HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 32, 30188-30198, August 10, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/32/30188    most recent M102061200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sanlioglu, S. Articles by Engelhardt, J. F. Search for Related Content PubMed PubMed Citation Articles by Sanlioglu, S. Articles by Engelhardt, J. F. Social Bookmarking                      What's this?

Lipopolysaccharide Induces Rac1-dependent Reactive Oxygen Species Formation and Coordinates Tumor Necrosis Factor- Secretion through IKK Regulation of NF-B^*

Salih Sanlioglu^§¶, Carl M. Williams^§, Lobelia Samavati, Noah S. Butler, Guoshun Wang, Paul B. McCray Jr., Teresa C. Ritchie^§**, Gary W. Hunninghake, Ebrahim Zandi^§§, and John F. Engelhardt^§**¶¶

From the  Department of Internal Medicine-Division of Pulmonary and Critical Care, the ^§ Center for Gene Therapy, ^** Department of Anatomy and Cell Biology, and  Department of Pediatrics, the University of Iowa College of Medicine, Iowa City, Iowa 52242, the  Department of Molecular Microbiology & Immunology, Norris Cancer Center, Los Angeles, California 90033, and the ^¶ Department of Medical Biology and Genetics, Akdeniz University, College of Medicine, Antalya, Turkey 07070

Received for publication, March 7, 2001, and in revised form, June 7, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Reactive oxygen species (ROS) are important second messengers generated in response to many types of environmental stress. In this setting, changes in intracellular ROS can activate signal transduction pathways that influence how cells react to their environment. In sepsis, a dynamic proinflammatory cellular response to bacterial toxins (e.g. lipopolysaccharide or LPS) leads to widespread organ damage and death. The present study demonstrates for the first time that the activation of Rac1 (a GTP-binding protein), and the subsequent production of ROS, constitutes a major pathway involved in NFB-mediated tumor necrosis factor- (TNF) secretion following LPS challenge in macrophages. Expression of a dominant negative mutant of Rac1 (N17Rac1) reduced Rac1 activation, ROS formation, NFB activation, and TNF secretion following LPS stimulation. In contrast, expression of a dominant active form of Rac1 (V12Rac1) mimicked these effects in the absence of LPS stimulation. IKK and IKK were both required downstream modulators of LPS-activated Rac1, since the expression of either of the IKK dominant mutants (IKKKM or IKKKA) drastically reduced NFB-dependent TNF secretion. Moreover, studies using CD14 blocking antibodies suggest that Rac1 induces TNF secretion through a pathway independent of CD14. However, a maximum therapeutic inhibition of LPS-induced TNF secretion occurred when both CD14 and Rac1 pathways were inhibited. Our results suggest that targeting both Rac1- and CD14-dependent pathways could be a useful therapeutic strategy for attenuating the proinflammatory cytokine response during the course of sepsis.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Septic shock induced by Gram-negative infections kills 50,000 to 100,000 people each year in the United States (1, 2). Sepsis is a systemic inflammatory response syndrome to a localized or systemic infection that leads to the overproduction of proinflammatory cytokines, such as TNF,¹ and the ultimate failure of multiple organ systems. According to the Centers for Disease Control and Prevention, sepsis is the third leading cause of infectious death in the United States (3).

Lipopolysaccharide (LPS), an endotoxin found in the outer membrane of Gram-negative bacteria (4), is a major trigger of sepsis. Recognition of LPS is crucial for host antimicrobial defense reactions (5, 6). LPS stimulates mononuclear cells (monocytes and macrophages) and neutrophils to produce immunoregulatory and proinflammatory cytokines (interleukin-1, interleukin-6, TNF-, TGF-, and prostaglandins) (7-10). The myeloid differentiation antigen CD14, a 55-kDa glycosylphosphatidylinositol-anchored membrane glycoprotein (mCD14), has been shown to play essential roles in the activation of human mononuclear phagocytes by LPS (11-13). CD14 is expressed predominantly on the surface of monocytes, macrophages, and neutrophils, (11, 14-16) and it also exists as a soluble plasma protein lacking the glycosylphosphatidylinositol anchor (sCD14) (5, 17). Both forms have been shown to play crucial roles in the recognition of LPS and in the initiation of cellular immune responses by LPS (11, 14, 18). LPS-binding protein (LBP), a 60-kDa serum glycoprotein produced by the liver, has also been shown to enhance LPS-induced cytokine production by monocytic cells (19, 20). LBP binds to the lipid A region of LPS to form an LBP-LPS complex, which then interacts with CD14 to induce cytokine production (16, 21, 22). Identification of cell surface receptors (e.g. the Toll-like receptors (TLR)), which interact with the LPS-LBP-CD14 complex, has further elucidated the mechanisms of LPS induced signaling pathways (23).

Although CD14 and LBP are involved in LPS signaling (CD14-dependent pathways), the existence of additional signaling pathways (CD14-independent pathways) have been reported by other investigators (24-27). LPS antagonists, lipid Iva, and Rhodobacter sphaeroides lipid A, but not anti-CD14 blocking antibody, inhibited LPS-induced monocyte activation under serum-free conditions (28). This suggested that these compounds act at a site distinct from CD14. In addition, neither LBP nor CD14 was found to be necessary for LPS-induced activation of bovine macrophages (29).

Human polymorphonuclear leukocytes are responsible for killing microorganisms and eliminating cellular debris. These functions are mediated by superoxide (O₂) generated by an NADPH-dependent oxidase, as well as other reactive oxygen species (ROS) such as hydrogen peroxide (H₂O₂), and hydroxyl radicals (^·OH) (30). The assembly of NADPH oxidase has been shown to be up-regulated in neutrophils exposed to bacterial LPS (31). Furthermore, DeLeo et al. (31) have demonstrated that LPS priming increased the level of Rac2, a small GTP-binding protein associated with p47^phox and p67^phox (two subunits needed for NADPH oxidase function, p91^phox) at the membrane. These studies support a role for LPS priming of the respiratory burst in polymorphonuclear leukocytes. In addition, Rac1 (a homolog of Rac2) has been shown to control mitogenic and oncogenic signals through NADPH oxidase superoxide production (32, 33). However, little is known about a potential role of Rac1-NADPH oxidase complexes in controlling LPS-mediated intracellular signaling pathways. We hypothesized that Rac1 might be involved in LPS-mediated signaling pathways leading to the activation of macrophages. In the present study, we provide functional and biochemical evidence that Rac1 induction of NFB is partially responsible for LPS-induced TNF production. Activation of this pathway by LPS is dependent on Rac1-mediated ROS formation and the subsequent activation of the IKK complex, but appears to be independent of the CD14 receptor. These studies provide further definition of the ROS-mediated signal transduction pathways that contribute to LPS-induced TNF secretion.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Preparation of Recombinant Adenoviruses-- Eight recombinant adenoviral vectors expressing either -galactosidase (Ad.CMVLacZ) (34), catalase (Ad.Cat) (35), a dominant negative mutant of Rac1 (Ad.N17Rac1) (36), a dominant active mutant of Rac1 (Ad.V12Rac1) (37), a dominant negative mutant form (K44M) of IKK (Ad.IKKKM), a dominant negative mutant form (K44A) of IKK (Ad.IKKKA), a dominant negative mutant form (S32A/S36A) of IB (Ad.IkBM) (38), or a luciferase reporter gene driven by NFB transcriptional activation (Ad.NFBLuc), were used for functional studies. Ad.IKKKM and Ad.IKKKA were constructed from pRc- actin plasmids encoding either the dominant negative mutant of IKK (IKKKM) or IKK (IKKKA) (39). Fragments encoding the HA-tagged IKKKM or IKKKA cDNAs were excised by HindIII-NotI restriction digestion from pRc- actin plasmids and blunt subcloned into the EcoRV site of the pAd.CMV-Link1 adenoviral shuttle plasmid. Recombinant adenoviruses were generated in 293 cells according to a procedure described by Anderson et al. (40). The expression of HA-IKKKM or HA-IKKKA from these replication defective adenoviral constructs was confirmed by Western blotting. pNFB-Luc plasmid (CLONTECH Laboratories, Inc., Palo Alto, CA) was used to generate Ad.NFBLuc vector. The fragment containing the luciferase gene driven by four tandem copies of the NFB consensus sequence fused to a TATA-like promoter from the herpes simplex virus-thymidine kinase gene was released by KpnI and XbaI double digestion. The KpnI and XbaI fragment was inserted into a promoterless adenoviral shuttle plasmid (pAd5mcspA) (40) and Ad.NFBLuc virus was generated by homologous recombination. Recombinant adenoviral stocks were generated as previously described (41) and were stored in 10 mM Tris with 20% glycerol at 80 °C. The particle titers of adenoviral stocks were determined by A₂₆₀ readings and were typically 10¹³ DNA particles/ml. The functional titers of adenoviral stocks were determined by plaque titering on 293 cells and expression assays for encoded proteins. Typically the particle/plaque forming unit ratio was equal to 25.

Rac1 Activation Assay-- Rac1 activation assays were performed using a modification of a previously described protocol (42). pGEX-PBD (PBD encodes the p21-binding domain of Pak1, an effector molecule that specifically binds activated Rac1) was kindly provided by Dr. Richard Cerione (43). GST-PBD fusion protein was purified from DL21 cells (Amersham Pharmacia Biotech, Piscataway, NJ) transformed with pGEX-PBD. Bacteria were grown at 37 °C to log phase and treated with 1 mM isopropyl-1-thio--D-galactopyranoside for 2 h. The cells were centrifuged and the cell pellet was resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 5 mM MgCl₂, 0.5% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 10 µg/ml aprotinin). Cells were then further lysed by 3 rounds of sonication (each lasting for 30 s). The lysate was subsequently centrifuged at 10,000 × g for 15 min, and the fusion protein was isolated from the supernatant using a Bulk GST Purification Kit (Amersham Pharmacia Biotech, Piscataway, NJ). The purified protein appeared as a single band on SDS-PAGE with Coomassie Blue staining. Protein concentrations were determined using the Bradford assay. For selective precipitation of GTP-bound Rac1, the GST-PBD fusion protein (50 µg) was prebound to agarose-conjugated anti-GST antibody (20 µg) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA; catalog number sc-138 AC) in 500 µl of lysis buffer at 4 °C overnight. Subsequently, samples were centrifuged at 2500 × g for 5 min and then washed three times with lysis buffer. These PBD-bound agarose beads were used for precipitation of GTP-bound Rac1 from LPS-treated RAW cells as described below.

Confluent monolayers of RAW cells were treated with 0.2 µg/ml LPS (Sigma, catalog number L-2630, source Escherichia coli Sertotype 0111-B4, <1.3% protein, 3,000,000 endotoxin units/mg) and incubated at 37 °C for different periods of time (0, 5, 15, and 30 min). Cells were harvested into lysis buffer (20 mM Hepes, pH 7.4, 0.5% Nonidet P-40, 10 mM MgCl₂, 10 mM -glycerophosphate, 10% glycerol, 10 µg/ml leupeptin, 10 µg/ml aprotinin) at the various time points by scraping. Precipitation of GTP-bound Rac1 was performed by the addition of 200 µg of RAW cell lysate to GST-PBD bound agarose beads for 2 h at 4 °C. Samples were then centrifuged at 2,500 × g for 5 min followed by three washes with lysis buffer. After boiling samples at 100 °C for 5 min in SDS-PAGE sample buffer followed by centrifugation, samples were loaded onto a 12% SDS-PAGE for Western blotting against anti-Rac1 antibodies. Nitrocellulose filters were blocked (5% non-fat dry milk in 1 × PBST) at 4 °C overnight followed by incubation with 0.2 µg/ml rabbit polyclonal anti-Rac-1 antibody (Santa Cruz Biotechnologies) diluted in blocking buffer for 1 h at 25 °C. Subsequently, the filter was washed and incubated with peroxidase-conjugated anti-rabbit IgG (Roche Molecular Biochemicals, Indianapolis, IN) at 0.9 µg/ml for 1 h at 25 °C. The filters were finally washed and developed using a chemiluminescence luminol reagent (Santa Cruz Biotechnologies, Santa Cruz, CA) and exposed to x-ray film. For loading controls, anti-GST antibody (B14) (Santa Cruz Biotechnology, catalog number sc-138) was used to probe the filters.

Tissue Culture and Infection-- RAW 264.7 cells were obtained from ATCC and grown on 35-mm Petri dishes in Dulbecco's modified Eagle's medium with 10% FBS and 1% penicillin and streptomycin. Adenoviral infections were performed for 2 h at 37 °C, in Dulbecco's modified Eagle's medium without FBS. After infections, an equal volume of Dulbecco's modified Eagle's medium with 20% FBS was added to increase the serum concentration to 10% and the infections were continued for a total of 40 h. Most studies used various multiplicities of infection (m.o.i.) to test recombinant adenoviral vectors. In RAW cells, adenoviral infection at an m.o.i. of 5,000 particles/cell gave greater than >95% transduction as evidenced by transgene expression. A subset of RAW cells (<5%) appeared to be refractory to adenoviral infection even at m.o.i. of 10,000 particles/cell.

Luciferase Assay and TNF Measurements-- The luciferase assay system with Reporter Lysis Buffer (Promega, Inc., catalog number E4030) was used to measure NFB-mediated transcriptional induction according to the manufacturer's protocol. All measurements of luciferase activity (relative light units) were normalized to the protein concentration. The NFB responsive luciferase reporter, Ad.NFBLuc, was used to co-infect cells at an m.o.i. of 5000 particles/cell in these experiments. For TNF protein measurements, a DuoSet ELISA Development System Kit from R&D Systems (Minneapolis, MN, catalog number DY410) was used according to manufacturers instructions. Anti-oxidant chemicals pyrrolidinedithiocarbamate (PDTC, Sigma, catalog number P-8765) and N-acetylcysteine (NAC, Sigma, catalog number A-8199) were used to treat RAW cells for 1 h at 37 °C prior to LPS treatment at doses ranging from 1 to 100 µM (PDTC) and 1 to 25 µM (NAC).

Electrophoretic Mobility Shift Assays (EMSA)-- Nuclear extracts were prepared according to the procedure published by Andrews and Faller (44). NFB oligos (Promega, Madison, WI, catalog number E329B) were end-labeled using [-³²P]ATP and T4-kinase according to the manufacturers instructions. The mobility shift assays were performed as previously described (45).

Electron Spin Resonance Spectroscopy (ESR)-- ESR was used to detect the production of hydroxyl radicals using a procedure modified from a previously published protocol (46). Briefly, ESR assays were conducted at room temperature using a Bruker model EMX ESR spectrometer (Bruker, Karlsvuhe, Germany) equipped with a TM₁₁₀ cavity and a flat cell (Electron Spin Resonance Core Facility, University of Iowa, IA). Instrument settings were as follows: receiver gain, 1 × 10⁶; modulation frequency, 100 kHz; microwave power, 40.1 mW; modulation amplitude, 1.0 G; sweep rate, 1.5 G/s. The WINEPR filter function, moving average (n = 5), was used to filter out noise in all spectra. Prior to LPS treatment, RAW cells were serum starved for 15 h, briefly trypsinized, and then resuspended in PBS with 0.5% FBS. The spin trap, 5,5-dimetyl-1-pyrroline N-oxide (DMPO), was added to cells at a final concentration of 50 mM. Cells then were immediately treated with LPS at a concentration of 5 µg/ml and the production of ^·OH was recorded for 45 min. Since the signal intensity decreased after 30 min, spectra recorded in the first 20 min were used for analysis. This procedure was also performed on RAW cells preinfected with Ad.N17Rac1, Ad.V12Rac1, or Ad.Cat virus at a m.o.i. of 10,000 particles/cell and incubated at 37 °C for 48 h prior to ESR analysis.

Dihydroethidium (DHE) Assays-- DHE assays were performed according to a modified protocol from Miller and colleagues (47). Briefly, RAW cells were grown to 70% confluency on 6-well plates and serum starved overnight. The medium was then changed to PBS containing 10 µM DHE for 20 min at 37 °C prior to LPS stimulation. Cells were stimulated with LPS (5 µg/ml) in PBS containing 10 µM DHE and 0.5% FBS for 30 min at 37 °C. Cells were then scraped off the plates and kept on ice prior to fluorescence-activated cell sorter analysis. For experiments which included superoxide dismutase pretreatments, cells were incubated in PBS containing 1000 units/ml purified superoxide dismutase enzyme (Sigma, catalog number S2525) and 10 µM DHE for 20 min prior to LPS treatment. LPS (5 µg/ml) stimulation was carried out in PBS containing 10 µM DHE, 1000 units/ml superoxide dismutase, and 0.5% FBS for 30 min at 37 °C.

Real Time PCR-- Total RNA was isolated using the Absolutely RNA RT-PCR Miniprep Kit according to manufacturers instructions (Stratagene, La Jolla, CA). RNA was quantified using the RiboGreen Kit (Molecular Probes, Eugene, OR). Total RNA was reversed transcribed to cDNA using the RETROscript RT-PCR Kit (Ambion, Austin, TX). PCR amplification was then performed in an iCycler iQ Fluorescence Thermocyler (Bio-Rad) as follows: 3 min at 95 °C, followed by 45 cycles of 20 s at 95 °C, 20 s at 58 °C, 20 s at 72 °C, and 10 s at 79 °C. Fluorescence data was captured during the dwell at 79 °C. Data were collected and recorded by iCycler iQ software (Bio-Rad) and expressed as a function of threshold cycle (C_t), the cycle at which the fluorescence intensity in a given reaction tube rises above background. Specific primer sets for murine TLR and HPRT genes were as follows (5'  3'): TLR2 sense, TGGTTCTTTTCCCAAACTGG and antisense, GCTTTCTTGGGCTTCCTCTT; TLR4 sense ATTGCTTGGCGAATGTTTCT and antisense, GACCCATGAAATTGGCACTC; TLR6 sense TCTGCAACATGAGCCAAGAC and antisense, GTTTTGCAACCGATTGTGTG; HPRT sense, CCTCATGGACTGATTATGGAC and antisense, CAGATTCAACTTGCGCTCATC. Primers were selected based on nucleotide sequences downloaded from the National Center for Biotechnology Information data bank and designed with software by Steve Rozen and Helen J. Skaletsky ((1998) Primer3, code available at genome.wi.mit.edu/genome_software/other/primer3.html). PCR conditions and data collection dwell temperature were based on melting curve analysis of each amplimer generated by the primers listed above. Data was captured at 4 °C below the lowest melting temperature among all amplimers assayed to ensure that primer-dimers were not contributing to the fluorescence signal generated with SYBR Green I DNA Dye. Relative quantitative gene expression was calculated as follows. For each sample assayed, the C_t for reactions amplifying TLR2, TLR4, TLR6, and HPRT were determined. HPRT was used as an internal reference. The C_t for each TLR gene was then corrected by subtracting the C_t for HPRT (C_t). Untreated controls were chosen as the reference samples, and the C_t for all LPS-treated experimental samples were subtracted from the C_t for the control samples (C_t). Finally, LPS-treated TLR2, TLR4, and TLR6 mRNA abundance relative to control TLR2, TLR4, and TLR6 mRNA abundance was calculated by the formula 2^(Ct). The validity of this approach was confirmed by using serial 10-fold dilutions of templates containing TLR and HPRT genes. Using this set of template mixtures, the amplification efficiencies for TLR2, TLR4, TLR6, and HPRT amplimers were found to be identical.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

LPS Activates the Rac1 Pathway-- Previous reports have demonstrated that antioxidants significantly inhibit LPS-mediated activation of NFB and subsequent TNF secretion (48, 49). We hypothesized that Rac1 might be a central molecular regulator of LPS-induced changes in the cellular redox state promoting the induction of proinflammatory signal transduction pathways. In order to test whether Rac1 activity was elevated following LPS treatment, an assay developed by Glaven and colleagues (42) was utilized. This assay was used to specifically detect the abundance of GTP-bound (activated) Rac1 by immunoprecipitation with a GST-PBD fusion protein in a macrophage cell line (RAW). In support of our initial hypothesis, the abundance of GTP-bound Rac1 increased significantly as early as 5 min after treatment of RAW cells with LPS, but not in mock treated controls (Fig. 1). These studies indicate that Rac1 is activated early during the cellular response to LPS.

View larger version (74K): [in this window] [in a new window]   Fig. 1.   LPS activates Rac1. Immunoprecipitation using a GST-PBD fusion protein that binds specifically to GTP-bound Rac1 (the active form) was used to detect the magnitude of Rac1 activation in response to LPS by Western blotting. RAW cells were treated with 0.2 µg/ml LPS or were mock treated for the exposure times (in minutes) indicated above each lane. 200 µg of RAW cell lysate from each condition was precipitated with GST-PBD and evaluated by Western blot against anti-Rac1 antibodies. The top blot indicates a representative anti-Rac1 Western with the p21 band (Rac1) indicated by an arrow. The same lysates were used in a Western blot against anti-GST antibodies as a loading control (bottom blot). The position of the GST-PBD protein is marked by an arrow.

Rac1 Modulates LPS-induced NFB Activity and TNF Secretion-- TNF secretion following LPS challenge is well known to correlate with the induction of NFB DNA binding activity (48, 50), which acts at sites in the TNF promoter to induce expression. Given our results demonstrating the activation of Rac1 by LPS, we next sought to determine whether this pathway induces TNF secretion via the NFB signal transduction pathway. To approach this question, RAW cells were infected with a recombinant adenovirus expressing either the dominant negative mutant form of Rac1 (Ad.N17Rac1), or -galactosidase (Ad.CMVLacZ) as a negative control, 48 h prior to LPS stimulation and assessment of TNF levels in the media. As seen as in Fig. 2A, a maximal 41% reduction in TNF secretion was achieved when RAW cells were infected with Ad.N17Rac1 at an m.o.i. 10,000 DNA particles/cell (the infection efficiency was >95%). This inhibitory response demonstrated a dose-dependent correlation with the particle dose of Ad.N17Rac1 virus used for infection. In contrast, no reduction in TNF secretion was evident when cells were infected with the negative control virus Ad.CMVLacZ.

View larger version (27K): [in this window] [in a new window]   Fig. 2.   N17Rac1 expression down-regulates LPS-induced NFB transcriptional activity and TNF secretion in RAW cells. RAW cells were co-infected with Ad.NFBLuc virus (m.o.i. of 5,000 particles/cell) together with Ad.N17Rac1 or Ad.CMVLacZ virus at increasing multiplicity of infections (particles/cell) as indicated below each graph. At 40 h post-infection, cells were stimulated with LPS (0.2 µg/ml) for 4 h at 37 °C. Cell supernatants were collected for enzyme-linked immunosorbent assay measurements of TNF (Panel A) and cell lysates were subsequently harvested for NFB-mediated luciferase activity assays (Panel B). Similar studies were performed by co-infecting cells with Ad.NFBLuc virus (m.o.i. of 5,000 DNA particles/cell) together with increasing titers of Ad.V12Rac1 or Ad.CMVLacZ virus. In these experiments, cell supernatants and lysates were harvested at 35 h after infection in the absence of LPS stimulation. Results depict TNF levels as determined by enzyme-linked immunosorbent assay (Panel C) and luciferase activity in relative light units (Panel D). Values in all graphs depict the mean (±S.E.) for four independent data points.

These results suggest that activation of Rac1 is required for a fraction, but not all, of the LPS-induced TNF secretion. We next sought to investigate whether Rac1-dependent TNF production following LPS stimulation correlated with the activation of NFB transcriptional activity. To initially test this hypothesis, RAW cells were co-infected with an adenovirus carrying an NFB responsive luciferase reporter gene (Ad.NFBLuc) in combination with Ad.N17Rac1 or Ad.CMVLacZ. Luciferase assays were then performed to assess NFB transcriptional activity. As seen in Fig. 2B, reductions in NFB reporter activity in the presence of N17Rac1 expression closely mirrored reductions seen in TNF production (Fig. 2A). Maximal inhibition of NFB transcriptional activity reached 47% when RAW cells were infected with the Ad.N17Rac1 virus at an m.o.i of 10,000 DNA particles/cell. No such reduction was evident when RAW cells were infected with he Ad.CMVLacZ virus. These results were confirmed by analysis of NFB DNA binding activity using EMSA. In these studies RAW cells were infected with either Ad.N17Rac1 or Ad.CMVLacZ for 48 h prior to LPS treatment and the preparation of nuclear extracts. As seen in Fig. 3A, Ad.N17Rac1, but not Ad.CMVLacZ, reduced NFB heterodimer complex formation (p50/p65) induced by LPS. The reduction in NFB DNA binding invoked by the expression of N17Rac1 was ~50% and closely paralleled findings from the luciferase reporter assays (Fig. 2B). These results indicate that a significant fraction of LPS-induced TNF secretion is mediated via Rac1 activation of NFB.

View larger version (28K): [in this window] [in a new window]   Fig. 3.   NFB activation occurs via the Rac1 pathway leading to the induction of TNF expression. In order to confirm that Rac1 regulates NFB transcriptional activation following LPS stimulation, EMSA was used to evaluate the level of NFB DNA binding in nuclear extracts from RAW cells infected with Ad.N17Rac1 (Panel A) or Ad.V12Rac1 (Panel B) viruses. Panel A depicts experiments performed in RAW cells infected with either Ad.N17Rac1 or Ad.CMVLacZ virus at increasing multiplicity of infections for 40 h prior to stimulation with LPS (0.2 µg/ml). Nuclear extracts were prepared at 2 h post-LPS treatment and the experimental conditions for each lane are indicated above the gel. The p50/p65 heterodimer of NFB and nonspecific shifted bands (NS) are indicated by arrows to the left of the gel. Panel B depicts EMSA results evaluating NFB DNA binding in RAW cells infected with Ad.V12Rac1, Ad.CMVLacZ, and/or Ad.IkBM. In these experiments, cells were preinfected with Ad.CMVLacZ or Ad.IBM for 30 h prior to superinfection with Ad.V12Rac1 for an additional 30 h. Nuclear extracts were prepared at 30 h (single vector conditions) and 60 h (dual vector conditions) following the initial infection in the absence of LPS stimulation. As a control, nuclear extracts were also prepared at 2 h after LPS treatment in uninfected cells. The experimental conditions for each lane are indicated above the gel. Results in Panels A and B are representative of three independent experiments performed in duplicate. Panel C depicts enzyme-linked immunosorbent assay results quantifying TNF secretion under conditions similar to those in Panel B. All experimental conditions in Panel C were performed in the absence of LPS stimulation. RAW cells were infected with either the Ad.IkBM or Ad.CMVLacZ virus at increasing multiplicity of infection at 37 °C for 30 h. Later, these cells were also infected with Ad.V12Rac1 virus at an m.o.i. of 5000 DNA particles/cell for an additional 35 h prior to harvesting supernatants for TNF secretion. Viral vectors used for infection and the multiplicity of infection (particles/cell) used are given below the graph. Values represent the mean (±S.E.) of four independent data points.

Constitutive Activation of Rac1 Mimics LPS Induction of NFB Activity and TNF Secretion-- As an alternative approach for demonstrating a causal link between NFB induction by Rac1 and TNF secretion, we tested whether expression of a dominant, constitutively active, form of Rac1 (V12Rac1) could mimic the effects of LPS treatment and lead to the induction of both NFB and TNF secretion. As seen in Fig. 2C, a 16-fold maximal induction in TNF secretion was obtained when RAW cells were infected with Ad.V12Rac1 virus at an m.o.i. 5000 DNA particles/cell. Importantly, this induction in TNF secretion was achieved in the absence of LPS stimulation and also demonstrated a clear dose response with the amount of virus used for infection. In contrast, only a slight induction of TNF secretion was detected with Ad.CMVLacZ virus at similar multiplicity of infections. The induction of TNF by V12Rac1 also clearly correlated with the activation of NFB transcriptional activity, as indicated by a 25-fold increase in luciferase reporter expression following co-infection with Ad.NFBLuc and Ad.V12Rac1, each at an m.o.i. of 5000 DNA particles/cell (Fig. 2D). EMSA analysis of cells expressing V12Rac1 demonstrated a direct correlation in the level of induced NFB DNA binding and TNF expression (Fig. 3B). Furthermore, both TNF secretion and NFB DNA binding induced by expression of the constitutively active V12Rac1 mutant was nearly completely blocked by co-expression of an IkB mutant that blocks NFB activation (IB S32A/S36A), but not by LacZ (Fig. 3, B and C). Taken together, these studies substantiate the hypothesis that Rac1 primarily induces TNF production through the NFB pathway. Since these studies with V12Rac1 were performed in the absence of LPS stimulation, the results indicate that Rac1 activation is a major effector of the proinflammatory signaling cascade distal to LPS receptor activation.

LPS Activation of Rac1 and Constitutively Active V12Rac1 Mediate NFB-dependent TNF Secretion through Activation of Both IKK and IKK-- Two adenoviral constructs expressing either the dominant mutant of IKK (Ad.IKKKM) or IKK (Ad.IKKKA) were generated to elucidate mechanisms by which Rac1 activates NFB-dependent TNF secretion. As shown in Fig. 4A, both recombinant constructs produced HA-tagged IKK subunits as detected by Western blot following infection in HeLa cells. We next sought to determine whether both IKK and IKK were required for Rac1 mediated activation of NFB and subsequent TNF expression. Two experimental conditions were evaluated, LPS induction of Rac1 and constitutive activation of Rac1 (using infection with Ad.V12Rac1) in the absence of LPS. As shown in Fig. 4, both LPS treatment and expression of V12Rac1 stimulated TNF secretion (Fig. 4B) and NFB-dependent transcription (Fig. 4C). LPS-induced TNF secretion was most significantly inhibited following infection at the highest multiplicity of infections with Ad.IKKKA (6.1-fold) as compared Ad.LacZ infected controls. Ad.IKKKM infection at an identical multiplicity of infection led to a 1.7-fold blunting of LPS-induced TNF secretion. Similarly, V12Rac1-induced TNF secretion was more significantly blocked by IKKKA (5.1-fold) as compared with Ad.IKKKM (2.5-fold). Interestingly, IKKKA preferentially inhibited NFB-dependent transcription following LPS stimulation (30-fold) or expression of V12Rac1 (18.2-fold) as compared with IKKKM (2.5-2.9-fold) (Fig. 4D). These finding suggest that IKK may play a more dominant role than IKK in NFB transcriptional activation following LPS induction of Rac1. However, the ~50% reduction in NFB transcriptional activity by IKKKM is somewhat different than previous reports suggesting little or no contribution of IKK to IKK activity following proinflammatory stimuli (51, 52). This difference may be attributable to the higher level of transgene expression achieved in the current study with recombinant adenoviral vectors.

View larger version (17K): [in this window] [in a new window]   Fig. 4.   IKK is preferentially required for Rac1 induction of NFB following LPS stimulation. Two recombinant adenoviral vectors, Ad.IKKKM and Ad.IKKKA, were used to probe the functional involvement of the IKK complex in LPS/Rac1-mediated activation of NFB and TNF expression. Panel A depicts a Western blot of cellular lysates from HeLa cells infected with either Ad.IKKKM or Ad.IKKKA (m.o.i. of 5000 particles/cell). Blots were probed with anti-HA peroxidase antibody (Roche Molecular Biochemicals) and developed using ECL. Lane 1, control uninfected; lane 2, IKKKM infected; lane 3, IKKKA-infected cell lysates. Molecular standard markers (-galactosidase (121 kDa) and bovine serum albumin (70 kDa)) are indicated to the left of the blot. In Panels B-D, RAW cells were infected with Ad.IKKKM, Ad.IKKKA, or Ad.LacZ 30 h prior to infection with Ad.V12Rac1 virus at the indicated multiplicity of infections. Supernatants were harvested 35 h after Ad.V12Rac1 infection for analysis of TNF levels by enzyme-linked immunosorbent assay (Panel B). As a comparison to Ad.V12Rac1-infected cells, RAW cells were infected with Ad.IKKKM, Ad.IKKKA, or Ad.LacZ 48 h prior to treatment with LPS for 4 h after which supernatants were harvested for analysis of TNF levels by enzyme-linked immunosorbent assay (Panel B). NFB transcriptional activity using Ad.NFBLuc-infected cells was similarly evaluated in Panel C. In these experiments RAW cells were infected with Ad.NFBLuc virus 35 h prior to harvesting. Viral vectors used for infection and the multiplicity of infection (particles/cell) used are given below the graph. The timing of viral infections was identical to that shown in Panel B. Values represent the mean (±S.E.) for three independent data points. Panel D depicts the fold-reduction in TNF expression (solid bars) and NFB-mediated luciferase activity (open bars) in the presence of Ad.IKKKM or Ad.IKKKA. Fold reductions were calculated from the mean values in the presence of each of these dominant mutants as compared with infection with Ad.LacZ.

LPS Stimulation of RAW Cells Leads to the Generation of Superoxide Radicals-- The assembly of NADPH oxidase has been previously shown to be activated in neutrophils by exposure to bacterial LPS (31). In neutrophils, this NADPH oxidase complex is responsible for the generation of superoxide, an important component of antibacterial activity in respiratory burst. Unlike neutrophil NADPH oxidase gp91, which as a transmembrane protein generates superoxides topologically in the extracellular compartment, other families of NADPH oxidases that generate intracellular superoxide proposed to act as second messengers important to intracellular signaling pathways have been recently identified (53-55). In order to test whether LPS treatment leads to the generation of ROS, ESR was performed using the spin trap, DMPO (46). As seen in Fig. 5C, treatment of RAW cells with LPS gave rise to significant levels of DMPO/^·OH spin adduct. Generation of LPS-induced DMPO/^·OH was significantly attenuated by infection with the dominant negative Ad.N17Rac1 (Fig. 5D). In contrast, expression of the constitutively active V12Rac1 mutant gave rise to extremely high levels of DMPO/^·OH even in the absence of LPS stimulation (Fig. 5E). This was not seen when the N17Rac1 negative mutant form of the protein was expressed in the absence of LPS (Fig. 5B).

View larger version (16K): [in this window] [in a new window]   Fig. 5.   Rac1 mediates ROS formation in RAW cells following LPS stimulation. RAW cells were trypsinized and resuspended (2 × 106 cells/ml) in phosphate-buffered saline with 0.5% FBS. DMPO was added to cells just prior to measurements. When applicable, LPS (5 µg/ml) was added immediately after DMPO. When indicated, cells were infected (10,000 particles/cell) with recombinant adenoviruses at 40 h prior to trypsinization for ESR assays. ESR measurements were recorded for 20 min after the addition of DMPO. The spectra are from cells treated under the following conditions: A, uninfected cells with no LPS treatment; B, Ad.N17Rac1-infected cells without LPS treatment; C, LPS-treated cells without infection; D, Ad.N17Rac1-infected cells treated with LPS; E, Ad.V12Rac1-infected cells without LPS treatment. Asterisks in Panel E mark the DMPO-hydroxyl radical adduct. The bar on the y axis represents 5 × 104 arbitrary units of intensity and the same scale is used for all panels. The x axis represents magnetic field in Gauss. aN = aH = 14.9 G is the hyperfine splitting constant for the DMPO/·OH adduct. Spectra shown are representative of at least two independent experiments.

Although these data are consistent with the generation of hydroxyl radicals following LPS stimulation, they presently cannot discriminate between superoxides as the precursor ROS responsible for DMPO adducts seen in our studies. DMPO can also react with superoxide (O₂) to form the DMPO/^·OOH superoxide adduct of DMPO. DMPO/^·OOH can then be rapidly converted to the DMPO/^·OH spin adduct. This spin adduct is indistinguishable from the DMPO/^·OH formed by direct trapping of authentic ·OH (56, 57). Therefore, it was necessary to determine if the DMPO/^·OH adduct was generated by initial trapping of O₂ or from the trapping of authentic ^·OH (58). Infection with the Ad.N17Rac1 virus dramatically decreased the magnitude of LPS-induced DMPO/^·OH spectra as shown in Fig. 5D. It is common knowledge that Rac1 activates NADPH oxidase to produce O₂ (32). Since N17Rac1 expression inhibited LPS-induced DMPO/^·OH radical formation in our assays, it is most likely that O₂ is the precursor to the DMPO/^·OH adduct recorded during ESR analysis. It is also possible that ^·OH radicals might be generated from H₂O₂ via a Fenton reaction. In order to test this hypothesis, RAW cells were infected with an adenovirus encoding catalase enzyme (Ad.Cat) (35). Infection with the Ad.Cat virus (Fig. 6, D and E) partially quenched the LPS-induced DMPO/^·OH adduct (Fig. 6, B and C). These findings suggest that a significant portion of the LPS-induced DMPO/^·OH adduct must be derived from H₂O₂, most likely via a Fenton reaction.

View larger version (25K): [in this window] [in a new window]   Fig. 6.   Catalase expression blocks induction of the DMPO/·OH adduct following LPS treatment. RAW cells were either uninfected or infected with Ad.Cat vector at an m.o.i. of 10,000 DNA particles/cell for 48 h prior to LPS treatment. ESR recordings were carried out as described under "Experimental Procedures." Panel A shows untreated cells. Panels B and C show two independent sets of cells treated with LPS (5 µg/ml) in the absence of infection. Panels D and E are two independent sets of cells infected with Ad.Cat and treated with LPS (5 µg/ml). The y axis represents 5 × 104 arbitrary units of intensity and the same scale was used for all conditions. The x axis is the magnetic field in Gauss.

The most likely origin of H₂O₂ following LPS stimulation would be expected to come from NADPH oxidase derived O₂ following dismutation by intracellular superoxide dismutase. However, since ESR is incapable of directly distinguishing between ^·OH and O₂ radical formation, additional assays were designed to confirm the generation O₂. The DHE assay (47), which is fairly specific for O₂ (59), was used to test whether the source of LPS-induced ROS was O₂. These DHE assays clearly demonstrated a significant increase in DHE fluorescence following treatment of RAW cells with LPS and suggested that O₂ radicals are, at least in part, a precursor ROS formed following LPS stimulation (Fig. 7). Furthermore, pretreatment of RAW cells with purified superoxide dismutase enzyme quenched the majority of LPS-induced O₂ production (Fig. 7). Both the DHE assay (with superoxide dismutase treatment) and the ESR results (with Ad.N17Rac1 infection) clearly suggest that O₂ is a major induced form of ROS in RAW cells following LPS stimulation.

View larger version (15K): [in this window] [in a new window]   Fig. 7.   LPS generates superoxide radicals in RAW cells. DHE assays were employed to evaluate superoxide radical formation following LPS exposure as described under "Experimental Procedures." Cells were pretreated with DHE (with and without superoxide dismutase (SOD) enzyme) followed by exposure to LPS. The mean fluorescent intensity (as determined by fluorescence-activated cell sorter analysis) is given on the y axis. Various treatment conditions are provided on the x axis. The data represents the mean (±S.E.) of six independent data points from two independent experiments.

Reactive Oxygen Species Are Critical for LPS-induced TNF Secretion-- We have clearly demonstrated that LPS treatment of RAW cells induces the production of ROS as determined by ESR. Although Ad.N17Rac1 expression reduced the production of ROS radicals in response to LPS treatment, the absolute requirement for ROS in the activation of NFB and subsequent TNF production remains unclear. Two potential hypotheses could explain the current findings. First, ROS generated by activated Rac1 could be an unrelated effect of activating this pathway and may not be required for NFB activation or TNF expression. Alternatively, Rac1-activated ROS production could be integral to the activation of NFB and TNF expression. In order to differentiate between these two potential mechanisms, we performed studies evaluating LPS-induced NFB transcriptional activation and TNF production under conditions where intracellular ROS were quenched by the use of chemical scavengers. These studies utilized two chemical scavengers, PDTC and NAC, which have been shown to quench superoxides (60), hydrogen peroxide (61, 62), and hydroxyl radicals (60, 62). RAW cells were treated with increasing concentrations of either PDTC or NAC for 1 h at 37 °C prior to LPS treatment. As seen in Fig. 8A, 34 and 61% reductions of TNF expression were obtained when RAW cells were treated with 25 or 100 µM PDTC, respectively. Similarly, treatment of RAW cells with 25 mM NAC reduced TNF production by 54%. In order to assess the effect of these antioxidants on NFB transcriptional activity, studies were performed using RAW cells preinfected with the luciferase reporter virus Ad.NFBLuc (m.o.i. of 5000 DNA particles/cell) prior to treatment with antioxidants (PDTC or NAC) and LPS treatment (Fig. 8B). These results demonstrated that LPS-induced NFB-mediated luciferase activity was reduced in a dose-dependent fashion when RAW cells were treated with these antioxidants. Interestingly, the antioxidant invoked reduction in NFB transcriptional activation was much more complete than their effect on TNF secretion. Together with earlier findings, these results support the hypothesis that Rac1-mediated ROS production may primarily act to induce NFB activation following LPS stimulation. However, it is also clear that activation of the Rac1 signaling cascade and subsequent ROS production accounts for only a portion of the LPS-mediated cellular responses leading to expression of TNF.

View larger version (22K): [in this window] [in a new window]   Fig. 8.   ROS are important mediators of LPS-induced TNF secretion. RAW cells were infected with Ad.NFBLuc (5,000 particles/cell) for 40 h prior to treatment with the indicated amounts (below each graph) of PDTC or NAC for 1 h at 37 °C. Subsequently, cells were stimulated with LPS (0.2 µg/ml) in the continued presence of antioxidants in the culture media and supernatants were harvested 4 h later for TNF assay. The concentration of TNF was determined by the enzyme-linked immunosorbent assay (Panel A) and the level of NFB transcriptional activation was assessed by luciferase activity (Panel B). Values represent the mean (±S.E.) of four independent data points.

CD14 Blocking Antibodies Decrease LPS-induced TNF Secretion Independent of Rac1-- Our results thus far demonstrate that Rac1 plays a critical role in ROS-mediated activation of NFB and subsequent TNF secretion. However, since N17Rac1 blocked only about half of the LPS-induced TNF production, our results also suggest that alternative pathways likely contribute to the activation of TNF. This is consistent with previous reports of both CD14-dependent (16, 21, 22) and CD14-independent (24-27) pathways in the mediation of LPS-induced TNF expression. Therefore, it seemed essential to investigate a possible association of Rac1 with CD14. In an initial effort to address this question, CD14-dependent pathways were blocked using CD14 blocking antibodies and the effects on Rac1 activation and TNF production were evaluated. The blocking antibody used, RmC5-3, has previously been demonstrated to block LPS-induced CD14-mediated signaling pathways (63, 64). As seen in Fig. 9A, treatment of RAW cells with RmC5-3 CD14 blocking antibodies prior to LPS stimulation significantly reduced TNF secretion in a dose-dependent fashion. In contrast, no such reductions were observed in cells treated with control anti-mIgG antibody. These findings demonstrated a partial reduction in TNF expression following inhibition of the CD14 receptor pathway that was similar in magnitude to the effects observed when Rac1 was inhibited by N17Rac1 expression. To begin to address whether Rac1 acts through CD14-dependent or -independent pathways, the level of GTP bound, activated Rac1 was assessed following treatment of RAW cells with anti-CD14 antibodies in the presence or absence of N17Rac1 expression. If Rac1 activation occurred through a pathway independent of CD14, we would expect to see no effect of anti-CD14 on the level of GTP bound Rac1. Results from this analysis (Fig. 9B) are consistent with the hypothesis that Rac1 is independent of CD14, since the blocking antibodies had no detectable influence on Rac1 activation. In contrast, N17Rac1 expression clearly decreased the level of GTP bound Rac1. We hypothesized that if these two pathways are acting in parallel, treatment with CD14 blocking antibodies and Ad.N17Rac1 should be capable of inhibiting the majority of TNF production following LPS stimulation. As anticipated, combined inhibition of Rac1 and CD14-dependent pathways demonstrated an additive effect on reducing TNF secretion (74 ± 6%), which was greater than inhibiting Rac1 (44 ± 6%) or CD14 (35 ± 7%) individually (Fig. 9C). These effects demonstrated a clear dose response to inhibitor (i.e. multiplicity of infection of Ad.N17Rac1 or concentration of anti-CD14 antibody) and were not seen with the control vector Ad.CMVLacZ or with the control isotype matched antibody. In summary, our overall findings suggest that LPS-induced Rac1 activation stimulates NFB activation and subsequent TNF expression through ROS production in a CD14-independent manner.

View larger version (27K): [in this window] [in a new window]   Fig. 9.   LPS activation of Rac1 is independent of CD14 receptor activation. CD14 blocking antibodies were used to evaluate the extent of CD14 receptor activation needed for LPS-induced TNF secretion (Panel A). RAW cells were treated with increasing concentrations of either anti-CD14 blocking antibody (rmC5-3) or anti-mouse IgG for 1 h at 37 °C. Then cells were stimulated with LPS (0.2 µg/ml) in the continued presence of antibodies for 4 h at 37 °C. Supernatants were collected for evaluation of TNF levels as determined by enzyme-linked immunosorbent assay. Values represent the mean (±S.E.) of four independent data points for each condition. The involvement of the CD14 receptor in Rac1 activation was similarly evaluated in Panel B. RAW cells were either pretreated with anti-CD14 receptor antibody for 1 h at 37 °C or infected with Ad.N17Rac1 (10,000 particles/cell) for 40 h prior to LPS (0.2 µg/ml) stimulation. The abundance of GTP-bound Rac1 was then evaluated at 5 to 30 min post-LPS treatment by immunoprecipitation with GST-PBD followed by Western blotting with anti-Rac1 antibody (upper panel). Duplicate Western blots were also probed with anti-GST antibody as a control for loading (lower panel). The combined ability of both anti-CD14 antibody and N17Rac1 to inhibit TNF secretion following LPS treatment was evaluated in Panel C. RAW cells were infected with either the Ad.N17Rac1 or Ad.CMVLacZ virus at m.o.i. of 10,000 particles/cell for 40 h prior to treatment with either rmC5-3 or anti-mIgG antibodies at the indicated concentrations for 1 h. Cells were then treated with LPS (0.2 µg/ml) for 4 h in the continued presence of rmC5-3 or anti-mIgG antibodies. Supernatants were harvested for en zyme-linked immunosorbent assay determination of TNF. Conditions for each experimental point are indicated below the graph with the percent reduction in TNF secretion. Values represent the mean (±S.E.) of three independent data points for each condition.

LPS Differentially Regulates the Expression of TLR in RAW Cells-- Results thus far have suggested that Rac1 mediates LPS activation of NFB through the production of ROS by a mechanism that is independent of CD14. However, the identity of the Rac1-linked receptor remains unknown. LPS is known to exert its effects on cells through the activation of Toll-like receptors. To date, numerous murine TLR genes have been identified (65). TLR4 is widely accepted as a primary mammalian LPS sensor (66, 67).

Although the function of TLR2 is somewhat controversial (68, 69), TLR2 has also been shown to mediate LPS-induced cellular signaling (70, 71). Interestingly, it has been recently reported that Staphylococcus aureus induction of TLR2 leads to Rac1-dependent NFB activation in THP-1 cells (72). Importantly, oligomerization of TLR receptors has been suggested to create LPS-specific signaling receptors functionally distinct from the conventional CD14-TLR4 pathway (73). For example, TLR6 and TLR2 have been shown to cooperate in the activation of NFB leading to TNF expression in RAW cells (74). For these reasons, we examined the expression levels of TLR2, TLR4, and TLR6 following LPS stimulation of RAW cells using real time PCR. We reasoned that such information would prove valuable for the identification of candidate receptors responsible for ROS formation following LPS stimulation. To this end, RAW cells were treated with LPS at concentrations of 0.2 or 5 µg/ml for 4 h and potential alterations in TLR mRNA levels were analyzed (Fig. 10). Our results indicated that the relative level of TLR4 mRNA was reduced by 60% following LPS exposure as compared with a 70% increase in TLR2 mRNA. Interestingly, a 3-fold induction in TLR6 mRNA levels was detected after 4 h of LPS treatment. Our findings demonstrating an increase in TLR2 mRNA levels and a decrease in TLR4 mRNA levels following LPS challenge substantiate previously published recent reports (75-77). The unique aspect of our finding, which has not been previously reported, is the up-regulation of TLR6 mRNA following LPS exposure. These results suggest that TLR2, TLR4, and TLR6 are all potential candidates that could mediate Rac1 activation in RAW cells. Furthermore, mRNA levels of these genes are differentially modulated following LPS challenge. The significance of these changes in response to LPS and the potential involvement of these Toll-like receptors in Rac1 signaling remain to be determined.

View larger version (22K): [in this window] [in a new window]   Fig. 10.   LPS differentially regulates the expression of TLR genes. Relative mRNA expression levels of various TLR genes (TLR2, TLR4, and TLR6) were determined in LPS-treated or untreated controls using real time-PCR as described under "Experimental Procedures." RAW cells were treated with 0.2 and 5 µg/ml LPS for 4 h at 37 °C prior to analysis. For each sample, TLR mRNA levels were normalized to HPRT as an internal control. For each TLR gene, untreated controls were chosen as the reference point to which all LPS-treated experimental samples were compared (untreated controls are normalized to 1). Data represent the mean (±S.E.) of four independent experiments. A statistically significant difference between untreated and LPS-treated samples, as determined by the paired Student's t test (p < 0.05), is denoted by .

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The number of deaths due to sepsis continues to rise worldwide (3). Despite extensive research, efficacious therapies for sepsis have yet to be developed (78). Moreover, clinical trials using either pharmacological agents or monoclonal anti-endotoxin antibodies have not been successful (79-82). The failure to develop effective therapies for septic shock is partly due to our limited understanding of the signaling pathways involved in the generation of the septic proinflammatory state.

In the present report, we have provided the first description of a pathway linking the small GTP-binding protein Rac1 to LPS-stimulated ROS generation, NFB transcriptional activation, and subsequent TNF expression (Fig. 11). Several key features of LPS-induced Rac1 signal transduction should be noted. First, inhibition of Rac1 with the dominant negative mutant N17Rac1 blocked about half of both NFB transcriptional activation and the LPS-induced TNF response. The same negative mutant blocked the majority of ROS formation induced by LPS. Second, the expression of the constitutively active form of Rac1 was capable of mimicking LPS-induced ROS formation, NFB activation, and TNF induction in the absence of endotoxin stimulation. Third, chemical antioxidants blocked the majority of the LPS-induced NFB transcriptional activation and only a fraction (~50%) of TNF expression. Fourth, we have clearly shown that LPS treatment leads to the generation of superoxide radicals. Together, these findings suggest that LPS-induced Rac1 activation acts primarily to induce TNF through a ROS-dependent NFB pathway.

View larger version (22K): [in this window] [in a new window]   Fig. 11.   Schematic model for the role of Rac1 in LPS-mediated NFB activation. Our results suggest the existence of an alternative ROS-dependent Rac1 activation pathway, which appears to be independent of the CD14 receptor but still capable of activating NFB-mediated TNF expression. As shown, a dominant inactive form of Rac1 (N17Rac1) or ROS scavengers (PDTC and NAC) inhibit the production of ROS, NFB activation, and TNF production. In contrast, a constitutively active form of Rac1 (V12Rac1) augments these events. Both IKK and IKK appear to be involved in Rac1-mediated NFB activation. This is supported by the finding that the dominant mutants IKK(K44M), IKK(K44A), and IkB(S32A/S36A) all inhibit NFB activation following expression of V12Rac1. The LPS receptor that interacts with Rac1 in this pathway is currently unknown.

Although the link between LPS activation of Rac1 and subsequent induction of NFB is strong, other pathways independent of Rac1 are also likely to influence the total level of NFB activation and TNF production following LPS treatment. This is indicated by the finding that N17Rac1 expression blocked only half of the LPS-induced NFB DNA binding and transcriptional activity. If the inhibition of Rac1 by the dominant negative mutant were indeed complete (as was suggested by activity assays for GTP bound Rac1), this would suggest that other LPS-induced pathways must also activate NFB. In contrast, V12Rac1 induction of NFB and TNF expression was nearly completely blocked by expression of the IB dominant mutant, suggesting that although multiple LPS-stimulated pathways may activate NFB, the Rac1 component appears to induce TNF primarily through NFB activation. Parallel pathways involved in NFB activation, which converge at the level of the IKK complex, have previously been identified (83). These studies have demonstrated that NIK and MEKK1 can independently activate the IKK complex through distinct regulation of IKK and IKK. In the case of LPS stimulation, our studies demonstrate that both IKK and IKK play a role in the activation of TNF expression. Similar effects of these IKK mutants on TNF expression were noted in V12Rac1 expressing cells, supporting the notion that the IKK complex is a predominant target of LPS-mediated Rac1 activation. Interestingly, the inhibition of IKK more significantly attenuated (18-30-fold) NFB activation than did inhibition of IKK, as noted in luciferase assays of LPS-treated and V12Rac1-expressing cells. Such findings suggest that IKK plays a more dominant role than IKK as an effector of Rac1 activation of NFB.

Our studies using CD14 blocking antibodies suggest that LPS-mediated Rac1 activation of NFB and TNF may be independent of the CD14 receptor. Testing LPS-induced Rac1 activation in CD14-deficient murine macrophages may confirm these observations. In this regard, CD14-dependent pathways of sepsis have recently been identified and they are increasing in number (66, 84-86). Human macrophage receptors other than CD14, such as CD11/CD18 integrins, have also been reported to bind to the lipid A region of Gram-negative bacteria (87, 88). Similar levels of TNF release were observed from CD14-deficient and wild type macrophages stimulated by whole E. coli (89). In this particular case, it was demonstrated that CD11b/CD18 receptors compensated for LPS responsiveness in the absence of CD14 receptor. The fact that intracellular Toll-like receptor activation can initiate signaling pathways, in the absence of CD14 and long after particle internalization in phagolysosomes, should also be considered (90). It is also interesting to note that lipopolysaccharide structure can influence the pathways activated in LPS-induced macrophage response (i.e. CD14-dependent versus CD14-independent (25)).

It is believed that CD11b/CD18 integrin-mediated LPS responsiveness is conducted through the same downstream signaling elements as CD14 (91-94). Therefore, although Rac1 responsiveness appears to be CD14 independent in our preliminary studies, this would not rule out the possibility that similar downstream molecules (MYD88, IRAK, and TRAF6 etc.) are involved in LPS-induced Rac1 signaling. It should be noted, however, in our studies the effects of inhibiting both CD14 and Rac1 were additive, indicating the possibility of differences in the pathways. Consequently, from a therapeutic standpoint, our studies suggest that dual inhibition of both CD14 and Rac1-dependent pathways may provide the most efficacious strategies for inhibiting proinflammatory cytokine production induced by LPS in the course of sepsis.

	ACKNOWLEDGEMENTS

We gratefully acknowledge Sean Martin and Garry Buettner at the ESR Facility of the University of Iowa for help with ESR analysis.

	FOOTNOTES

^* This work was supported by National Institutes of Health NHLBI Grants HL60316 and DK54759 (to J. F. E.). A Leukemia and Lymphoma Special Fellow.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§§ A Leukemia and Lymphoma Special Fellow.

^¶¶ To whom correspondence should be addressed: Dept. of Anatomy and Cell Biology, University of Iowa, College of Medicine, 51 Newton Rd., Rm. 1-111 BSB, Iowa City, IA 52242. Tel.: 319-335-7744; Fax: 319-335-7198; E-mail: john-engelhardt@uiowa.edu.

Published, JBC Papers in Press, June 11, 2001, DOI 10.1074/jbc.M102061200

	ABBREVIATIONS

The abbreviations used are: TNF, tumor necrosis factor-; ROS, reactive oxygen species; LPS, lipopolysaccharide; LBP, lipopolysaccharide-binding protein; TLR, Toll-like receptor; GST, glutathione S-transferase; PAGE, polyacrylamide gel electrophoresis; FBS, fetal bovine serum; m.o.i., multiplicity of infection; PDTC, pyrrolidinedithiocarbamate; NAC, N-acetylcysteine; EMSA, electrophoretic mobility shift assay; PBS, phosphate-buffered saline; DMPO, 5,5-dimetyl-1-pyrroline N-oxide; DHE, dihydroethidium; RT-PCR, real time-polymerase chain reaction; HPRT, hypoxanthine-guanine-phosphoribosyl-transferase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. Pena, Z. Fu, C. Schwarzer, and T. E. Machen Pseudomonas aeruginosa Inhibition of Flagellin-Activated NF-{kappa}B and Interleukin-8 by Human Airway Epithelial Cells Infect. Immun., July 1, 2009; 77(7): 2857 - 2865. [Abstract] [Full Text] [PDF]

				G. Zanotti, M. Casiraghi, J. B. Abano, J. R. Tatreau, M. Sevala, H. Berlin, S. Smyth, W. K. Funkhouser, K. Burridge, S. H. Randell, et al. Novel critical role of Toll-like receptor 4 in lung ischemia-reperfusion injury and edema Am J Physiol Lung Cell Mol Physiol, July 1, 2009; 297(1): L52 - L63. [Abstract] [Full Text] [PDF]

				M. Starkey, J. H. Hickman, L. Ma, N. Zhang, S. De Long, A. Hinz, S. Palacios, C. Manoil, M. J. Kirisits, T. D. Starner, et al. Pseudomonas aeruginosa Rugose Small-Colony Variants Have Adaptations That Likely Promote Persistence in the Cystic Fibrosis Lung J. Bacteriol., June 1, 2009; 191(11): 3492 - 3503. [Abstract] [Full Text] [PDF]

				H. Itani, X. Liu, E. H. Sarsour, P. C. Goswami, E. Born, H. L. Keen, and C. D. Sigmund Regulation of Renin Gene Expression by Oxidative Stress Hypertension, June 1, 2009; 53(6): 1070 - 1076. [Abstract] [Full Text] [PDF]

				W. Han, M. Joo, M. B. Everhart, J. W. Christman, F. E. Yull, and T. S. Blackwell Myeloid cells control termination of lung inflammation through the NF-{kappa}B pathway Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L320 - L327. [Abstract] [Full Text] [PDF]

				C. M. Elks, N. Mariappan, M. Haque, A. Guggilam, D. S. A. Majid, and J. Francis Chronic NF-{kappa}B blockade reduces cytosolic and mitochondrial oxidative stress and attenuates renal injury and hypertension in SHR Am J Physiol Renal Physiol, February 1, 2009; 296(2): F298 - F305. [Abstract] [Full Text] [PDF]

				H. Yuan, C. N. Perry, C. Huang, E. Iwai-Kanai, R. S. Carreira, C. C. Glembotski, and R. A. Gottlieb LPS-induced autophagy is mediated by oxidative signaling in cardiomyocytes and is associated with cytoprotection Am J Physiol Heart Circ Physiol, February 1, 2009; 296(2): H470 - H479. [Abstract] [Full Text] [PDF]

				C. Schwarzer, Z. Fu, H. Fischer, and T. E. Machen Redox-independent Activation of NF-{kappa}B by Pseudomonas aeruginosa Pyocyanin in a Cystic Fibrosis Airway Epithelial Cell Line J. Biol. Chem., October 3, 2008; 283(40): 27144 - 27153. [Abstract] [Full Text] [PDF]

				B. Illek, Z. Fu, C. Schwarzer, T. Banzon, S. Jalickee, S. S. Miller, and T. E. Machen Flagellin-stimulated Cl- secretion and innate immune responses in airway epithelia: role for p38 Am J Physiol Lung Cell Mol Physiol, October 1, 2008; 295(4): L531 - L542. [Abstract] [Full Text] [PDF]

				Y. Jung, H. Kim, S. H. Min, S. G. Rhee, and W. Jeong Dynein Light Chain LC8 Negatively Regulates NF-{kappa}B through the Redox-dependent Interaction with I{kappa}B{alpha} J. Biol. Chem., August 29, 2008; 283(35): 23863 - 23871. [Abstract] [Full Text] [PDF]

				M. Mofarrahi, T. Nouh, S. Qureshi, L. Guillot, D. Mayaki, and S. N. A. Hussain Regulation of angiopoietin expression by bacterial lipopolysaccharide Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L955 - L963. [Abstract] [Full Text] [PDF]

				J. R. Peterson, D. W. Infanger, V. A. Braga, Y. Zhang, R. V. Sharma, J. F. Engelhardt, and R. L. Davisson Longitudinal noninvasive monitoring of transcription factor activation in cardiovascular regulatory nuclei using bioluminescence imaging Physiol Genomics, April 1, 2008; 33(2): 292 - 299. [Abstract] [Full Text] [PDF]

				C. D. Palmer, B. E. Mutch, S. Workman, J. P. McDaid, N. J. Horwood, and B. M. J. Foxwell Bmx tyrosine kinase regulates TLR4-induced IL-6 production in human macrophages independently of p38 MAPK and NF{kappa}B activity Blood, February 15, 2008; 111(4): 1781 - 1788. [Abstract] [Full Text] [PDF]

				H. Bayat, S. Xu, D. Pimentel, R. A. Cohen, and B. Jiang Activation of Thromboxane Receptor Upregulates Interleukin (IL)-1 Induced VCAM-1 Expression Through JNK Signaling Arterioscler. Thromb. Vasc. Biol., January 1, 2008; 28(1): 127 - 134. [Abstract] [Full Text] [PDF]

				D. M. Cortez, M. D. Feldman, S. Mummidi, A. J. Valente, B. Steffensen, M. Vincenti, J. L. Barnes, and B. Chandrasekar IL-17 stimulates MMP-1 expression in primary human cardiac fibroblasts via p38 MAPK- and ERK1/2-dependent C/EBP- , NF-{kappa}B, and AP-1 activation Am J Physiol Heart Circ Physiol, December 1, 2007; 293(6): H3356 - H3365. [Abstract] [Full Text] [PDF]

				K. Hybiske, Z. Fu, C. Schwarzer, J. Tseng, J. Do, N. Huang, and T. E. Machen Effects of cystic fibrosis transmembrane conductance regulator and {Delta}F508CFTR on inflammatory response, ER stress, and Ca2+ of airway epithelia Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1250 - L1260. [Abstract] [Full Text] [PDF]

				F. J. Miller Jr, M. Filali, G. J. Huss, B. Stanic, A. Chamseddine, T. J. Barna, and F. S. Lamb Cytokine Activation of Nuclear Factor {kappa}B in Vascular Smooth Muscle Cells Requires Signaling Endosomes Containing Nox1 and ClC-3 Circ. Res., September 28, 2007; 101(7): 663 - 671. [Abstract] [Full Text] [PDF]

				D. N. Patel, C. A. King, S. R. Bailey, J. W. Holt, K. Venkatachalam, A. Agrawal, A. J. Valente, and B. Chandrasekar Interleukin-17 Stimulates C-reactive Protein Expression in Hepatocytes and Smooth Muscle Cells via p38 MAPK and ERK1/2-dependent NF-{kappa}B and C/EBPbeta Activation J. Biol. Chem., September 14, 2007; 282(37): 27229 - 27238. [Abstract] [Full Text] [PDF]

				V. Poulaki, E. Iliaki, N. Mitsiades, C. S. Mitsiades, Y. N. Paulus, D. V. Bula, E. S. Gragoudas, and J. W. Miller Inhibition of Hsp90 attenuates inflammation in endotoxin-induced uveitis FASEB J, July 1, 2007; 21(9): 2113 - 2123. [Abstract] [Full Text] [PDF]

				K. McPhillips, W. J. Janssen, M. Ghosh, A. Byrne, S. Gardai, L. Remigio, D. L. Bratton, J. L. Kang, and P. Henson TNF-{alpha} Inhibits Macrophage Clearance of Apoptotic Cells via Cytosolic Phospholipase A2 and Oxidant-Dependent Mechanisms J. Immunol., June 15, 2007; 178(12): 8117 - 8126. [Abstract] [Full Text] [PDF]

				A. L. Humlicek, L. J. Manzel, C. L. Chin, L. Shi, K. J. D. A. Excoffon, M. C. Winter, D. M. Shasby, and D. C. Look Paracellular Permeability Restricts Airway Epithelial Responses to Selectively Allow Activation by Mediators at the Basolateral Surface J. Immunol., May 15, 2007; 178(10): 6395 - 6403. [Abstract] [Full Text] [PDF]

				H. Liu, H. Zhang, and H. J. Forman Silica Induces Macrophage Cytokines through Phosphatidylcholine-Specific Phospholipase C with Hydrogen Peroxide Am. J. Respir. Cell Mol. Biol., May 1, 2007; 36(5): 594 - 599. [Abstract] [Full Text] [PDF]

				A. V. Miletic, D. B. Graham, V. Montgrain, K. Fujikawa, T. Kloeppel, K. Brim, B. Weaver, R. Schreiber, R. Xavier, and W. Swat Vav proteins control MyD88-dependent oxidative burst Blood, April 15, 2007; 109(8): 3360 - 3368. [Abstract] [Full Text] [PDF]

				C.-S. Yang, D.-S. Lee, C.-H. Song, S.-J. An, S. Li, J.-M. Kim, C. S. Kim, D. G. Yoo, B. H. Jeon, H.-Y. Yang, et al. Roles of peroxiredoxin II in the regulation of proinflammatory responses to LPS and protection against endotoxin-induced lethal shock J. Exp. Med., March 19, 2007; 204(3): 583 - 594. [Abstract] [Full Text] [PDF]

				L. M. Williams, U. Sarma, K. Willets, T. Smallie, F. Brennan, and B. M. J. Foxwell Expression of Constitutively Active STAT3 Can Replicate the Cytokine-suppressive Activity of Interleukin-10 in Human Primary Macrophages J. Biol. Chem., March 9, 2007; 282(10): 6965 - 6975. [Abstract] [Full Text] [PDF]

				S. M. Sacre, A. M. C. Lundberg, E. Andreakos, C. Taylor, M. Feldmann, and B. M. Foxwell Selective Use of TRAM in Lipopolysaccharide (LPS) and Lipoteichoic Acid (LTA) Induced NF-{kappa}B Activation and Cytokine Production in Primary Human Cells: TRAM Is an Adaptor for LPS and LTA Signaling J. Immunol., February 15, 2007; 178(4): 2148 - 2154. [Abstract] [Full Text] [PDF]

				A. Wullaert, L. Verstrepen, S. Van Huffel, M. Adib-Conquy, S. Cornelis, M. Kreike, M. Haegman, K. El Bakkouri, M. Sanders, K. Verhelst, et al. LIND/ABIN-3 Is a Novel Lipopolysaccharide-inducible Inhibitor of NF-{kappa}B Activation J. Biol. Chem., January 5, 2007; 282(1): 81 - 90. [Abstract] [Full Text] [PDF]

				R. Dajani, S. Sanlioglu, Y. Zhang, Q. Li, M. M. Monick, E. Lazartigues, T. Eggleston, R. L. Davisson, G. W. Hunninghake, and J. F. Engelhardt Pleiotropic functions of TNF-{alpha} determine distinct IKKbeta-dependent hepatocellular fates in response to LPS Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G242 - G252. [Abstract] [Full Text] [PDF]

				Z. Fu, K. Bettega, S. Carroll, K. R. Buchholz, and T. E. Machen Role of Ca2+ in responses of airway epithelia to Pseudomonas aeruginosa, flagellin, ATP, and thapsigargin Am J Physiol Lung Cell Mol Physiol, January 1, 2007; 292(1): L353 - L364. [Abstract] [Full Text] [PDF]

				L. Li and B. Frei Iron Chelation Inhibits NF-{kappa}B-Mediated Adhesion Molecule Expression by Inhibiting p22phox Protein Expression and NADPH Oxidase Activity Arterioscler. Thromb. Vasc. Biol., December 1, 2006; 26(12): 2638 - 2643. [Abstract] [Full Text] [PDF]

				P. Sancho-Bru, R. Bataller, J. Colmenero, X. Gasull, M. Moreno, V. Arroyo, D. A. Brenner, and P. Gines Norepinephrine induces calcium spikes and proinflammatory actions in human hepatic stellate cells Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G877 - G884. [Abstract] [Full Text] [PDF]

				M. Utsugi, K. Dobashi, T. Ishizuka, T. Kawata, T. Hisada, Y. Shimizu, A. Ono, and M. Mori Rac1 Negatively Regulates Lipopolysaccharide-Induced IL-23 p19 Expression in Human Macrophages and Dendritic Cells and NF-{kappa}B p65 trans Activation Plays a Novel Role J. Immunol., October 1, 2006; 177(7): 4550 - 4557. [Abstract] [Full Text] [PDF]

				R. Cui, B. Tieu, A. Recinos, R. G. Tilton, and A. R. Brasier RhoA Mediates Angiotensin II-Induced Phospho-Ser536 Nuclear Factor {kappa}B/RelA Subunit Exchange on the Interleukin-6 Promoter in VSMCs Circ. Res., September 29, 2006; 99(7): 723 - 730. [Abstract] [Full Text] [PDF]

				T. D. Starner, N. Zhang, G. Kim, M. A. Apicella, and P. B. McCray Jr. Haemophilus influenzae Forms Biofilms on Airway Epithelia: Implications in Cystic Fibrosis Am. J. Respir. Crit. Care Med., July 15, 2006; 174(2): 213 - 220. [Abstract] [Full Text] [PDF]

				M. A. James, J. H. Lee, and A. J. Klingelhutz Human Papillomavirus Type 16 E6 Activates NF-{kappa}B, Induces cIAP-2 Expression, and Protects against Apoptosis in a PDZ Binding Motif-Dependent Manner. J. Virol., June 1, 2006; 80(11): 5301 - 5307. [Abstract] [Full Text] [PDF]

				P. Matos and P. Jordan Rac1, but Not Rac1B, Stimulates RelB-mediated Gene Transcription in Colorectal Cancer Cells J. Biol. Chem., May 12, 2006; 281(19): 13724 - 13732. [Abstract] [Full Text] [PDF]

				F. Syeda, J. Grosjean, R. A. Houliston, R. J. Keogh, T. D. Carter, E. Paleolog, and C. P. D. Wheeler-Jones Cyclooxygenase-2 Induction and Prostacyclin Release by Protease-activated Receptors in Endothelial Cells Require Cooperation between Mitogen-activated Protein Kinase and NF-{kappa}B Pathways J. Biol. Chem., April 28, 2006; 281(17): 11792 - 11804. [Abstract] [Full Text] [PDF]

				C. Dogra, H. Changotra, S. Mohan, and A. Kumar Tumor Necrosis Factor-like Weak Inducer of Apoptosis Inhibits Skeletal Myogenesis through Sustained Activation of Nuclear Factor-{kappa}B and Degradation of MyoD Protein J. Biol. Chem., April 14, 2006; 281(15): 10327 - 10336. [Abstract] [Full Text] [PDF]

				S. S. Iyer, R. S. Agrawal, C. R. Thompson, S. Thompson, J. A. Barton, and D. J. Kusner Phospholipase D1 Regulates Phagocyte Adhesion J. Immunol., March 15, 2006; 176(6): 3686 - 3696. [Abstract] [Full Text] [PDF]

				C.-Y. Wei, K.-C. Huang, Y.-H. Chou, P.-F. Hsieh, K.-H. Lin, and W.-W. Lin The Role of Rho-Associated Kinase in Differential Regulation by Statins of Interleukin-1beta- and Lipopolysaccharide-Mediated Nuclear Factor {kappa}B Activation and Inducible Nitric-Oxide Synthase Gene Expression in Vascular Smooth Muscle Cells Mol. Pharmacol., March 1, 2006; 69(3): 960 - 967. [Abstract] [Full Text] [PDF]

				J. Tseng, J. Do, J. H. Widdicombe, and T. E. Machen Innate immune responses of human tracheal epithelium to Pseudomonas aeruginosa flagellin, TNF-{alpha}, and IL-1beta Am J Physiol Cell Physiol, March 1, 2006; 290(3): C678 - C690. [Abstract] [Full Text] [PDF]

				Q. Li and J. F. Engelhardt Interleukin-1beta Induction of NF{kappa}B Is Partially Regulated by H2O2-mediated Activation of NF{kappa}B-inducing Kinase J. Biol. Chem., January 20, 2006; 281(3): 1495 - 1505. [Abstract] [Full Text] [PDF]

				Q. Li, M. M. Harraz, W. Zhou, L. N. Zhang, W. Ding, Y. Zhang, T. Eggleston, C. Yeaman, B. Banfi, and J. F. Engelhardt Nox2 and Rac1 Regulate H2O2-Dependent Recruitment of TRAF6 to Endosomal Interleukin-1 Receptor Complexes Mol. Cell. Biol., January 1, 2006; 26(1): 140 - 154. [Abstract] [Full Text] [PDF]

				A. L. Theiss, J. G. Simmons, C. Jobin, and P. K. Lund Tumor Necrosis Factor (TNF) {alpha} Increases Collagen Accumulation and Proliferation in Intestinal Myofibroblasts via TNF Receptor 2 J. Biol. Chem., October 28, 2005; 280(43): 36099 - 36109. [Abstract] [Full Text] [PDF]

				C. L. Chin, L. J. Manzel, E. E. Lehman, A. L. Humlicek, L. Shi, T. D. Starner, G. M. Denning, T. F. Murphy, S. Sethi, and D. C. Look Haemophilus influenzae from Patients with Chronic Obstructive Pulmonary Disease Exacerbation Induce More Inflammation than Colonizers Am. J. Respir. Crit. Care Med., July 1, 2005; 172(1): 85 - 91. [Abstract] [Full Text] [PDF]

				P. H. Tan, P. Sagoo, C. Chan, J. B. Yates, J. Campbell, S. C. Beutelspacher, B. M. J. Foxwell, G. Lombardi, and A. J. T. George Inhibition of NF-{kappa}B and Oxidative Pathways in Human Dendritic Cells by Antioxidative Vitamins Generates Regulatory T Cells J. Immunol., June 15, 2005; 174(12): 7633 - 7644. [Abstract] [Full Text] [PDF]

				K. El Bakkouri, A. Wullaert, M. Haegman, K. Heyninck, and R. Beyaert Adenoviral Gene Transfer of the NF-{kappa}B Inhibitory Protein ABIN-1 Decreases Allergic Airway Inflammation in a Murine Asthma Model J. Biol. Chem., May 6, 2005; 280(18): 17938 - 17944. [Abstract] [Full Text] [PDF]

				J. S. Kang, Y. D. Yoon, I. J. Cho, M. H. Han, C. W. Lee, S.-K. Park, and H. M. Kim Glabridin, an Isoflavan from Licorice Root, Inhibits Inducible Nitric-Oxide Synthase Expression and Improves Survival of Mice in Experimental Model of Septic Shock J. Pharmacol. Exp. Ther., March 1, 2005; 312(3): 1187 - 1194. [Abstract] [Full Text] [PDF]

				D. R. Curran, R. K. Morgan, P. J. Kingham, N. Durcan, W. G. McLean, M. T. Walsh, and R. W. Costello Mechanism of eosinophil induced signaling in cholinergic IMR-32 cells Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L326 - L332. [Abstract] [Full Text] [PDF]

				T. Syrovets, B. Buchele, C. Krauss, Y. Laumonnier, and T. Simmet Acetyl-Boswellic Acids Inhibit Lipopolysaccharide-Mediated TNF-{alpha} Induction in Monocytes by Direct Interaction with I{kappa}B Kinases J. Immunol., January 1, 2005; 174(1): 498 - 506. [Abstract] [Full Text] [PDF]

				J. Campbell, C. J. Ciesielski, A. E. Hunt, N. J. Horwood, J. T. Beech, L. A. Hayes, A. Denys, M. Feldmann, F. M. Brennan, and B. M. J. Foxwell A Novel Mechanism for TNF-{alpha} Regulation by p38 MAPK: Involvement of NF-{kappa}B with Implications for Therapy in Rheumatoid Arthritis J. Immunol., December 1, 2004; 173(11): 6928 - 6937. [Abstract] [Full Text] [PDF]

				J.-D. Luo, Y.-Y. Wang, W.-L. Fu, J. Wu, and A. F. Chen Gene Therapy of Endothelial Nitric Oxide Synthase and Manganese Superoxide Dismutase Restores Delayed Wound Healing in Type 1 Diabetic Mice Circulation, October 19, 2004; 110(16): 2484 - 2493. [Abstract] [Full Text] [PDF]

				H. S. Park, H. Y. Jung, E. Y. Park, J. Kim, W. J. Lee, and Y. S. Bae Cutting Edge: Direct Interaction of TLR4 with NAD(P)H Oxidase 4 Isozyme Is Essential for Lipopolysaccharide-Induced Production of Reactive Oxygen Species and Activation of NF-{kappa}B J. Immunol., September 15, 2004; 173(6): 3589 - 3593. [Abstract] [Full Text] [PDF]

				M. M. Monick, R. K. Mallampalli, M. Bradford, D. McCoy, T. J. Gross, D. M. Flaherty, L. S. Powers, K. Cameron, S. Kelly, A. H. Merrill Jr., et al. Cooperative Prosurvival Activity by ERK and Akt in Human Alveolar Macrophages is Dependent on High Levels of Acid Ceramidase Activity J. Immunol., July 1, 2004; 173(1): 123 - 135. [Abstract] [Full Text] [PDF]

				I. Tritto and G. Ambrosio The multi-faceted behavior of nitric oxide in vascular "inflammation": catchy terminology or true phenomenon? Cardiovasc Res, July 1, 2004; 63(1): 1 - 4. [Full Text] [PDF]

				O. Equils, Z. Madak, C. Liu, K. S. Michelsen, Y. Bulut, and D. Lu Rac1 and Toll-IL-1 Receptor Domain-Containing Adapter Protein Mediate Toll-Like Receptor 4 Induction of HIV-Long Terminal Repeat J. Immunol., June 15, 2004; 172(12): 7642 - 7646. [Abstract] [Full Text] [PDF]

				W. G. Li, D. Gavrila, X. Liu, L. Wang, S. Gunnlaugsson, L. L. Stoll, M. L. McCormick, C. D. Sigmund, C. Tang, and N. L. Weintraub Ghrelin Inhibits Proinflammatory Responses and Nuclear Factor-{kappa}B Activation in Human Endothelial Cells Circulation, May 11, 2004; 109(18): 2221 - 2226. [Abstract] [Full Text] [PDF]

				T. Wang, B. Liu, W. Zhang, B. Wilson, and J.-S. Hong Andrographolide Reduces Inflammation-Mediated Dopaminergic Neurodegeneration in Mesencephalic Neuron-Glia Cultures by Inhibiting Microglial Activation J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 975 - 983. [Abstract] [Full Text] [PDF]

				Y. Zhao, S. Joshi-Barve, S. Barve, and L. H. Chen Eicosapentaenoic Acid Prevents LPS-Induced TNF-{alpha} Expression by Preventing NF-{kappa}B Activation J. Am. Coll. Nutr., February 1, 2004; 23(1): 71 - 78. [Abstract] [Full Text] [PDF]

				L. Qin, Y. Liu, T. Wang, S.-J. Wei, M. L. Block, B. Wilson, B. Liu, and J.-S. Hong NADPH Oxidase Mediates Lipopolysaccharide-induced Neurotoxicity and Proinflammatory Gene Expression in Activated Microglia J. Biol. Chem., January 9, 2004; 279(2): 1415 - 1421. [Abstract] [Full Text] [PDF]

				M. Song, J. A. Kellum, H. Kaldas, and M. P. Fink Evidence That Glutathione Depletion Is a Mechanism Responsible for the Anti-Inflammatory Effects of Ethyl Pyruvate in Cultured Lipopolysaccharide-Stimulated RAW 264.7 Cells J. Pharmacol. Exp. Ther., January 1, 2004; 308(1): 307 - 316. [Abstract] [Full Text] [PDF]

				R. F. Schwabe, R. Bataller, and D. A. Brenner Human hepatic stellate cells express CCR5 and RANTES to induce proliferation and migration Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G949 - G958. [Abstract] [Full Text] [PDF]

				M. M. Monick, L. S. Powers, N. S. Butler, and G. W. Hunninghake Inhibition of Rho Family GTPases Results in Increased TNF-{alpha} Production After Lipopolysaccharide Exposure J. Immunol., September 1, 2003; 171(5): 2625 - 2630. [Abstract] [Full Text] [PDF]

				N. J. Horwood, T. Mahon, J. P. McDaid, J. Campbell, H. Mano, F. M. Brennan, D. Webster, and B. M.J. Foxwell Bruton's Tyrosine Kinase Is Required For Lipopolysaccharide-induced Tumor Necrosis Factor {alpha} Production J. Exp. Med., June 16, 2003; 197(12): 1603 - 1611. [Abstract] [Full Text] [PDF]

				S. Xiong, H. She, H. Takeuchi, B. Han, J. F. Engelhardt, C. H. Barton, E. Zandi, C. Giulivi, and H. Tsukamoto Signaling Role of Intracellular Iron in NF-kappa B Activation J. Biol. Chem., May 9, 2003; 278(20): 17646 - 17654. [Abstract] [Full Text] [PDF]

				X.-L. Chen, Q. Zhang, R. Zhao, X. Ding, P. E. Tummala, and R. M. Medford Rac1 and Superoxide Are Required for the Expression of Cell Adhesion Molecules Induced by Tumor Necrosis Factor-alpha in Endothelial Cells J. Pharmacol. Exp. Ther., May 1, 2003; 305(2): 573 - 580. [Abstract] [Full Text] [PDF]

				J. Zabner, P. Karp, M. Seiler, S. L. Phillips, C. J. Mitchell, M. Saavedra, M. Welsh, and A. J. Klingelhutz Development of cystic fibrosis and noncystic fibrosis airway cell lines Am J Physiol Lung Cell Mol Physiol, May 1, 2003; 284(5): L844 - L854. [Abstract] [Full Text] [PDF]

				C. Fan, J. Yang, and J. F. Engelhardt Temporal pattern of NF{kappa}B activation influences apoptotic cell fate in a stimuli-dependent fashion J. Cell Sci., March 14, 2003; 115(24): 4843 - 4853. [Abstract] [Full Text] [PDF]

				T. Peng, X. Lu, M. Lei, and Q. Feng Endothelial Nitric-oxide Synthase Enhances Lipopolysaccharide-stimulated Tumor Necrosis Factor-alpha Expression via cAMP-mediated p38 MAPK Pathway in Cardiomyocytes J. Biol. Chem., February 28, 2003; 278(10): 8099 - 8105. [Abstract] [Full Text] [PDF]

				C. Ritter, M. Andrades, J. C. F. Moreira, F. Dal-Pizzol, and S. N. A. Hussain Superoxide production during sepsis development Am. J. Respir. Crit. Care Med., February 1, 2003; 167(3): 474 - 475. [Full Text] [PDF]

				V. L. Vega and A. De Maio Geldanamycin Treatment Ameliorates the Response to LPS in Murine Macrophages by Decreasing CD14 Surface Expression Mol. Biol. Cell, February 1, 2003; 14(2): 764 - 773. [Abstract] [Full Text] [PDF]

				C. Fan, Q. Li, D. Ross, and J. F. Engelhardt Tyrosine Phosphorylation of Ikappa Balpha Activates NFkappa B through a Redox-regulated and c-Src-dependent Mechanism Following Hypoxia/Reoxygenation J. Biol. Chem., January 10, 2003; 278(3): 2072 - 2080. [Abstract] [Full Text] [PDF]

				B. Liu and J.-S. Hong Role of Microglia in Inflammation-Mediated Neurodegenerative Diseases: Mechanisms and Strategies for Therapeutic Intervention J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 1 - 7. [Abstract] [Full Text] [PDF]

				S. S. Deshpande, B. Qi, Y. C. Park, and K. Irani Constitutive Activation of rac1 Results in Mitochondrial Oxidative Stress and Induces Premature Endothelial Cell Senescence Arterioscler. Thromb. Vasc. Biol., January 1, 2003; 23(1): e1 - 6. [Abstract] [Full Text] [PDF]

				H. J. Forman and M. Torres Reactive Oxygen Species and Cell Signaling: Respiratory Burst in Macrophage Signaling Am. J. Respir. Crit. Care Med., December 15, 2002; 166(12): S4 - 8. [Abstract] [Full Text] [PDF]

				H. E. Marshall and J. S. Stamler Nitrosative Stress-induced Apoptosis through Inhibition of NF-kappa B J. Biol. Chem., September 6, 2002; 277(37): 34223 - 34228. [Abstract] [Full Text] [PDF]

				Y. Liu, L. Qin, B. C. Wilson, L. An, J.-S. Hong, and B. Liu Inhibition by Naloxone Stereoisomers of beta -Amyloid Peptide (1-42)-induced Superoxide Production in Microglia and Degeneration of Cortical and Mesencephalic Neurons J. Pharmacol. Exp. Ther., September 1, 2002; 302(3): 1212 - 1219. [Abstract] [Full Text] [PDF]

				M. M. Monick, P. K. Robeff, N. S. Butler, D. M. Flaherty, A. B. Carter, M. W. Peterson, and G. W. Hunninghake Phosphatidylinositol 3-Kinase Activity Negatively Regulates Stability of Cyclooxygenase 2 mRNA J. Biol. Chem., August 30, 2002; 277(36): 32992 - 33000. [Abstract] [Full Text] [PDF]

				M. M. Monick, L. Powers, N. Butler, T. Yarovinsky, and G. W. Hunninghake Interaction of matrix with integrin receptors is required for optimal LPS-induced MAP kinase activation Am J Physiol Lung Cell Mol Physiol, August 1, 2002; 283(2): L390 - L402. [Abstract] [Full Text] [PDF]

				T. Kizaki, K. Suzuki, Y. Hitomi, N. Taniguchi, D. Saitoh, K. Watanabe, K. Onoe, N. K. Day, R. A. Good, and H. Ohno Uncoupling protein 2 plays an important role in nitric oxide production of lipopolysaccharide-stimulated macrophages PNAS, July 9, 2002; 99(14): 9392 - 9397. [Abstract] [Full Text] [PDF]

				R. F. Schwabe and D. A. Brenner Role of glycogen synthase kinase-3 in TNF-alpha -induced NF-kappa B activation and apoptosis in hepatocytes Am J Physiol Gastrointest Liver Physiol, July 1, 2002; 283(1): G204 - G211. [Abstract] [Full Text] [PDF]

				H.-Y. Hsu and M.-H. Wen Lipopolysaccharide-mediated Reactive Oxygen Species and Signal Transduction in the Regulation of Interleukin-1 Gene Expression J. Biol. Chem., June 14, 2002; 277(25): 22131 - 22139. [Abstract] [Full Text] [PDF]

				A. Denys, I. A. Udalova, C. Smith, L. M. Williams, C. J. Ciesielski, J. Campbell, C. Andrews, D. Kwaitkowski, and B. M. J. Foxwell Evidence for a Dual Mechanism for IL-10 Suppression of TNF-{alpha} Production That Does Not Involve Inhibition of p38 Mitogen-Activated Protein Kinase or NF-{kappa}B in Primary Human Macrophages J. Immunol., May 15, 2002; 168(10): 4837 - 4845. [Abstract] [Full Text] [PDF]

				K. Y. Kim, B. G. Kim, S.-O. Kim, S.-E. Yoo, Y.-G. Kwak, S.-W. Chae, and K. W. Hong Prevention of Lipopolysaccharide-Induced Apoptosis by (2S,3S,4R)-N""-Cyano-N-(6-amino-3,4-dihydro-3-hydroxy-2-methyl-2-dimethoxymethyl-2H-benzopyran-4-yl)-N'-benzylguanidine, a Benzopyran Analog, in Endothelial Cells J. Pharmacol. Exp. Ther., February 1, 2002; 300(2): 535 - 542. [Abstract] [Full Text] [PDF]

				Q. Ma and K. Kinneer Chemoprotection by Phenolic Antioxidants. INHIBITION OF TUMOR NECROSIS FACTOR alpha INDUCTION IN MACROPHAGES J. Biol. Chem., January 18, 2002; 277(4): 2477 - 2484. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/32/30188    most recent M102061200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sanlioglu, S. Articles by Engelhardt, J. F. Search for Related Content PubMed PubMed Citation Articles by Sanlioglu, S. Articles by Engelhardt, J. F. Social Bookmarking                      What's this?