HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 31, 29393-29402, August 3, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/31/29393    most recent M101778200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kim, B. Y. Articles by Akazawa, C. Search for Related Content PubMed PubMed Citation Articles by Kim, B. Y. Articles by Akazawa, C. Social Bookmarking                      What's this?

Molecular Characterization of Mammalian Homologues of Class C Vps Proteins That Interact with Syntaxin-7^*

Bong Yoon Kim, Helmut Krämer^§, Akitsugu Yamamoto^¶, Eiki Kominami, Shinichi Kohsaka, and Chihiro Akazawa^**

From the  Department of Neurochemistry, National Institute of Neuroscience, NCNP, Kodaira, Tokyo 187-8502, Japan, the ^§ Center for Basic Neuroscience, University of Texas Southwestern Medical Center, Dallas, Texas 75235-9111, the ^¶ Department of Physiology, Kansai Medical University, Moriguchi, Osaka 570-8506, Japan, and the  Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo 113-8421, Japan

Received for publication, February 27, 2001, and in revised form, May 28, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Vesicle-mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Extensive genetic studies using yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. However, their mammalian counterparts are not fully elucidated. In this study, we identified two human homologues of yeast Class C VPS genes, human VPS11 (hVPS11) and human VPS18 (hVPS18). We also characterized the subcellular localization and interactions of the protein products not only from these genes but also from the other mammalian Class C VPS homologue genes, hVPS16 and rVPS33a. The protein products of hVPS11 (hVps11) and hVPS18 (hVps18) were ubiquitously expressed in peripheral tissues, suggesting that they have a fundamental role in cellular function. Indirect immunofluorescence microscopy revealed that the mammalian Class C Vps proteins are predominantly associated with late endosomes/lysosomes. Immunoprecipitation and gel filtration studies showed that the mammalian Class C Vps proteins constitute a large hetero-oligomeric complex that interacts with syntaxin-7. These results indicate that like their yeast counterparts, mammalian Class C Vps proteins mediate vesicle trafficking steps in the endosome/lysosome pathway.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Eukaryotic cells contain highly specialized intracellular membrane-bound compartments. Vesicle trafficking between these organelles is very important for the maintenance of cell homeostasis (1, 2). Although numerous proteins and protein complexes have been characterized as having a role in intracellular vesicle transport and protein sorting, their precise mechanisms of involvement have not yet been elucidated. Genetic studies using yeast mutants have identified more than 40 vacuolar protein sorting (VPS)¹ genes coding for proteins required for vacuolar proteins transports (3-5). These vps mutants are categorized into six classes, A-F, with respect to their morphology and acidification defects (6, 7). The Class C vps mutants are characterized by remarkable abnormalities in vacuole morphology, accumulations of multivesicular bodies, temperature-sensitive growth defects, osmotic sensitivity, reduced amino acid pools, and sporulation defects (5, 6, 8-11).

There are four Class C VPS genes, VPS11, VPS16, VPS18, and VPS33. The yeast VPS11 and VPS18 genes are also known as END1/PEP5/VAM1 (8-10) and PEP3/VAM8, respectively (9, 11). The protein products of VPS11 and VPS18 contain a characteristic cysteine-rich RING-H2 finger domain in their C-terminal regions (10-13). The RING-H2 finger domain is a subfamily of the RING finger motif utilized by numerous proteins for diverse cellular functions, including oncogenesis, cell differentiation, signal transduction, and membrane vesicle trafficking (14, 15).

The Class C Vps proteins, Vps11p, Vps16p, Vps18p, and Vps33p, exist as a large detergent-insoluble HOPS (homotypic fusion and vacuole protein sorting) complex that also contains Vps39p and Vps41p. This Class C Vps/HOPS complex associates with Vam3p involved in regulating both vesicle docking/fusion and vacuole-to-vacuole fusion (12, 16-19).

Previous studies have reported that Vps18p and Vps33p share significant homology with the Drosophila gene products, deep orange (dor) and carnation (car), respectively. These proteins are associated into a large complex that localizes to the endosomal compartment and is required for membrane trafficking to lysosomes and pigment granules in Drosophila eyes (20, 21). Therefore, it appeared likely that mammalian homologues of the yeast Class C Vps proteins are also involved in protein sorting steps. Additionally, syntaxin-7, a Vam3p-related protein, was recently identified in mammals (22-25). Although there is some discrepancy regarding the precise intracellular localization of syntaxin-7, it is clear that syntaxin-7 is an essential factor for the fusion of late endosomes with lysosomes, lysosome homotypic fusion, and endocytic trafficking to late endosomes (24-26).

The functional roles of Class C Vps proteins have been extensively investigated in yeast. In contrast, relatively little is known about their mammalian counterparts. Therefore, we sought to identify and characterize Vps proteins that may control intracellular vesicle trafficking events in mammalian cells. In the present study, we identify two human VPS gene homologues, hVPS11 and hVPS18, and characterize biochemical features and intracellular localizations of Class C Vps proteins. We show that mammalian Class C Vps proteins exist as a hetero-oligomeric complex primarily associated with late endosomes/lysosomes and that the complex interacts with syntaxin-7, suggesting that it has a role in SNARE complex assembly.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation of human VPS11 and VPS18-- The GenBank^TM data base of human expressed sequence tags was searched using the Saccharomyces cerevisiae VPS11/PEP5/END1 sequences (8, 10). One of the human expressed sequence tag clones (accession number AA385518) had a distant homology to the RING-H2 finger domain region of S. cerevisiae VPS11/PEP5/END1. Two oligonucleotide polymerase chain reaction (PCR) primers (5'-AGCAGATTGCACAGGATGAG-3' and 5'-CAGAGTCAATTTGTTGAAAA-3') were designed and used to amplify a 395-base pair fragment using a HeLa cell cDNA template for PCR under standard conditions. Amplified fragments were subcloned into pGEM-T Easy vector (Promega, Madison, WI) and subsequently sequenced. The EcoRI-digested insert fragment from pGEM-T Easy vector was used as a probe for screening the human brain cDNA library constructed in ZAPII (gift from Dr. S. Nakanishi, Kyoto University, Kyoto, Japan). Ten positive clones were obtained from 1 × 10⁶ plaques screened. The clone carrying the longest insert was sequenced from both strands.

hVPS18 was identified by searching the GenBank^TM data base using S. cerevisiae VPS18/PEP3 sequences (11, 13) and Drosophila deep orange sequences (20, 21). A novel cDNA, designated KIAA1475 (GenBank^TM accession number AB040908) containing an open reading frame of 976 amino acids was found to be 34% identical to deep orange and 26% identical to S. cerevisiae VPS18/PEP3. The KIAA1475 clone was obtained from the KAZUSA DNA institute (Chiba, Japan).

Northern Blot Analyses-- A hVPS11 cDNA fragment was excised using the BamHI restriction enzyme (1808 base pairs), and a hVPS18 cDNA fragment was excised using the SacI restriction enzyme (972 base pair). Fragments were random-primed radiolabeled (Life Technologies, Inc.) and hybridization was carried out at 42 °C overnight using human multiple tissue Northern blots (CLONTECH, Palo Alto, CA) as described previously (27).

Expression Vectors-- Epitope-tagged, full-length hVPS11, hVPS18, and rVPS33a were prepared using PCR with custom-designed oligonucleotide primers containing the appropriate restriction enzyme sites. To insert full-length hVPS11 downstream of the Myc- and HA-tagged sequence at the N-terminal end, a forward primer containing the EcoRI site upstream of the initiation codon (5'-CGGAATTCAAATGGCGGCCTACCTGCA-3') and a reverse primer including the XhoI site downstream of stop codon (5'-CCTCGAGTTAAGTGCCCCTCCTGGA-3') were used to amplify PCR products from a pBluescript SK(+)-hVPS11 template. PCR products were subcloned into the pGEM-T Easy vector and subsequently sequenced. The EcoRI/XhoI-digested full-length hVPS11 was inserted into the EcoRI and XhoI site of the pMyc-CMV and pHA-CMV mammalian expression vectors (CLONTECH) to generate pMyc- and pHA-hVPS11, respectively. The N-terminally Myc- and HA-tagged hVPS18 constructs were also generated by PCR using oligonucleotide 5'-CGGAATTCCCATGGCGTCCATCCAT and 3'-CCGCTCGAGCTACAGCCAACTGAGC using the pBluescript II SK(+)-KIAA1475 clone as a template. EcoRI- and XhoI-digested full-length hVPS18 was inserted into the EcoRI and XhoI site of the pMyc-CMV and pHA-CMV mammalian expression vectors to generate pMyc- and pHA-hVPS18, respectively. A full-length rat VPS33a (GenBank^TM accession number U35244) was amplified by PCR from rat total brain cDNAs. A forward primer containing the XhoI site upstream of the initiation codon (5'-CAGATCTCGAGCGATGGCGGCTCACCT) and a reverse primer containing the EcoRI site downstream of the stop codon (5'-CAGAATTCCTAGAAAGGCTTTTCCATGA) were used to amplify PCR products. The XhoI- and EcoRI-digested full-length rVPS33a was inserted into the XhoI and EcoRI site of the pEGFP-C1 mammalian expression vector (CLONTECH) to generate GFP-rVPS33a. The N-terminally Myc-tagged full-length human syntaxin-7 (GenBank^TM accession number U77942) construct was generated by PCR using custom-designed oligonucleotide primers. The 5' primer (CGGAATTCCCATGTCTTACACTCCA) and the 3' primer (AATGCGGCCGCTCAGTGGTTCAATC) were used to amplify PCR products from a human cDNA brain library. All constructs were verified by DNA sequencing.

Cell Culture and Transfection-- COS-7, HeLa, HEK 293, NRK, and BHK cells were cultured in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum (Nippon Bio-Supply Center, Tokyo, Japan), 100 units/ml penicillin, and 100 µg/ml streptomycin in humidified incubators with 5% CO₂ at 37 °C. Plasmid DNAs were transfected into COS-7 cells using FuGENE 6 transfection regents (Roche Molecular Biochemicals).

Antibodies-- Peptides corresponding to the internal 20 amino acids of hVps11 (²²²IVSRDRKVSPKSEFTSRDSQ²⁴¹) and 14 amino acids of hVps18 (⁴²⁶RPDSLLSEERVWEY⁴³⁹) were synthesized. The peptides were coupled to m-maleimidobenzoyl N-hydroxysuccinimide ester-activated keyhole limpet hemocyanin and used as immunogens in rabbits. The polyclonal antiserum was affinity purified. Briefly, the immunogen peptides were linked to activated CH Sepharose 4B (Amersham Pharmacia Biotech), and polyclonal antiserum was affinity-purified by binding and elution from the Sepharose column. A glutathione S-transferase fusion protein containing amino acids 599-839 of hVPS16 was expressed in bacteria, purified, and used to raise antisera in rabbits. The polyclonal antiserum was affinity purified using the glutathione S-transferase-hVps16 (599) fusion protein. The monoclonal antibodies for human early endosome antigen 1 (EEA1) were purchased from Transduction Laboratories (Lexington, KY). The mouse monoclonal antibodies recognizing the transferrin receptor (CD71) and GFP (B-2) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The rabbit polyclonal antibodies recognizing GFP were purchased from CLONTECH. A mouse monoclonal anti-Myc epitope (9E10) antibody was purchased from Upstate Biotechnology (Lake Placid, NY). A rat monoclonal anti-HA (3F10) antibody was purchased from Roche Molecular Biochemicals. The mouse monoclonal antibody for lysosome-associated membrane protein-1 (Lamp-1) was a gift from Dr. M. Fukuda (The Burnham Institute, La Jolla, CA). The polyclonal antibodies for syntaxin-7 were kindly provided by Dr. Y. Wada (Osaka University, Osaka, Japan). Fluorescein isothiocyanate-conjugated affinity isolated goat anti-mouse IgG secondary antibody was purchased from BIOSOURCE (Camarillo, CA). Texas Red-conjugated affinity isolated donkey anti-rabbit IgG secondary antibody was purchased from Amersham Pharmacia Biotech.

Indirect Immunofluorescence Analyses-- For immunofluorescence microscopy, COS-7 cells were fixed in 4% paraformaldehyde in PBS for 30 min at room temperature. Cells were then permeabilized in 0.2% saponin (WAKO Co. Ltd., Tokyo, Japan) for 20 min, and nonspecific antibody binding sites were blocked with PBS containing 0.2% bovine serum albumin, 0.2% saponin, and 1% normal goat serum for 30 min at room temperature. Cells were then incubated with 2 µg/ml affinity purified anti-hVps11, anti-hVps16, or anti-hVps18 antibodies diluted in PBS containing 0.2% bovine serum albumin, 0.2% saponin and 1% normal goat serum for 2 h. After rinsing three times with PBS, cells were incubated with secondary antibodies for 1 h and then rinsed five times with PBS. Cells were mounted in Perma Fluor (Immunon, Pittsburgh, PA) and viewed under a CLSM2010 confocal laser-scanning microscope (Amersham Pharmacia Biotech).

Western Blot Analyses-- The cultured cells were washed twice with ice-cold PBS and then scraped into ice-cold homogenization buffer containing 50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and Complete^TM protease inhibitor mixture (Roche Molecular Biochemicals). The cells were rotated at 4 °C for 30 min to lyse the cells. The cells were centrifuged at 10,000 × g for 15 min, the supernatants were collected, and protein was quantitated. Supernatants were diluted into equal volumes of 2× SDS gel sample buffer (300 mM Tris-HCl, pH 6.8, 4% SDS, 10% glycerol, 0.006% bromphenol blue, 10% -mercaptoethanol) and boiled for 5 min. Samples were electrophoresed on 4/20% gradient SDS-polyacrylamide gels (Daiichi Pure Chemicals Co., Ltd., Tokyo, Japan), and electroblotted onto Immobilon-P membrane (Millipore, Bedford, MA). The blots were incubated with anti-hVps11, anti-hVps16, and anti-hVps18 antibodies for 2 h at room temperature and then incubated in horseradish peroxidase-conjugated secondary antibodies. Antibody binding was detected using the ECL protein detection kit (Amersham Pharmacia Biotech) according to the manufacturer's specifications.

Subcellular Fractionation-- HEK 293 cells grown in 10-cm dishes were washed twice with ice-cold PBS, scraped into 200 µl of PBS, and lysed by sonication. Nuclei and unlysed cells were removed by spinning the lysate at 6,000 × g for 10 min. The postnuclear supernatant was then centrifuged at 100,000 × g for 30 min at 4 °C to separate the cytosolic (supernatant) and membrane fractions (pellet). The pellets were resuspended in 200 µl of PBS containing 1% Triton X-100, incubated on ice for 1 h, and then centrifuged at 100,000 × g for 30 min. Equal portions of the cytosol and membrane fractions were separated by SDS-PAGE and analyzed by immunoblotting.

Treatment of Membranes with Various Detergents-- Membrane preparations were performed as described previously (28). Briefly, three 10-cm culture dishes of confluent HEK 293 cells were scraped into ice-cold PBS and washed once, and the cells were spun down by brief centrifugation. The cells were resuspended in 1 ml of ice-cold homogenization buffer (0.25 M sucrose, 20 mM HEPES, pH 7.0, 2 mM EGTA, 2 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, Complete^TM protease inhibitor mixture) and homogenized by brief sonication. Unlysed cells and nuclei were removed by centrifugation at 1,000 × g for 15 min. Postnuclear supernatants were divided into four aliquots (200 µl each) and centrifuged at 12,000 × g for 15 min. The pellets were resuspended in homogenization buffer containing 1.5 M NaCl; 0.2 M Na₂CO₃, pH 11.4; 5 M urea; or 1% Triton X-100. These suspensions were incubated on ice for 30 min and then centrifuged at 100,000 × g for 15 min. After centrifugation, equal portions of each supernatant and pellet were diluted into equal volumes of 2× SDS gel sample buffer, and SDS-PAGE and immunoblotting were carried out as described above.

Immunoprecipitation-- For immunoprecipitation, the cells were lysed in modified radioimmune precipitation buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, Complete^TM protease inhibitor mixture). Total cell lysates were clarified by centrifugation at 10,000 × g for 10 min, and protein concentrations were determined. Identical amounts of protein from each sample were precleared by incubation with protein A/G-Sepharose 4 fast flow (Amersham Pharmacia Biotech) for 30 min at 4 °C. After the removal of protein A/G-Sepharose by brief centrifugation, the solution was incubated with 2 µg each of anti-hVps11, anti-hVps16, anti-hVps18, polyclonal anti-GFP, monoclonal anti-Myc antibodies, or control IgGs for overnight at 4 °C. Immunoprecipitation of the antigen-antibody complex was accomplished by adding 40 µl of protein A/G-Sepharose for 1 h at 4 °C. Sepharose-bound proteins were solubilized in 40 µl of 1× SDS gel sample buffer. Samples were separated and analyzed by 4-20% gradient SDS-polyacrylamide gels and then transferred onto Immobilon-P membranes. Western blots were detected with ECL detection kits.

Gel Filtration Chromatography-- COS-7 cells transiently cotransfected with expression constructs encoding Myc-hVps11, HA-hVps18, and GFP-rVps33a. After 24 h of transfection, cells were washed ice-cold PBS and scraped into 1 ml of ice-cold homogenization buffer (20 mM HEPES-KOH, pH 7.4, 2 mM EDTA, 1 mM MgCl₂, and Complete^TM protease inhibitor mixture). Cells lysed by 15 passages through a 25 gauge needle. Nuclei and unlysed cells were removed by spinning the lysate at 6000 × g for 10 min. The postnuclear supernatants were centrifuged at 100,000 × g for 30 min at 4 °C. The 0.5 ml of resulting supernatant was loaded onto a Superose 6 gel filtration column (HR 10/30) equilibrated in homogenization buffer prior to load. The column was run at a flow rate of 1.0 ml/min using ÄKTA Explorer 10S (Amersham Pharmacia Biotech), and 1.0 ml of each fraction was collected and analyzed by SDS-polyacrylamide gel electrophoresis followed by Western blot analyses. The blots were incubated with anti-Myc, anti-HA, and anti-GFP antibodies for 2 h at room temperature and then incubated in horseradish peroxidase-conjugated secondary antibodies. Molecular weight was estimated by HMW marker kit (Amersham Pharmacia Biotech).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning of Human Homologues of Yeast VPS11 and VPS18-- To identify mammalian homologues of the yeast Class C VPS genes, we searched the expressed sequence tag data base using the BLAST (National Center for Biotechnology Information, Bethesda, MD) with the S. cerevisiae Vps11p as a query. A human expressed sequence tag clone (GenBank^TM accession number AA385518) fragment encoding a RING-H2 finger domain was identified. This cDNA fragment was used to probe a human brain cDNA library. Among the 10 positive clones, the longest open reading frame was 2823 base pairs, encoding a 941-amino acid polypeptide (Fig. 1A). A BLAST search for the non-redundunt protein data base using this open reading frame amino acid sequence as the query retrieved not only S. cerevisiae Vps11p but also homologues of other species at the high score range. In this report, we refer to this protein as human Vps11 (hVps11). The hVps11 shares 25% overall identity of amino acid sequence with S. cerevisiae Vps11p. Additionally, hVps11 shows a distant homology to proteins of unknown function from Arabidopsis thaliana (GenBank^TM accession number AC007018), Neurospora crassa (accession number AL355933), and Caenorhabditis elegans (accession number Z46794) with 39, 34, and 26% identity, respectively.

View larger version (43K): [in this window] [in a new window]   Fig. 1.   Amino acid sequences and structures of human Vps11 and Vps18. A and B, amino acid sequences of human Vps11 and Vps18. The C-terminal RING-H2 finger domain is boxed (schematic representation is shown in green), with conserved cysteine and histidine residues represented by boldface within the box. The clathrin heavy chain repeat (CHCR) domain is shown in boldface (schematic representation is shown in blue), and the coiled-coil domain is thick-underlined and boldface italic (schematic representation is shown in purple). The ATP/GTP binding motif is thin-underlined and boldface (schematic representation is shown in black). C, amino acid alignments of RING-H2 finger domains are shown. Conserved cysteine and histidine residues are boxed with purple and blue, respectively.

The human protein homologue of yeast Vps18p, hVps18, was identified by searching the sequence data base using S. cerevisiae Vps18p and the Drosophila dor protein as a query. The KIAA1475 cDNA (GenBank^TM accession number AB040908) was found to contain an open reading frame of 976 amino acids (Fig. 1B) that displays 34% overall identity Drosophila dor protein and 26% identity with S. cerevisiae Vps18p. Furthermore, hVps18 is homologous to the A. thaliana T12C242 protein (GenBank^TM accession number AC025417), the C. elegans Pep3-related protein (accession number U23522), and the Candida albicans Vps18-related protein (accession number AJ289080) with 30, 25, and 20% identity, respectively.

hVPS11 and hVPS18 Are Ubiquitously Expressed in All Tissues Examined-- Northern blot analyses were performed to determine tissue distribution of hVPS11 and hVPS18 mRNAs. The hVPS11 mRNA (an ~3.2-kilobase pair transcript) was ubiquitously expressed, with the lowest levels in the lung and liver (Fig. 2A). The mRNA expression pattern of hVPS18 (an ~4.0-kilobase transcript) was similar to that of hVPS11 (Fig. 2B).

View larger version (28K): [in this window] [in a new window]   Fig. 2.   Analyses of hVPS11 and hVPS18 mRNA expression in human multiple tissues. Northern blot analysis of hVPS11 (A) and hVPS18 (B) in selected human tissues was performed. Two micrograms per lane of poly(A)+ RNA isolated from different human tissues (CLONTECH) were hybridized to radiolabeled hVPS11 and hVPS18 fragments. Expression of the housekeeping gene, ubiquitin, was used as an internal loading control (bottom). The exposure shown for hVPS11 was overnight (A), whereas that for hVPS18 was 5 days (B).

hVps11, hVps16, and hVps18 Are Expressed in Cell Lines from Several Species-- To determine cellular expression patterns for hVps11, hVps16, and hVps18, Western blot analyses were performed on lysates from the following cell lines: HeLa, HEK 293, COS-7, NRK, and BHK. Anti-hVps11 and anti-hVps18 antibodies recognized major bands of ~112 and 116 kDa, respectively, in lysates from all the cell lines tested (Fig. 3, A and B). The anti-hVps18 antibody recognized an additional higher molecular mass band in COS-7 and BHK cells and an ~88-kDa protein band in the HeLa, HEK 293, COS-7, and NRK cell lines. This 88-kDa band may represent a hVps18 degradation product because it was not detected in membrane fractionation experiments (see Fig. 4A). The anti-hVps16 antibody recognized a major protein band migrating at ~97 kDa in lysates from all cell lines tested (Fig. 3C).

View larger version (28K): [in this window] [in a new window]   Fig. 3.   Expression of human homologues of Class C Vps proteins in several cell lines. Western blotting of 30 µg of lysates from HeLa, HEK 293, COS-7, NRK, and BHK cells (lanes 1-5) was performed using anti-hVps11(A), anti-hVps18 (B), and anti-hVps16 (C) polyclonal antibodies. Antibody specificity was confirmed by preincubation of anti-hVps11, anti-hVps18, and anti-hVps16 with their antigens (lanes 6-10).

View larger version (18K): [in this window] [in a new window]   Fig. 4.   Subcellular distribution of human homologues of Class C Vps proteins. A, the cytosol and total membrane fractions derived from HEK 293 cells were resolved by SDS-PAGE and processed for immunoblot analysis using antibodies against hVps11, hVps18, hVps16, EEA1, and syntaxin-7. B, postnuclear membrane pellet fractions from HEK 293 cells were extracted with various disruptive agents and centrifuged at 100,000 × g, and the resulting supernatants (S) and pellets (P) were analyzed by SDS-PAGE and immunoblotted with anti-hVps11, anti-hVps18, and anti-hVps16 antibodies.

hVps11, hVps16, and hVps18 Localize to Both Cytosolic and Membrane Compartments-- Yeast Class C Vps proteins have been reported to be associated with the cytosolic face of vacuolar membranes (10-13). To determine intracellular localizations of hVps11, hVps16, and hVps18, postnuclear supernatants from HEK 293 cells were fractionated into cytosolic and membrane components and were subjected to Western blot analyses using antibodies recognizing the three proteins. The analyses showed that all three proteins exist in both the cytosolic and membrane fractions (Fig. 4A). In control experiments, EEA1 was also detected in both cytosolic and membrane fractions from HEK 293 cells, in agreement with published reports (29), whereas the transmembrane protein syntaxin-7 was detected in the membrane fraction (23). These results suggest that the human Class C Vps proteins cycle between the cytosolic and membrane-bound pools.

hVps11, hVps16, and hVps18 Are Membrane-associated-- Although hVps11, hVps16, and hVps18 lack a putative transmembrane region, they are found to be in the membrane fractions from HEK 293 cells. To elucidate the molecular mechanism of their membrane association, membrane fractions from HEK 293 cells were further extracted with 1.5 M NaCl, 5 M urea, 0.2 M sodium bicarbonate at pH 11.4, or 1% Triton X-100. The extracts were Western blotted for hVps11, hVps16, and hVps18. All three proteins were highly solubilized with urea, sodium bicarbonate, and Triton X-100 but only partially extracted with in 1.5 M NaCl (Fig. 4B). These results suggest that the proteins are primarily soluble and associated weakly with the cytosolic face of membranes.

hVps11, hVps16, and hVps18 Associate with Late Endosomes/Lysosomes-- To further determine the intracellular localizations of hVps11, hVps16, and hVps18, immunocytochemistry was performed on COS-7 cells. As shown in Fig. 5, all three proteins showed a vesicular and cytosolic staining. Staining was eliminated when antibodies were preincubated with their respective antigens (data not shown). Essentially the same stainings were observed in HeLa, NRK, and BHK cells (data not shown). We then compared the immunostaining patterns for hVps11, hVps16, and hVps18 with those of EEA1, transferrin receptor, and Lamp-1. EEA1, transferrin receptor, and Lamp-1 were selected for comparison as standard markers for early endosomes (29, 30), recycling endosomes/plasma membranes (31, 32), and late endosomes/lysosomes (33), respectively. The staining patterns of hVps11, hVps16, and hVps18 overlapped significantly with that of Lamp-1 (Fig. 5). These observations indicate that human Class C Vps proteins are associated primarily with late endosomes/lysosomes and are compatible with the fact that their yeast counterparts are involved in the late step transport to vacuoles.

View larger version (106K): [in this window] [in a new window]   Fig. 5.   Immunolocalization of hVps11, hVps18, and hVps16. Double labeling of hVps11 (a, d, and g), hVps18 (j), and hVps16 (m) with endosomal/lysosomal markers in COS-7 cells was performed. hVps11 immunoreactivity (Texas Red) (a, d, and g) was compared with immunofluorescence (fluorescein isothiocyanate) of transferrin receptor (TfR) (b), EEA1 (e), and Lamp-1 (h). hVps18 and hVps16 immunoreactivities were compared with immunoreactivity for Lamp-1 (k and n). Arrowheads indicate examples of structures positive for hVps11 (g), hVps18 (j), hVps16 (m), and Lamp-1 (h, k, and n). Merged images are shown in c, f, i, l, and o. Arrows indicate examples of colocalized vesicles. Bar = 10 µm.

Human Class C Vps Proteins Interact with Each Other in Vivo-- Previous studies have shown that yeast Class C Vps proteins form a complex within cells (12, 16-18). To test whether such a complex is formed also in mammalian cells, interactions of endogenous human Class C Vps proteins were examined by immunoprecipitation experiments. As shown in Fig. 6A, anti-hVps11 antibody co-immunoprecipitated hVps18 and hVp16. Similarly, antibodies against hVps18 and hVps16 co-immunoprecipitated the other two proteins (Fig. 6, B and C, respectively). These data unequivocally indicate that those three proteins interact with each other in vivo.

View larger version (43K): [in this window] [in a new window]   Fig. 6.   Co-immunoprecipitation of human Class C Vps proteins in HEK 293 cells. 1% Nonidet P-40-soluble fractions were immunoprecipitated from postnuclear supernatants from HEK 293 cells using affinity-purified polyclonal antibodies recognizing hVps11, hVps18, and hVps16 (control rabbit IgG was used as a negative control). Immunoprecipitates were analyzed by SDS-PAGE using the indicated antibodies: A, hVps11 immunoprecipitation blotted with anti-hVps18 and anti-hVps16 antibodies; B, hVps18 immunoprecipitation blotted with anti-hVps11 and anti-hVps16 antibodies; C, hVps16 immunoprecipitation blotted with anti-hVps11 and anti-hVps18 antibodies.

hVps11, hVps18, and rVps33a Constitute a Large Oligomeric Complex-- We also analyzed whether the other mammalian Class C Vps protein, rVps33a, is included in the complex. For this purpose, expression vectors for Myc-, HA-, and GFP-tagged mammalian Class C Vps proteins were cotransfected into COS-7 cells. HA-hVps18 and GFP-rVps33a efficiently co-immunoprecipitated with Myc-hVps11 (Fig. 7A). Similarly, Myc-hVps11 and hVps18 co-immunoprecipitated with GFP-rVps33a (Fig. 7B).

View larger version (39K): [in this window] [in a new window]   Fig. 7.   Subcellular localization of GFP-rVps33a and Gel filtration analyses of mammalian Class C Vps proteins in transfected COS-7 cells. COS-7 cells were transiently cotransfected with combinations of Myc-hVps11, HA-hVps18, GFP alone, and GFP-rVps33a. Immunoprecipitations were performed from lysates using anti-hVps11 (A) and anti-GFP (B). Immunoprecipitates were Western blotted using anti-HA antibody, anti-GFP antibody, and anti-Myc antibody. Rabbit IgG immunoprecipitates were used as negative controls. Total cell lysates were Western blotted to assess expression of the following: A, Myc-hVps11, HA-Vps18, and GFP-Vps33a; B, GFP alone, GFP-rVps33a, Myc-hVps11, and hVps18. C, GFP-rVps33a expressing COS-7 cells were immunostained using anti-hVps11 antibody to assess colocalization. Bar = 10 µm. D, the cytosolic fraction prepared from COS-7 cells transiently cotransfected with expression vectors encoding Myc-hVps11, HA-hVps18, and GFP-rVps33a was chromatographed and analyzed by SDS-PAGE. The immunoblots were probed with an anti-Myc, anti-HA, and anti-GFP antibodies to detect the proteins.

To verify the co-immunoprecipitation data, GFP-rVps33a-transfected COS-7 cells were immunostained anti-hVps11, anti-hVps18, and anti-hVps16 antibodies. GFP-rVps33a demonstrated a vesicular staining pattern and colocalized with hVps11 immunoreactivity (Fig. 7C). Similar colocalization was observed for hVps18 and hVps16 (data not shown).

In order to analyze whether mammalian Class C Vps proteins constitute a complex in vivo, COS-7 cells expressing Myc-hVps11p, HA-hVPS18p, and GFP-rVps33a were subjected to gel filtration analyses. In the cytosolic fraction of transfected COS-7 cells, these three molecules migrated to the fractions corresponding to high molecular masses (>670 kDa), suggesting that they form a large oligomeric protein complex (Fig. 7D).

Taken together with the data in Figs. 6 and 7, these results indicate that mammalian Class C Vps proteins constitute a hetero-oligomeric complex in vivo and play roles for late endosome/lysosomal trafficking pathway.

hVps11 and hVps18 Are Associated with Syntaxin-7-- Previous reports have described that the Class C Vps complex binds to Vam3p but not Vam7p or Vti1, suggesting that it may function prior to trans-SNARE pairing and is required for vesicle docking/fusion reactions (16, 19). It has also been reported that the mammalian counterpart of yeast Vam3p, syntaxin-7, is responsible for mediating endocytic trafficking to late endosomes as well as late endosome-lysosome and lysosome hetero/homotypic fusion (24-26). To examine whether this interaction is conserved between yeast and mammals, Myc-tagged human syntaxin-7 (Myc-hSyn-7) and either HA-tagged hVPS11 or HA-tagged hVPS18 were transfected into COS-7 cells and subjected to immunoprecipitation analyses. Myc-hSyn-7 was co-immunoprecipitated with both HA-hVps11 and HA-hVps18 (Fig. 8A). Similarly, when the inverse immunoprecipitation was performed, HA-tagged hVps11 and HA-tagged hVps18 were found to co-immunoprecipitate with Myc-hSyn-7 (Fig. 8B).

View larger version (52K): [in this window] [in a new window]   Fig. 8.   hVps11 and hVps18 interact with human syntaxin-7. COS-7 cells were cotransfected with the indicated combinations of HA-hVps11, HA-hVps18, and Myc-hSyn-7. After 48 h, total cell lysates were prepared and immunoprecipitated with anti-hVps11 (A, lane 2), anti-hVps18 (A, lane 4), or anti-Myc antibodies (B, lanes 2 and 4). Rabbit IgG immunoprecipitates served as negative controls (A, lanes 1 and 3; B, lanes 1 and 3). Immunoprecipitates were Western blotted using anti-Myc and anti-HA antibodies to detect co-precipitated proteins. Total cell lysates were Western blotted with anti-HA and anti-Myc antibodies to assess expression of HA-hVps11, HA-hVps18, and Myc-hSyn-7. C, Myc-hSyn-7 expressing COS-7 cells were immunostained using anti-hVps11 antibody to assess localization. Arrowheads indicate examples of structures positive for hVps11 and Myc-hSyn-7. Arrows indicate examples of colocalized vesicles. Bar = 10 µm.

To verify this result, Myc-hSyn-7-transfected COS-7 cells were immunostained anti-hVps11, anti-hVps18, and anti-hVps16 antibodies. Myc-hSyn-7 showed a vesicular staining pattern and colocalized with hVps11 immunoreactivity in some vesicle structures (Fig. 8C). Similar localization was observed for hVps18 and hVps16 (data not shown). This interaction of mammalian Class C Vps proteins and syntaxin-7 indicates that mammalian Class C Vps complex functions are at the late endocytic trafficking and membrane docking/fusion reactions of late endosomes/lysosomes.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The yeast Class C Vps proteins form a large hetero-oligomeric protein complex that mediates the delivery of vacuolar hydrolases to vacuoles and regulates homotypic vacuole fusion through interactions with Vam3p (12, 16-19). In the present study, we identified two human homologues of yeast Class C Vps proteins, hVps11 and hVps18. Furthermore, we showed that these proteins, along with other Class C Vps proteins (hVps16 and rVps33a), constitute a hetero-oligomeric complex, interact with the Vam3p homologue syntaxin-7, and associate en bloc with membranes of late endosomes/lysosomes.

A search of the data base revealed the presence of homologues of these proteins in a variety of eukaryotic organisms, including yeasts, fungi, fly, nematode, plants, and mammals. Furthermore, these proteins are highly conserved across eukaryotic species not only in their primary structure but also in their domain organization, suggesting that they share common functions in membrane trafficking. For example, both hVps11 and hVps18 and their counterparts in other species contain a C-terminal RING-H2 finger domain, a variant of the RING finger domain. The RING-H2 finger domain differs from the RING finger by the presence of a second histidine at the corresponding position of the fourth cysteine in the RING finger domain (Fig. 1C). These domains are found in various proteins that form multiprotein complexes, including those with known roles in membrane trafficking (14, 15). EEA1 has a specific lipid-binding domain, FYVE finger, which is also a variant of the RING finger domain. The FYVE finger domain binds to phosphatidylinositol 3-phosphate on early endosome membranes with high specificity and is required for early endosome localization of EEA1 (34-37). It is likely that the RING-H2 finger domains of hVps11 and hVps18 are also involved in protein-protein and/or protein-lipid interactions. In addition, hVps11 and hVps18 are predicted to form one or more -helical coiled-coil domain (38). The coiled-coil domain is conserved in a broad spectrum of membrane fusion proteins, suggesting a similar function for this domain in the Class C Vps proteins (39). Finally, hVps11 and hVps18 have a highly conserved sequence related to a region of the clathrin heavy chain repeat domains required for clathrin heavy chain self assembly and light chain binding and trimerization (Fig. 1, A and B). The clathrin heavy chain repeat domains are also found in other proteins implicated in vacuole protein sorting, such as Vam2p/Vps41p and Vam6p/Vps39p (40, 41), suggesting that the domains are responsible for their complex formation. We are currently investigating the roles of these domains in the complex formation and association with their target membranes of the mammalian Class C Vps proteins.

Northern blot and immunoblot analyses of the mammalian Vps proteins showed that they are expressed in a wide variety of tissues and cell lines, suggesting that these proteins may have common physiological functions. Previous studies in yeast demonstrated that Class C Vps proteins cofractionated with vacuolar membranes (12). Our cellular fractionation and subcellular localization studies showed that mammalian Class C Vps proteins are soluble proteins that are weakly associated with the cytosolic face of endosome/lysosome membranes. Furthermore, our immunoprecipitation and gel filtration analyses unequivocally demonstrated that all the mammalian Class C Vps proteins together constitute a hetero-oligomeric protein complex, as with the yeast counterparts. Homologues of Vps18p and Vps33p have been also identified in Drosophila: Dor and Car, respectively, the mutations of which cause defects in eye pigmentation (20, 21). Car and Vps33p belong to the family of Sec1p-related proteins, which are essential for vesicle docking and fusion by binding to the syntaxin as do SNAREs (21, 42). Biochemical studies have demonstrated that Dor and Car are part of a large protein complex associated with endosomal membranes. Phenotypic characterization of the dor and car mutants has indicated defects in the lysosomal delivery of internalized ligands and the biogenesis of the pigment granules, a compartment related to the vacuole/lysosomes (21). Collectively, the organization and functions of the Class C Vps protein complex appear to be conserved from yeast through Drosophila to mammals.

Several lines of evidence have suggested that in yeast, the molecular complex including Class C Vps proteins contain two additional regulators of vacuolar fusion and docking, Vam2p/Vps41p and Vam6p/Vps39p. This complex was termed the HOPS (homotypic fusion and vacuole protein sorting) complex and is essential for homotypic vacuole fusion and vacuole protein sorting (17, 18). Although it is not entirely clear whether mammalian Class C Vps proteins interact with the counterparts of Vam2p/Vps41p and Vam6p/Vps39p, the structural similarities between the yeast and mammalian Class C Vps proteins suggest that this may be the case.

Syntaxin-7 shares 24% identity with yeast Vam3p and is ubiquitously expressed in multiple tissues tested (22). It is localized to the late endosomes and is required for late endosome and lysosome fusion. Induced expression of mouse syntaxin-7 lacking the transmembrane domain block endocytic transport from early endosome to late endosome (24, 25). Likewise, microinjection into cells of bacterially expressed syntaxin-7 lacking the transmembrane domain or of anti-syntaxin-7 antibodies inhibits homotypic lysosome fusion and heterotypic late endosome/lysosome fusion but has no effect on homotypic early endosome fusion (26). Although there is some discrepancy regarding the localization of mammalian syntaxin-7, the syntaxin-7 expression pattern is very similar to that of hVps11 and hVps18, and both hVps11 and hVps18 interact with Myc-tagged human syntaxin-7. Taken together, it seems likely that mammalian Class C Vps proteins are also required for late endosome/lysosome fusion and the endocytic transport pathway.

Many questions still remain regarding the roles of mammalian Class C Vps proteins. Our results suggest that Class C Vps proteins are structurally and functionally conserved among yeast, Drosophila, and mammals. Understanding the interaction of mammalian Class C Vps proteins with syntaxin-7 will likely provide significant clues for studying membrane docking and fusion events in mammalian cells.

	ACKNOWLEDGEMENTS

We thank Dr. Kazuhisa Nakayama (University of Tsukuba), Dr. Noriyuki Nishimura, Dr. Hitoshi Osaka, Dr. Keiji Wada (National Institute of Neuroscience, NCNP), and Dr. Yoh Wada (Osaka University) for helpful discussion and sharing experimental materials. We also thank Dr. Colin K. Combs for critical reading of the manuscript. We dedicate this article to the memory of Dr. Kiichi Arahata (National Institute of Neuroscience, NCNP), who passed away while this project was under way.

	FOOTNOTES

^* This work was supported by the Ministry of Health, Labour and Welfare of Japan; a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan; the Japan Health Sciences Foundation (to S. K. and C. A.); and NEI Grant EY 10199; and Welch Foundation Grant I-1300 (to H. K.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EMBL Data Bank with accession number(s) AB027508 and NM_021729.

^** To whom correspondence should be addressed. Tel.: 81-42-341-2711, ext. 5233; Fax: 81-42- 567-0518; E-mail: akazawa@ncnp.go.jp.

Published, JBC Papers in Press, May 29, 2001, DOI 10.1074/jbc.M101778200

	ABBREVIATIONS

The abbreviations used are: VPS, vacuolar protein sorting; CMV, cytomegalovirus; EEA1, early endosome antigen 1; GFP, green fluorescent protein; HA, hemagglutinin; Lamp-1, lysosome-associated membrane protein-1; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptor.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				B. L. Grosshans, D. Ortiz, and P. Novick Rabs and their effectors: Achieving specificity in membrane traffic PNAS, August 8, 2006; 103(32): 11821 - 11827. [Abstract] [Full Text] [PDF]

				S. Yogosawa, S. Hatakeyama, K. I. Nakayama, H. Miyoshi, S. Kohsaka, and C. Akazawa Ubiquitylation and Degradation of Serum-inducible Kinase by hVPS18, a RING-H2 Type Ubiquitin Ligase J. Biol. Chem., December 16, 2005; 280(50): 41619 - 41627. [Abstract] [Full Text] [PDF]

				S. Pulipparacharuvil, M. A. Akbar, S. Ray, E. A. Sevrioukov, A. S. Haberman, J. Rohrer, and H. Kramer Drosophila Vps16A is required for trafficking to lysosomes and biogenesis of pigment granules J. Cell Sci., August 15, 2005; 118(16): 3663 - 3673. [Abstract] [Full Text] [PDF]

				K. C. Sadler, A. Amsterdam, C. Soroka, J. Boyer, and N. Hopkins A genetic screen in zebrafish identifies the mutants vps18, nf2 and foie gras as models of liver disease Development, August 1, 2005; 132(15): 3561 - 3572. [Abstract] [Full Text] [PDF]

				S. C. W. Richardson, S. C. Winistorfer, V. Poupon, J. P. Luzio, and R. C. Piper Mammalian Late Vacuole Protein Sorting Orthologues Participate in Early Endosomal Fusion and Interact with the Cytoskeleton Mol. Biol. Cell, March 1, 2004; 15(3): 1197 - 1210. [Abstract] [Full Text] [PDF]

				V. Poupon, A. Stewart, S. R. Gray, R. C. Piper, and J. P. Luzio The Role of mVps18p in Clustering, Fusion, and Intracellular Localization of Late Endocytic Organelles Mol. Biol. Cell, October 1, 2003; 14(10): 4015 - 4027. [Abstract] [Full Text] [PDF]

				K. Mizuno, A. Kitamura, and T. Sasaki Rabring7, a Novel Rab7 Target Protein with a RING Finger Motif Mol. Biol. Cell, September 1, 2003; 14(9): 3741 - 3752. [Abstract] [Full Text] [PDF]

				S. Liu and S. H. Leppla Cell Surface Tumor Endothelium Marker 8 Cytoplasmic Tail-independent Anthrax Toxin Binding, Proteolytic Processing, Oligomer Formation, and Internalization J. Biol. Chem., February 7, 2003; 278(7): 5227 - 5234. [Abstract] [Full Text] [PDF]

				E. Rojo, J. Zouhar, V. Kovaleva, S. Hong, and N. V. Raikhel The AtC-VPS Protein Complex Is Localized to the Tonoplast and the Prevacuolar Compartment in Arabidopsis Mol. Biol. Cell, February 1, 2003; 14(2): 361 - 369. [Abstract] [Full Text] [PDF]

				J. R. C. Whyte and S. Munro Vesicle tethering complexes in membrane traffic J. Cell Sci., January 7, 2002; 115(13): 2627 - 2637. [Abstract] [Full Text] [PDF]

This Article <