branch
2 and 3) and three compose both archaeal and bacterial sequences
(branch 1A, 1C, and 4A).

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 5.
Phylogenetic tree of archaeal type Class I
FBP aldolases. The numbers at the nodes are bootstrap
proportions according to Maximum likelihood (ML), Neighbor
joining (NJ), and Maximum parsinomy (MP). Only
values greater 30% are shown. Archaeal members are indicated by
boldface letters, and the biochemical characterized enzymes
are underlined. The accession numbers are given in the
alignment of Fig. 4.
|
|
 |
DISCUSSION |
Aldolases of T. tenax and P. furiosus, Members of a New Type of
Class I FBP Aldolase--
The FBP aldolases of T. tenax and
P. furiosus resemble specifically the Class I FBP aldolase
of E. coli (DhnA) not only on sequence level but also in
regard to biochemical properties. In common with E. coli
Class I FBP aldolase (DhnA), catalysis of both archaeal enzymes
proceeds via a Schiff-base mechanism. The archaeal enzymes, like the
E. coli enzyme, exhibit (i) additional enzyme activity with
Fru-1-P, albeit at a much higher Km value than for
FBP, and (ii) maximal turnover rates that are stimulated by citrate
(Table I). Finally, also with respect to quarternary structure both
archaeal aldolases show specific resemblance to the Class I enzyme of
E. coli (DhnA). All three enzymes tend to form higher
oligomerization states representing octa-/decamers or even higher
oligomers, whereas the members of the classical Class I and II FBP
aldolases form mostly tetramers or dimers, respectively. Thus,
structural features and mode of enzyme mechanism classify the FBP
aldolases of T. tenax and P. furiosus as members of a new type of Class I FBP aldolase, distinct from classical Class I
enzymes, which consists of homologs in almost all Archaea and some Bacteria.
Transcription of the fba Genes of T. tenax and P. furiosus,
Integration of the FBP Aldolases in the Physiological
Framework--
The PPi-PFK (27) and the FBP aldolase
catalyze reversible reactions of successive steps in the variant of the
Embden-Meyerhof-Parnas pathway of T. tenax, and as such both
enzymes fulfill equivalent functions in the anabolic as well as
catabolic direction of the pathway. Therefore, the co-transcription of
the fba and pfp gene gives rise to the
coordinated expression of both enzymes in T. tenax. On the
contrary, in most organisms using pathways characterized by a
unidirectional working PFK, either dependent of ATP or like in P. furiosus of ADP (21, 32), a linkage of FBP aldolase and PFK coding
genes does not seem to be meaningful. Sometimes FBP aldolase genes are
co-transcribed with genes coding for other reversible
enzymes of glycolysis (e.g. glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase) or of the Calvin cycle (e.g. ribulose bisphosphate carboxylase/oxygenase and
phosphoribulokinase) as shown for classical Class II FBP aldolases (5,
55, 56). Because FBP aldolase is an essential constituent of glycolysis as well as gluconeogenesis, it is remarkable that the fba
expression in both organisms T. tenax and P. furiosus is significantly higher under catabolic than under
anabolic growth conditions (T. tenax, glucose/CO2; P. furiosus, maltose/pyruvate). An
explanation might be that the higher transcript level under catabolic
conditions is caused by the necessity of higher carbon flux rates
through the pathway for energy conservation than is required for biosynthesis.
A New Family of Aldolases, the Archaeal Type Class I FBP
Aldolases--
Despite functional similarity with the classical Class
I FBP aldolases, the new family of Class I aldolases differs
significantly at sequence level. These non-significant average sequence
similarities as well as the absence of certain DhnA-typical motifs in
classical Class I enzymes characterize this new family of Class I FBP
aldolases as a very divergent, new type in addition to classical Class
I aldolases. However, both types of Class I FBP aldolases like
other ( )8 (TIM) barrel proteins share, beside the
predicted similar secondary structure arrangement, basic common
sequence features in regions flanking the active site lysine or engaged
in phosphate binding (13, 57).
Strikingly, all completed archaeal genomes contain at least one homolog
of this new type of Class I FBP aldolases, with the only exception of
T. acidophilum, which is supposed to use only the
non-phosphorylative Entner-Doudoroff pathway for carbohydrate metabolism (58, 59). In contrast to Archaea, only in about 50% of
completely sequenced bacterial genomes DhnA-related open reading frames
have been identified, and no eucaryal homolog has been assigned yet. At
the moment we do not know whether this new type of Class I FBP
aldolases is the only enzyme responsible for aldolase activity in
Archaea. Reports of metal-dependent Class II aldolase
enzyme activity in Haloarchaea (eg. Halobacterium halobium)
(16) suggest that additional enzymes might be present, which have not
been identified yet in the sequenced genomes, due to their low sequence
similarity to known Class I and II aldolases. Because of this so far
obviously exclusive occurrence of this new type of aldolase, together
with the absence of classical Class I and II aldolases, in Archaea and
the non-significant amino acid sequence homology to classical Class I
enzymes, we propose to classify this new family as archaeal type Class
I FBP aldolases (Class IA) to oppose them to classical Class I
aldolases only found in Eucarya and Bacteria.
Phylogenetic Implications--
The phylogenetic tree (Fig. 5) is
composed of seven deeply branching lineages each bearing members of one
or both prokaryotic domains, whose relationships among each other are
rather poorly resolved. The presence of Class IA FBP aldolases from
Bacteria and Archaea, from Euryarchaeota and Crenarchaeota
(e.g. aldolases of Euryarchaeota in branch 1A, 2, 3, 4A;
enzymes of Crenarchaeota in branch 2 and 3), or even from one organism
(e.g. enzymes of E. coli in branch 1B and 4B) in
at least two different deeply rooting main branches suggests that early
gene duplication events confer mainly to the characteristic topology of
the tree. Probably an early, first gene duplication event (before the
separation of Archaea and Bacteria) has led to a segregation into two
main paralogous lineages (1A, B, C, 2, and 3, 4A, B). Subsequent gene duplication events in each of the two main lineages combined with differential loss might have created four lineages exhibiting only Archaea (branch 2 and 3) or Bacteria and Archaea (branch 1A-C and
branch 4A, B). This scenario seems to be supported by the fact that the
separation of the main branches is in all cases clearly older than the
corresponding speciation events in the bacterial or archaeal lineages
(e.g. divergence of Euryarchaeota and Crenarchaeota, branch
2 and 3) and in two cases even older than the divergence of Bacteria
and Archaea (branch 1A-C and branch 4A, B). An example of a more recent
gene duplication is found in branch 1A leading to the isoenzymes of
A. fulgidus.
Phylogenetic analyses identified at least 4 lineages in Archaea and 2 lineages in Bacteria. The only limited presence of the archaeal type
Class I FBP aldolases in Bacteria might be explained by the assumption
of differential loss of the coding genes in some bacterial lineages.
Several independent lateral gene transfers from Archaea to Bacteria
seem to be unlikely since the branching order of archaeal enzymes
(branch 1A and 2) as well as of bacterial enzymes (branch 1B and 4B)
fits quite well with the archaeal and bacterial radiation. However,
lateral gene transfer events, most likely from Archaea to Bacteria, may
be responsible for the surprising occurrence of the aldolases of
Aquifex aeolicus and Desulfovibrio vulgaris in
branch 1A as well as of Thiobacillus ferrooxidans in branch 4A.
Surprisingly, the FBP aldolase of Treponema denticola shows
no affinity to the bacterial branch 1B but is rather closely related to
the enzyme of the Crenarchaeote S. solfataricus, with which it forms a highly supported monophyletic group. This close association may perhaps also be due to a lateral gene transfer event. If the T. denticola sequence is omitted from the tree calculation,
the S. solfataricus sequence is placed at the basis of
branch 1A (albeit with a low bootstrap support of 50), thus
complementing the archaeal lineage by a crenarchaeal member.
In summary, the archaeal type Class I aldolase genes seem to be
descendants of an ancient lineage separated very early from the gene
lineages of the classical Class I and Class II aldolases, probably
already in the common ancestor of extant life. The evolution of the new
family seems to be mainly the result of non-lateral orthologous
evolution including a complex mixture of gene duplications with
subsequent differential loss and probably some late lateral gene
transfer elements. Surprisingly, up to now no homologs of that gene
family have been identified in Eucarya, questioning whether they never
possessed these genes or secondarily lost them.
 |
ACKNOWLEDGEMENTS |
We thank T. Knura, N. Meijer, and I. Revet
for technical assistance; K. Michalke for computer assistance; and R. Hensel for critically reading the manuscript and for continuous support.
 |
FOOTNOTES |
*
This work was supported by the Deutsche
Forschungsgemeinschaft and by the Earth and Life Sciences Foundation,
which is subsidized by the Netherlands Organization for Scientific
Research.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: FB 9, Mikrobiologie, Universität Essen, Universitätsstr. 5, 45117 Essen, Germany. Tel.: 0049-201-1833442; Fax: 0049-201-1833990;
E-mail: bettina.siebers@uni-essen.de.
Published, JBC Papers in Press, May 31, 2001, DOI 10.1074/jbc.M103447200
 |
ABBREVIATIONS |
The abbreviations used are:
FBP, fructose
1,6-bisphosphate;
Fru-1-P, fructose 1-phosphate;
DHAP, dihydroxyacetone
phosphate;
GAP, glyceraldehyde 3-phosphate;
FBP aldolase, fructose-1,6-bisphosphate aldolase;
PPi-PFK, PPi-dependent phosphofructokinase;
TIM, triose-phosphate isomerase;
kb, kilobase pairs;
bp, base pair;
PCR, polymerase chain reaction;
RBS, ribosome-binding site;
BRE, transcription factor B recognition element.
 |
REFERENCES |
| 1.
|
Rutter, W. J.
(1964)
Fed. Proc.
23,
1248-1257
|
| 2.
|
Lebherz, H. G.,
and Rutter, W. J.
(1969)
Biochemistry
8,
109-121
|
| 3.
|
Alefounder, P. R.,
Baldwin, S. A.,
Perham, R. N.,
and Shorts, N. J.
(1989)
J. Biochem. (Tokyo)
257,
529-534
|
| 4.
|
Fothergill-Gilmore, L. A.,
and Michels, P. A. M.
(1993)
Biophys. Mol. Biol.
59,
105-235
|
| 5.
|
Plaumann, M.,
Pelzer-Reith, B.,
Martin, W. F.,
and Schnarrenberger, C.
(1997)
Curr. Genet.
31,
430-438
|
| 6.
|
Thomson, G. J.,
Howlett, G. J.,
Ashcroft, A. E.,
and Berry, A.
(1998)
J. Biochem. (Tokyo)
331,
437-445
|
| 7.
|
Marsh, J. J.,
and Lebherz, H. G.
(1992)
Trends Biochem. Sci.
17,
110-113
|
| 8.
|
Pelzer-Reith, B.,
Wiegand, S.,
and Schnarrenberger, C.
(1994)
Plant Physiol.
106,
1137-1144
|
| 9.
|
Gross, W.,
Bayer, M. G.,
Schnarrenberger, C.,
Gebhart, U. B.,
Maier, T. L.,
and Schenk, H. E. A.
(1994)
Plant Physiol.
105,
1393-1398
|
| 10.
|
Henze, K.,
Morrison, H. G.,
Sogin, M. L.,
and Müller, M.
(1998)
Gene (Amst.)
222,
163-168
|
| 11.
|
Witke, C.,
and Götz, F.
(1993)
J. Bacteriol.
175,
7495-7499
|
| 12.
|
Blom, N. S.,
Tétreault, St.,
Coulombe, R.,
and Sygusch, J.
(1996)
Nat. Struct. Biol.
3,
856-862
|
| 13.
|
Copley, R. R.,
and Bork, P.
(2000)
J. Mol. Biol.
303,
627-640
|
| 14.
|
Lang, D.,
Thoma, R.,
Henn-Sax, M.,
Sterner, R.,
and Wilmanns, M.
(2000)
Science
289,
1546-1550
|
| 15.
|
Fuchs, G.,
Winter, H.,
Steiner, I.,
and Stupperich, E.
(1983)
Arch. Microbiol.
136,
160-162
|
| 16.
|
Dhar, N. M.,
and Altekar, W.
(1986)
FEMS Microbiol. Lett.
35,
177-181
|
| 17.
|
Krishnan, G.,
and Altekar, W.
(1991)
Eur. J. Biochem.
195,
343-350
|
| 18.
|
Schäfer, T.,
and Schönheit, P.
(1992)
Arch. Microbiol.
158,
188-202
|
| 19.
|
Siebers, B.,
and Hensel, R.
(1993)
FEMS Microbiol. Lett.
111,
1-8
|
| 20.
|
Yu, J. P.,
Ladapo, J.,
and Whitman, W. B.
(1994)
J. Bacteriol.
176,
325-332
|
| 21.
|
Kengen, S. W.,
de Bok, F. A. M.,
van Loo, N.-D.,
Dijkema, C.,
Stams, A. J. M.,
and de Vos, W. M.
(1994)
J. Biol. Chem.
269,
17537-17541
|
| 22.
|
Galperin, M. Y.,
Aravind, L.,
and Koonin, E. V.
(2000)
FEMS Microbiol. Lett.
183,
259-264
|
| 23.
|
Zillig, W.,
Stetter, K. O.,
Schäfer, W.,
Janekovic, D.,
Wunderl, S.,
Holz, I.,
and Palm, P.
(1981)
Zbl. Bakt. Hyg. I. Abt. Orig. C
2,
205-227
|
| 24.
|
Fischer, F.,
Zillig, W.,
Stetter, K. O.,
and Schreiber, G.
(1983)
Nature
301,
511-513
|
| 25.
|
Fiala, G.,
and Stetter, K. O.
(1986)
Arch. Microbiol.
145,
56-61
|
| 26.
|
Siebers, B.,
Wendisch, V. F.,
and Hensel, R.
(1997)
Arch. Microbiol.
168,
120-127
|
| 27.
|
Siebers, B.,
Klenk, H. P.,
and Hensel, R.
(1998)
J. Bacteriol.
180,
2137-2143
|
| 28.
|
Brunner, N. A.,
Brinkmann, H.,
Siebers, B.,
and Hensel, R.
(1998)
Biochemistry
273,
6149-6156
|
| 29.
|
Brunner, N. A.,
Siebers, B.,
and Hensel, R.
(2001)
Extremophiles
5,
101-109
|
| 30.
|
Schramm, A.,
Siebers, B.,
Tjaden, B.,
Brinkmann, H.,
and Hensel, R.
(2000)
J. Bacteriol.
182,
2001-2009
|
| 31.
|
Kengen, S. W.,
Tuininga, J. E.,
de Bok, F. A. M.,
Stams, A. J. M.,
and de Vos, W. M.
(1995)
J. Biol. Chem.
270,
30453-30457
|
| 32.
|
Tuininga, J. E.,
Verhees, C. H.,
van der Oost, J.,
Kengen, S. W.,
Stams, A. J. M.,
and de Vos, W. M.
(1999)
J. Biol. Chem.
274,
21023-21028
|
| 33.
|
Mukund, S.,
and Adams, M. W. W.
(1995)
J. Biol. Chem.
270,
8389-8392
|
| 34.
|
Van der Oost, J.,
Schut, G.,
Kengen, S. W.,
Hagen, W. R.,
Thomm, M.,
and de Vos, W. M.
(1998)
J. Biol. Chem.
273,
28149-28154
|
| 35.
|
Kengen, S. W. M.,
Luesink, E. J.,
Stams, A. J. M.,
and Zehnder, A. J. B.
(1993)
Eur. J. Biochem.
213,
305-312
|
| 36.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 37.
|
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254
|
| 38.
|
Higuchi, R.,
Krummel, B.,
and Saiki, R. K.
(1988)
Nucleic Acids Res.
16,
7351-7367
|
| 39.
|
Stafford, W.
(1992)
Anal. Biochem.
203,
295-301
|
| 40.
|
Ward, D. E.,
Kengen, S.,
van der Oost, J.,
and de Vos, W. M.
(2000)
J. Bacteriol.
182,
2559-2566
|
| 41.
|
Thompson, J. D.,
Higgins, D. G.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680
|
| 42.
|
Philippe, H.
(1993)
Nucleic Acids Res.
21,
5264-5272
|
| 43.
|
Adachi, J.,
and Hasegawa, M.
(1996)
MOLPHY, version 2.3
, Institute of Statistical Mathematics, Tokyo
|
| 44.
|
Strimmer, K.,
and van Haeseler, A.
(1996)
Mol. Biol. Evol.
13,
964-969
|
| 45.
|
Saitou, N.,
and Nei, M.
(1987)
Mol. Biol. Evol.
4,
406-425
|
| 46.
|
Swofford, D. L.
(1999)
PAUP, version 4
, Sinauer Associates, Inc., Sunderland, MA
|
| 47.
|
Rost, B.,
and Sander, C.
(1993)
J. Mol. Biol.
232,
584-599
|
| 48.
|
Rost, B.,
and Sander, C.
(1994)
Proteins
19,
55-72
|
| 49.
|
Condò, I.,
Ciammaruconi, A.,
Benelli, D.,
Ruggero, D.,
and Londei, P.
(1999)
Mol. Microbiol.
34,
377-384
|
| 50.
|
Tolstrup, N.,
Sensen, C. W.,
Garrett, R. A.,
and Clausen, I. G.
(2000)
Extremophiles
4,
175-179
|
| 51.
|
Soppa, J.
(1999)
Mol. Microbiol.
31,
1295-1305
|
| 52.
|
Soppa, J.
(1999)
Mol. Microbiol.
31,
1589-1601
|
| 53.
|
Bell, S. D.,
and Jackson, S. P.
(2001)
Curr. Opin. Microbiol.
4,
208-213
|
| 54.
|
Van der Oost, J.,
Ciaramella, M.,
Moracci, M.,
Pisani, F. M.,
Rossi, M.,
and de Vos, W. M.
(1998)
Adv. Biochem. Eng. Biotechnol.
61,
87-116
|
| 55.
|
Gibson, J. L.,
Falcone, D. L.,
and Tabita, F. R.
(1991)
J. Biol. Chem.
266,
14646-14653
|
| 56.
|
Van den Bergh, E. R. E.,
Baker, S. C.,
Raggers, R. J.,
Terpstra, P.,
Woudstra, E. C.,
Dijkhuizen, L.,
and Meijer, W. G.
(1996)
J. Bacteriol.
178,
888-893
|
| 57.
|
Choi, K. H.,
Mazurkie, A. S.,
Morris, A. J.,
Utheza, D.,
Tolan, D. R.,
and Allen, K. N.
(1999)
Biochemistry
38,
12655-12664
|
| 58.
|
Budgen, N.,
and Danson, M. J.
(1986)
FEBS Lett.
196,
207-210
|
| 59.
|
Ruepp, A.,
Graml, W.,
Santos-Martinez, M.-L.,
Koretke, K. K.,
Volker, C.,
Mewes, H. W.,
Frishman, D.,
Stocker, S.,
Lupas, A. N.,
and Baumeister, W.
(2000)
Nature
407,
508-513
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. L. Menon, F. L. Poole II, A. Cvetkovic, S. A. Trauger, E. Kalisiak, J. W. Scott, S. Shanmukh, J. Praissman, F. E. Jenney Jr., W. R. Wikoff, et al.
Novel Multiprotein Complexes Identified in the Hyperthermophilic Archaeon Pyrococcus furiosus by Non-denaturing Fractionation of the Native Proteome
Mol. Cell. Proteomics,
April 1, 2009;
8(4):
735 - 751.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Kanai, J. Akerboom, S. Takedomi, H. J. G. van de Werken, F. Blombach, J. van der Oost, T. Murakami, H. Atomi, and T. Imanaka
A Global Transcriptional Regulator in Thermococcus kodakaraensis Controls the Expression Levels of Both Glycolytic and Gluconeogenic Enzyme-encoding Genes
J. Biol. Chem.,
November 16, 2007;
282(46):
33659 - 33670.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. St-Jean and J. Sygusch
Stereospecific Proton Transfer by a Mobile Catalyst in Mammalian Fructose-1,6-bisphosphate Aldolase
J. Biol. Chem.,
October 19, 2007;
282(42):
31028 - 31037.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. S. Ertunga, A. Colak, A. O. Belduz, S. Canakci, H. Karaoglu, and C. Sandalli
Cloning, Expression, Purification and Characterization of Fructose-1,6-bisphosphate Aldolase from Anoxybacillus gonensis G2
J. Biochem.,
June 1, 2007;
141(6):
817 - 825.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Woodson and J. C. Escalante-Semerena
The cbiS Gene of the Archaeon Methanopyrus kandleri AV19 Encodes a Bifunctional Enzyme with Adenosylcobinamide Amidohydrolase and {alpha}-Ribazole-Phosphate Phosphatase Activities.
J. Bacteriol.,
June 1, 2006;
188(12):
4227 - 4235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. L. Grochowski, H. Xu, and R. H. White
Ribose-5-Phosphate Biosynthesis in Methanocaldococcus jannaschii Occurs in the Absence of a Pentose-Phosphate Pathway
J. Bacteriol.,
November 1, 2005;
187(21):
7382 - 7389.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Weinberg, G. J. Schut, S. Brehm, S. Datta, and M. W. W. Adams
Cold Shock of a Hyperthermophilic Archaeon: Pyrococcus furiosus Exhibits Multiple Responses to a Suboptimal Growth Temperature with a Key Role for Membrane-Bound Glycoproteins
J. Bacteriol.,
January 1, 2005;
187(1):
336 - 348.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. Hendrickson, R. Kaul, Y. Zhou, D. Bovee, P. Chapman, J. Chung, E. Conway de Macario, J. A. Dodsworth, W. Gillett, D. E. Graham, et al.
Complete Genome Sequence of the Genetically Tractable Hydrogenotrophic Methanogen Methanococcus maripaludis
J. Bacteriol.,
October 15, 2004;
186(20):
6956 - 6969.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. J. Patron, M. B. Rogers, and P. J. Keeling
Gene Replacement of Fructose-1,6-Bisphosphate Aldolase Supports the Hypothesis of a Single Photosynthetic Ancestor of Chromalveolates
Eukaryot. Cell,
October 1, 2004;
3(5):
1169 - 1175.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Siebers, B. Tjaden, K. Michalke, C. Dorr, H. Ahmed, M. Zaparty, P. Gordon, C. W. Sensen, A. Zibat, H.-P. Klenk, et al.
Reconstruction of the Central Carbohydrate Metabolism of Thermoproteus tenax by Use of Genomic and Biochemical Data
J. Bacteriol.,
April 1, 2004;
186(7):
2179 - 2194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Lorentzen, E. Pohl, P. Zwart, A. Stark, R. B. Russell, T. Knura, R. Hensel, and B. Siebers
Crystal Structure of an Archaeal Class I Aldolase and the Evolution of ({beta}{alpha})8 Barrel Proteins
J. Biol. Chem.,
November 21, 2003;
278(47):
47253 - 47260.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. J. Schut, S. D. Brehm, S. Datta, and M. W. W. Adams
Whole-Genome DNA Microarray Analysis of a Hyperthermophile and an Archaeon: Pyrococcus furiosus Grown on Carbohydrates or Peptides
J. Bacteriol.,
July 1, 2003;
185(13):
3935 - 3947.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dorr, M. Zaparty, B. Tjaden, H. Brinkmann, and B. Siebers
The Hexokinase of the Hyperthermophile Thermoproteus tenax: ATP-DEPENDENT HEXOKINASES AND ADP-DEPENDENT GLUCOKINASES, TWO ALTERNATIVES FOR GLUCOSE PHOSPHORYLATION IN ARCHAEA
J. Biol. Chem.,
May 23, 2003;
278(21):
18744 - 18753.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. B. Eckburg, P. W. Lepp, and D. A. Relman
Archaea and Their Potential Role in Human Disease
Infect. Immun.,
February 1, 2003;
71(2):
591 - 596.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hansen, B. Reichstein, R. Schmid, and P. Schonheit
The First Archaeal ATP-Dependent Glucokinase, from the Hyperthermophilic Crenarchaeon Aeropyrum pernix, Represents a Monomeric, Extremely Thermophilic ROK Glucokinase with Broad Hexose Specificity
J. Bacteriol.,
November 1, 2002;
184(21):
5955 - 5965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Verhees, J. Akerboom, E. Schiltz, W. M. de Vos, and J. van der Oost
Molecular and Biochemical Characterization of a Distinct Type of Fructose-1,6-Bisphosphatase from Pyrococcus furiosus
J. Bacteriol.,
June 15, 2002;
184(12):
3401 - 3405.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Canback, S. G. E. Andersson, and C. G. Kurland
The global phylogeny of glycolytic enzymes
PNAS,
April 30, 2002;
99(9):
6097 - 6102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. H. Verhees, M. A. Huynen, D. E. Ward, E. Schiltz, W. M. de Vos, and J. van der Oost
The Phosphoglucose Isomerase from the Hyperthermophilic Archaeon Pyrococcus furiosus Is a Unique Glycolytic Enzyme That Belongs to the Cupin Superfamily
J. Biol. Chem.,
October 26, 2001;
276(44):
40926 - 40932.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|