Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M101167200 on May 25, 2001

J. Biol. Chem., Vol. 276, Issue 32, 29729-29739, August 10, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/32/29729    most recent
M101167200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, B.
Right arrow Articles by Lee, M. Y. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, B.
Right arrow Articles by Lee, M. Y. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Transcriptional Regulation of the Human DNA Polymerase delta  Catalytic Subunit Gene POLD1 by p53 Tumor Suppressor and Sp1*

Baoqing Li and Marietta Y. W. LeeDagger

From the Department of Biochemistry and Molecular Biology, New York Medical College, Valhalla, New York 10595

Received for publication, February 6, 2001, and in revised form, April 23, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The DNA polymerase delta  catalytic subunit gene (POLD1) was studied as a transcriptional target of p53. Northern blotting showed that a significantly decreased steady-state level of POLD1 mRNA was associated with increased wild-type p53 expression in cells treated with methyl methanesulfonate. When ectopic wild-type p53 expression was induced to a physiologically relevant level in "tet-off" cultured cells in which p53 expression was tightly regulated by tetracycline, it was found that POLD1 steady-state mRNA was repressed by about 65%. Transient cotransfection experiments using a POLD1 promoter luciferase reporter construct showed that: (i) POLD1 promoter activity was inhibited by transfected wild-type p53 plasmid to a maximum of about 86%; (ii) p53 mediated a large part of the transcriptional repression through a sequence-specific interaction with a site identified as the P4 site of the POLD1 promoter; (iii) tumor-derived p53 mutations in the p53 DNA-binding domain completely abolished the p53 transrepression activity. Moreover, transfection assays demonstrated that p53 was able to repress Sp1-stimulated POLD1 promoter activity and that this repression was largely due to the loss of the sequence-specific interaction between Sp1 protein and the P4 Sp1-binding site, which overlaps the P4 p53-binding site. Finally, gel shift assays suggested that p53 competes with Sp1 protein for binding to the P4 sequence of the POLD1 promoter.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

DNA replication is a highly organized process that involves many enzymes and proteins, including several DNA polymerases. DNA polymerase delta  (pol delta )1 is one of the at least 12 DNA polymerases identified thus far in mammalian cells (1, 2). Studies of in vitro reconstituted SV40 DNA replication established the requirement of two DNA polymerases, pol delta  and pol alpha . pol delta  is capable of highly processive DNA synthesis in association with the molecular sliding clamp, PCNA, and thus plays a role in the synthesis of the leading strand at the replication fork. pol alpha /primase functions to synthesize RNA-DNA primers for initiation on the leading strand, but it is thought that pol delta  is required for the completion of Okazaki fragment synthesis (3, 4). Several lines of evidences have shown that pol delta  may also be involved in nucleotide excision repair (5, 6) and in base excision repair of exogenous DNA methylation damage (7). Recently, pol delta  has been found to be important for mismatch repair (8) and mitotic double-strand break-induced gene conversion (9).

The pol delta  enzyme is now thought to consist of at least four subunits in human and Schizosaccharomyces pombe (10, 11). The catalytic subunit is a 125-kDa protein that is encoded by the POLD1 gene in human cells (12). The transcriptional level of pol delta  mRNA is regulated during the cell cycle (13) and is induced in serum-stimulated cells (14). The POLD1 gene promoter is TATA-less, GC-rich, and has been reported to be activated by Sp1 and Sp3 transcriptional factors that bind specifically to two repeat sequences in the promoter (15). Nevertheless, the effects of other transcriptional factors on POLD1 promoter remain unknown.

The p53 tumor suppressor gene product functions as a checkpoint in maintaining genome stability. More than half of a wide spectrum of human cancers contain mutations in the p53 tumor suppressor gene, and more than 90% of the p53 missense mutations are clustered within the sequence-specific DNA-binding domain, suggesting that functional inactivation of p53, especially the DNA binding activity of p53, is a crucial and often obligatory step in pathways to tumorigenesis. p53 protein is induced and/or activated in response to a variety of stimuli such as DNA damage or the expression of viral oncogenes. Activation of p53 leads to one of the two major cellular pathways, either apoptosis or cell cycle arrest, that prevents cells from progressing to S phase until the damaged DNA is fully repaired (16). The transcriptional functions of p53 are well established to be important in arresting the cell cycle, although this is less clear in p53-mediated apoptosis.

As a transcription activator, p53 recognizes a specific consensus DNA sequence consisting of two copies of a 10-bp motif, 5'-PuPuPuC(A/T)(T/A)GPyPyPy-3', separated by a 0-13-bp spacer. Wild-type p53 transactivates the expression of its target genes by specifically binding to p53-binding sites in the sequences of these genes (17). Among the p53-transactivated genes is p21/WAF1/Cip1, which encodes a cyclin-dependent kinase inhibitor (18). It is evident that the p53-induced transcription of p21/WAF1/Cip1 is responsible in large measure for p53-dependent G1 arrest (19, 20). Moreover, p21/WAF1/Cip1 has been shown to directly inhibit DNA replication by binding tightly to and masking the elements on PCNA that are required for its interaction with DNA polymerase delta  (21). The product of another p53-transactivated gene, Gadd45, has been shown to interact with PCNA and inhibit DNA excision repair (22). Other evidence has also suggested that p53 may play one or more roles in regulating processes such as DNA replication, repair, and recombination (16). p53 not only acts as a transcriptional activator but also has been shown to repress the activity of a broad range of viral and cellular gene promoters that lack p53 binding sites, including but not limited to those of the alpha -fetoprotein gene (ARF), bcl-2, cdc2, c-fos, cyclooxygenase-2 gene (Cox-2), DNA topoisomerase IIalpha gene, insulin-like growth factor I receptor gene (IGF-IR), microtubule-associated protein gene (Map4), retinoblastoma gene (Rb), and Werner helicase gene (WRN) (16, 23-27).

Because of its critical role in DNA synthesis, we investigated whether the DNA polymerase delta  catalytic subunit gene, POLD1, is one of the transcriptional targets of the p53 tumor suppressor. The study described here demonstrates that the expression of the POLD1 gene mRNA is repressed by wild-type p53 in response to DNA damage. This p53-mediated repression is at the transcriptional level and is mediated largely through a specific interaction between p53 and a p53-binding site in the POLD1 promoter. Evidence was also obtained for a mechanism in which p53 exerts its repressive effect by exclusion of the binding of Sp1 transcriptional factor to a Sp1-binding site harbored within the p53 binding site.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Culture and Cell Treatments-- The cell lines Saos-2, H1299, and MDA MB231 and three lines of MCF7 were purchased from American Type Culture Collection (ATCC, Manassas, VA). Cells were cultured according to ATCC protocols. A human breast carcinoma MCF7 cell line that expresses relatively low levels of p53 under normal conditions was selected for this study. For DNA damaging agent treatment experiments, MCF7 or MDA MB231 cells were exposed to 100 µg/ml methane methylsulfonate (MMS) (Aldrich). Human colon cancer cell lines RKO and RKO mp53-13 (28) were kindly provided by Dr. M. B. Kastan, St. Jude Children's Research Hospital, Memphis, TN. H24-p53-14, a H1299 human large-cell lung carcinoma cell line (29) that expresses tetracycline-induced wild-type p53, was provided by Dr. X. Chen, Medical College of Georgia, Augusta, GA. H24-p53-14 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1.6 µg/ml tetracycline, 0.3 mg/ml G418 (Life Technologies, Inc.), and 2 µg/ml puromycin (Stratagene). For the tetracycline-dependent p53 induction experiments, H24-p53-14 cells were cultured in medium containing the indicated tetracycline concentrations (1.6 µg/ml, 40 ng/ml, 20 ng/ml, 10 ng/ml, 5 ng/ml, 2 ng/ml, or without tetracycline) and harvested 24 h after tetracycline treatment. Drosophila Schneider line 2 (SL2) cells were purchased from ATCC and grown in Schneider medium (Life Technologies, Inc.) supplemented with 10% fetal bovine serum at 25 °C.

Plasmid Constructs-- The full-length POLD1 promoter/reporter pGL-1758 was generated as described (15). Mutated POLD1 promoter constructs are shown in Fig. 5A. The promoter constructs pGL-583 and pGL-1758/-272 were generated by PCR. PCR reactions were performed using the Expand High Fidelity PCR System (Roche Molecular Biochemicals). The pGLDelta -113/-58 has a 55-bp deletion from -113 to -58 in the full-length POLD1 promoter. The full-length promoter construct pGL-1758 was double-digested at the HindIII site at the 3' end of the promoter insertion and at the PstI site at -113. The larger of the two generated fragments contains the vector sequences and a 3' deleted promoter sequence (from -1758 to -113) and was isolated for subsequent ligation with a -58 to +49 promoter PCR fragment containing a PstI site at -58 and a HindIII site at the 3' end. Site-directed mutagenesis was performed to generate the P4 p53-binding site-mutated promoter construct pGL-1758mP4 and the P4 Sp1-binding site-mutated promoter pGL-1758mSp1. Primers used for pGL-1758mP4 and pGL-1758mSp1 were 5'CCCTGCAGTCGATAAATAGGGGCGTGGCATTTACCGCACTTGGGC3' and 5'GTCGAACAAGCGGTTATTGGCCTTGCCCGC3', respectively. The underlined letters indicate the P4 Sp1-binding site, and bold italic letters indicate changes of sequence from the original promoter sequence. Mutated promoter constructs were made using the QuikChange site-directed mutagenesis kit (Stratagene). The sequences of all promoter constructs were verified by automated sequencing by the DNA Core Laboratory, University of Miami. The control p53 reporter plasmid p53-Luc was purchased from Stratagene. It has an artificial p53 promoter containing 15 repeats of consensus p53-binding sites.

The p53 expression plasmid pCMV-p53 was renamed from the pC53-SN3-p53wt plasmid (30), which was provided by Dr. B. Vogelstein, Johns Hopkins University School of Medicine, Baltimore, MD. The control vector pCMV-0 was generated by religating the vector fragment generated by the BamHI digestion of pCMV-p53. p53 point mutant expression plasmids (pCMV-L22Q/W23S pCMV-V143A, pCMV-R175H, pCMV-R248W, pCMV-R273H, and pCMV-R282) were generated using the QuikChange site-directed mutagenesis kit (Stratagene). PCR was performed to prepare the Delta Pro p53 mutant, which has a deletion from residues 63 to 91. The 1.8-kb BamHI fragment, which contains the coding sequence for p53 and other unknown sequences at both ends of the coding fragment, was isolated from the original pC53-SN3-p53wt plasmid. This fragment was ligated into the BamHI site of the pUC18 vector to generate pUC18-p53. The 5' p53 fragment containing residues 1-62 was generated by PCR. The forward primer, 5'-GGTCGACTCTAGAGG-3', was designed according to the multiple cloning site sequences on the pUC18 vector and included the GG sequence (underlined) of the GGATCC BamHI site. The reverse primer, 5'-CGGTACCGGACCTGGGTCTTC-3', was designed to include a GGTACC KpnI site (underlined). For the 3' p53 fragment containing residues 92-393, the forward primer was 5'-CCGGTACCCCTGTCATCTTCTG-3' and included a GGTACC KpnI site (underlined). The reverse primer, 5'-GCTCGGTACCCGGGG-3', was designed according to the multiple cloning site sequences on the pUC18 vector and included the GGATCC BamHI site (underlined). The PCR products from each reaction were subsequently ligated into BamHI-digested pCMV-0 vector fragment in a three-piece ligation. Because of a junctional GGTACC KpnI site, the Delta Pro mutant has two extra residues (Gly and Thr) in the deleted region. Mutated sites in all of the p53 mutants generated were verified by sequencing from both directions using the T7 Sequenase method according to the manufacturer's protocol (Amersham Pharmacia Biotech).

The Sp1 expression plasmid pPacSp1 (31) was kindly provided by Dr. R. Tijian, University of California, Berkeley, CA. The control vector pPacU was constructed by religation after excision of the XhoI insert fragment. The p53 expression vector, pPac-p53, was generated such that the p53 cDNA was driven under the control of the Drosophila actin 5C promoter. The p53 cDNA was PCR-amplified using pCMV-p53 as the template. The forward primer was 5'-ggatccGAGGAGCCGCAGTCAGATCC-3', and the reverse primer was 5'-ggatccGTCTGAGTCAGGCCC-3', both of which contain BamHI sites (underlined). The PCR product was isolated by BamHI digestion and then ligated with BamHI-linearized pPacU vector fragment. Orientation of the resulting plasmid was positively identified by PvuII/XhoI double digestion.

Northern Blotting-- Northern blotting was performed as described previously (14). Total RNA was extracted from cells using STAT60 (Tel-Test, Friendswood, TX). The POLD1 gene cDNA (12) was used as the template for PCR amplification of a probe fragment from nucleotide 2660 to 2920. The control GAPDH probe was purchased from CLONTECH as a 1.1-kb cDNA fragment. The autoradiographic images were captured with a charge-coupled device (CCD) camera (Datavision, North Falmouth, MA), and the ratio of POLD1 mRNA to GAPDH mRNA was quantified by performing densitometric analysis within the linear range of each capture signal using the Image Pro Plus software (Media Cybernetics, Silver Spring, MD).

Western Blotting and Antibodies-- Cells were lysed in Nonidet P-40 lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml pepstatin, and 10 µg/ml leupeptin). Samples of cell lysate supernatant (30 µg protein) were resolved on SDS-PAGE and transferred to nitrocellulose membranes. The membranes were incubated with 0.5-1.0 µg/ml primary antibodies. Immunocomplexes were detected by incubation with chemiluminescence-based SuperSignal substrate (Pierce) and subsequent exposure to x-ray film. The p53 monoclonal antibody PAb421 was provided by Dr. E. Harlow, Massachusetts General Hospital. The p53 monoclonal antibody DO-1 and Sp1 polyclonal antibody PEP2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-actin polyclonal antibodies (Sigma) were incubated with the same membrane following membrane stripping.

Transient Cotransfection Assays and Luciferase Reporter Gene Assays-- Saos-2 cells (1.5 × 105) were plated onto a 6-well plate and grown overnight in Opti-MEM I medium (Life Technologies, Inc.). pCMV-p53 expression plasmid or pCMV-0 control vector DNA (0.1 µg) was cotransfected with pGL-1758 reporter (0.2 µg) into Saos-2 cells using LipofectAMINE/PLUS (Life Technologies, Inc.). The medium was changed 3 h after transfection. The cells were lysed in 70 µl of reporter lysis buffer (Promega) 24 h after transfection. Transient cotransfection assays in Drosophila SL2 cells were performed at room temperature using CellFectin reagent according to the manufacturer's protocol (Life Technologies, Inc.). pPac-p53 expression plasmid DNA (0.4 µg) and/or pPac-Sp1 expression plasmid (0.2 µg) were used together with each POLD1 promoter/reporter construct (0.5 µg). pPacU plasmid was used as the control vector. The total amount of DNA for cotransfection was adjusted to 3 µg by adding pUC18 DNA. The medium was changed 5 h after transfection. Forty-eight hours after transfection, cells were collected in 1× reporter lysis buffer (Promega).

Cells transfected in 6-well plates were gently washed with cold phosphate-buffered saline (80 mM Na2HPO4, 20 mM NaH2PO4, 100 mM NaCl, pH 7.6), lysed in 70 µl of reporter lysis buffer in a luciferase assay system (Promega) for 10 min at room temperature with gentle vortexing. Cell lysates were collected and centrifuged briefly. Aliquots (10 µl) of cell extract were used for luciferase assays using 50 µl of substrate solution (Promega). Luciferase activity was measured by a luminometer (Turner Designs) with settings of 3-s delay time and 10-s integration time. Relative luciferase units were evaluated after normalization against protein concentration of each sample. Fold change was expressed as (relative luciferase unit with pCMV-p53/relative luciferase unit with pCMV-0). Values are the means ± standard deviation (error bars) of relative luciferase activity from triplicate samples in three separate experiments.

Electrophoretic Mobility Shift Assays (EMSA)-- DNA oligonucleotides were synthesized and high pressure liquid chromatography-purified by Operon Technologies, Alameda, CA. The sequences of the oligonucleotides are as follows: P1upp, 5'-AATTACCTGGACTTCTGTCCGAACAACAAGTGTTTGCT3-'; P2upp, 5'-AATTAGATGGAGACATTCACCCAATAAATGTTTCCAGA-3'; P3upp, 5'-AATTGCACTGGCAACATCTGTGAACAAGATAACCATCCT-3'; P4upp, 5'-AATTCAGTCGAACAAGCGGGGCGTGGCCTTGCCCGCACT-3'; P5upp, 5'-AATTGCGGCTCTGGGCTTGCGCGCGCGGGAGTCAGGGGT-3'; mP4upp, 5'-AATTCAGTCGATAAATAGGGGCGTGGCATTTACCGCACT-3'; mSp1upp, 5'-AATTCAGTCGAACAAGCGGTTATTGGCCTTGCCCGCACT-3'; Gadd45upp, 5'-AATTCTCGAGCAGAACATGTCTAAGCATGCTGGGCTCGAG-3'; mGadd45upp, 5'-AATTCTCGAGCAGAAAATTTCTAAGAATTCTGGGCTCGAG-3'. Underlined letters indicate putative p53-binding sites in the POLD1 promoter or in the Gadd45 promoter. Letters in italics indicate changes from the original sequence. About 0.5 µg of each oligonucleotide pair was heated at 65 °C for 5 min in annealing buffer (50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 1 mM ATP, 1 mM DTT, and 5% polyethylene glycol 8000) and then annealed by cooling to room temperature. Annealed ds-oligonucleotides were fill-in labeled at room temperature for 30 min with 0.2 mM dTTP (Promega), 60 µCi of 3000 Ci/mmol [alpha -32P]dATP (PerkinElmer Life Sciences), and exo- Klenow fragment (New England Biolabs). Oligonucleotides were purified by phenol/chloroform extraction and precipitated with ethanol. Usually, 4 × 106-6 × 106 cpm/µl was obtained for each oligonucleotide probe.

Human wild-type p53 was over-expressed in Sf9 insect cells using p53 recombinant baculovirus h-p53wt (provided by Dr. C. Prives, Columbia University). 2 × 108 cells were collected 48 h after infection. Nuclei extraction and the Sepharose Q step of p53 purification were performed as described previously (32). Eluted fractions were collected, resolved on 10% SDS-PAGE, and stained by Coomassie blue or detected by Western blot using p53 monoclonal antibody DO-1. Purified PAb421 antibody was coupled to ProA beads to make a p53 immunoaffinity column. The p53 peak fractions from Sepharose Q were combined and dialyzed against buffer containing 50 mM Tris-HCl, pH 7.6, 50 mM NaCl, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml pepstatin, and 50 µg/ml leupeptin. Clarified proteins were loaded onto the PAb421 immunoaffinity column. p53 was then eluted with 30% ethylene glycol and dialyzed into a buffer containing 10 mM Tris-HCl, pH 7.6, 25% glycerol, 5 mM NaCl, 0.1 mM EDTA, 10 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml pepstatin, and 50 µg/ml leupeptin. All purification steps were performed at 4 °C. p53 protein was aliquoted and stored at -70 °C.

Affinity-purified recombinant p53 (50 ng) or 30 ng of recombinant Sp1 protein (Promega) was incubated with 50 ng of ds-poly(dI-dC)·poly(dI-dC) (Pharmacia) and ~0.5 ng (14,000 cpm) of each oligonucleotide probe in 50 µl of EMSA buffer (20 mM Hepes, pH 7.9, 25 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 0.025% Nonidet P-40, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 10% glycerol) for 30 min at room temperature. For supershift assays, 0.1 µg of p53 monoclonal antibody DO-1 or Sp1 polyclonal antibody PEP2 was incubated individually with p53 or Sp1 protein in EMSA buffer at room temperature for 10 min before the addition of the ds-poly(dI-dC)·poly(dI-dC) and probe. For competition assays, an excess amount (5×, 30×, and 200× molar ratio) of cold P4-40-mer or other 40-mers (Gadd45-wt or Gadd45-mt) that contained either the consensus p53-binding site or mutated p53-binding sites were used. Cold oligonucleotides were added to the reaction mixtures and incubated for 10 min before the addition of the probe. For EMSA using both Sp1 and p53, 30 ng of Sp1 was used in combination with 15, 50, and 250 ng of p53. Other steps were the same as described previously. EMSA reaction mixtures were loaded onto a native 4% polyacrylamide gels containing 0.5× Tris borate-EDTA buffer (TBE; 44.5 mM Tris-HCl, 44.5 mM boric acid, 1 mM EDTA, pH 8.3), 0.05% Nonidet P-40, and 2.5% glycerol. Gels were run in 0.5× TBE running buffer at 200-230 V for about 2 h at 4 °C, dried, and exposed to x-ray film.

Southwestern Blotting-- Southwestern blotting was performed as described by Zhao and Chang (15). Samples were resolved on 5-15% gradient SDS-PAGE and then transferred to a polyvinylidene difluoride membrane (PVDF-PSQ, Millipore, Bedford, MA) for 4 h at 4 °C. The membrane was prehybridized in HB buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, and 10 mM DTT) with 5% nonfat dry milk at room temperature for 30 min. Following two rinses with HB buffer containing 0.25% milk, the membrane was hybridized with the 32P-labeled 40-mer P4 oligonucleotide probe (5 × 106 cpm/ml) in HB buffer containing 0.25% milk and 100 ng/ml of ds-poly(dI-dC)·poly(dI-dC) at room temperature for 2 h. The membrane was then washed four times with HB buffer containing 0.25% milk, for 10 min each time, and exposed overnight to a x-ray film. MCF7 and RKO cell extract (30 µg) protein were used for each lane. 20 ng of Sp1 protein (Promega) was loaded as a control.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Exposure of Cells to DNA-damaging Agents Induces Accumulation of Wild-type p53 and Down-regulates Steady-state Levels of POLD1 Gene mRNA-- Exponentially growing human breast carcinoma cells MCF7 with wild-type p53 (33) were exposed to MMS, an alkylating agent that induces DNA base modifications. Northern blot analysis showed a reduction of POLD1 mRNA levels at 6 and 12 h (Fig. 1, top panel). p53 levels were elevated soon after MMS treatment as shown by Western blotting (Fig. 1, bottom panel). In contrast, POLD1 mRNA levels showed no significant change in MDA MB-231 cells (Fig. 1, top panel), a human breast adenocarcinoma cell line that constitutively expresses a transcriptionally inactive mutation of p53 (R280K) (34). Similar results were observed (data not shown) when human colon cancer cell lines RKO and RKOmp53-13 (28) that express wild-type p53 and a dominant negative p53, respectively, were treated with MMS, in that POLD1 mRNA levels were reduced only in the cell line expressing a wild-type p53. The inverse correlation between wild-type p53 expression and POLD1 mRNA steady-state levels suggested the involvement of wild-type p53 in the down-regulation of POLD1 transcription in the cellular response to DNA damage.


View larger version (55K):
[in this window]
[in a new window]
 
Fig. 1.   Northern blot analysis of POLD1 gene mRNA after exposure to a DNA-damaging agent. MCF 7 and MDA MB-231 cells were treated with 100 µg/ml MMS for the indicated periods. Cells were harvested for total RNA isolation or protein extraction. Total RNA (20 µg) was subjected to Northern blotting using probes for POLD1 and GAPDH. Thirty µg of protein from each sample lysate was loaded on a gel and immunoblotted for p53 using p53 monoclonal antibody DO-1 (see "Experimental Procedures").

Steady-state Levels of POLD1 mRNA Are Reduced by Induction of Physiologically Relevant Levels of Wild-type p53 in "tet-off" Cells-- The transcriptional response of the POLD1 gene to induced ectopic p53 expression was investigated in a tet-off cell line, H24-p53-14, in which p53 expression was tightly suppressed by tetracycline concentration in the culture medium (29). p53 expression under the conditions used for these experiments was monitored by Western blotting at different levels of tetracycline (Fig. 2A). As expected, p53 expression was induced to varying levels in accordance with decreasing tetracycline concentration. p53 was detectable at 40 ng/ml tetracycline or less. When tetracycline was completely removed from the medium, p53 expression in these cells was maximally induced to a level that was comparable with the levels elicited by MMS treatment of MCF7 cells. The transcriptional control of POLD1 expression by p53 under these conditions, which likely reflects physiologically relevant levels of p53, was then investigated by Northern blotting (Fig. 2B). POLD1 mRNA levels were reduced by about 65% at maximal p53 expression (either with 2 ng/ml tetracycline or without tetracycline). The levels of POLD1 mRNA decreased only when tetracycline was reduced below 10-5 ng/ml. Overall, these results show that the POLD1 gene mRNA is suppressed by p53 levels that are physiologically relevant in cultured cells. In addition, it is seen that POLD1 mRNA could be seen to be reduced only after a certain threshold of expression of p53. When the parental p53 null cell line H1299 was treated with tetracycline, no changes in POLD1 mRNA levels were observed (data not shown), ruling out a nonspecific inhibition of POLD1 mRNA by tetracycline.


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 2.   Induction of physiologically relevant levels of wild-type p53 in tet-off cells reduces steady-state levels of POLD1 mRNA. A, Western blot analysis of ectopic p53 expression induced to physiologically relevant level in H24-p53-14 cells. Lanes 1 and 2, MCF 7 breast cancer cells were cultured in the absence (lane 1) or presence (lane 2) of MMS for 4 h; lanes 3-9, H24-p53-14 cells were cultured with the indicated tetracycline concentrations for 24 h. Cells were harvested, and 30 µg of protein from each sample lysate was loaded on a gel and immunoblotted for p53 using p53 monoclonal antibody DO-1. Results from a representative experiment are shown. B, Northern blot analysis of decreased POLD1 steady-state mRNA levels by tetracycline-induced p53. H24-p53-14 cells were cultured in medium with indicated tetracycline concentrations. Twenty-four hours after induction, cells were harvested and total RNA was isolated. Total RNA (20 µg) was subjected to Northern blotting using probes for POLD1 and GAPDH.

Repressive Effect of Exogenous Wild-type p53 Expression on POLD1 Promoter Activity in Saos-2 Cells-- Transient cotransfection experiments were performed in the p53 null cell line, Saos-2, using the POLD1 promoter luciferase reporter construct pGL-1758 and various amounts of a wild-type p53 expression plasmid, pCMV-p53, to establish that the repression of POLD1 steady-state mRNA levels by p53 is at the level of the POLD1 gene promoter. The pGL-1758 reporter contains the 1.8-kb 5' flanking region of the POLD1 gene fused with the firefly luciferase reporter gene (15). p53 levels were monitored by Western blotting (Fig. 3A) and were shown to increase in correspondence with the amount of transfected plasmid DNA. Results from the luciferase assays (Fig. 3B) showed no repression when 3 or 10 ng of wt-p53 expression plasmid was transfected even though low levels of p53 protein were detected by Western blot. Thirty ng of p53 plasmid DNA caused a 2-fold increase of p53 expression level compared with that at 10 ng and about a 5-fold increase if compared with 3 ng of p53 plasmid. At 30 ng/ml p53 plasmid, inhibition of POLD1 promoter activity was significant (73%). This result is consistent with the repression of POLD1 mRNA observed in the previous experiments with tet-off cells. Increasing the amount of transfected p53 plasmid resulted in a maximal repression of promoter activity by 83% at 0.1 µg of p53 plasmid DNA. Promoter activity was not repressed further by greater amounts of p53 expression plasmid at 0.3 and 1 µg, indicating a saturable system for POLD1 repression. These experiments confirm that exogenous wild-type p53 inhibits POLD1 promoter activity.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 3.   Repression of exogenous wild-type p53 expression on POLD1 promoter activity in Saos-2 cells. A, Western blot analysis of exogenous p53 expression with different amounts of transfected pCMV-p53 plasmid. pGL-1758 reporter (0.2 µg) and various amounts of pCMV-p53 plasmid were co-transfected into Saos-2 cells (see "Experimental Procedures"). Cells were harvested 24 h after transfection. Lanes 1-7: 0 ng, 3 ng, 10 ng, 30 ng, 0.1 µg, 0.3 µg, and 1 µg of pCMV-p53 expression plasmid, respectively. pUC18 plasmid was added to adjust the total amount of DNA to 1.5 µg. p53 protein was detected by Western blotting with DO-1 p53 antibody. Actin was blotted to indicate the same amount of cell extract loaded. B, dose dependence of POLD1 promoter activity by ectopic p53. Co-transfection was performed as described in A. Aliquots of cell extracts (10 µl) were used for luciferase assays. Results were expressed as fold of change (relative luciferase unit with pCMV-p53/relative luciferase unit with pCMV-0). Values are the mean ± S.D. (error bars) from triplicate samples in three separate experiments. C, Western blot analysis of exogenous p53 expression at various time points after transfection. Saos-2 cells were transfected with 0.2 µg of pGL-1758 reporter plasmid and 0.1 µg of pCMV-p53 or pCMV-0 control plasmid. Cells were harvested at different time points after transfection. Lanes 1, 3, 5, 7, and 9: 6, 12, 24, 36, and 48 h, respectively, after transfection with pCMV-0. Lanes 2, 4, 6, 8, and 10: 6, 12, 24, 36, and 48 h, respectively, after transfection with pCMV-p53. D, time course study of POLD1 promoter activity by ectopic p53. Co-transfection was performed as described in C.

The repression of the POLD1 promoter activity by p53 was examined at different time points after transfection (Fig. 3C). Promoter activity was inhibited by about 65% at the 12-h time point after transfection when exogenous p53 expression was increased more than 5-fold compared with the p53 expression level at the 6-h time point. The activity of the POLD1 promoter was further repressed by about 85% at 24 and 36 h, whereas the corresponding levels of exogenous p53 protein were maintained at the peak. At 48 h, the p53 expression level decreased by about half, possibly because of its instability. However, the inhibited promoter activity at 48 h was not affected, indicating the lack of an immediate effect on POLD1 promoter upon the decline of p53 expression. The time course results confirmed that there was a time-dependent repression of the POLD1 promoter activity by wild-type p53 protein. The results also justified the promoter repression results of Fig. 3B, which were performed at 24 h after transfection when p53 was maximally expressed.

In Vitro EMSA of the Interaction of p53 with the Sequence in the P4 Site of the POLD1 Promoter-- A direct binding of wt-p53 to the consensus p53-binding site (RRCWWGYYY---RRCWWGYYY) has been shown to be essential for the transcriptional activity of p53 (35, 36). Inspection of the POLD1 promoter shows five potential p53-binding sites, designated P1-P5. Sequence matches for the five sites are shown in Fig. 4A. The interaction between p53 and these putative p53-binding sites, which might provide a possible explanation for the p53 repression of POLD1 promoter, was studied by EMSA using purified recombinant p53 protein. Human recombinant p53 was overexpressed in insect cells and was purified to about 90% homogeneity (Fig. 4B). Gel shift assay results (Fig. 4C) showed that only a 40-mer ds-oligonucleotide spanning the P4 site (see "Experimental Procedures") was shifted by purified p53 protein (lane 11) and was further supershifted in the presence of p53 monoclonal antibody DO-1 (lane 12). The P4 site matched the canonical p53-binding site in 17 of 20 nucleotides and harbors a Sp1-binding site between the two halves of the p53 binding sequence (Fig. 4A). A 40-mer Gadd45 ds-oligonucleotide containing a known p53-binding site (see "Experimental Procedures") was used as a positive control (lanes 16 to 18). P4 oligonucleotide/p53 bands were weaker than the Gadd45 shifted bands, suggesting that p53 has a lower affinity for the P4 oligonucleotide than the Gadd45 sequence. A 40-mer oligonucleotide containing the P5 site was shifted and supershifted but with a very weak signal (lanes 14 and 15), whereas oligonucleotides containing P1, P2, and P3 sites were not shifted by p53.


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 4.   EMSA analysis of the in vitro interaction of p53 protein with the POLD1 promoter P4 site sequence. A, putative p53-binding sites P1 to P5. Sites are shown with the consensus sequence below each site. There are four sites (P1-P4) as shown and one half-site (P5). A Sp1 site located in the P4 site is also shown. Matches with the p53 consensus site are underlined. R = A or G; W = A or T; Y = C or T. B, p53 was over-expressed in insect cells and was purified as described under "Experimental Procedures." The purified p53 was loaded onto a 5-15% gradient SDS-PAGE and silver-stained. C, EMSA analysis of p53 binding to putative sites P1-P5. EMSA was performed using labeled oligonucleotides containing each putative site as indicated. A Gadd45 probe was used as a control. Purified p53 (50 ng) was incubated with a labeled 40-mer probe corresponding to each putative site. Lanes 1, 4, 7, 10, 13, and 16: probes only. Lanes 2, 5, 8, 11, 14, and 17: p53 + probes. Lanes 3, 6, 9, 12, 15, and 18: p53 monoclonal antibody DO-1 + p53 + probes. Bands for the free probe, protein-DNA complex, or antibody-protein-DNA complex are indicated. D, EMSA analysis of specific p53 binding to the P4 site on POLD1 promoter by competition and supershift assays. Indicated amounts of different unlabeled oligonucleotides were added to test for competition with the labeled probes (see "Experimental Procedures"). Lane 1: p53 + probe; lanes 2-4: p53 + probe + cold wild-type Gadd45-oligonucleotide; lanes 5-7: p53 + probe + cold mutated Gadd45-oligonucleotide; lanes 8-10: p53 + probe + cold P4-oligonucleotide; lanes 11-14: p53 + probe + antibodies as indicated. E, EMSA analysis of sequence specific p53 binding to the P4 p53-binding site. Purified p53 (50 ng) was incubated with each labeled 40-mer probe. Lanes 1, 4, 7, and 10: probes only. Lanes 2, 5, 8, and 11: p53 protein + probes. Lanes 3, 6, 9, and 12: p53 + p53 antibody DO-1 + probes. The Gadd45 probe was used as a control. Each oligonucleotide containing mutated sequences was listed. The P4 p53-binding site is underlined, and the P4 Sp1-binding site is double underlined. Letters in bold italics indicate mutated sequences.

Cold oligonucleotides were used for binding competition to confirm the specificity of the binding of p53 to the P4 site (Fig. 4D). Only cold P4 oligonucleotide (lanes 8-10) and Gadd45 40-mer (Fig. 4D, lanes 2-4) were able to compete with the shifted band in a dose-dependent manner, whereas mutated Gadd45 oligonucleotide (Gadd45-mt, sequence described under "Experimental Procedures") caused a partial nonspecific competition at 200-fold molar excess (lanes 5-7). All three p53 monoclonal antibodies, PAb1801, DO-1, and PAb421, were able to supershift the P4 oligonucleotide-p53 complex, indicating a specific p53-DNA interaction (lanes 11-13). In contrast, the Sp1 polyclonal antibody PEP2 did not supershift the p53/P4 band (lane 14). Thus, the results indicate that P4 is the likely site for p53 binding to the POLD1 promoter.

If the putative P4 p53-binding site is a sequence-specific p53-binding site, mutations in this site should result in the elimination of its binding to p53. A 40-mer oligonucleotide (mP4) containing a mutated P4 p53-binding site was tested by EMSA (Fig. 4E). Four matched nucleotides in the first half of the p53 10-bp motif and three matched nucleotides in the second half motif of the P4 sequence were mutated (sequence described in Fig. 4E, lower panel). The interaction of mP4 with p53 was greatly weakened compared with the P4 oligonucleotide, as only very weak signals for the shifted and supershifted bands were observed (Fig. 4E, lanes 5 and 6). In contrast, the mSp1 oligonucleotide (sequence described in lower panel), in which the intervening sequence between the two halves of the p53 consensus was mutated and which has an unchanged P4 p53-binding site, was able to bind and retain an interaction with p53 (Fig. 4E, lanes 8 and 9). These results provide additional evidence for a sequence-specific interaction between p53 and the P4 site. The results from the above experiments showed that only the P4 site possesses a sequence that exhibits significant interaction with p53 and provided the initial identification of the P4 site as the likely locus for the actions of p53 on the transcriptional activity of the intact POLD1 promoter.

Interaction between p53 and the P4 p53-binding Site Plays a Major Role in the Regulation of POLD1 Promoter by p53-- The function of the P4 site in the intact promoter as the site of p53 action was analyzed by the use of deletion and point mutations in the pGL-1758 POLD1 reporter construct. The P4 p53-binding site in the promoter was either deleted (pGLDelta -113/-58) or mutated (pGL-1758mP4). Promoter/reporter constructs and site-directed mutation sequences are shown in Fig. 5A. The effect of p53 on these promoter constructs was examined by co-transfection into Saos-2 cells. p53 repressed the promoter activity of pGLDelta -113/-58 by about 55%, whereas it repressed that of pGL-1758mP4 by about 35% (Fig. 5B). The transrepression activity of p53 on both promoters was significantly diminished but not fully lost compared with that of the full-length pGL-1758 promoter (about 86% inhibition). Nevertheless, these results indicate that p53 mediated its major inhibitory effects on POLD1 promoter through the P4 site. The diminished p53 inhibitory effect on the P4-mutated POLD1 promoter is likely due to the loss of p53 binding to the mutated P4 site (mP4), as shown in Fig. 4E. The results also suggest a possibility that there may be other p53 negative response elements in addition to the P4 site present in the POLD1 promoter, because deletion of the P4 site did not completely ablate p53 repression.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 5.   Interaction between p53 and the P4 p53-binding site in the regulation of POLD1 promoter by p53. A, maps of the mutated POLD1 promoter constructs. The indicated regions of the POLD1 promoter and 5' flanking region (shaded boxes) were linked to the luciferase coding region (open boxes). The arrow indicates the transcription start site, and numbering is related to the first residue of exon 1. Each solid bar denotes a putative p53-binding site (P1-P5). Graphs were not drawn to scale. Mutated sites for pGL-1758mP4 and pGL-1758mSp are shown in the lower panel. The P4 p53-binding site is underlined, and the P4 Sp1-binding site is double underlined. Letters in bold italics indicate mutated sequences. B, luciferase assays of p53 regulation of mutated POLD1 promoter/reporter constructs. pCMV-p53 or pCMV-0 plasmid (0.1 µg) were transfected with 0.2 µg of each promoter/reporter plasmid as described under "Experimental Procedures." Cells were harvested 24 h after transfection. Cell extracts were used for luciferase assays. Values are the mean ± S.D. (error bars) of relative luciferase units (RLU) from triplicate samples in three independent experiments.

In addition, when the P4 site was deleted (pGLDelta -113/-58), the basal promoter activity in the absence of p53 was reduced by about 39% compared with that for the pGL-1758 full-length promoter. This was attributed to the fact that the deleted region in pGLDelta -113/-58 also includes a Sp1-binding site (see below). The deletion of the Sp1-binding site could contribute to the significantly reduced basal promoter activity for pGLDelta -113/-58. This possibility was confirmed by the results with the pGL-1758mSp1 promoter, where the P4 Sp1-binding site was mutated and the P4 p53 binding site was unchanged (Fig. 5A). In this promoter, basal promoter activity was similarly reduced by about 34% in the absence of p53 (Fig. 5B). When a 5' deletion promoter construct (pGL-583) in the 5'-most 1.2-kb region was truncated, resulting in the deletion of the P1, P2, and P3 sites, p53 inhibited the promoter activity by about 83%; this indicated that the three putative p53-binding sites (P1, P2, and P3) are unlikely to be involved in p53 transcriptional repression.

Transrepression of POLD1 by p53 Mutants-- Tumor-derived mutations in p53 significantly reduce p53 transrepression activity on many promoters such as the mouse DP1 promoter (37), the DNA topoisomerase IIalpha promoter (25), and the insulin-like growth factor I receptor gene promoter (26). To determine whether the inhibition of POLD1 promoter was affected by tumor-derived mutations in p53, wt-p53 or individual tumor-derived p53 point mutants (pCMV-V143A, pCMV-R175H, pCMV-R248W, pCMV-R273H, and pCMV-R282W) were transfected into Saos-2 cells. All of these mutants are ones that have lost p53 consensus binding and transactivation activities. Only wt-p53 was able to inhibit POLD1 promoter activity (by about 85%) compared with the control vector (Fig. 6B). All of the tumor-derived p53 point mutants exhibited a disruption of transrepression activity under identical assay conditions. The Delta Pro deletion mutant (Dlt-Pro), which has been reported to have normal p53-mediated transcriptional activation but is defective in p53-mediated apoptosis, did not exhibit a significantly reduced repression activity. Results from these p53 mutants indicated that the specific DNA binding activity of p53 was indispensable for the p53 transcriptional regulation of POLD1 promoter, confirming the results from the above experiments.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 6.   Repression of POLD1 by p53 mutants. A, Western blot of wt-p53 and p53 mutants. Twenty µg of protein from each sample lysate was loaded on 10% SDS-PAGE, and p53 was detected by a mixture of p53 antibodies DO-1 and PAb421. B, luciferase assay of the effect of p53 mutants on POLD1 promoter activity. The indicated p53 mutant expression plasmids or pCMV-0 (0.1 µg) were transfected with 0.2 µg of POLD1 promoter/reporter gene plasmids. Cells were harvested 24 h after transfection, and the cell extracts were assayed for luciferase activity. Values are the mean ± S.D. (error bars) of relative luciferase units (RLU) from triplicate samples in three separate experiments. C, indicated p53 mutant expression plasmids or pCMV-0 (0.1 µg) were transfected with 0.2 µg of p53 control reporter p53-Luc (Stratagene). Cells were harvested 24 h after transfection. Aliquots of cell extracts were used for luciferase assays.

Extracts from appropriately transfected Saos-2 cells were examined to show that wild-type and p53 mutants were produced at equivalent levels (Fig. 6A). All of the p53 constructs transfected in Saos-2 cells were able to express their corresponding proteins to approximately similar levels. In addition, wild-type and mutant p53 protein levels were stable between 18 and 36 h after transfection (data not shown). Therefore, these results eliminated the possibility that the lack of significant repression activity on POLD1 promoter by p53 mutants is due to deficient protein levels of p53 mutants in transfected Saos-2 cells or that the results are due to overexpression of the mutants compared with the wild type. To confirm the transcriptional activation functions of all the ectopic p53 mutants, reporter gene assays were performed (Fig. 6C). Experiments were performed under the same conditions as described in Fig. 6B, except that an artificial p53 reporter promoter containing 15 repeats of consensus p53-binding site was used instead of the full-length POLD1 promoter/reporter pGL-1758. The results showed that wild-type p53 and the Delta Pro p53 deletion mutant were able to activate promoter activity substantially whereas the other mutants were transactivation defective, consistent with the reported behavior of p53 in promoter activation. These results indicated that the inhibition of POLD1 promoter activity by wild-type p53 was not an artificial effect because of general inactivation of the transcriptional machinery or squelching of general transcription factors. This conclusion is based on the result that the wild-type p53 and the Delta Pro p53 deletion mutant were able to substantially activate the p53-Luc reporter, whereas an inhibition would be expected in the general inactivation or transcriptional squelching mechanism.

Sp1 Transcription Factor Interacts with the P4 Site Sequence in Vitro-- Southwestern blotting of cell extracts was performed to study other transcriptional factors that may participate in the regulation of POLD1 promoter by p53 repressor at the basal transcriptional level. MCF7 and RKO cells were treated with and without MMS. The radiolabeled 40-mer P4 oligonucleotide was used as a probe. Two signals were detected when the labeled P4 oligonucleotide was hybridized with the membrane, indicating that the P4 oligonucleotide interacted with two proteins of about 90 and 30 kDa in size (Fig. 7A, left panel, lanes 1-4). The 90-kDa signal was of the same molecular size as that in lane 5, where purified recombinant Sp1 protein was used. The same membrane was Western-blotted with Sp1 polyclonal antibody, which detected a band of 90 kDa (Fig. 7A, right panel). The 90-kDa Sp1 band superimposed well with the 90-kDa signal in the Southwestern blot. These data suggested that the P4 oligonucleotide complexed with the Sp1 protein from nuclear extracts in vitro. However, no signal was observed at the position of p53 in the Southwestern blot (Fig. 7A, left panel, lanes 1-4). The lack of detectable interaction between the P4 oligonucleotide with p53 is not likely because of a lack of p53 protein. Western blotting of the same membrane showed that cellular p53 was induced by MMS treatment (Fig. 7A, right panel, lanes 1-4). Because Southwestern blotting employs a denaturation step, it might result in the loss of native conformation and binding activity in some sensitive DNA-binding proteins such as p53. A stepwise denaturation-renaturation procedure using 7 M guanidine HCl under the same conditions did not show positive results either (data not shown). The 30-kDa signal in the Southwestern blot showed that the P4 oligonucleotide also interacted with an unknown cellular protein.


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 7.   Interaction between Sp1 transcriptional factor and the P4 site sequence in vitro. A, Southwestern analysis of P4 oligonucleotide-binding proteins. Left panel: 30 µg of nuclear extract protein from RKO control cells (lane 1), RKO cells treated with 100 µg/ml MMS (lane 2), MCF7 cells (lane 3), MCF7 cells treated with 100 µg/ml MMS (lane 4), and 20 ng of purified recombinant Sp1 protein (lane 5) were resolved on 5-15% gradient SDS-PAGE and then transferred to a polyvinylidene difluoride membrane (PVDF-PSQ, Millipore). The membrane was hybridized with the 32P-labeled P4 site 40-mer, the same probe used in EMSA. After washing, the membrane was exposed to x-ray film. Molecular size markers are labeled on the left. Right panel: Western blot of the same membrane probed with antibodies against Sp1 (upper section) or p53 (lower section). Positions of the p53 or Sp1 protein band are indicated. B, EMSA analysis of Sp1-P4 oligonucleotide interaction. Electrophoretic mobility shift assays were performed using Sp1 and oligonucleotides containing each mutated P4 site as indicated. A Gadd45 probe was used as a control. Purified Sp1 (30 ng) was incubated with each labeled 40-mer probe. Probe preparation and EMSAs were performed as described under "Experimental Procedures." Lanes 1, 3, 5, and 7: Sp1 protein + probes. Lanes 2, 4, 6, and 8: Sp1 + Sp1 polyclonal antibody PEP2 + probes. Bands for free probe, protein-DNA complex, or antibody-protein-DNA complex are indicated. Each oligonucleotide contains mutated sequences as listed. The P4 p53-binding site is underlined, and the P4 Sp1-binding site is double underlined. Letters in bold italics indicate mutated sequences.

To confirm a sequence-specific interaction between Sp1 factor and the P4 Sp1-binding site, EMSA was performed using purified recombinant Sp1 protein and 40-mer oligonucleotides. The P4 oligonucleotide was shifted by Sp1 protein (Fig. 7B, lane 1) and supershifted by the addition of Sp1 polyclonal antibody (lane 2). Sp1 was able to bind to the mP4 oligonucleotide, in which the p53-binding site was mutated (lanes 3 and 4). However, when the mSp1 oligonucleotide, which contains a mutated Sp1-binding site, was used as a probe, Sp1/DNA binding was eliminated (lanes 5 and 6), indicating a specific binding of Sp1 to the Sp1-binding site in the P4 sequence.

p53 Partially Suppresses Sp1-stimulated POLD1 Promoter Activity via the P4 Site-- The binding of the Sp1 factor to the P4 site adds another layer of complexity to the regulation of the POLD1 promoter, because Sp1-family proteins have been found to stimulate the basal transcriptional level of POLD1 promoter (15). To investigate the effect of p53 on the Sp1-stimulated promoter activity, Sp1 and p53 expression plasmids were co-transfected into Drosophila SL2 cells, which lack endogenous Sp1 factors and have been useful in studying the function of Sp1 proteins (31). As shown in Fig. 8A (the second bar in the pGL-1758 group), when the full-length POLD1 promoter/reporter construct pGL-1758 was co-transfected with Sp1 expression plasmid pPacSp1, the promoter was stimulated about 7-fold compared with the results for the control vector (first bar in pGL-1758 group). Similar results were obtained with pGL-1758mP4 in which the P4 p53-binding site was mutated. Elimination of the P4 Sp1-binding site by mutation (pGL-1758mSp1) resulted in an approximately 50% reduction of promoter activity, indicating that the P4 Sp1-binding site is responsible for about half of the Sp1-dependent stimulation. Because the POLD1 promoter contains multiple Sp1 sites, this result is not surprising, but nevertheless shows that the Sp1 site in P4 is a major site for Sp1 activation of the POLD1 promoter.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 8.   partial suppression of Sp1-stimulated POLD1 promoter activity by p53 via the P4 site. A, luciferase assays of POLD1 promoter activity for co-transfection in Drosophila SL2 cells, Promoter/ reporter constructs together with Sp1 expression plasmid and p53 expression plasmid were used for co-transfection assays (see "Experimental Procedures"). For Sp1 + p53, the pPac-Sp1 expression plasmid and pPac-p53 expression plasmid were used. For Sp1, pPac-Sp1 expression plasmid and pPacU control plasmid were used. For the control, pPacU control plasmid was used. pGL2 is the pGL2 basic control reporter vector; pGL-1758 is the full-length POLD1 promoter/reporter construct; pGL-1758mSp1 and pGL-1758mp53 are promoter/reporters with mutations in the Sp1-binding site and the p53-binding site, respectively. Aliquots of cell extracts were assayed for luciferase activity. Values are mean ± S.D. (error bars) from triplicate samples in three separate experiments. RLU, relative luciferase units. B, ectopic expressions of Sp1 and p53 are shown in the lower panel as determined by Western blotting.

The regulatory effects of p53 on the Sp1-stimulated POLD1 promoter were examined by co-transfection of the p53 expression plasmid pPac-p53 with the Sp1 plasmid pPas-Sp1, as shown in the third bar in each group (Fig. 8A). The Sp1-stimulated activity of the full-length promoter was reduced by about 62% by exogenous p53 but was not completely eliminated. This indicated that p53 was able to inhibit the Sp1-stimulated POLD1 promoter activity and also showed that part of the Sp1-stimulated promoter activity was independent of p53 repression. However, bearing in mind that mutation of the P4 Sp1 site (pGL-1758mSp1) led to a reduction of about 50% in Sp1-stimulated promoter activity, the results are consistent with those expected if p53 completely inhibited the ability of Sp1 to act at the P4 site. When the p53 plasmid was co-transfected with the pGL-1758mP4 reporter in which the P4 p53-binding site is mutated, only a slight inhibition was observed. Similar results were obtained with the pGL-1758mSp1 reporter where the P4 Sp1-binding site is mutated. These data provide evidence that the action of p53 on the POLD1 indicated is largely mediated through the P4 Sp1 site. However, the results also indicate that in addition to the P4 p53-binding site, there are some other sites through which p53 was able to down-regulate POLD1 promoter in a minor way. In Fig. 8B, extracts from appropriately transfected SL2 cells were examined to show equivalent levels of exogenous Sp1 or p53 expression.

p53 Competes with Sp1 Protein for Binding to the P4 Sequence in EMSA-- The fact that p53 and Sp1 individually bind to corresponding sites in close proximity suggested a mechanism whereby p53 may interact with Sp1 protein on the P4 Sp1 cis-element to suppress Sp1-stimulated POLD1 promoter activity. To investigate this possibility, EMSA was performed using purified recombinant Sp1 and p53 protein for binding to the P4 oligonucleotide. In this experiment, different molar ratios of Sp1 and p53 were tested (these were calculated on the assumption that both protein are monomers, although it should be noted that both p53 and Sp1 bind to DNA as oligomers). At a nominal 1:1 molar ratio, p53 was unable to affect Sp1-P4 oligonucleotide interaction (Fig. 9, lane 6). However, as the ratio of p53 increased, there was a corresponding appearance of the p53-P4 oligonucleotide complex and an attenuated binding of Sp1 to the P4 oligonucleotide (Fig. 9, lane 7). A 15-fold molar excess of p53 completely abrogated Sp1-DNA complex formation and resulted in the appearance of a strong p53-DNA complex and an additional band due to nonspecific binding (Fig. 9, lane 8).


View larger version (62K):
[in this window]
[in a new window]
 
Fig. 9.   Competition between Sp1 protein and p53 for binding to the P4 site. Purified recombinant Sp1 and p53 protein were used for EMSA. Labeled 40-mer P4-oligonucleotide containing the P4 p53-binding site and the P4 Sp1-binding site was used as the probe. EMSA was performed as described under "Experimental Procedures." Lane 1: probe only; lane 2: 30 ng of Sp1 protein + probe; lane 3: 30 ng of Sp1 + Sp1 polyclonal antibody PEP2 + probe; lane 4: 15 ng of purified p53 + probe; lane 5: 15 ng of purified p53 + p53 monoclonal antibody DO-1 + probe; lanes 6-8: probes and 30 ng of Sp1 protein were used with the following amounts of p53: lane 6, 15 ng; lane 7, 50 ng; lane 8, 250 ng. The positions of the Sp1-DNA complex and the p53-DNA complex are indicated; *, indicates nonspecific binding.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

p53 is a powerful tumor suppressor that acts as a checkpoint in maintaining genomic stability by inducing cell cycle arrest or apoptosis after DNA damage, largely through its function as a transcriptional regulator. Following enhanced expression and activation of p53 as a transcription factor, it also participates in a process by which DNA replication pauses, presumably until DNA repair is complete. Only a few p53 target genes have been identified as involved in the inhibition of DNA replication. Among these are p21/Cip1/WAF1 (18) and Gadd45 (22). Nevertheless, as evidenced by the example of p21/Cip1/WAF1, regulation of a single p53 transcriptional target gene is generally not sufficient to account for the biological functions of p53 (19, 20). In this regard, the identification of p53 target genes that participate in the regulation of DNA replication is an important objective, because the control of DNA synthesis is clearly one of the key cellular processes that is impacted by p53. In this study, the POLD1 gene was identified as a novel target of p53 transcriptional regulation, and evidence was obtained for a competition by p53 with Sp1 at a novel p53 binding sequence (P4), which harbors an internal Sp1 site.

Care was taken in this study to use a tet-off cell system in which ectopic wt-p53 expression was induced to a level similar to that observed in MMS-treated MCF7 cells. The H24-p53-14 cell line used in this study is one of the tet-off cell lines that has been utilized to investigate the role of p53 in G1 cell cycle arrest or apoptosis. Transcripts of genes such as p21/Waf1/Cip1, mdm2, Gadd45, and bax were also shown to be activated in these cell lines (29). In this study, POLD1 mRNA was found to be repressed in response to both MMS- and tetracycline-induced p53 expression, suggesting that POLD1 repression by p53 is physiologically relevant.

The results from this study provide evidence for a mechanism involving competition between p53 and Sp1 for binding to the P4 site of the POLD1 promoter, which contains both a p53 and a Sp1 site. This type of exclusion mechanism for p53 transcriptional repression may be more general, as evidence has been found for competition between p53 and other transcriptional factors in other systems. The repression of alpha -fetoprotein expression by p53 was found to involve competition between binding of p53 and hepatic nuclear factor-3 for overlapping sites in the alpha -fetoprotein promoter (23), a situation similar to that observed for the POLD1 promoter. Studies of the inhibition of the cyclooxygenase-2 gene by p53 have revealed that p53 competes with TATA-binding protein in a 40-bp region in the promoter close to the transcription start site; however, the specific sequence elements involved have not been identified (24). In vitro competition between p53 and Sp1 for binding to overlapping DNA sequences has been reported for the SV40 and HIV-LTR (human immunodeficiency virus) viral promoters (38, 39). The requirement for multiple Sp1 binding sites within the p53-responsive region for the transcriptional inhibitory effect of wild-type p53 has recently been shown on cellular promoters for vascular endothelial growth factor gene (VEGF) (40) and human telomerase catalytic subunit gene (hTERT) (41). Therefore, the findings that p53 is able to exclude the binding of Sp1 by overlapping binding sites and exert a repressive effect on POLD1 gene transcription provides an important example of Sp1-p53 exclusion on a cellular gene promoter, considering a wealth of recent evidence that p53 is able to inhibit Sp1-mediated promoter activity of many genes such as insulin-like growth factor-I receptor gene (26), Werner helicase gene (27), and the multiple drug resistance-associated protein gene (42). In addition, Sp1-binding sites are present in the promoters of many growth-regulated genes (43). It may be important to consider that such inhibitory effects of p53 on Sp1-mediated promoter activity could be extended to the regulation of other cellular promoters that contain overlapping p53- and Sp1-binding sites. There is also evidence that there are structural similarities in the binding motifs for Sp1 and p53 (44), providing a structural rationale for the existence of overlapping Sp1-p53 binding sites.

Biochemical evidence for physical interactions between p53 and Sp1 has been lacking. Attempts to detect a stable Sp1-p53 heterocomplex using cell extracts from MMS-treated MCF7 cells in the presence or absence of P4 oligonucleotide were negative, although positive signals were obtained from experiments with extracts in which p53 was expressed ectopically (data not shown). In addition, we were unable to detect a Sp1-p53-DNA complex in our EMSA experiment (Fig. 9). The negative results for Sp1-p53 heterocomplex formation are consistent with the co-immunoprecipitation and EMSA results obtained by Bargonetti et al. (39). Nevertheless, in some studies, Sp1 has been found to form a heterocomplex with mutant or proliferative forms of p53 in regulating promoter activities (45, 46). Furthermore, we cannot exclude the operation of a second level of transrepression involving p53 interaction with other transcription factors, as the co-transfection experiments involving Sp1 and p53 indicated that a competition at the P4 site would account for only about half of the observed p53 effects on Sp1-driven promoter activity.

p53 has been shown to transrepress several other DNA replication-related genes. In a "DEX-on" cell line, dexamethasone-induced wild-type p53 protein expression led to cell growth inhibition and a significant decrease in steady-state mRNA level of DNA polymerase alpha  catalytic subunit gene. The mechanism of such inhibition has not been investigated (47). Wild-type p53 also confers cell line-dependent repression of the promoter of PCNA gene, the product of which is well established to be involved in DNA replication/repair and cell cycle regulation (48, 49). Wild-type but not mutant p53 induced by DNA damaging agents was able to cause a decrease in DNA topoisomerase IIalpha mRNA and promoter activity. However, such transrepression is not by p53 sequence-specific binding (25, 50). Recent studies of genes regulated by p53 have revealed additional DNA replication genes that are repressed by p53, including DNA primase polypeptide I, chromosomal protein HMG-17, and RFC 37, which encodes one of the small subunits of replication factor C (RFC) that loads and unloads PCNA clamps (51-53).

The exact biological functions/consequences of the transrepression of DNA replication-related genes are still unclear. These genes are generally expressed in late G1/S-phase when cells have already passed the cell cycle restriction point and are committed to enter S phase and initiate DNA synthesis. It is conceivable that p53-mediated POLD1 repression serves to halt DNA replication as the consequence of p53-induced cell cycle arrest, which involves immediate-early genes such as c-jun, c-fos, c-myc, and other cell cycle regulation genes such as p21/WAF1/Cip1, Cyclin/Cdk, and Rb. It is also possible that the transcriptional repression of POLD1 and other DNA replication genes may be the result of p53-induced prolonged, probably permanent, G1 delay based on the fact that the expression of DNA polymerase alpha  (54) and DNA polymerase delta 2 are significantly inhibited during myeloid and erythroleukemia cell terminal differentiation. Growing lines of evidence have argued that loss of p53 results in decreased genomic stability, not because of loss of transient checkpoint controls but because of a failure to prevent severely damaged cells from surviving and propagating, underscoring the important role of prolonged G1 arrest in maintaining DNA integrity (55). Further studies are needed for insightful understanding of the biological effects of the p53 transrepression of DNA polymerase delta  catalytic subunit gene. However, it is possible that loss of wild-type p53 function in cancer cells might rescue the POLD1 promoter activity normally repressed by wild-type p53, contributing to unregulated cancer cell growth and proliferation.

It seems paradoxical that after the genome is harmed by DNA-damaging agents, p53, the "genome guardian," represses the transcription of POLD1 gene, the product of which is also suggested to be involved in DNA repair. A possible scenario is that p53 arrests cell cycle, halts DNA replication, and leads to the repression of POLD1 transcription. Simultaneously, p53 stimulates initiation of DNA repair, which involves DNA polymerase epsilon  and DNA polymerase beta . There are some reports that provide support for this possibility. 1) pol epsilon  functions as a sensor for DNA replication coordinating the transcriptional and cell cycle response to replication block (56). 2) pol epsilon  or pol delta  components perform equally well in reconstituted nucleotide-excision repair assays (6). 3) In yeast genetic studies, pol epsilon  and pol delta  are able to efficiently substitute for each other in nucleotide excision repair after uv damage (57). (4) Transcription of pol beta , the major DNA polymerase in base-excision repair, is not repressed by overexpressed p53 (49).

In summary, the present studies show that POLD1 gene expression is repressed by wild-type p53. The evidence indicates that the majority of transcriptional repression was mediated by sequence-specific binding of p53 to the P4 p53-binding site in the POLD1 promoter. Examination of the mechanism by which p53 represses the POLD1 promoter led to the identification of a competition between p53 and Sp1 for overlapping binding sites in the P4 sequence of the POLD1 promoter. Thus, the present finding that POLD1 is subject to p53 transrepression adds the DNA polymerase delta  catalytic subunit gene, a central enzyme of DNA replication, to the growing group of DNA replication/repair genes inhibited by p53. These findings also add to the currently emerging body of evidence that sequence-specific binding of p53 to promoter sequences can result in transcriptional repression in addition to the known effects of p53 as a transcriptional activator. However, the biological functions/consequences of the transrepression of POLD1 by p53 in response to DNA damage is more complicated and remain to be determined. Future investigation of POLD1 transcriptional regulation by other cis-elements and trans-factors and the interaction between p53 and trans-factors may be helpful in understanding the biological significance of POLD1 gene regulation by p53 in response to DNA damage in cellular processes such as DNA replication/repair, cell cycle arrest, and apoptosis.

    ACKNOWLEDGEMENTS

We are grateful to Drs. X. Chen, M. Kastan, C. Prives, B. Vogelstein, E. Harlow, and R. Tijian for generously providing reagents.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.This

work was supported by National Institutes of Health Grant GM 31973.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 914-594-4070; Fax: 914-594-4058; E-mail: marietta_lee@nymc.edu.

Published, JBC Papers in Press, May 25, 2001, DOI 10.1074/jbc.M101167200

2 B. Li and M. Y. W. Lee, unpublished data.

    ABBREVIATIONS

The abbreviations used are: pol delta , DNA polymerase delta ; POLD1, DNA polymerase delta  catalytic subunit gene; PCNA, proliferating cell nuclear antigen; Gadd45, growth arrest and DNA damage-inducible gene 45; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DTT, dithiothreitol; MMS, methane methylsulfonate; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; bp, base pair(s); kb, kilobase pair(s); SL2 cells, Drosophila Schneider line 2 cells; ds-, double-stranded-; wt, wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Woodgate, R. (1999) Genes Dev. 13, 2191-2195
2. Dominguez, O., Ruiz, J. F., De Lera, T. L., Garcia-Diaz, M., Gonzalez, M. A., Kirchhoff, T., Martinez-A, C., Bernad, A., and Blanco, L. (2000) EMBO J. 19, 1731-1742
3. Waga, S., and Stillman, B. (1994) Nature 369, 207-212
4. Waga, S., Bauer, G., and Stillman, B. (1994) J. Biol. Chem. 269, 10923-10934
5. Zeng, X. R., Jiang, Y., Zhang, S. J., Hao, H., and Lee, M. Y. (1994) J. Biol. Chem. 269, 13748-13751
6. Aboussekhra, A., Biggerstaff, M., Shivji, M. K., Vilpo, J. A., Moncollin, V., Podust, V. N., Protic, M., Hubscher, U., Egly, J. M., and Wood, R. D. (1995) Cell 80, 859-868
7. Halas, A., Baranowska, H., Policinska, Z., and Jachymczyk, W. J. (1997) Curr. Genet. 31, 292-301
8. Longley, M. J., Pierce, A. J., and Modrich, P. (1997) J. Biol. Chem. 272, 10917-10921
9. Holmes, A. M., and Haber, J. E. (1999) Cell 96, 415-424
10. Liu, L., Mo, J., Rodriguez-Belmonte, E. M., and Lee, M. Y. (2000) J. Biol. Chem. 275, 18739-18744
11. Zuo, S., Bermudez, V., Zhang, G., Kellman, Z., and Hurwitz, J. (2000) J. Biol. Chem. 275, 5153-5162
12. Yang, C. L., Chang, L. S., Zhang, P., Hao, H., Zhu, L., Toomey, N. L., and Lee, M. Y. (1992) Nucleic Acids Res. 20, 735-745
13. Zeng, X. R., Hao, H., Jiang, Y., and Lee, M. Y. (1994) J. Biol. Chem. 269, 24027-24033
14. Hao, H., Jiang, Y., Zhang, S. J., Zhang, P., Zeng, R. X., and Lee, M. Y. (1992) Chromosoma 102, S121-127
15. Zhao, L., and Chang, L. S. (1997) J. Biol. Chem. 272, 4869-4882
16. Ko, L. J., and Prives, C. (1996) Genes Dev. 10, 1054-1072
17. Levine, A. J. (1997) Cell 88, 323-331
18. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. (1993) Cell 75, 817-825
19. Brugarolas, J., Chandrasekaran, C., Gordon, J. I., Beach, D., Jacks, T., and Hannon, G. J. (1995) Nature 377, 552-557
20. Deng, C., Zhang, P., Harper, J. W., Elledge, S. J., and Leder, P. (1995) Cell 82, 675-684
21. Waga, S., Hannon, G. J., Beach, D., and Stillman, B. (1994) Nature 369, 574-578
22. Smith, M. L., Chen, I. T., Zhan, Q., Bae, I., Chen, C. Y., Gilmer, T. M., Kastan, M. B., O'Connor, P. M., and Fornace, A. J., Jr. (1994) Science 266, 1376-1380
23. Lee, K. C., Crowe, A. J., and Barton, M. C. (1999) Mol. Cell. Biol. 19, 1279-1288
24. Subbaramaiah, K., Altorki, N., Chung, W. J., Mestre, J. R., Sampat, A., and Dannenberg, A. J. (1999) J. Biol. Chem. 274, 10911-10915
25. Wang, Q., Zambetti, G. P., and Suttle, D. P. (1997) Mol. Cell. Biol. 17, 389-397
26. Ohlsson, C., Kley, N., Werner, H., and LeRoith, D. (1998) Endocrinology 139, 1101-1107
27. Yamabe, Y., Shimamoto, A., Goto, M., Yokota, J., Sugawara, M., and Furuichi, Y. (1998) Mol. Cell. Biol. 18, 6191-6200
28. Slichenmyer, W. J., Nelson, W. G., Slebos, R. J., and Kastan, M. B. (1993) Cancer Res. 53, 4164-4168
29. Chen, X., Ko, L. J., Jayaraman, L., and Prives, C. (1996) Genes Dev. 10, 2438-2451
30. Kern, S. E., Pietenpol, J. A., Thiagalingam, S., Seymour, A., Kinzler, K. W., and Vogelstein, B. (1992) Science 256, 827-830
31. Courey, A. J., and Tjian, R. (1988) Cell 55, 887-898
32. Delphin, C., Cahen, P., Lawrence, J. J., and Baudier, J. (1994) Eur. J. Biochem. 223, 683-692
33. Zhan, Q., Chen, I. T., Antinore, M. J., and Fornace, A. J., Jr. (1998) Mol. Cell. Biol. 18, 2768-2778
34. Bartek, J., Iggo, R., Gannon, J., and Lane, D. P. (1990) Oncogene 5, 893-899
35. el-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B. (1992) Nat. Genet. 1, 45-49
36. Hansen, R., and Oren, M. (1997) Curr. Opin. Genet. Dev. 7, 46-51
37. Gopalkrishnan, R. V., Lam, E. W. F., and Kedinger, C. (1998) J. Biol. Chem. 273, 10972-10978
38. Perrem, K., Rayner, J., Voss, T., Sturzbecher, H., Jackson, P., and Braithwaite, A. (1995) Oncogene 11, 1299-1307
39. Bargonetti, J., Chicas, A., White, D., and Prives, C. (1997) Cell. Mol. Biol. 43, 935-949
40. Zhang, L., Yu, D., Hu, M., Xiong, S., Lang, A., Ellis, L. M., and Pollock, R. E. (2000) Cancer Res. 60, 3655-3661
41. Kanaya, T., Kyo, S., Hamada, K., Takakura, M., Kitagawa, Y., Harada, H., and Inoue, M. (2000) Clin. Cancer Res. 6, 1239-1251
42. Wang, Q., and Beck, W. T. (1998) Cancer Res. 58, 5762-5769
43. Azizkhan, J., Jensen, D. E., Pierce, A. J., and Wade, M. (1993) Crit. Rev. Eukaryotic Gene Expr. 3, 229-254
44. MacLeod, M. C. (1993) Nucleic Acids Res. 21, 1439-1447
45. Gualberto, A., and Baldwin, A. S., Jr. (1995) J. Biol. Chem. 270, 19680-19683
46. Borellini, F., and Glazer, R. I. (1993) J. Biol. Chem. 268, 7923-7928
47. Lin, D., Shields, M. T., Ullrich, S. J., Appella, E., and Mercer, W. E. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 9210-9214
48. Jackson, P., Ridgway, P., Rayner, J., Noble, J., and Braithwaite, A. (1994) Biochem. Biophys. Res. Commun. 203, 133-140
49. Yamaguchi, M., Hayashi, Y., Matsuoka, S., Takahashi, T., and Matsukage, A. (1994) Eur. J. Biochem. 221, 227-237
50. Sandri, M. I., Isaacs, R. J., Ongkeko, W. M., Harris, A. L., Hickson, I. D., Broggini, M., and Sikhanskaya, F. (1996) Nucleic Acids Res. 24, 4464-4470
51. Yu, J., Zhang, L., Hwang, P. M., Rago, C., Kinzler, K. W., and Vogelstein, B. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 14517-14522
52. Kannan, K., Amariglio, N., Rechavi, G., and Givol, D. (2000) FEBS Lett. 470, 77-82
53. Zhao, R., Gish, K., Murphy, M., Yin, Y., Notterman, D., Hoffman, W. H., Tom, E., and Mack, D. H. (2000) Genes Dev. 14, 981-993
54. Moore, A. L., and Wang, T. S. (1994) Cell Growth Differ. 5, 485-494
55. Carr, A. M. (2000) Science 287, 1765-1766
56. Navas, T. A., Zhou, Z., and Elledge, S. J. (1995) Cell 80, 29-39
57. Budd, M. E., and Campbell, J. L. (1995) Mol. Cell. Biol. 15, 2173-2179


Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Cancer Res.Home page
K. Kumamoto, E. A. Spillare, K. Fujita, I. Horikawa, T. Yamashita, E. Appella, M. Nagashima, S. Takenoshita, J. Yokota, and C. C. Harris
Nutlin-3a Activates p53 to Both Down-regulate Inhibitor of Growth 2 and Up-regulate mir-34a, mir-34b, and mir-34c Expression, and Induce Senescence
Cancer Res., May 1, 2008; 68(9): 3193 - 3203.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Zaky, C. Busso, T. Izumi, R. Chattopadhyay, A. Bassiouny, S. Mitra, and K. K. Bhakat
Regulation of the human AP-endonuclease (APE1/Ref-1) expression by the tumor suppressor p53 in response to DNA damage
Nucleic Acids Res., March 1, 2008; 36(5): 1555 - 1566.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Hosokawa, A. Takehara, K. Matsuda, H. Eguchi, H. Ohigashi, O. Ishikawa, Y. Shinomura, K. Imai, Y. Nakamura, and H. Nakagawa
Oncogenic Role of KIAA0101 Interacting with Proliferating Cell Nuclear Antigen in Pancreatic Cancer
Cancer Res., March 15, 2007; 67(6): 2568 - 2576.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Van Bodegom, Z. Saifudeen, S. Dipp, S. Puri, B. S. Magenheimer, J. P. Calvet, and S. S. El-Dahr
The Polycystic Kidney Disease-1 Gene Is a Target for p53-mediated Transcriptional Repression
J. Biol. Chem., October 20, 2006; 281(42): 31234 - 31244.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Shats, M. Milyavsky, X. Tang, P. Stambolsky, N. Erez, R. Brosh, I. Kogan, I. Braunstein, M. Tzukerman, D. Ginsberg, et al.
p53-dependent Down-regulation of Telomerase Is Mediated by p21waf1
J. Biol. Chem., December 3, 2004; 279(49): 50976 - 50985.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Lohr, C. Moritz, A. Contente, and M. Dobbelstein
p21/CDKN1A Mediates Negative Regulation of Transcription by p53
J. Biol. Chem., August 29, 2003; 278(35): 32507 - 32516.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Watanabe, M. Sugaya, A. M. Atkins, E. A. Aquilino, A. Yang, D. L. Borris, J. Brady, and A. Blauvelt
Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Prolongs the Life Span of Primary Human Umbilical Vein Endothelial Cells
J. Virol., June 1, 2003; 77(11): 6188 - 6196.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-J. Im, M. R. Pittelkow, and R. Kumar
Divergent Regulation of the Growth-promoting Gene IEX-1 by the p53 Tumor Suppressor and Sp1
J. Biol. Chem., April 19, 2002; 277(17): 14612 - 14621.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/32/29729    most recent
M101167200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, B.
Right arrow Articles by Lee, M. Y. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, B.
Right arrow Articles by Lee, M. Y. W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement