|
Originally published In Press as doi:10.1074/jbc.M101167200 on May 25, 2001
J. Biol. Chem., Vol. 276, Issue 32, 29729-29739, August 10, 2001
Transcriptional Regulation of the Human DNA Polymerase Catalytic Subunit Gene POLD1 by p53 Tumor Suppressor and
Sp1*
Baoqing
Li and
Marietta Y. W.
Lee
From the Department of Biochemistry and Molecular Biology, New York
Medical College, Valhalla, New York 10595
Received for publication, February 6, 2001, and in revised form, April 23, 2001
 |
ABSTRACT |
The DNA polymerase catalytic subunit
gene (POLD1) was studied as a transcriptional target
of p53. Northern blotting showed that a significantly decreased
steady-state level of POLD1 mRNA was associated with increased
wild-type p53 expression in cells treated with methyl methanesulfonate.
When ectopic wild-type p53 expression was induced to a physiologically
relevant level in "tet-off" cultured cells in which p53 expression
was tightly regulated by tetracycline, it was found that POLD1
steady-state mRNA was repressed by about 65%. Transient
cotransfection experiments using a POLD1 promoter
luciferase reporter construct showed that: (i) POLD1
promoter activity was inhibited by transfected wild-type p53 plasmid to
a maximum of about 86%; (ii) p53 mediated a large part of the
transcriptional repression through a sequence-specific interaction with
a site identified as the P4 site of the POLD1 promoter;
(iii) tumor-derived p53 mutations in the p53 DNA-binding domain
completely abolished the p53 transrepression activity. Moreover,
transfection assays demonstrated that p53 was able to repress
Sp1-stimulated POLD1 promoter activity and that this
repression was largely due to the loss of the sequence-specific
interaction between Sp1 protein and the P4 Sp1-binding site, which
overlaps the P4 p53-binding site. Finally, gel shift assays suggested
that p53 competes with Sp1 protein for binding to the P4 sequence of the POLD1 promoter.
 |
INTRODUCTION |
DNA replication is a highly organized process that involves many
enzymes and proteins, including several DNA polymerases. DNA polymerase
(pol )1 is one of the
at least 12 DNA polymerases identified thus far in mammalian cells (1,
2). Studies of in vitro reconstituted SV40 DNA replication
established the requirement of two DNA polymerases, pol and pol
. pol is capable of highly processive DNA synthesis in
association with the molecular sliding clamp, PCNA, and thus plays a
role in the synthesis of the leading strand at the replication fork. pol /primase functions to synthesize RNA-DNA primers for initiation on the leading strand, but it is thought that pol is
required for the completion of Okazaki fragment synthesis (3, 4).
Several lines of evidences have shown that pol may also be involved
in nucleotide excision repair (5, 6) and in base excision repair of
exogenous DNA methylation damage (7). Recently, pol has been found
to be important for mismatch repair (8) and mitotic
double-strand break-induced gene conversion (9).
The pol enzyme is now thought to consist of at least four subunits
in human and Schizosaccharomyces pombe (10, 11). The
catalytic subunit is a 125-kDa protein that is encoded by the
POLD1 gene in human cells (12). The transcriptional level of
pol mRNA is regulated during the cell cycle (13) and is induced
in serum-stimulated cells (14). The POLD1 gene promoter is
TATA-less, GC-rich, and has been reported to be activated by Sp1 and
Sp3 transcriptional factors that bind specifically to two repeat
sequences in the promoter (15). Nevertheless, the effects of other
transcriptional factors on POLD1 promoter remain unknown.
The p53 tumor suppressor gene product functions as a checkpoint in
maintaining genome stability. More than half of a wide spectrum of
human cancers contain mutations in the p53 tumor suppressor gene, and
more than 90% of the p53 missense mutations are clustered within the
sequence-specific DNA-binding domain, suggesting that functional
inactivation of p53, especially the DNA binding activity of p53, is a
crucial and often obligatory step in pathways to tumorigenesis. p53
protein is induced and/or activated in response to a variety of stimuli
such as DNA damage or the expression of viral oncogenes. Activation of
p53 leads to one of the two major cellular pathways, either apoptosis
or cell cycle arrest, that prevents cells from progressing to S phase
until the damaged DNA is fully repaired (16). The transcriptional
functions of p53 are well established to be important in arresting the
cell cycle, although this is less clear in p53-mediated apoptosis.
As a transcription activator, p53 recognizes a specific consensus DNA
sequence consisting of two copies of a 10-bp motif, 5'-PuPuPuC(A/T)(T/A)GPyPyPy-3', separated by a 0-13-bp spacer. Wild-type p53 transactivates the expression of its target genes by
specifically binding to p53-binding sites in the sequences of these
genes (17). Among the p53-transactivated genes is
p21/WAF1/Cip1, which encodes a
cyclin-dependent kinase inhibitor (18). It is evident that
the p53-induced transcription of p21/WAF1/Cip1 is responsible in
large measure for p53-dependent G1 arrest (19, 20). Moreover, p21/WAF1/Cip1 has been shown to directly inhibit DNA
replication by binding tightly to and masking the elements on PCNA that
are required for its interaction with DNA polymerase (21). The
product of another p53-transactivated gene, Gadd45, has been shown to interact with PCNA and inhibit DNA excision repair
(22). Other evidence has also suggested that p53 may play one or more
roles in regulating processes such as DNA replication, repair, and
recombination (16). p53 not only acts as a transcriptional activator
but also has been shown to repress the activity of a broad range of
viral and cellular gene promoters that lack p53 binding sites,
including but not limited to those of the -fetoprotein gene
(ARF), bcl-2, cdc2, c-fos,
cyclooxygenase-2 gene (Cox-2), DNA topoisomerase II gene,
insulin-like growth factor I receptor gene (IGF-IR),
microtubule-associated protein gene (Map4), retinoblastoma gene (Rb), and Werner helicase gene (WRN) (16,
23-27).
Because of its critical role in DNA synthesis, we investigated whether
the DNA polymerase catalytic subunit gene, POLD1, is one
of the transcriptional targets of the p53 tumor suppressor. The study
described here demonstrates that the expression of the POLD1
gene mRNA is repressed by wild-type p53 in response to DNA damage.
This p53-mediated repression is at the transcriptional level and is
mediated largely through a specific interaction between p53 and a
p53-binding site in the POLD1 promoter. Evidence was also
obtained for a mechanism in which p53 exerts its repressive effect by
exclusion of the binding of Sp1 transcriptional factor to a Sp1-binding
site harbored within the p53 binding site.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Cell Treatments--
The cell lines Saos-2,
H1299, and MDA MB231 and three lines of MCF7 were purchased from
American Type Culture Collection (ATCC, Manassas, VA). Cells were
cultured according to ATCC protocols. A human breast carcinoma MCF7
cell line that expresses relatively low levels of p53 under normal
conditions was selected for this study. For DNA damaging agent
treatment experiments, MCF7 or MDA MB231 cells were exposed to 100 µg/ml methane methylsulfonate (MMS) (Aldrich). Human colon
cancer cell lines RKO and RKO mp53-13 (28) were kindly provided by Dr.
M. B. Kastan, St. Jude Children's Research Hospital, Memphis, TN.
H24-p53-14, a H1299 human large-cell lung carcinoma cell line (29) that
expresses tetracycline-induced wild-type p53, was provided by Dr. X. Chen, Medical College of Georgia, Augusta, GA. H24-p53-14 cells were
cultured in Dulbecco's modified Eagle's medium supplemented
with 10% fetal bovine serum, 1.6 µg/ml tetracycline, 0.3 mg/ml G418
(Life Technologies, Inc.), and 2 µg/ml puromycin (Stratagene). For
the tetracycline-dependent p53 induction experiments,
H24-p53-14 cells were cultured in medium containing the indicated
tetracycline concentrations (1.6 µg/ml, 40 ng/ml, 20 ng/ml, 10 ng/ml,
5 ng/ml, 2 ng/ml, or without tetracycline) and harvested 24 h
after tetracycline treatment. Drosophila Schneider line 2 (SL2) cells were purchased from ATCC and grown in Schneider medium
(Life Technologies, Inc.) supplemented with 10% fetal bovine serum at
25 °C.
Plasmid Constructs--
The full-length POLD1
promoter/reporter pGL 1758 was generated as described (15).
Mutated POLD1 promoter constructs are shown in Fig.
5A. The promoter constructs pGL 583 and pGL 1758/ 272 were generated by PCR. PCR reactions were performed using the Expand
High Fidelity PCR System (Roche Molecular Biochemicals). The
pGL 113/ 58 has a 55-bp deletion from 113 to 58 in the full-length POLD1 promoter. The full-length promoter construct pGL 1758 was double-digested at the HindIII site at the 3'
end of the promoter insertion and at the PstI site at 113.
The larger of the two generated fragments contains the vector sequences
and a 3' deleted promoter sequence (from 1758 to 113) and was
isolated for subsequent ligation with a 58 to +49 promoter PCR
fragment containing a PstI site at 58 and a
HindIII site at the 3' end. Site-directed mutagenesis was
performed to generate the P4 p53-binding site-mutated promoter
construct pGL 1758mP4 and the P4 Sp1-binding site-mutated promoter
pGL 1758mSp1. Primers used for pGL 1758mP4 and pGL 1758mSp1 were
5'CCCTGCAGTCGATAAATAGGGGCGTGGCATTTACCGCACTTGGGC3' and 5'GTCGAACAAGCGGTTATTGGCCTTGCCCGC3', respectively. The
underlined letters indicate the P4 Sp1-binding site, and bold italic
letters indicate changes of sequence from the original promoter
sequence. Mutated promoter constructs were made using the QuikChange
site-directed mutagenesis kit (Stratagene). The sequences of all
promoter constructs were verified by automated sequencing by the DNA
Core Laboratory, University of Miami. The control p53 reporter plasmid
p53-Luc was purchased from Stratagene. It has an artificial p53
promoter containing 15 repeats of consensus p53-binding sites.
The p53 expression plasmid pCMV-p53 was renamed from the pC53-SN3-p53wt
plasmid (30), which was provided by Dr. B. Vogelstein, Johns Hopkins
University School of Medicine, Baltimore, MD. The control vector pCMV-0
was generated by religating the vector fragment generated by the
BamHI digestion of pCMV-p53. p53 point mutant expression
plasmids (pCMV-L22Q/W23S pCMV-V143A, pCMV-R175H, pCMV-R248W, pCMV-R273H, and pCMV-R282) were generated using the QuikChange site-directed mutagenesis kit (Stratagene). PCR was performed to
prepare the Pro p53 mutant, which has a deletion from residues 63 to
91. The 1.8-kb BamHI fragment, which contains the coding sequence for p53 and other unknown sequences at both ends of the coding
fragment, was isolated from the original pC53-SN3-p53wt plasmid. This
fragment was ligated into the BamHI site of the pUC18 vector
to generate pUC18-p53. The 5' p53 fragment containing residues 1-62
was generated by PCR. The forward primer,
5'-GGTCGACTCTAGAGG-3', was designed according to the
multiple cloning site sequences on the pUC18 vector and included the GG
sequence (underlined) of the GGATCC BamHI site. The reverse
primer, 5'-CGGTACCGGACCTGGGTCTTC-3', was designed to
include a GGTACC KpnI site (underlined). For the 3' p53
fragment containing residues 92-393, the forward primer was
5'-CCGGTACCCCTGTCATCTTCTG-3' and included a GGTACC
KpnI site (underlined). The reverse primer,
5'-GCTCGGTACCCGGGG-3', was designed according to the
multiple cloning site sequences on the pUC18 vector and included the
GGATCC BamHI site (underlined). The PCR products from each
reaction were subsequently ligated into BamHI-digested pCMV-0 vector fragment in a three-piece ligation. Because of a junctional GGTACC KpnI site, the Pro mutant has two extra
residues (Gly and Thr) in the deleted region. Mutated sites in all of
the p53 mutants generated were verified by sequencing from both
directions using the T7 Sequenase method according to the
manufacturer's protocol (Amersham Pharmacia Biotech).
The Sp1 expression plasmid pPacSp1 (31) was kindly provided by Dr.
R. Tijian, University of California, Berkeley, CA. The control vector
pPacU was constructed by religation after excision of the
XhoI insert fragment. The p53 expression vector, pPac-p53, was generated such that the p53 cDNA was driven under the control of the Drosophila actin 5C promoter. The p53 cDNA was
PCR-amplified using pCMV-p53 as the template. The forward primer was
5'-ggatccGAGGAGCCGCAGTCAGATCC-3', and the
reverse primer was 5'-ggatccGTCTGAGTCAGGCCC-3', both of which contain BamHI sites (underlined). The PCR product was
isolated by BamHI digestion and then ligated with
BamHI-linearized pPacU vector fragment. Orientation of the
resulting plasmid was positively identified by
PvuII/XhoI double digestion.
Northern Blotting--
Northern blotting was performed as
described previously (14). Total RNA was extracted from cells using
STAT60 (Tel-Test, Friendswood, TX). The POLD1 gene cDNA
(12) was used as the template for PCR amplification of a probe fragment
from nucleotide 2660 to 2920. The control GAPDH probe was
purchased from CLONTECH as a 1.1-kb cDNA
fragment. The autoradiographic images were captured with a
charge-coupled device (CCD) camera (Datavision, North Falmouth, MA),
and the ratio of POLD1 mRNA to GAPDH mRNA was quantified by
performing densitometric analysis within the linear range of each
capture signal using the Image Pro Plus software (Media Cybernetics, Silver Spring, MD).
Western Blotting and Antibodies--
Cells were lysed in Nonidet
P-40 lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Nonidet P-40, 1 mM
phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml
pepstatin, and 10 µg/ml leupeptin). Samples of cell lysate
supernatant (30 µg protein) were resolved on SDS-PAGE and transferred
to nitrocellulose membranes. The membranes were incubated with 0.5-1.0
µg/ml primary antibodies. Immunocomplexes were detected by incubation
with chemiluminescence-based SuperSignal substrate (Pierce) and
subsequent exposure to x-ray film. The p53 monoclonal antibody PAb421
was provided by Dr. E. Harlow, Massachusetts General Hospital. The p53
monoclonal antibody DO-1 and Sp1 polyclonal antibody PEP2 were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-actin
polyclonal antibodies (Sigma) were incubated with the same membrane
following membrane stripping.
Transient Cotransfection Assays and Luciferase Reporter Gene
Assays--
Saos-2 cells (1.5 × 105) were plated
onto a 6-well plate and grown overnight in Opti-MEM I medium (Life
Technologies, Inc.). pCMV-p53 expression plasmid or pCMV-0 control
vector DNA (0.1 µg) was cotransfected with pGL 1758 reporter
(0.2 µg) into Saos-2 cells using LipofectAMINE/PLUS (Life
Technologies, Inc.). The medium was changed 3 h after
transfection. The cells were lysed in 70 µl of reporter lysis buffer
(Promega) 24 h after transfection. Transient cotransfection assays
in Drosophila SL2 cells were performed at room temperature
using CellFectin reagent according to the manufacturer's protocol
(Life Technologies, Inc.). pPac-p53 expression plasmid DNA (0.4 µg)
and/or pPac-Sp1 expression plasmid (0.2 µg) were used together with
each POLD1 promoter/reporter construct (0.5 µg). pPacU
plasmid was used as the control vector. The total amount of DNA for
cotransfection was adjusted to 3 µg by adding pUC18 DNA. The medium
was changed 5 h after transfection. Forty-eight hours after
transfection, cells were collected in 1× reporter lysis buffer
(Promega).
Cells transfected in 6-well plates were gently washed with cold
phosphate-buffered saline (80 mM
Na2HPO4, 20 mM
NaH2PO4, 100 mM NaCl, pH 7.6),
lysed in 70 µl of reporter lysis buffer in a luciferase assay system
(Promega) for 10 min at room temperature with gentle vortexing. Cell
lysates were collected and centrifuged briefly. Aliquots (10 µl) of
cell extract were used for luciferase assays using 50 µl of substrate
solution (Promega). Luciferase activity was measured by a luminometer
(Turner Designs) with settings of 3-s delay time and 10-s integration
time. Relative luciferase units were evaluated after normalization
against protein concentration of each sample. Fold change was expressed
as (relative luciferase unit with pCMV-p53/relative luciferase unit
with pCMV-0). Values are the means ± standard deviation (error
bars) of relative luciferase activity from triplicate samples in three
separate experiments.
Electrophoretic Mobility Shift Assays (EMSA)--
DNA
oligonucleotides were synthesized and high pressure liquid
chromatography-purified by Operon Technologies, Alameda, CA. The
sequences of the oligonucleotides are as follows: P1upp,
5'-AATTACCTGGACTTCTGTCCGAACAACAAGTGTTTGCT3-'; P2upp,
5'-AATTAGATGGAGACATTCACCCAATAAATGTTTCCAGA-3';
P3upp, 5'-AATTGCACTGGCAACATCTGTGAACAAGATAACCATCCT-3'; P4upp, 5'-AATTCAGTCGAACAAGCGGGGCGTGGCCTTGCCCGCACT-3';
P5upp, 5'-AATTGCGGCTCTGGGCTTGCGCGCGCGGGAGTCAGGGGT-3'; mP4upp,
5'-AATTCAGTCGATAAATAGGGGCGTGGCATTTACCGCACT-3';
mSp1upp, 5'-AATTCAGTCGAACAAGCGGTTATTGGCCTTGCCCGCACT-3';
Gadd45upp, 5'-AATTCTCGAGCAGAACATGTCTAAGCATGCTGGGCTCGAG-3'; mGadd45upp, 5'-AATTCTCGAGCAGAAAATTTCTAAGAATTCTGGGCTCGAG-3'.
Underlined letters indicate putative p53-binding sites in the
POLD1 promoter or in the Gadd45 promoter. Letters
in italics indicate changes from the original sequence. About 0.5 µg
of each oligonucleotide pair was heated at 65 °C for 5 min in
annealing buffer (50 mM Tris-HCl, pH 7.6, 10 mM
MgCl2, 1 mM ATP, 1 mM DTT, and 5%
polyethylene glycol 8000) and then annealed by cooling to room
temperature. Annealed ds-oligonucleotides were fill-in labeled at room
temperature for 30 min with 0.2 mM dTTP (Promega), 60 µCi
of 3000 Ci/mmol [ -32P]dATP (PerkinElmer Life
Sciences), and exo Klenow fragment (New England Biolabs).
Oligonucleotides were purified by phenol/chloroform extraction and
precipitated with ethanol. Usually, 4 × 106-6 × 106 cpm/µl was obtained for each oligonucleotide probe.
Human wild-type p53 was over-expressed in Sf9 insect cells using
p53 recombinant baculovirus h-p53wt (provided by Dr. C. Prives, Columbia University). 2 × 108 cells were collected
48 h after infection. Nuclei extraction and the Sepharose Q step
of p53 purification were performed as described previously (32). Eluted
fractions were collected, resolved on 10% SDS-PAGE, and stained by
Coomassie blue or detected by Western blot using p53 monoclonal
antibody DO-1. Purified PAb421 antibody was coupled to ProA beads to
make a p53 immunoaffinity column. The p53 peak fractions from Sepharose
Q were combined and dialyzed against buffer containing 50 mM Tris-HCl, pH 7.6, 50 mM NaCl, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml pepstatin, and 50 µg/ml leupeptin.
Clarified proteins were loaded onto the PAb421 immunoaffinity column.
p53 was then eluted with 30% ethylene glycol and dialyzed into a
buffer containing 10 mM Tris-HCl, pH 7.6, 25% glycerol, 5 mM NaCl, 0.1 mM EDTA, 10 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, 10 µg/ml pepstatin, and 50 µg/ml leupeptin. All purification steps
were performed at 4 °C. p53 protein was aliquoted and stored at
70 °C.
Affinity-purified recombinant p53 (50 ng) or 30 ng of recombinant Sp1
protein (Promega) was incubated with 50 ng of
ds-poly(dI-dC)·poly(dI-dC) (Pharmacia) and ~0.5 ng (14,000 cpm) of each oligonucleotide probe in 50 µl of EMSA buffer (20 mM Hepes, pH 7.9, 25 mM KCl, 2 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT,
0.025% Nonidet P-40, 2 mM spermidine, 0.1 mg/ml bovine
serum albumin, 10% glycerol) for 30 min at room temperature. For
supershift assays, 0.1 µg of p53 monoclonal antibody DO-1 or Sp1
polyclonal antibody PEP2 was incubated individually with p53 or Sp1
protein in EMSA buffer at room temperature for 10 min before the
addition of the ds-poly(dI-dC)·poly(dI-dC) and probe. For competition
assays, an excess amount (5×, 30×, and 200× molar ratio) of cold
P4-40-mer or other 40-mers (Gadd45-wt or Gadd45-mt) that contained
either the consensus p53-binding site or mutated p53-binding sites were
used. Cold oligonucleotides were added to the reaction mixtures and
incubated for 10 min before the addition of the probe. For EMSA using
both Sp1 and p53, 30 ng of Sp1 was used in combination with 15, 50, and
250 ng of p53. Other steps were the same as described previously. EMSA
reaction mixtures were loaded onto a native 4% polyacrylamide gels
containing 0.5× Tris borate-EDTA buffer (TBE; 44.5 mM
Tris-HCl, 44.5 mM boric acid, 1 mM EDTA, pH
8.3), 0.05% Nonidet P-40, and 2.5% glycerol. Gels were run in 0.5×
TBE running buffer at 200-230 V for about 2 h at 4 °C, dried,
and exposed to x-ray film.
Southwestern Blotting--
Southwestern blotting was performed
as described by Zhao and Chang (15). Samples were resolved on 5-15%
gradient SDS-PAGE and then transferred to a polyvinylidene difluoride
membrane (PVDF-PSQ, Millipore, Bedford, MA) for 4 h at
4 °C. The membrane was prehybridized in HB buffer (10 mM
Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM
MgCl2, 0.5 mM EDTA, and 10 mM DTT)
with 5% nonfat dry milk at room temperature for 30 min. Following two
rinses with HB buffer containing 0.25% milk, the membrane was
hybridized with the 32P-labeled 40-mer P4
oligonucleotide probe (5 × 106 cpm/ml) in HB buffer
containing 0.25% milk and 100 ng/ml of
ds-poly(dI-dC)·poly(dI-dC) at room temperature for 2 h. The
membrane was then washed four times with HB buffer containing 0.25%
milk, for 10 min each time, and exposed overnight to a x-ray film. MCF7
and RKO cell extract (30 µg) protein were used for each lane. 20 ng
of Sp1 protein (Promega) was loaded as a control.
 |
RESULTS |
Exposure of Cells to DNA-damaging Agents Induces Accumulation of
Wild-type p53 and Down-regulates Steady-state Levels of POLD1 Gene
mRNA--
Exponentially growing human breast carcinoma cells MCF7
with wild-type p53 (33) were exposed to MMS, an alkylating agent that
induces DNA base modifications. Northern blot analysis showed a
reduction of POLD1 mRNA levels at 6 and 12 h (Fig.
1, top panel). p53
levels were elevated soon after MMS treatment as shown by Western
blotting (Fig. 1, bottom panel). In contrast, POLD1 mRNA levels showed no significant change in MDA MB-231 cells (Fig. 1,
top panel), a human breast adenocarcinoma cell line that
constitutively expresses a transcriptionally inactive mutation of p53
(R280K) (34). Similar results were observed (data not shown) when human colon cancer cell lines RKO and RKOmp53-13 (28) that express wild-type
p53 and a dominant negative p53, respectively, were treated with MMS,
in that POLD1 mRNA levels were reduced only in the cell line
expressing a wild-type p53. The inverse correlation between wild-type
p53 expression and POLD1 mRNA steady-state levels suggested the
involvement of wild-type p53 in the down-regulation of POLD1
transcription in the cellular response to DNA damage.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 1.
Northern blot analysis of POLD1
gene mRNA after exposure to a DNA-damaging agent. MCF 7 and MDA MB-231 cells were treated with 100 µg/ml MMS for the
indicated periods. Cells were harvested for total RNA isolation or
protein extraction. Total RNA (20 µg) was subjected to Northern
blotting using probes for POLD1 and GAPDH. Thirty µg of
protein from each sample lysate was loaded on a gel and immunoblotted
for p53 using p53 monoclonal antibody DO-1 (see "Experimental
Procedures").
|
|
Steady-state Levels of POLD1 mRNA Are Reduced by Induction of
Physiologically Relevant Levels of Wild-type p53 in
"tet-off" Cells--
The transcriptional response of the
POLD1 gene to induced ectopic p53 expression was investigated in a
tet-off cell line, H24-p53-14, in which p53 expression was
tightly suppressed by tetracycline concentration in the culture medium
(29). p53 expression under the conditions used for these experiments
was monitored by Western blotting at different levels of tetracycline
(Fig. 2A). As expected, p53
expression was induced to varying levels in accordance with decreasing
tetracycline concentration. p53 was detectable at 40 ng/ml tetracycline
or less. When tetracycline was completely removed from the medium, p53
expression in these cells was maximally induced to a level that was
comparable with the levels elicited by MMS treatment of MCF7 cells. The
transcriptional control of POLD1 expression by p53 under these
conditions, which likely reflects physiologically relevant levels of
p53, was then investigated by Northern blotting (Fig. 2B).
POLD1 mRNA levels were reduced by about 65% at maximal p53
expression (either with 2 ng/ml tetracycline or without tetracycline).
The levels of POLD1 mRNA decreased only when tetracycline was
reduced below 10-5 ng/ml. Overall, these results show that the
POLD1 gene mRNA is suppressed by p53 levels that are
physiologically relevant in cultured cells. In addition, it is seen
that POLD1 mRNA could be seen to be reduced only after a certain
threshold of expression of p53. When the parental p53 null cell line
H1299 was treated with tetracycline, no changes in POLD1 mRNA
levels were observed (data not shown), ruling out a nonspecific
inhibition of POLD1 mRNA by tetracycline.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 2.
Induction of physiologically relevant levels
of wild-type p53 in tet-off cells reduces steady-state levels of POLD1
mRNA. A, Western blot analysis of ectopic p53
expression induced to physiologically relevant level in H24-p53-14
cells. Lanes 1 and 2, MCF 7 breast cancer cells
were cultured in the absence (lane 1) or presence
(lane 2) of MMS for 4 h; lanes 3-9,
H24-p53-14 cells were cultured with the indicated tetracycline
concentrations for 24 h. Cells were harvested, and 30 µg of
protein from each sample lysate was loaded on a gel and immunoblotted
for p53 using p53 monoclonal antibody DO-1. Results from a
representative experiment are shown. B, Northern blot
analysis of decreased POLD1 steady-state mRNA levels by
tetracycline-induced p53. H24-p53-14 cells were cultured in medium with
indicated tetracycline concentrations. Twenty-four hours after
induction, cells were harvested and total RNA was isolated. Total RNA
(20 µg) was subjected to Northern blotting using probes for POLD1 and
GAPDH.
|
|
Repressive Effect of Exogenous Wild-type p53 Expression on POLD1
Promoter Activity in Saos-2 Cells--
Transient cotransfection
experiments were performed in the p53 null cell line, Saos-2, using the
POLD1 promoter luciferase reporter construct pGL 1758 and
various amounts of a wild-type p53 expression plasmid, pCMV-p53, to
establish that the repression of POLD1 steady-state mRNA levels by
p53 is at the level of the POLD1 gene promoter. The
pGL 1758 reporter contains the 1.8-kb 5' flanking region of the
POLD1 gene fused with the firefly luciferase reporter gene
(15). p53 levels were monitored by Western blotting (Fig.
3A) and were shown to increase
in correspondence with the amount of transfected plasmid DNA. Results
from the luciferase assays (Fig. 3B) showed no repression
when 3 or 10 ng of wt-p53 expression plasmid was transfected even
though low levels of p53 protein were detected by Western blot. Thirty
ng of p53 plasmid DNA caused a 2-fold increase of p53 expression level
compared with that at 10 ng and about a 5-fold increase if compared
with 3 ng of p53 plasmid. At 30 ng/ml p53 plasmid, inhibition of
POLD1 promoter activity was significant (73%). This result
is consistent with the repression of POLD1 mRNA observed in the
previous experiments with tet-off cells. Increasing the amount of
transfected p53 plasmid resulted in a maximal repression of promoter
activity by 83% at 0.1 µg of p53 plasmid DNA. Promoter activity was
not repressed further by greater amounts of p53 expression plasmid at
0.3 and 1 µg, indicating a saturable system for POLD1 repression.
These experiments confirm that exogenous wild-type p53 inhibits
POLD1 promoter activity.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 3.
Repression of exogenous wild-type p53
expression on POLD1 promoter activity in Saos-2
cells. A, Western blot analysis of exogenous p53
expression with different amounts of transfected pCMV-p53 plasmid.
pGL 1758 reporter (0.2 µg) and various amounts of pCMV-p53 plasmid
were co-transfected into Saos-2 cells (see "Experimental
Procedures"). Cells were harvested 24 h after transfection.
Lanes 1-7: 0 ng, 3 ng, 10 ng, 30 ng, 0.1 µg, 0.3 µg,
and 1 µg of pCMV-p53 expression plasmid, respectively. pUC18 plasmid
was added to adjust the total amount of DNA to 1.5 µg. p53 protein
was detected by Western blotting with DO-1 p53 antibody. Actin was
blotted to indicate the same amount of cell extract loaded.
B, dose dependence of POLD1 promoter activity by
ectopic p53. Co-transfection was performed as described in
A. Aliquots of cell extracts (10 µl) were used for
luciferase assays. Results were expressed as fold of change (relative
luciferase unit with pCMV-p53/relative luciferase unit with pCMV-0).
Values are the mean ± S.D. (error bars) from
triplicate samples in three separate experiments. C, Western
blot analysis of exogenous p53 expression at various time points after
transfection. Saos-2 cells were transfected with 0.2 µg of pGL 1758
reporter plasmid and 0.1 µg of pCMV-p53 or pCMV-0 control plasmid.
Cells were harvested at different time points after transfection.
Lanes 1, 3, 5, 7, and 9: 6, 12, 24, 36, and 48 h, respectively, after transfection
with pCMV-0. Lanes 2, 4, 6, 8, and 10:
6, 12, 24, 36, and 48 h, respectively, after transfection with
pCMV-p53. D, time course study of POLD1 promoter
activity by ectopic p53. Co-transfection was performed as described in
C.
|
|
The repression of the POLD1 promoter activity by p53 was
examined at different time points after transfection (Fig.
3C). Promoter activity was inhibited by about 65% at the
12-h time point after transfection when exogenous p53 expression was
increased more than 5-fold compared with the p53 expression level at
the 6-h time point. The activity of the POLD1 promoter was
further repressed by about 85% at 24 and 36 h, whereas the
corresponding levels of exogenous p53 protein were maintained at the
peak. At 48 h, the p53 expression level decreased by about half,
possibly because of its instability. However, the inhibited promoter
activity at 48 h was not affected, indicating the lack of an
immediate effect on POLD1 promoter upon the decline of p53
expression. The time course results confirmed that there was a
time-dependent repression of the POLD1 promoter
activity by wild-type p53 protein. The results also justified the
promoter repression results of Fig. 3B, which were performed
at 24 h after transfection when p53 was maximally expressed.
In Vitro EMSA of the Interaction of p53 with the Sequence in
the P4 Site of the POLD1 Promoter--
A direct binding of wt-p53 to
the consensus p53-binding site (RRCWWGYYY RRCWWGYYY) has
been shown to be essential for the transcriptional activity of p53 (35,
36). Inspection of the POLD1 promoter shows five potential
p53-binding sites, designated P1-P5. Sequence matches for the five
sites are shown in Fig. 4A. The interaction between p53 and these putative p53-binding sites, which
might provide a possible explanation for the p53 repression of
POLD1 promoter, was studied by EMSA using purified
recombinant p53 protein. Human recombinant p53 was overexpressed in
insect cells and was purified to about 90% homogeneity (Fig.
4B). Gel shift assay results (Fig. 4C) showed
that only a 40-mer ds-oligonucleotide spanning the P4 site (see
"Experimental Procedures") was shifted by purified p53 protein
(lane 11) and was further supershifted in the presence of
p53 monoclonal antibody DO-1 (lane 12). The P4 site matched
the canonical p53-binding site in 17 of 20 nucleotides and
harbors a Sp1-binding site between the two halves of the p53 binding
sequence (Fig. 4A). A 40-mer Gadd45 ds-oligonucleotide containing a known p53-binding site (see "Experimental Procedures") was used as a positive control (lanes 16 to 18). P4
oligonucleotide/p53 bands were weaker than the Gadd45 shifted bands,
suggesting that p53 has a lower affinity for the P4 oligonucleotide
than the Gadd45 sequence. A 40-mer oligonucleotide containing the P5
site was shifted and supershifted but with a very weak signal
(lanes 14 and 15), whereas oligonucleotides
containing P1, P2, and P3 sites were not shifted by p53.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 4.
EMSA analysis of the in vitro
interaction of p53 protein with the POLD1
promoter P4 site sequence. A, putative
p53-binding sites P1 to P5. Sites are shown with the consensus sequence
below each site. There are four sites (P1-P4) as shown and
one half-site (P5). A Sp1 site located in the P4 site is
also shown. Matches with the p53 consensus site are
underlined. R = A or G;
W = A or T; Y = C or T. B,
p53 was over-expressed in insect cells and was purified as described
under "Experimental Procedures." The purified p53 was loaded onto a
5-15% gradient SDS-PAGE and silver-stained. C, EMSA
analysis of p53 binding to putative sites P1-P5. EMSA was performed
using labeled oligonucleotides containing each putative site as
indicated. A Gadd45 probe was used as a control. Purified
p53 (50 ng) was incubated with a labeled 40-mer probe corresponding to
each putative site. Lanes 1, 4, 7, 10, 13, and
16: probes only. Lanes 2, 5, 8, 11, 14, and 17: p53 + probes. Lanes 3, 6, 9, 12, 15, and 18: p53 monoclonal antibody DO-1 + p53 + probes. Bands for the free probe, protein-DNA complex, or
antibody-protein-DNA complex are indicated. D, EMSA analysis
of specific p53 binding to the P4 site on POLD1 promoter by
competition and supershift assays. Indicated amounts of different
unlabeled oligonucleotides were added to test for competition with the
labeled probes (see "Experimental Procedures"). Lane 1:
p53 + probe; lanes 2-4: p53 + probe + cold wild-type
Gadd45-oligonucleotide; lanes 5-7: p53 + probe + cold mutated Gadd45-oligonucleotide; lanes
8-10: p53 + probe + cold P4-oligonucleotide; lanes
11-14: p53 + probe + antibodies as indicated. E, EMSA
analysis of sequence specific p53 binding to the P4 p53-binding site.
Purified p53 (50 ng) was incubated with each labeled 40-mer probe.
Lanes 1, 4, 7, and 10: probes only.
Lanes 2, 5, 8, and 11: p53 protein + probes. Lanes 3, 6, 9, and 12: p53 + p53 antibody DO-1 + probes. The Gadd45 probe was used as a
control. Each oligonucleotide containing mutated sequences was listed.
The P4 p53-binding site is underlined, and the P4
Sp1-binding site is double underlined. Letters in
bold italics indicate mutated sequences.
|
|
Cold oligonucleotides were used for binding competition to confirm the
specificity of the binding of p53 to the P4 site (Fig. 4D).
Only cold P4 oligonucleotide (lanes 8-10) and Gadd45 40-mer (Fig. 4D, lanes 2-4) were able to
compete with the shifted band in a dose-dependent manner,
whereas mutated Gadd45 oligonucleotide (Gadd45-mt, sequence described
under "Experimental Procedures") caused a partial nonspecific
competition at 200-fold molar excess (lanes 5-7). All three
p53 monoclonal antibodies, PAb1801, DO-1, and PAb421, were able to
supershift the P4 oligonucleotide-p53 complex, indicating a
specific p53-DNA interaction (lanes 11-13). In contrast,
the Sp1 polyclonal antibody PEP2 did not supershift the p53/P4 band
(lane 14). Thus, the results indicate that P4 is the likely
site for p53 binding to the POLD1 promoter.
If the putative P4 p53-binding site is a sequence-specific p53-binding
site, mutations in this site should result in the elimination of its
binding to p53. A 40-mer oligonucleotide (mP4) containing a mutated P4
p53-binding site was tested by EMSA (Fig. 4E). Four matched
nucleotides in the first half of the p53 10-bp motif and three matched
nucleotides in the second half motif of the P4 sequence were mutated
(sequence described in Fig. 4E, lower
panel). The interaction of mP4 with p53 was greatly weakened
compared with the P4 oligonucleotide, as only very weak signals for the
shifted and supershifted bands were observed (Fig. 4E,
lanes 5 and 6). In contrast, the mSp1
oligonucleotide (sequence described in lower panel), in
which the intervening sequence between the two halves of the p53
consensus was mutated and which has an unchanged P4 p53-binding site,
was able to bind and retain an interaction with p53 (Fig.
4E, lanes 8 and 9). These results
provide additional evidence for a sequence-specific interaction between
p53 and the P4 site. The results from the above experiments showed that
only the P4 site possesses a sequence that exhibits significant
interaction with p53 and provided the initial identification of the P4
site as the likely locus for the actions of p53 on the transcriptional activity of the intact POLD1 promoter.
Interaction between p53 and the P4 p53-binding Site Plays a Major
Role in the Regulation of POLD1 Promoter by p53--
The function of
the P4 site in the intact promoter as the site of p53 action was
analyzed by the use of deletion and point mutations in the pGL 1758
POLD1 reporter construct. The P4 p53-binding site in the promoter was
either deleted (pGL 113/ 58) or mutated (pGL 1758mP4).
Promoter/reporter constructs and site-directed mutation sequences are
shown in Fig. 5A. The effect
of p53 on these promoter constructs was examined by co-transfection
into Saos-2 cells. p53 repressed the promoter activity of
pGL 113/ 58 by about 55%, whereas it repressed that of
pGL 1758mP4 by about 35% (Fig. 5B). The transrepression
activity of p53 on both promoters was significantly diminished but not
fully lost compared with that of the full-length pGL 1758 promoter
(about 86% inhibition). Nevertheless, these results indicate that p53
mediated its major inhibitory effects on POLD1 promoter
through the P4 site. The diminished p53 inhibitory effect on the
P4-mutated POLD1 promoter is likely due to the loss of p53
binding to the mutated P4 site (mP4), as shown in Fig. 4E.
The results also suggest a possibility that there may be other p53
negative response elements in addition to the P4 site present in the
POLD1 promoter, because deletion of the P4 site did not
completely ablate p53 repression.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 5.
Interaction between p53 and the P4
p53-binding site in the regulation of POLD1 promoter
by p53. A, maps of the mutated POLD1
promoter constructs. The indicated regions of the POLD1
promoter and 5' flanking region (shaded boxes) were linked
to the luciferase coding region (open boxes). The
arrow indicates the transcription start site, and
numbering is related to the first residue of exon 1. Each
solid bar denotes a putative p53-binding site
(P1-P5). Graphs were not drawn to scale. Mutated sites for
pGL 1758mP4 and pGL 1758mSp are shown in the lower panel.
The P4 p53-binding site is underlined, and the P4
Sp1-binding site is double underlined. Letters in
bold italics indicate mutated sequences. B,
luciferase assays of p53 regulation of mutated POLD1
promoter/reporter constructs. pCMV-p53 or pCMV-0 plasmid (0.1 µg)
were transfected with 0.2 µg of each promoter/reporter plasmid as
described under "Experimental Procedures." Cells were harvested
24 h after transfection. Cell extracts were used for luciferase
assays. Values are the mean ± S.D. (error bars) of
relative luciferase units (RLU) from triplicate samples in
three independent experiments.
|
|
In addition, when the P4 site was deleted (pGL -113/-58), the basal
promoter activity in the absence of p53 was reduced by about 39%
compared with that for the pGL 1758 full-length promoter. This was
attributed to the fact that the deleted region in pGL 113/ 58 also
includes a Sp1-binding site (see below). The deletion of the
Sp1-binding site could contribute to the significantly reduced basal
promoter activity for pGL 113/ 58. This possibility was confirmed
by the results with the pGL 1758mSp1 promoter, where the P4
Sp1-binding site was mutated and the P4 p53 binding site was unchanged
(Fig. 5A). In this promoter, basal promoter activity was
similarly reduced by about 34% in the absence of p53 (Fig. 5B). When a 5' deletion promoter construct (pGL 583) in the
5'-most 1.2-kb region was truncated, resulting in the deletion of the P1, P2, and P3 sites, p53 inhibited the promoter activity by about 83%; this indicated that the three putative p53-binding sites (P1, P2,
and P3) are unlikely to be involved in p53 transcriptional repression.
Transrepression of POLD1 by p53 Mutants--
Tumor-derived
mutations in p53 significantly reduce p53 transrepression activity on
many promoters such as the mouse DP1 promoter (37), the DNA
topoisomerase II promoter (25), and the insulin-like growth factor I
receptor gene promoter (26). To determine whether the inhibition of
POLD1 promoter was affected by tumor-derived mutations in
p53, wt-p53 or individual tumor-derived p53 point mutants (pCMV-V143A,
pCMV-R175H, pCMV-R248W, pCMV-R273H, and pCMV-R282W) were transfected
into Saos-2 cells. All of these mutants are ones that have lost p53
consensus binding and transactivation activities. Only wt-p53 was able
to inhibit POLD1 promoter activity (by about 85%) compared
with the control vector (Fig.
6B). All of the tumor-derived p53 point mutants exhibited a disruption of transrepression activity under identical assay conditions. The Pro deletion mutant (Dlt-Pro), which has been reported to have normal p53-mediated transcriptional activation but is defective in p53-mediated apoptosis, did not exhibit
a significantly reduced repression activity. Results from these p53
mutants indicated that the specific DNA binding activity of p53 was
indispensable for the p53 transcriptional regulation of
POLD1 promoter, confirming the results from the above
experiments.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 6.
Repression of POLD1 by p53 mutants.
A, Western blot of wt-p53 and p53 mutants. Twenty µg of
protein from each sample lysate was loaded on 10% SDS-PAGE, and p53
was detected by a mixture of p53 antibodies DO-1 and PAb421.
B, luciferase assay of the effect of p53 mutants on
POLD1 promoter activity. The indicated p53 mutant expression
plasmids or pCMV-0 (0.1 µg) were transfected with 0.2 µg of
POLD1 promoter/reporter gene plasmids. Cells were harvested
24 h after transfection, and the cell extracts were assayed for
luciferase activity. Values are the mean ± S.D. (error
bars) of relative luciferase units (RLU) from
triplicate samples in three separate experiments. C,
indicated p53 mutant expression plasmids or pCMV-0 (0.1 µg) were
transfected with 0.2 µg of p53 control reporter p53-Luc (Stratagene).
Cells were harvested 24 h after transfection. Aliquots of cell
extracts were used for luciferase assays.
|
|
Extracts from appropriately transfected Saos-2 cells were examined to
show that wild-type and p53 mutants were produced at equivalent levels
(Fig. 6A). All of the p53 constructs transfected in Saos-2
cells were able to express their corresponding proteins to
approximately similar levels. In addition, wild-type and mutant p53
protein levels were stable between 18 and 36 h after transfection (data not shown). Therefore, these results eliminated the possibility that the lack of significant repression activity on POLD1
promoter by p53 mutants is due to deficient protein levels of p53
mutants in transfected Saos-2 cells or that the results are due to
overexpression of the mutants compared with the wild type. To confirm
the transcriptional activation functions of all the ectopic p53
mutants, reporter gene assays were performed (Fig. 6C).
Experiments were performed under the same conditions as described in
Fig. 6B, except that an artificial p53 reporter promoter
containing 15 repeats of consensus p53-binding site was used instead of
the full-length POLD1 promoter/reporter pGL 1758. The
results showed that wild-type p53 and the Pro p53 deletion mutant
were able to activate promoter activity substantially whereas the
other mutants were transactivation defective, consistent with the
reported behavior of p53 in promoter activation. These results
indicated that the inhibition of POLD1 promoter activity by
wild-type p53 was not an artificial effect because of general inactivation of the transcriptional machinery or squelching of general
transcription factors. This conclusion is based on the result
that the wild-type p53 and the Pro p53 deletion mutant were able to
substantially activate the p53-Luc reporter, whereas an inhibition
would be expected in the general inactivation or transcriptional
squelching mechanism.
Sp1 Transcription Factor Interacts with the P4 Site Sequence in
Vitro--
Southwestern blotting of cell extracts was performed to
study other transcriptional factors that may participate in the
regulation of POLD1 promoter by p53 repressor at the basal
transcriptional level. MCF7 and RKO cells were treated with and without
MMS. The radiolabeled 40-mer P4 oligonucleotide was used as a probe.
Two signals were detected when the labeled P4 oligonucleotide was hybridized with the membrane, indicating that the P4 oligonucleotide interacted with two proteins of about 90 and 30 kDa in size (Fig. 7A, left panel,
lanes 1-4). The 90-kDa signal was of the same molecular size as that in lane 5, where purified
recombinant Sp1 protein was used. The same membrane was Western-blotted
with Sp1 polyclonal antibody, which detected a band of 90 kDa (Fig.
7A, right panel). The 90-kDa Sp1 band superimposed well with
the 90-kDa signal in the Southwestern blot. These data suggested that
the P4 oligonucleotide complexed with the Sp1 protein from nuclear extracts in vitro. However, no signal was observed at the
position of p53 in the Southwestern blot (Fig. 7A, left
panel, lanes 1-4). The lack of detectable interaction
between the P4 oligonucleotide with p53 is not likely because of a lack
of p53 protein. Western blotting of the same membrane showed that
cellular p53 was induced by MMS treatment (Fig. 7A, right
panel, lanes 1-4). Because Southwestern blotting
employs a denaturation step, it might result in the loss of native
conformation and binding activity in some sensitive DNA-binding
proteins such as p53. A stepwise denaturation-renaturation procedure
using 7 M guanidine HCl under the same conditions did not
show positive results either (data not shown). The 30-kDa signal in the
Southwestern blot showed that the P4 oligonucleotide also interacted
with an unknown cellular protein.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 7.
Interaction between Sp1 transcriptional
factor and the P4 site sequence in vitro. A,
Southwestern analysis of P4 oligonucleotide-binding proteins.
Left panel: 30 µg of nuclear extract protein from RKO
control cells (lane 1), RKO cells treated with 100 µg/ml
MMS (lane 2), MCF7 cells (lane 3), MCF7 cells
treated with 100 µg/ml MMS (lane 4), and 20 ng of purified
recombinant Sp1 protein (lane 5) were resolved on 5-15%
gradient SDS-PAGE and then transferred to a polyvinylidene difluoride
membrane (PVDF-PSQ, Millipore). The membrane was hybridized
with the 32P-labeled P4 site 40-mer, the same probe used in
EMSA. After washing, the membrane was exposed to x-ray film. Molecular
size markers are labeled on the left. Right
panel: Western blot of the same membrane probed with antibodies
against Sp1 (upper section) or p53 (lower
section). Positions of the p53 or Sp1 protein band are indicated.
B, EMSA analysis of Sp1-P4 oligonucleotide interaction.
Electrophoretic mobility shift assays were performed using Sp1 and
oligonucleotides containing each mutated P4 site as indicated. A
Gadd45 probe was used as a control. Purified Sp1 (30 ng) was
incubated with each labeled 40-mer probe. Probe preparation and EMSAs
were performed as described under "Experimental Procedures."
Lanes 1, 3, 5, and 7: Sp1 protein + probes. Lanes 2, 4, 6, and 8: Sp1 + Sp1 polyclonal antibody PEP2 + probes. Bands for free probe,
protein-DNA complex, or antibody-protein-DNA complex are indicated.
Each oligonucleotide contains mutated sequences as listed. The P4
p53-binding site is underlined, and the P4 Sp1-binding site
is double underlined. Letters in bold
italics indicate mutated sequences.
|
|
To confirm a sequence-specific interaction between Sp1 factor and the
P4 Sp1-binding site, EMSA was performed using purified recombinant Sp1
protein and 40-mer oligonucleotides. The P4 oligonucleotide was shifted
by Sp1 protein (Fig. 7B, lane 1) and supershifted by the addition of Sp1 polyclonal antibody (lane 2). Sp1 was
able to bind to the mP4 oligonucleotide, in which the p53-binding site was mutated (lanes 3 and 4). However, when the
mSp1 oligonucleotide, which contains a mutated Sp1-binding site, was
used as a probe, Sp1/DNA binding was eliminated (lanes 5 and
6), indicating a specific binding of Sp1 to the Sp1-binding
site in the P4 sequence.
p53 Partially Suppresses Sp1-stimulated POLD1 Promoter Activity via
the P4 Site--
The binding of the Sp1 factor to the P4 site adds
another layer of complexity to the regulation of the POLD1
promoter, because Sp1-family proteins have been found to stimulate the
basal transcriptional level of POLD1 promoter (15). To
investigate the effect of p53 on the Sp1-stimulated promoter activity,
Sp1 and p53 expression plasmids were co-transfected into
Drosophila SL2 cells, which lack endogenous Sp1 factors and
have been useful in studying the function of Sp1 proteins (31). As
shown in Fig. 8A (the
second bar in the pGL 1758 group), when the full-length
POLD1 promoter/reporter construct pGL 1758 was
co-transfected with Sp1 expression plasmid pPacSp1, the promoter was
stimulated about 7-fold compared with the results for the control
vector (first bar in pGL 1758 group). Similar results were
obtained with pGL 1758mP4 in which the P4 p53-binding site was
mutated. Elimination of the P4 Sp1-binding site by mutation
(pGL 1758mSp1) resulted in an approximately 50% reduction of promoter
activity, indicating that the P4 Sp1-binding site is responsible for
about half of the Sp1-dependent stimulation. Because the
POLD1 promoter contains multiple Sp1 sites, this result is
not surprising, but nevertheless shows that the Sp1 site in P4 is a
major site for Sp1 activation of the POLD1 promoter.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 8.
partial suppression of Sp1-stimulated
POLD1 promoter activity by p53 via the P4 site.
A, luciferase assays of POLD1 promoter activity
for co-transfection in Drosophila SL2 cells, Promoter/
reporter constructs together with Sp1 expression plasmid and p53
expression plasmid were used for co-transfection assays (see
"Experimental Procedures"). For Sp1 + p53, the pPac-Sp1 expression
plasmid and pPac-p53 expression plasmid were used. For Sp1, pPac-Sp1
expression plasmid and pPacU control plasmid were used. For the
control, pPacU control plasmid was used. pGL2 is the pGL2
basic control reporter vector; pGL 1758 is the full-length
POLD1 promoter/reporter construct; pGL 1758mSp1
and pGL 1758mp53 are promoter/reporters with mutations in
the Sp1-binding site and the p53-binding site, respectively. Aliquots
of cell extracts were assayed for luciferase activity. Values are
mean ± S.D. (error bars) from triplicate samples in
three separate experiments. RLU, relative luciferase units.
B, ectopic expressions of Sp1 and p53 are shown in the
lower panel as determined by Western blotting.
|
|
The regulatory effects of p53 on the Sp1-stimulated POLD1
promoter were examined by co-transfection of the p53 expression plasmid
pPac-p53 with the Sp1 plasmid pPas-Sp1, as shown in the third
bar in each group (Fig. 8A). The Sp1-stimulated
activity of the full-length promoter was reduced by about 62% by
exogenous p53 but was not completely eliminated. This indicated that
p53 was able to inhibit the Sp1-stimulated POLD1 promoter
activity and also showed that part of the Sp1-stimulated promoter
activity was independent of p53 repression. However, bearing in mind
that mutation of the P4 Sp1 site (pGL 1758mSp1) led to a reduction of
about 50% in Sp1-stimulated promoter activity, the results are
consistent with those expected if p53 completely inhibited the ability
of Sp1 to act at the P4 site. When the p53 plasmid was
co-transfected with the pGL 1758mP4 reporter in which the P4
p53-binding site is mutated, only a slight inhibition was observed. Similar results were obtained with the pGL 1758mSp1 reporter where the
P4 Sp1-binding site is mutated. These data provide evidence that the
action of p53 on the POLD1 indicated is largely mediated through the P4
Sp1 site. However, the results also indicate that in addition to the P4
p53-binding site, there are some other sites through which p53 was able
to down-regulate POLD1 promoter in a minor way. In Fig.
8B, extracts from appropriately transfected SL2 cells were
examined to show equivalent levels of exogenous Sp1 or p53 expression.
p53 Competes with Sp1 Protein for Binding to the P4 Sequence in
EMSA--
The fact that p53 and Sp1 individually bind to corresponding
sites in close proximity suggested a mechanism whereby p53 may interact with Sp1 protein on the P4 Sp1 cis-element to
suppress Sp1-stimulated POLD1 promoter activity. To
investigate this possibility, EMSA was performed using purified
recombinant Sp1 and p53 protein for binding to the P4 oligonucleotide.
In this experiment, different molar ratios of Sp1 and p53 were tested
(these were calculated on the assumption that both protein are
monomers, although it should be noted that both p53 and Sp1 bind to DNA
as oligomers). At a nominal 1:1 molar ratio, p53 was unable to affect
Sp1-P4 oligonucleotide interaction (Fig.
9, lane 6). However, as the ratio of p53 increased, there was a corresponding appearance of the
p53-P4 oligonucleotide complex and an attenuated binding of Sp1 to the
P4 oligonucleotide (Fig. 9, lane 7). A 15-fold molar excess
of p53 completely abrogated Sp1-DNA complex formation and resulted in
the appearance of a strong p53-DNA complex and an additional band due
to nonspecific binding (Fig. 9, lane 8).

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 9.
Competition between Sp1 protein
and p53 for binding to the P4 site. Purified recombinant Sp1 and
p53 protein were used for EMSA. Labeled 40-mer P4-oligonucleotide
containing the P4 p53-binding site and the P4 Sp1-binding site was used
as the probe. EMSA was performed as described under "Experimental
Procedures." Lane 1: probe only; lane 2: 30 ng
of Sp1 protein + probe; lane 3: 30 ng of Sp1 + Sp1
polyclonal antibody PEP2 + probe; lane 4: 15 ng of purified
p53 + probe; lane 5: 15 ng of purified p53 + p53 monoclonal
antibody DO-1 + probe; lanes 6-8: probes and 30 ng of Sp1
protein were used with the following amounts of p53: lane 6,
15 ng; lane 7, 50 ng; lane 8, 250 ng. The
positions of the Sp1-DNA complex and the p53-DNA complex are
indicated; *, indicates nonspecific binding.
|
|
 |
DISCUSSION |
p53 is a powerful tumor suppressor that acts as a checkpoint in
maintaining genomic stability by inducing cell cycle arrest or
apoptosis after DNA damage, largely through its function as a
transcriptional regulator. Following enhanced expression and activation
of p53 as a transcription factor, it also participates in a process by
which DNA replication pauses, presumably until DNA repair is complete.
Only a few p53 target genes have been identified as involved in the
inhibition of DNA replication. Among these are
p21/Cip1/WAF1 (18) and
Gadd45 (22). Nevertheless, as evidenced by the example of
p21/Cip1/WAF1, regulation of a single
p53 transcriptional target gene is generally not sufficient to account
for the biological functions of p53 (19, 20). In this regard, the
identification of p53 target genes that participate in the regulation
of DNA replication is an important objective, because the control of
DNA synthesis is clearly one of the key cellular processes that is
impacted by p53. In this study, the POLD1 gene was
identified as a novel target of p53 transcriptional regulation, and
evidence was obtained for a competition by p53 with Sp1 at a novel p53
binding sequence (P4), which harbors an internal Sp1 site.
Care was taken in this study to use a tet-off cell system in which
ectopic wt-p53 expression was induced to a level similar to that
observed in MMS-treated MCF7 cells. The H24-p53-14 cell line used in
this study is one of the tet-off cell lines that has been utilized to
investigate the role of p53 in G1 cell cycle arrest or
apoptosis. Transcripts of genes such as
p21/Waf1/Cip1, mdm2,
Gadd45, and bax were also shown to be activated
in these cell lines (29). In this study, POLD1 mRNA was found to be
repressed in response to both MMS- and tetracycline-induced p53
expression, suggesting that POLD1 repression by p53 is physiologically relevant.
The results from this study provide evidence for a mechanism involving
competition between p53 and Sp1 for binding to the P4 site of the
POLD1 promoter, which contains both a p53 and a Sp1 site.
This type of exclusion mechanism for p53 transcriptional repression may
be more general, as evidence has been found for competition between p53
and other transcriptional factors in other systems. The repression of
-fetoprotein expression by p53 was found to involve competition
between binding of p53 and hepatic nuclear factor-3 for overlapping
sites in the -fetoprotein promoter (23), a situation similar to that
observed for the POLD1 promoter. Studies of the inhibition
of the cyclooxygenase-2 gene by p53 have revealed that p53 competes
with TATA-binding protein in a 40-bp region in the promoter close to
the transcription start site; however, the specific sequence elements
involved have not been identified (24). In vitro competition
between p53 and Sp1 for binding to overlapping DNA sequences has been
reported for the SV40 and HIV-LTR (human immunodeficiency virus) viral
promoters (38, 39). The requirement for multiple Sp1 binding sites
within the p53-responsive region for the transcriptional inhibitory
effect of wild-type p53 has recently been shown on cellular promoters for vascular endothelial growth factor gene (VEGF) (40) and human telomerase catalytic subunit gene (hTERT) (41).
Therefore, the findings that p53 is able to exclude the binding of Sp1
by overlapping binding sites and exert a repressive effect on
POLD1 gene transcription provides an important example of
Sp1-p53 exclusion on a cellular gene promoter, considering a wealth of
recent evidence that p53 is able to inhibit Sp1-mediated promoter
activity of many genes such as insulin-like growth factor-I receptor
gene (26), Werner helicase gene (27), and the multiple drug
resistance-associated protein gene (42). In addition, Sp1-binding sites
are present in the promoters of many growth-regulated genes (43). It
may be important to consider that such inhibitory effects of p53 on Sp1-mediated promoter activity could be extended to the regulation of
other cellular promoters that contain overlapping p53- and Sp1-binding
sites. There is also evidence that there are structural similarities in
the binding motifs for Sp1 and p53 (44), providing a structural
rationale for the existence of overlapping Sp1-p53 binding sites.
Biochemical evidence for physical interactions between p53 and Sp1 has
been lacking. Attempts to detect a stable Sp1-p53 heterocomplex using
cell extracts from MMS-treated MCF7 cells in the presence or absence of
P4 oligonucleotide were negative, although positive signals were
obtained from experiments with extracts in which p53 was expressed
ectopically (data not shown). In addition, we were unable to detect a
Sp1-p53-DNA complex in our EMSA experiment (Fig. 9). The negative
results for Sp1-p53 heterocomplex formation are consistent with the
co-immunoprecipitation and EMSA results obtained by Bargonetti et
al. (39). Nevertheless, in some studies, Sp1 has been found to
form a heterocomplex with mutant or proliferative forms of p53 in
regulating promoter activities (45, 46). Furthermore, we cannot exclude
the operation of a second level of transrepression involving p53
interaction with other transcription factors, as the co-transfection
experiments involving Sp1 and p53 indicated that a competition at the
P4 site would account for only about half of the observed p53 effects
on Sp1-driven promoter activity.
p53 has been shown to transrepress several other DNA
replication-related genes. In a "DEX-on" cell line,
dexamethasone-induced wild-type p53 protein expression led to cell
growth inhibition and a significant decrease in steady-state mRNA
level of DNA polymerase catalytic subunit gene. The mechanism of
such inhibition has not been investigated (47). Wild-type p53 also
confers cell line-dependent repression of the promoter of
PCNA gene, the product of which is well established to be
involved in DNA replication/repair and cell cycle regulation (48, 49).
Wild-type but not mutant p53 induced by DNA damaging agents was able to
cause a decrease in DNA topoisomerase II mRNA and promoter
activity. However, such transrepression is not by p53 sequence-specific
binding (25, 50). Recent studies of genes regulated by p53 have
revealed additional DNA replication genes that are repressed by p53,
including DNA primase polypeptide I, chromosomal protein HMG-17, and
RFC 37, which encodes one of the small subunits of replication
factor C (RFC) that loads and unloads PCNA clamps (51-53).
The exact biological functions/consequences of the transrepression of
DNA replication-related genes are still unclear. These genes are
generally expressed in late G1/S-phase when cells have already passed the cell cycle restriction point and are committed to
enter S phase and initiate DNA synthesis. It is conceivable that
p53-mediated POLD1 repression serves to halt DNA replication as the
consequence of p53-induced cell cycle arrest, which involves immediate-early genes such as c-jun, c-fos,
c-myc, and other cell cycle regulation genes such as
p21/WAF1/Cip1,
Cyclin/Cdk, and Rb. It is also
possible that the transcriptional repression of POLD1 and
other DNA replication genes may be the result of p53-induced prolonged,
probably permanent, G1 delay based on the fact that the
expression of DNA polymerase (54) and DNA polymerase
2 are significantly
inhibited during myeloid and erythroleukemia cell terminal
differentiation. Growing lines of evidence have argued that loss of p53
results in decreased genomic stability, not because of loss of
transient checkpoint controls but because of a failure to prevent
severely damaged cells from surviving and propagating, underscoring the
important role of prolonged G1 arrest in maintaining DNA
integrity (55). Further studies are needed for insightful understanding
of the biological effects of the p53 transrepression of DNA polymerase
catalytic subunit gene. However, it is possible that loss of
wild-type p53 function in cancer cells might rescue the
POLD1 promoter activity normally repressed by wild-type p53,
contributing to unregulated cancer cell growth and proliferation.
It seems paradoxical that after the genome is harmed by DNA-damaging
agents, p53, the "genome guardian," represses the transcription of
POLD1 gene, the product of which is also suggested to be
involved in DNA repair. A possible scenario is that p53 arrests cell
cycle, halts DNA replication, and leads to the repression of POLD1
transcription. Simultaneously, p53 stimulates initiation of DNA repair,
which involves DNA polymerase and DNA polymerase . There are
some reports that provide support for this possibility. 1) pol functions as a sensor for DNA replication coordinating the
transcriptional and cell cycle response to replication block (56). 2)
pol or pol components perform equally well in reconstituted
nucleotide-excision repair assays (6). 3) In yeast genetic studies, pol
and pol are able to efficiently substitute for each other in
nucleotide excision repair after uv damage (57). (4) Transcription of pol , the major DNA polymerase in base-excision repair, is not repressed by overexpressed p53 (49).
In summary, the present studies show that POLD1 gene
expression is repressed by wild-type p53. The evidence indicates that the majority of transcriptional repression was mediated by
sequence-specific binding of p53 to the P4 p53-binding site in the
POLD1 promoter. Examination of the mechanism by which p53
represses the POLD1 promoter led to the identification of a
competition between p53 and Sp1 for overlapping binding sites in the P4
sequence of the POLD1 promoter. Thus, the present finding
that POLD1 is subject to p53 transrepression adds the DNA
polymerase catalytic subunit gene, a central enzyme of DNA
replication, to the growing group of DNA replication/repair genes
inhibited by p53. These findings also add to the currently emerging
body of evidence that sequence-specific binding of p53 to promoter
sequences can result in transcriptional repression in addition to the
known effects of p53 as a transcriptional activator. However, the
biological functions/consequences of the transrepression of
POLD1 by p53 in response to DNA damage is more complicated
and remain to be determined. Future investigation of POLD1
transcriptional regulation by other cis-elements and trans-factors and the interaction between p53 and
trans-factors may be helpful in understanding the biological
significance of POLD1 gene regulation by p53 in response to
DNA damage in cellular processes such as DNA replication/repair, cell
cycle arrest, and apoptosis.
 |
ACKNOWLEDGEMENTS |
We are grateful to Drs. X. Chen, M. Kastan,
C. Prives, B. Vogelstein, E. Harlow, and R. Tijian for generously
providing reagents.
 |
FOOTNOTES |
*
The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.This
work was supported by National Institutes of
Health Grant GM 31973.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 914-594-4070;
Fax: 914-594-4058; E-mail: marietta_lee@nymc.edu.
Published, JBC Papers in Press, May 25, 2001, DOI 10.1074/jbc.M101167200
2
B. Li and M. Y. W. Lee, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
pol , DNA
polymerase ;
POLD1, DNA polymerase catalytic subunit
gene;
PCNA, proliferating cell nuclear antigen;
Gadd45, growth arrest and DNA damage-inducible gene 45;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
DTT, dithiothreitol;
MMS, methane methylsulfonate;
EMSA, electrophoretic mobility shift assay;
PCR, polymerase chain reaction;
PAGE, polyacrylamide gel electrophoresis;
bp, base pair(s);
kb, kilobase pair(s);
SL2 cells, Drosophila Schneider line
2 cells;
ds-, double-stranded-;
wt, wild type.
 |
REFERENCES |
| 1.
|
Woodgate, R.
(1999)
Genes Dev.
13,
2191-2195
|
| 2.
|
Dominguez, O.,
Ruiz, J. F.,
De Lera, T. L.,
Garcia-Diaz, M.,
Gonzalez, M. A.,
Kirchhoff, T.,
Martinez-A, C.,
Bernad, A.,
and Blanco, L.
(2000)
EMBO J.
19,
1731-1742
|
| 3.
|
Waga, S.,
and Stillman, B.
(1994)
Nature
369,
207-212
|
| 4.
|
Waga, S.,
Bauer, G.,
and Stillman, B.
(1994)
J. Biol. Chem.
269,
10923-10934
|
| 5.
|
Zeng, X. R.,
Jiang, Y.,
Zhang, S. J.,
Hao, H.,
and Lee, M. Y.
(1994)
J. Biol. Chem.
269,
13748-13751
|
| 6.
|
Aboussekhra, A.,
Biggerstaff, M.,
Shivji, M. K.,
Vilpo, J. A.,
Moncollin, V.,
Podust, V. N.,
Protic, M.,
Hubscher, U.,
Egly, J. M.,
and Wood, R. D.
(1995)
Cell
80,
859-868
|
| 7.
|
Halas, A.,
Baranowska, H.,
Policinska, Z.,
and Jachymczyk, W. J.
(1997)
Curr. Genet.
31,
292-301
|
| 8.
|
Longley, M. J.,
Pierce, A. J.,
and Modrich, P.
(1997)
J. Biol. Chem.
272,
10917-10921
|
| 9.
|
Holmes, A. M.,
and Haber, J. E.
(1999)
Cell
96,
415-424
|
| 10.
|
Liu, L.,
Mo, J.,
Rodriguez-Belmonte, E. M.,
and Lee, M. Y.
(2000)
J. Biol. Chem.
275,
18739-18744
|
| 11.
|
Zuo, S.,
Bermudez, V.,
Zhang, G.,
Kellman, Z.,
and Hurwitz, J.
(2000)
J. Biol. Chem.
275,
5153-5162
|
| 12.
|
Yang, C. L.,
Chang, L. S.,
Zhang, P.,
Hao, H.,
Zhu, L.,
Toomey, N. L.,
and Lee, M. Y.
(1992)
Nucleic Acids Res.
20,
735-745
|
| 13.
|
Zeng, X. R.,
Hao, H.,
Jiang, Y.,
and Lee, M. Y.
(1994)
J. Biol. Chem.
269,
24027-24033
|
| 14.
|
Hao, H.,
Jiang, Y.,
Zhang, S. J.,
Zhang, P.,
Zeng, R. X.,
and Lee, M. Y.
(1992)
Chromosoma
102,
S121-127
|
| 15.
|
Zhao, L.,
and Chang, L. S.
(1997)
J. Biol. Chem.
272,
4869-4882
|
| 16.
|
Ko, L. J.,
and Prives, C.
(1996)
Genes Dev.
10,
1054-1072
|
| 17.
|
Levine, A. J.
(1997)
Cell
88,
323-331
|
| 18.
|
El-Deiry, W. S.,
Tokino, T.,
Velculescu, V. E.,
Levy, D. B.,
Parsons, R.,
Trent, J. M.,
Lin, D.,
Mercer, W. E.,
Kinzler, K. W.,
and Vogelstein, B.
(1993)
Cell
75,
817-825
|
| 19.
|
Brugarolas, J.,
Chandrasekaran, C.,
Gordon, J. I.,
Beach, D.,
Jacks, T.,
and Hannon, G. J.
(1995)
Nature
377,
552-557
|
| 20.
|
Deng, C.,
Zhang, P.,
Harper, J. W.,
Elledge, S. J.,
and Leder, P.
(1995)
Cell
82,
675-684
|
| 21.
|
Waga, S.,
Hannon, G. J.,
Beach, D.,
and Stillman, B.
(1994)
Nature
369,
574-578
|
| 22.
|
Smith, M. L.,
Chen, I. T.,
Zhan, Q.,
Bae, I.,
Chen, C. Y.,
Gilmer, T. M.,
Kastan, M. B.,
O'Connor, P. M.,
and Fornace, A. J., Jr.
(1994)
Science
266,
1376-1380
|
| 23.
|
Lee, K. C.,
Crowe, A. J.,
and Barton, M. C.
(1999)
Mol. Cell. Biol.
19,
1279-1288
|
| 24.
|
Subbaramaiah, K.,
Altorki, N.,
Chung, W. J.,
Mestre, J. R.,
Sampat, A.,
and Dannenberg, A. J.
(1999)
J. Biol. Chem.
274,
10911-10915
|
| 25.
|
Wang, Q.,
Zambetti, G. P.,
and Suttle, D. P.
(1997)
Mol. Cell. Biol.
17,
389-397
|
| 26.
|
Ohlsson, C.,
Kley, N.,
Werner, H.,
and LeRoith, D.
(1998)
Endocrinology
139,
1101-1107
|
| 27.
|
Yamabe, Y.,
Shimamoto, A.,
Goto, M.,
Yokota, J.,
Sugawara, M.,
and Furuichi, Y.
(1998)
Mol. Cell. Biol.
18,
6191-6200
|
| 28.
|
Slichenmyer, W. J.,
Nelson, W. G.,
Slebos, R. J.,
and Kastan, M. B.
(1993)
Cancer Res.
53,
4164-4168
|
| 29.
|
Chen, X.,
Ko, L. J.,
Jayaraman, L.,
and Prives, C.
(1996)
Genes Dev.
10,
2438-2451
|
| 30.
|
Kern, S. E.,
Pietenpol, J. A.,
Thiagalingam, S.,
Seymour, A.,
Kinzler, K. W.,
and Vogelstein, B.
(1992)
Science
256,
827-830
|
| 31.
|
Courey, A. J.,
and Tjian, R.
(1988)
Cell
55,
887-898
|
| 32.
|
Delphin, C.,
Cahen, P.,
Lawrence, J. J.,
and Baudier, J.
(1994)
Eur. J. Biochem.
223,
683-692
|
| 33.
|
Zhan, Q.,
Chen, I. T.,
Antinore, M. J.,
and Fornace, A. J., Jr.
(1998)
Mol. Cell. Biol.
18,
2768-2778
|
| 34.
|
Bartek, J.,
Iggo, R.,
Gannon, J.,
and Lane, D. P.
(1990)
Oncogene
5,
893-899
|
| 35.
|
el-Deiry, W. S.,
Kern, S. E.,
Pietenpol, J. A.,
Kinzler, K. W.,
and Vogelstein, B.
(1992)
Nat. Genet.
1,
45-49
|
| 36.
|
Hansen, R.,
and Oren, M.
(1997)
Curr. Opin. Genet. Dev.
7,
46-51
|
| 37.
|
Gopalkrishnan, R. V.,
Lam, E. W. F.,
and Kedinger, C.
(1998)
J. Biol. Chem.
273,
10972-10978
|
| 38.
|
Perrem, K.,
Rayner, J.,
Voss, T.,
Sturzbecher, H.,
Jackson, P.,
and Braithwaite, A.
(1995)
Oncogene
11,
1299-1307
|
| 39.
|
Bargonetti, J.,
Chicas, A.,
White, D.,
and Prives, C.
(1997)
Cell. Mol. Biol.
43,
935-949
|
| 40.
|
Zhang, L., Yu, D.,
Hu, M.,
Xiong, S.,
Lang, A.,
Ellis, L. M.,
and Pollock, R. E.
(2000)
Cancer Res.
60,
3655-3661
|
| 41.
|
Kanaya, T.,
Kyo, S.,
Hamada, K.,
Takakura, M.,
Kitagawa, Y.,
Harada, H.,
and Inoue, M.
(2000)
Clin. Cancer Res.
6,
1239-1251
|
| 42.
|
Wang, Q.,
and Beck, W. T.
(1998)
Cancer Res.
58,
5762-5769
|
| 43.
|
Azizkhan, J.,
Jensen, D. E.,
Pierce, A. J.,
and Wade, M.
(1993)
Crit. Rev. Eukaryotic Gene Expr.
3,
229-254
|
| 44.
|
MacLeod, M. C.
(1993)
Nucleic Acids Res.
21,
1439-1447
|
| 45.
|
Gualberto, A.,
and Baldwin, A. S., Jr.
(1995)
J. Biol. Chem.
270,
19680-19683
|
| 46.
|
Borellini, F.,
and Glazer, R. I.
(1993)
J. Biol. Chem.
268,
7923-7928
|
| 47.
|
Lin, D.,
Shields, M. T.,
Ullrich, S. J.,
Appella, E.,
and Mercer, W. E.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9210-9214
|
| 48.
|
Jackson, P.,
Ridgway, P.,
Rayner, J.,
Noble, J.,
and Braithwaite, A.
(1994)
Biochem. Biophys. Res. Commun.
203,
133-140
|
| 49.
|
Yamaguchi, M.,
Hayashi, Y.,
Matsuoka, S.,
Takahashi, T.,
and Matsukage, A.
(1994)
Eur. J. Biochem.
221,
227-237
|
| 50.
|
Sandri, M. I.,
Isaacs, R. J.,
Ongkeko, W. M.,
Harris, A. L.,
Hickson, I. D.,
Broggini, M.,
and Sikhanskaya, F.
(1996)
Nucleic Acids Res.
24,
4464-4470
|
| 51.
|
Yu, J.,
Zhang, L.,
Hwang, P. M.,
Rago, C.,
Kinzler, K. W.,
and Vogelstein, B.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
14517-14522
|
| 52.
|
Kannan, K.,
Amariglio, N.,
Rechavi, G.,
and Givol, D.
(2000)
FEBS Lett.
470,
77-82
|
| 53.
|
Zhao, R.,
Gish, K.,
Murphy, M.,
Yin, Y.,
Notterman, D.,
Hoffman, W. H.,
Tom, E.,
and Mack, D. H.
(2000)
Genes Dev.
14,
981-993
|
| 54.
|
Moore, A. L.,
and Wang, T. S.
(1994)
Cell Growth Differ.
5,
485-494
|
| 55.
|
Carr, A. M.
(2000)
Science
287,
1765-1766
|
| 56.
|
Navas, T. A.,
Zhou, Z.,
and Elledge, S. J.
(1995)
Cell
80,
29-39
|
| 57.
|
Budd, M. E.,
and Campbell, J. L.
(1995)
Mol. Cell. Biol.
15,
2173-2179
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Kumamoto, E. A. Spillare, K. Fujita, I. Horikawa, T. Yamashita, E. Appella, M. Nagashima, S. Takenoshita, J. Yokota, and C. C. Harris
Nutlin-3a Activates p53 to Both Down-regulate Inhibitor of Growth 2 and Up-regulate mir-34a, mir-34b, and mir-34c Expression, and Induce Senescence
Cancer Res.,
May 1, 2008;
68(9):
3193 - 3203.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Zaky, C. Busso, T. Izumi, R. Chattopadhyay, A. Bassiouny, S. Mitra, and K. K. Bhakat
Regulation of the human AP-endonuclease (APE1/Ref-1) expression by the tumor suppressor p53 in response to DNA damage
Nucleic Acids Res.,
March 1, 2008;
36(5):
1555 - 1566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hosokawa, A. Takehara, K. Matsuda, H. Eguchi, H. Ohigashi, O. Ishikawa, Y. Shinomura, K. Imai, Y. Nakamura, and H. Nakagawa
Oncogenic Role of KIAA0101 Interacting with Proliferating Cell Nuclear Antigen in Pancreatic Cancer
Cancer Res.,
March 15, 2007;
67(6):
2568 - 2576.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Van Bodegom, Z. Saifudeen, S. Dipp, S. Puri, B. S. Magenheimer, J. P. Calvet, and S. S. El-Dahr
The Polycystic Kidney Disease-1 Gene Is a Target for p53-mediated Transcriptional Repression
J. Biol. Chem.,
October 20, 2006;
281(42):
31234 - 31244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Shats, M. Milyavsky, X. Tang, P. Stambolsky, N. Erez, R. Brosh, I. Kogan, I. Braunstein, M. Tzukerman, D. Ginsberg, et al.
p53-dependent Down-regulation of Telomerase Is Mediated by p21waf1
J. Biol. Chem.,
December 3, 2004;
279(49):
50976 - 50985.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Lohr, C. Moritz, A. Contente, and M. Dobbelstein
p21/CDKN1A Mediates Negative Regulation of Transcription by p53
J. Biol. Chem.,
August 29, 2003;
278(35):
32507 - 32516.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Watanabe, M. Sugaya, A. M. Atkins, E. A. Aquilino, A. Yang, D. L. Borris, J. Brady, and A. Blauvelt
Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Prolongs the Life Span of Primary Human Umbilical Vein Endothelial Cells
J. Virol.,
June 1, 2003;
77(11):
6188 - 6196.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Im, M. R. Pittelkow, and R. Kumar
Divergent Regulation of the Growth-promoting Gene IEX-1 by the p53 Tumor Suppressor and Sp1
J. Biol. Chem.,
April 19, 2002;
277(17):
14612 - 14621.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2001 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|