JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M011618200 on May 31, 2001

J. Biol. Chem., Vol. 276, Issue 32, 30521-30526, August 10, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
276/32/30521    most recent
M011618200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ogushi, K.-i.
Right arrow Articles by Hirayama, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ogushi, K.-i.
Right arrow Articles by Hirayama, T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Salmonella enteritidis FliC (Flagella Filament Protein) Induces Human beta -Defensin-2 mRNA Production by Caco-2 Cells*

Ken-ichi Ogushiab, Akihiro Wadaa, Takuro Niidomeb, Naoki Moric, Kazunori Oishid, Tsuyoshi Nagataked, Akira Takahashie, Hiroshi Asakuraf, Sou-ichi Makinof, Hironobu Hojog, Yoshiaki Nakaharag, Mio Ohsakib, Tomomitsu Hatakeyamab, Haruhiko Aoyagib, Hisao Kurazonoh, Joel Mossi, and Toshiya Hirayamaaj

From the Departments of a Bacteriology, c Preventive Medicine and AIDS Research, and d Internal Medicine, Institute of Tropical Medicine, and the b Department of Applied Chemistry, Faculty of Engineering, Nagasaki University, Sakamoto, Nagasaki 852-8523, Japan, the e Department of Nutrition, School of Medicine Tokushima University, Kuramoto-cho, Tokushima 770-8503, Japan, the f Department of Veterinary Microbiology, Obihiro University of Agriculture and Veterinary Medicine, Obihiro Inada, Hokkaido 080-8555, Japan, the g Department of Industrial Chemistry, Tokai University, Kitakaname, Hiratsuka-shi, Kanagawa 259-1292, Japan, the h Faculty of Health Science, Okayama University of Medical School, Shikata-chou, Okayama 700-8558, Japan, and the i Pulmonary-Critical Care Medicine Branch, NHLBI, National Institutes of Health, Bethesda, Maryland 20892

Received for publication, December 22, 2000, and in revised form, May 29, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Antimicrobial peptides are crucial for host defense at mucosal surfaces. Bacterial factors responsible for induction of human beta -defensin-2 (hBD-2) mRNA expression in Caco-2 human carcinoma cells were determined. Salmonella enteritidis, Salmonella typhimurium, Salmonella typhi, Salmonella dublin, and culture supernatants of these strains induced hBD-2 mRNA expression in Caco-2 human carcinoma cells. Using luciferase as a reporter gene for a ~2.1-kilobase pair hBD-2 promoter, the hBD-2-inducing factor in culture supernatant of S. enteritidis was isolated. The supernatant factor was heat-stable and proteinase-sensitive. After purification by anion exchange and gel filtration chromatography, the hBD-2-inducing factor was identified as a 53-kDa monomeric protein with the amino-terminal sequence AQVINTNSLSLLTQNNLNK, which is identical to that of the flagella filament structural protein (FliC) of S. enteritidis. Consistent with this finding, the 53-kDa protein reacted with anti-FliC antibody, which prevented its induction of hBD-2 mRNA in Caco-2 cells. In agreement, the hBD-2-inducing activity in culture supernatant was completely neutralized by anti-FliC antibody. In gel retardation analyses, FliC increased binding of NF-kappa B (p65 homodimer) to hBD-2 gene promoter sequences. We conclude that S. enteritidis FliC induces hBD-2 expression in Caco-2 cells via NF-kappa B activation and thus plays an important role in up-regulation of the innate immune response.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Antimicrobial peptides play an important role in host defense at mucosal surfaces. The two major groups of vertebrate defensins, alpha - and beta -defensins, differ in the arrangements of their disulfide bonds. Six human alpha -defensins (HD-1 to HD-6)1 and two beta -defensins (hBD-1 and hBD-2) have been reported to date. HD-1, HD-2, HD-3, and HD-4 are present in neutrophils, where they constitute 30-50% of the total protein in azurophilic granules (1). HD-5 and HD-6 were identified in the Paneth cells of small intestinal crypts (2, 3) and in female reproductive tissue (4). hBD-1 was purified from plasma (5) and detected in a range of epithelial tissues (6). hBD-2 was purified from skin and shown to be expressed in the lung and uterus (7). hBD-2 was induced in mucosal tissues following bacterial infections (7-9).

Salmonella species are Gram-negative organisms that cause gastroenteritis and enteric fever in humans. As pointed out by Bäumler et al. (10), an increase in numbers of human infections with Salmonella enteritidis began in the 1960s but was followed by an almost 50% decrease from 1970 to 1976. Another increase began in 1977, with signs of a decrease beginning in 1992. In contrast, the increasing frequency of S. enteritidis infection in poultry did not begin until 1989, and a decline started in 1996 (11). Reasons for the fluctuations are unknown, but the recent recognition of food-borne infection with S. enteritidis has renewed interest in how these organisms can invade, persist, and spread.

To evaluate the role of defensins in S. enteritidis infection, we investigated the induction of hBD-2 in Caco-2 cells, a human colon carcinoma line. S. enteritidis, Salmonella typhimurium, Salmonella typhi, and Salmonella dublin increased hBD-2 mRNA levels, as did the culture supernatant of these strains. The hBD-2-inducing protein in S. enteritidis supernatant was purified by sequential anion exchange and gel filtration chromatography, and the amino-terminal sequence was determined. It was established that the hBD-2-inducing factor is flagella filament structural protein (FliC) of S. enteritidis, and induction results from NF-kappa B activation.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Bacteria Strains and Growth Conditions-- S. enteritidis, S. typhimurium, S. typhi, and S. dublin strains were grown on tryptic soy agar and then in liquid culture overnight in 3 ml of tryptic soy broth (TSB). A sample (500 µl) of the overnight culture was added to 20 ml of TSB, and bacteria harvested in log phase were used in this study.

Induction of hBD-2 mRNA in Caco-2 Cells-- Caco-2 cells were grown in DMEM supplemented with 10% fetal calf serum (FCS) in 60-mm diameter plates in a 5% CO2 atmosphere at 37 °C. When 90% confluent, cells were incubated with 100 µl of log-phase bacteria (3 × 107 colony-forming units/ml) or 500 µl of filtered culture supernatant in 2 ml of FCS-free DMEM for 6 h at 37 °C.

Total RNA was prepared from Caco-2 cells with ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer's specifications and quantified by absorbance at 260 nm. cDNA, synthesized from 1 µg of Caco-2 cell total RNA, was incubated with 2.5 µM oligo(dT) primer, 1 mM of each deoxynucleotide triphosphate, and reverse transcriptase for 30 min at 42 °C. cDNA was mixed with 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 1 mM of each deoxynucleotide triphosphate, 1.25 units of Taq DNA polymerase, and 50 pmol each of primer hBD-2 sense (GGTGAAGCTCCCAGCCATCA), hBD-2 antisense (TATCTTTGGACACCATAGTT), GAPDH sense (TGAAGGTCGGAGTCAACGGATTTGGT), and GAPDH antisense (CATGTGGGCCGAGGTCCACCAC). The mixture was covered with mineral oil before initiating PCR for 40 cycles of 1 min at 94 °C, 2 min at 55 °C, and 2 min at 72 °C. PCR products were identified in ethidium bromide-stained 1.5% agarose gels.

Luciferase Assay-- To assess hBD-2 promoter activity, Caco-2 cells were seeded in 24-well culture plates (1 × 105 cells in 1 ml of DMEM per well) and incubated for 24 h at 37 °C. 2.5 µg of the hBD-2 promoter linked to a luciferase reporter gene (5'-deletion constructs of the hBD-2 promoter (pGL3-2110, pGL3-938, pGL3-398, pGL3-229, and pGL3-197) or a mutated hBD-2 promoter construct (pGL3-938/mt)) (12) were incubated with 0.5 µg of an internal control Renilla luciferase expression vector (pRL-TK) and 10 µl of 1.6 mM dendritic poly-(L-lysine) (KG6) (13) in 250 µl of FCS-free DMEM for 15 min at room temperature before addition of DNA-peptide complexes to Caco-2 cells. After incubation for 3 h at 37 °C, 1 ml of DMEM was added, and 12 h later, the culture medium was replaced.

After DNA transfection, the medium was replaced with 1 ml of fresh FCS-free DMEM, and 250 µl of the sample to be assayed was then added. After incubation for 6 h at 37 °C, Caco-2 cells were washed with 1 ml of PBS and lysed by adding 300 µl of lysis buffer (Toyo Ink Co.). After 15 min at room temperature, the lysate was centrifuged (18,000 × g, 5 min, 4 °C). Luciferase activity of the supernatant, measured using a luminometer (Berthold), was normalized to the activity of an internal control Renilla luciferase.

Purification and Sequencing of hBD-2-inducing Factor from S. enteritidis Culture Supernatant-- S. enteritidis was grown in 100 ml of TSB at 37 °C for 16 h before centrifugation at 9,000 × g for 30 min and collection of culture supernatant. Proteins precipitated with 70% saturated ammonium sulfate were collected by centrifugation (9000 × g, 30 min, 4 °C) after incubation overnight at 4 °C. The precipitate, containing hBD-2-inducing factor, was dissolved in 2 ml of 20 mM Tris-HCl, pH 7.5, and dialyzed against the same buffer. The dialyzed sample was centrifuged at 15,000 × g for 5 min to remove insoluble material, and filtered (0.45 µM filter (Sartorius)) before application to a column (1.6 × 3 cm) of ResourceQ ion exchange resin, which was equilibrated with 20 mM Tris-HCl, pH 7.5, and eluted with a linear gradient of 0-300 mM NaCl in the same buffer at a flow rate of 1 ml/min. Induction of hBD-2 by each fraction was determined by the luciferase reporter gene assay. Active fractions were pooled and applied to a column (1 × 30 cm) of Superose 12, which was eluted with PBS at a flow rate of 0.5 ml/min.

The purified hBD-2-inducing factor was subjected to SDS-PAGE in 10% gel and transferred to polyvinylidene difluoride membranes at 100 V for 1 h with transfer buffer (25 mM Tris, 0.19 M glycine, 20% methanol) followed by staining with Ponceau-S. The protein band was excised for amino acid sequencing with a gas-phase protein sequencer PPSQ-21 (Shimadzu, Japan).

Preparation of Anti-FliC Peptide Antibody, Anti-FliC Protein Antibody, and Western Blotting-- A peptide, NH2-QFTFDDKTKNESAKL (amino acids 339-353 of S. enteritidis FliC with an added carboxyl-terminal Cys), was synthesized and coupled to KLH. Rabbits were immunized with the KLH-coupled peptide (200 µg) or with purified FliC protein (40 µg) on day 0, with peptide (200 µg) or FliC (40 µg) on day 21 and with peptide (100 µg) or FliC (40 µg) at intervals of a week thereafter until the desired serum antibody titer against the peptide or protein was reached. All antigens were injected subcutaneous in complete Freund's adjuvant (1:1). Rabbits were bled 7 weeks after the first injection.

For immunoblotting, proteins were transferred to polyvinylidene difluoride membranes (Millipore, Immobilon-P membranes) at 100 V for 1 h at 4 °C with transfer buffer. Membranes were incubated with 5% milk powder in TBS-T (50 mM Tris-HCl, pH 7.5, 15 mM NaCl, 0.1% Tween-20) for 1 h and washed with TBS-T, followed by incubation in a 1: 5000 dilution of anti-FliC peptide IgG in TBS-T for 1 h at room temperature. After washing in TBS-T, membranes were incubated in a 1: 5000 dilution of horseradish peroxidase-conjugated protein A in TBS-T for 30 min at room temperature. The membranes were washed in TBS-T, followed by incubation for 5 min in TBS (50 mM Tris-HCl, pH 7.5, 15 mM NaCl), before detection by ECL (Amersham Pharmacia Biotech).

Isolation of Flagellin (FliC) from S. enteritidis Cells-- FliC of S. enteritidis was prepared as previously described (14, 15) with the following modifications. S. enteritidis, cultured in 2 liters of TSB at 37 °C for 16 h were pelleted by centrifugation at 5,000 × g for 30 min at 4 °C and suspended in 40 ml of PBS, which was adjusted to pH 2 with 1 M HCl and maintained at that pH with constant stirring for 30 min at room temperature. After centrifugation at 100,000 × g for 1 h at 4 °C, the pH of the supernatant containing detached monomeric flagellin was adjusted to 7.2 with 1 M NaOH and (NH4)2SO4 was added to 65% saturation. After incubation overnight at 4 °C, the mixture was centrifuged at 15,000 × g for 15 min at 4 °C. The precipitate was dissolved in distilled water, dialyzed against distilled water, heated at 65 °C for 15 min, and placed on ice. The sample was centrifuged at 100,000 × g for 1 h at 4 °C. To the supernatant, which contained depolymerized FliC, solid (NH4)2SO4 was added to a concentration of 0.7 M. After storage overnight at room temperature, polymerized FliC was collected by centrifugation (100,000 × g, 1 h, 4 °C) and dissolved in PBS.

Construction of pET-FliC and Purification of Recombinant FliC-- A complete structural gene of the fliC gene was amplified by PCR using a set of oligonucleotide primers, primer 1 (5'-GGCCATGGCACAAGTCATTAAT-3') and primer 2 (5'-GGGGATCCTTAACGCAGTAAAGAGAG-3'), followed by digestion with NcoI and BamHI sites of pET15b (Novagen, Darmstadt, Germany) and pET-FliC was yielded. pET-FliC was transformed into Escherichia coli BL21 (pLysS) to express FliC protein.

Bacterial cells were harvested by centrifugation 5 h after induction of mid-log phase culture with 1 mM isopropyl-beta -D-thiogalactopyranoside. Lysis was performed in the PBS by repeated sonication. After centrifugation at 18,000 × g for 15 min at 4 °C, the supernatant was collected and adjusted to pH 2 with 1 M HCl, and it was maintained at that pH with constant stirring for 30 min at room temperature. After centrifugation at 100,000 × g for 1 h at 4 °C, the pH of the supernatant was adjusted to 7.2 with 1 M NaOH and dialyzed against PBS.

Preparation of Nuclear Extract-- To prepare nuclear extract, Caco-2 cells were grown to about 90% confluency in 100-mm dishes, the culture medium was replaced with 10 ml of FCS-free medium, and incubation was continued for 1 h at 37 °C. Cells were then incubated with FliC, 100 ng/ml, for 0, 1, 3, 6, or 12 h, washed with PBS, and scraped in 2 ml of PBS. After addition of 400 µl of Buffer A (10 mM HEPES-KOH, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 0.2% Nonidet P-40) containing protease inhibitor mixture tablets (Roche Molecular Biochemicals), pH 7.9, to the scraped cells and gentle rotation for 10 min at 4 °C, nuclei were pelleted by centrifugation (100 × g, 5 min, 4 °C) and dispersed in 100 µl of Buffer B (20 mM HEPES-KOH, pH 7.9, 0.4 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride) containing protease inhibitor mixture tablets followed by gentle rotation for 30 min at 4 °C. After centrifugation (18,000 × g, 15 min, 4 °C), the concentration of protein in the supernatant was determined by the method of Bradford (Bio-Rad).

Electrophoretic Mobility Gel Shift Assay-- Oligonucleotides were synthesized by Amersham Pharmacia Biotech. The positive strands of the double-stranded oligonucleotides, corresponding to regions of the hBD-2 promoter, were prepared as follows, with mutated nucleotide sequences underlined: wild-type NF-kappa B (-213 to -196) for hBD-2, 5'-TTTTCTGGGGTTTCCTGA-3'; mutated NF-kappa B for hBD-2, 5'-TTTTCATAGGTTTAATGA-3'. The complementary strands in equal concentrations were mixed, heated to 95 °C for 5 min, and annealed by slowly cooling to room temperature. Double-stranded oligonucleotides were stored at -20 °C in 50 mM NaCl. For electrophoretic mobility shift assay, oligonucleotide probes were labeled with [gamma -32P]ATP (Amersham Pharmacia Biotech) using T4 polynucleotide kinase (Takara, Shiga, Japan) and purified using ProbeQuantTM G-50 Micro Columns (Amersham Pharmacia Biotech).

Samples (2 µg) of nuclear proteins were incubated with the indicated radiolabeled oligonucleotides for 20 min at 25 °C in binding buffer (20 mM Tris-HCl, pH 7.9, 50 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 2 mM MgCl2, 1 mM EDTA, 0.1% Nonidet P-40, 50 µg/ml bovine serum albumin). Specificities of the binding reactions were tested in competition assays in which a 100-fold excess of unlabeled wild-type or mutated oligonucleotide was added. Protein-nucleotide complexes were separated by electrophoresis in a 4% DNA retardation gel with Tris borate/EDTA (36 mM Tris-HCl, 36 mM boric acid, 0.8 mM EDTA) at constant current (20 mA) at 4 °C. Gels were dried, and complexes were analyzed by autoradiography using a Fuji imaging analyzer (Fuji Film).

Supershift experiments were performed by adding antibody (1 µl) to the binding mixture 15 min before addition of the radiolabeled probe; complexes were then separated as described above. Antibodies against synthetic peptides derived from NF-kappa B/Rel family proteins (p65(A) against amino acids 3-19 of p65, p65(C) against amino acids 531-550 of p65, p50 (N-19) against the amino terminus of p50, p52 (K-27) against conserved epitope of p52, c-Rel (N) against the amino terminus of c-Rel, and Rel B (C-19) against the carboxyl terminus of Rel B) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Induction of hBD-2 mRNA in Caco-2 Cells by Salmonella Species-- To evaluate the effect of Salmonella species on hBD-2 mRNA levels by RT-PCR, Caco-2 cells were incubated for 6 h with S. typhimurium, S. enteritidis, S. typhi, or S. dublin or their broth culture filtrates, each of which increased hBD-2 mRNA (Fig. 1).


View larger version (37K):
[in this window]
[in a new window]
  		Fig. 1.   Effects of Salmonella species or culture supernatants on hBD-2 mRNA in Caco-2 cells. A, RT-PCR products of hBD-2 mRNA from Caco-2 cells incubated for 6 h with medium (lane 1), S. typhimurium (lane 2), S. enteritidis (lane 3), S. typhi (lane 4), or S. dublin (lane 5). GAPDH control in each sample is shown in the bottom panel. B, RT-PCR products of hBD-2 mRNA from Caco-2 cells after incubation for 6 h with control TSB medium (lane 1), S. typhimurium culture supernatant (lane 2), S. enteritidis culture supernatant (lane 3), S. typhi culture supernatant (lane 4), or S. dublin culture supernatant (lane 5). GAPDH controls are shown in the bottom panel. Data are representative of three separate experiments.

Stability of hBD-2-inducing Factor in S. enteritidis Supernatant-- The factor in S. enteritidis culture supernatant responsible for hBD-2 induction was stable to heating at 100 °C for 10 min (Fig. 2). However, incubation for 2 h with trypsin or proteinase K resulted in a loss of hBD-2-inducing activity, indicating that the factor in broth culture of S. enteritidis was heat-stable and proteinase-sensitive.


View larger version (57K):
[in this window]
[in a new window]
  		Fig. 2.   Stability of hBD-2-inducing factor activity in S. enteritidis culture supernatant. hBD-2 mRNA in Caco-2 cells (top panel) was assayed by the RT-PCR method after incubation of cells for 6 h with samples of culture supernatant that had been treated as indicated. Results with GAPDH mRNA are shown in the bottom panel. Lane 1, control TSB medium; lane 2, S. enteritidis culture supernatant; lane 3, supernatant incubated for 2 h with trypsin, 40 µg/ml, and heated for 10 min at 100 °C; lane 4, supernatant incubated for 2 h with proteinase K, 200 µg/ml, and heated for 10 min at 100 °C; lane 5, supernatant heated for 10 min at 100 °C. Data are representative of three separate experiments.

Purification of hBD-2-inducing Factor from S. enteritidis Supernatant-- hBD-2-inducing activity in S. enteritidis supernatant was estimated by induction of luciferase activity of pGL3-2110-transfected Caco-2 cells. pGL3-2110 contains the 5' flanking region of the hBD-2 gene (-2110 to -1) in a luciferase-reporter plasmid (Fig. 7). pGL3-2110-transfected cells were incubated with S. enteritidis supernatant, before and after heat and proteinase treatment and before assay of luciferase activity (Fig. 3). As was shown in the RT-PCR assay (Fig. 2), in the luciferase assay, the hBD-2-inducing factor activity in culture supernatant was heat-stable and proteinase-sensitive (Fig. 3).


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 3.   Stability of hBD-2-inducing factor in S. enteritidis culture supernatant assayed with luciferase as the reporter gene. hBD-2-inducing activity in Caco-2 cells was quantified by luciferase activity of pGL3-2110 (12)-transfected cells. The cells were incubated for 6 h with control TSB medium, S. enteritidis supernatant, heat-treated supernatant (10 min at 100 °C), or incubation for 2 h with 40 µg/ml trypsin or 200 µg/ml proteinase K (5), followed by heat treatment. Luciferase activity was then examined. Luciferase activity is reported relative to that of cells transfected with empty vector. Data are the means ± S.D. of values from three separate experiments with assays in duplicate.

Using the luciferase assay system, the hBD-2-inducing factor in S. enteritidis supernatant was purified by anion exchange and gel filtration chromatography (Fig. 4, A and B, and Table I). In pooled effluents from Superose 12, a single protein band of 53 kDa was seen by Coomassie Brilliant Blue staining after SDS-PAGE in 10% gel (Fig. 4C). The amino-terminal sequence of the 53-kDa protein, AQVINTNSLSLLTQNNLNK, is identical to that of flagella filament structural protein (FliC) of S. enteritidis. Consistent with this result, the 53-kDa protein reacted with anti-FliC peptide antibody (Fig. 4D).


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 4.   Purification of hBD-2-inducing factor from S. enteritidis culture supernatant. A, chromatography of ammonium sulfate-precipitated supernatant proteins on ResourceQ. Samples (<FR><NU>1</NU><DE>50</DE></FR> volume) of fractions (8 ml) were assayed for hBD-2-inducing activity. Activity is expressed relative to that of cells transfected with empty vector. B, pooled active fractions from ResourceQ anion exchange chromatography were subjected to gel filtration on Superose 12. Samples (<FR><NU>1</NU><DE>100</DE></FR> volume) of fractions (1 ml) were assayed for luciferase activity. C, SDS-PAGE analysis of fractions during purification-10% gel stained with Coomassie Brilliant Blue. Positions of molecular mass standards (Bio-Rad) are on the left. Lane 1, S. enteritidis culture supernatant (1 µg); lane 2, ammonium sulfate-precipitated sample (1 µg); lane 3, sample after ResourceQ anion exchange chromatography (1 µg); lane 4, purified hBD-2-inducing factor (500 ng) after gel filtration on Superose 12 (1 µg). D, Western blot of Superose 12-purified hBD-2-inducing factor (500 ng) reacted with anti-FliC peptide antibody. Shown is hBD-2 induction factor after SDS-PAGE in a 10% gel. Arrowhead indicates 53-kDa S. enteritidis FliC.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Purification of hBD-2-inducing factor in S. enteritidis culture supernatant

When pGL3-2110-transfected Caco-2 cells were incubated with FliC for 6 h before assay of the luciferase activity, inducing activity was concentration-dependent up to 0-0.1 µg/ml and was maximal with 0.1-10 µg/ml (data not shown).

Inhibition of hBD-2 induction by the 53-kDa protein or FliC with anti-FliC protein antibody confirmed that FliC is the hBD-2-inducing factor (Fig. 5A). Inhibitory effects of the two proteins on hBD-2-inducing activity in the luciferase assay were similarly relieved by antibody, consistent with the conclusion that the 53-kDa protein in S. enteritidis supernatant is FliC and functions as an hBD-2-inducing factor.


View larger version (14K):
[in this window]
[in a new window]
  		Fig. 5.   Effect of anti-FliC protein antibody on activity of FliC, 53-kDa protein, and S. enteritidis culture supernatant. A, samples (100 ng) of 53-kDa protein (open circle ) or FliC () were incubated with the indicated dilution of anti-FliC protein IgG in 1 ml of FCS-free DMEM for 1 h at 37 °C, and then added to pGL3-2110-transfected Caco-2 cells. After incubation for 6 h, hBD-2-inducing activity was determined by the luciferase reporter gene assay. Relative luciferase activity is shown. Data are means ± S.D. of values from three separate experiments with assays in duplicate. B, samples of S. enteritidis culture supernatant or control buffer (TSB) were incubated with or without anti-53-kDa protein IgG and then added to pGL3-2110-transfected Caco-2 cells to determine hBD-2 induction by luciferase reporter gene assay. Data are the means ± S.D. of values from three separate experiments with assays in duplicate.

To determine whether FliC is the major hBD-2-inducing factor in S. enteritidis culture supernatant, the effect of anti-FliC protein antibody on this activity was examined. As shown in Fig. 5B, the hBD-2-inducing activity was completely neutralized by anti-53-kDa protein (FliC) antibody, indicating that FliC is responsible for the hBD-2-inducing activity in culture supernatant.

FliC Expressed in E. coli (BL21) Causes hBD-2 Induction-- To clarify that FliC is really hBD-2-inducing factor in S. enteritidis culture supernatant, a FliC expression plasmid was constructed, and recombinant FliC was expressed in E. coli, BL21. As shown in Fig. 6A, the lysate with recombinant FliC but not control lysate has hBD-2-inducing activity in a dose-dependent manner.


View larger version (14K):
[in this window]
[in a new window]
  		Fig. 6.   Recombinant FliC produced by E. coli has hBD-2 induction activity in Caco-2 cells. A, lysate of control E. coli (BL21) (open circle ) or pET-FliC-transformed E. coli () were incubated with pGL3-2110-transfected Caco-2 cells to determine hBD-2 induction by the luciferase reporter gene assay. B, S. enteritidis FliC (open circle ) or purified recombinant FliC () were incubated with pGL3-2110-transfected Caco-2 cells to determine hBD-2 induction by luciferase reporter gene assay. Data are the means ± S.D. of values from three separate experiments with assays in duplicate.

When pGL3-2110-transfected Caco-2 cells were incubated with recombinant FliC or original FliC for 6 h before assay of luciferase activity, hBD-2-inducing activity exhibited concentration-dependent effects up to 0-0.1 µg/ml and was maximal with 0.1-10 µg/ml (Fig. 6B).

Gram-positive MSSA (ATCC25923) and its culture supernatant and E. coli BL21 strains and their supernatant did not activate the hBD-2 reporter gene in Caco-2 cells (data not shown).

These all results support the hypothesis that FliC is a major hBD-2-inducing factor in S. enteritidis culture supernatant.

Effect of Deletion or Mutation of NF-kappa B-binding Sequences in the hBD-2 Gene on FliC-Stimulation of Promoter Activity-- Recently, we reported that induction of hBD-2 mRNA by H. pylori is regulated by NF-kappa B (12). To determine FliC effects on hBD-2 mRNA may involve NF-kappa B activation, Caco-2 cells were transfected with different luciferase-reporter constructs and stimulated with FliC. FliC did not enhance luciferase activity in Caco-2 cells transfected with the control luciferase-reporter plasmid, pGL3 or of those transfected with pGL3-197, or pGL3-938mt (Fig. 7). It did increase activity of cells transfected with pGL3-2110, pGL3-938, pGL3-398, or pGL3-229 (Fig. 7), consistent with involvement of NF-kappa B in the induction of hBD-2 by FliC.


View larger version (16K):
[in this window]
[in a new window]
  		Fig. 7.   Effects of deletions and mutation in the NF-kappa B site of the hBD-2 promoter on response of Caco-2 cells to FliC. Luciferase reporter gene constructs of the hBD-2 promoter region with putative binding elements for NF-kappa B located at -208 to -199 are depicted diagrammatically on the left, with their activities in the luciferase assay on the right. Open bars represent activities without FliC incubation, and solid bars represent activities with FliC incubation. Data are the means ± S.D. of values from three separate experiments, with assays in duplicate.

FliC Activates NF-kappa B in Caco-2 Cells-- Binding of proteins to 18-base pair oligonucleotides, with a sequence corresponding to that of the NF-kappa B site at position -208 to -199 in the hBD-2 promoter region, was evaluated by electrophoretic mobility shift assay. Caco-2 cells were incubated with FliC, 100 ng/ml, for 0, 1, 3, 6, or 12 h. Specific DNA-protein complexes that bound NF-kappa B sequence were not observed in control cells (Fig. 8A). After incubation with FliC for 1 h, levels of complexes were increased, but they decreased with longer incubation. Addition of a 100-fold excess of unlabeled oligonucleotide with wild-type sequence, but not that with the mutated sequence, specifically decreased the amount of radiolabeled complex (Fig. 8A).


View larger version (62K):
[in this window]
[in a new window]
  		Fig. 8.   Effect of FliC on NF-kappa B-binding proteins. A, Caco-2 cells were incubated for the indicated time with FliC before preparation of nuclear extracts for gel retardation analysis using 32P-labeled double-stranded oligonucleotide with sequence of the NF-kappa B-binding site of the hBD-2 gene promoter. To test specificity of binding, a 100-fold excess of unlabeled wild-type (wt) (hBD-2 NF-kappa B) or mutant (mt) (hBD-2 NF-kappa B) oligonucleotide (Oligo) was added. B, nuclear extracts from cells incubated with FliC for 1 h were incubated without or with antibodies against the amino terminus of p65 or the carboxyl terminus of p65, p50, p52, RelB, or c-Rel before incubation with labeled oligonucleotide. Arrows indicate specific NF-kappa B complexes. Data are representative of those from three separate experiments.

Identification of NF-kappa B-binding Proteins in Nuclei of Caco-2 Cells Treated with FliC-- To identify proteins that bound to the NF-kappa B site, mobility shift assays were performed using antibodies raised against p65, p50, p52, c-Rel, and RelB proteins. As shown in Fig. 8B, in the presence of oligonucleotide with sequence of the NF-kappa B site in the hBD-2 promoter, p65-specific antibodies, but not several others, caused a marked supershift, suggesting that p65-p65 homodimer was a major component of the DNA-binding complex.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Unlike hBD-1, which is produced constitutively, hBD-2 is synthesized in response to bacterial infection or proinflammatory agonists, suggesting a role for hBD-2 in epithelial innate host defense (7, 16). The bacterial factors that induce hBD-2 in mammalian cells are still unclear, and the regulation of hBD-2 production in mammalian cells is poorly understood. For these reasons, we investigated hBD-2 induction by S. enteritidis in Caco-2 cells. Recently, O'Neil et al. (17) showed that S. dublin and enteroinvasive E. coli induced hBD-2 mRNA in Caco-2 or HT-29 cells. In agreement with those findings, hBD-2 mRNA was detected in cells and also in culture supernatant following incubation with several Salmonella species (S. typhimurium, S. enteritidis, S. typhi, and S. dublin) or their culture supernatants (Fig. 1). Similarly, hBD-2 mRNA induction in MKN45 cells by S. typhimurium, S. enteritidis, S. typhi, and S. dublin has been reported (9). Harder et al. (18) demonstrated that a mucoid phenotype of Pseudomonas aeruginosa, but not two nonmucoid P. aeruginosa strains, induced hBD-2 mRNA in cultured normal bronchial and tracheal, as well as in normal and CF (cystic fibrosis)-derived nasal epithelial cells.

In the present report, the hBD-2-inducing factor from S. enteritidis culture supernatant was purified and identified immunologically and by sequencing as FliC (flagella filament structural protein), the major flagella filament protein of S. enteritidis. FliC induced high levels of hBD-2 production in Caco-2 cells. Because hBD-2-inducing activity in S. enteritidis culture supernatant was completely neutralized by anti-FliC antibody (Fig. 5B), we concluded that FliC was the hBD-2-inducing factor in S. enteritidis culture supernatant.

Bacterial FliCs have been implicated in the production of cytokines. Purified phase I Salmonella flagellin and Salmonella FliC synthesized in E. coli each enhanced release of tumor necrosis factor alpha  and IL-1 from a human promonocytic cell line (19, 20). S. typhi flagella impaired antigen uptake and presentation by human macrophages (21) and induced a cytokine cascade in these cells (22). P. aeruginosa flagella mutants demonstrated reduced pathogenicity in the mouse pneumonia model, consistent with the observation that purified flagella can themselves produce pulmonary inflammation (23). FliC from enteroaggregative E. coli stimulated release of IL-8 from Caco-2 cells, and recombinant enteroaggregative E. coli FliC, synthesized in nonpathogenic E. coli, maintained its ability to induce IL-8 (24).

Recently, Gewirtz et al. (25) reported that S. typhimurium induced expression of IL-8 via Ca2+-mediated activation of the NF-kappa B pathway in epithelial cells. S. typhimurium invasion is not required for NF-kappa B activation in intestinal epithelial cells, although bacterial contact is necessary (26). The invasion-defective S. typhimurium mutant HilDelta , which lacks the type III secretion apparatus, was able to induce IL-8 in T84 cells. Thus, IL-8 induction was not dependent on the type III secretion system.

Because IL-8, tumor necrosis factor alpha , and IL-1 were induced in mammalian cells by bacterial FliC (19-24), we suspected that FliC acting through NF-kappa B might be responsible for hBD-2 induction. Activation of NF-kappa B by Gram-negative and Gram-positive cell wall components is well known, although whether FliC activated NF-kappa B was not shown. As shown here, NF-kappa B was activated by FliC, and only the p65-p65 NF-kappa B homodimer was shown to bind the hBD-2 promoter region. Thus, FliC can activate NF-kappa B in mammalian cells, and it appears to be responsible for a number of the critical effects of Salmonella on mammalian cells.2

    ACKNOWLEDGEMENT

We thank Dr. Martha Vaughan for helpful discussions and critical review of the manuscript.

    FOOTNOTES

* This work was supported by grants-in-aid from the Ministry of Education, Science, Sports and Culture of Japan.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

j To whom correspondence should be addressed. Tel.: 81-95-849-7831; Fax: 81-95-849-7805; Email: hirayama@net.nagasaki-u.ac.jp.

Published, JBC Papers in Press, May 31, 2001, DOI 10.1074/jbc.M011618200

2 During the revision of this report, Hayashi et al. (27) identified that the flagellins of Listeria monocytogenes and S. typhimurium are recognized by Toll-like receptor 5 (TLR5) in host mammalian cells.

    ABBREVIATIONS

The abbreviations used are: HD, human alpha -defensin; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hBD, human beta -defensin; IL, interleukin; NF-kappa B, nuclear factor-kappa B; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RT, reverse transcription; TBS, Tris-buffered saline; TSB, tryptic soy broth.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Harwig, S. S. L., Ganz, T., and Lehrer, R. I. (1994) Methods Enzymol. 236, 160-172
2. Jones, D. E., and Bevins, C. L. (1992) J. Biol. Chem. 267, 23216-23225
3. Jones, D. E., and Bevins, C. L. (1993) FEBS Lett. 315, 182-192
4. Svinarich, D. M., Wolf, N. A., Gomez, R., Gonik, B., and Romeo, R. (1997) Am. J. Obstet. Gynecol. 176, 470-475
5. Bensch, K. W., Raida, M., Magert, H. J., Schulz-Knappe, P., and Forssman, W. G. (1995) FEBS Lett. 368, 326-330
6. Zhao, C., Wang, I., and Lehrer, R. I. (1996) FEBS Lett. 396, 319-322
7. Harder, J., Bartels, J., Christophers, E., and Schroder, J. M. (1997) Nature 387, 86
8. Bals, R., Wang, X., Wu, Z., Freeman, T., Bafina, V., Zasloff, M., and Wilson, J. M. (1998) J. Clin. Invest. 102, 874-880
9. Wada, A., Mori, N., Oishi, K., Hojo, H., Nakahara, Y., Hamanaka, Y., Nakashima, M., Sekine, I., Ogushi, K., Niidome, T., Nagatake, T., Moss, J., and Hirayama, T. (1999) Biochem. Biophys. Res. Commun. 263, 770-774
10. Bäumer, A. J., Hargis, R. M., and Tsolis, R. M. (2000) Science 287, 50
11. Ward, L. R., Threlfall, J., Smith, H. R., and O'Brien, S. J. (2000) Science 287, 1753-1754
12. Wada, A., Ogushi, Kimura, T., Hojo, H., Mori, N., Suzuki, S., Kumatori, A., May, Se, Nakahara, Y., Nakamura, M., Joel, M., and Hirayama, T. (2000) Cell. Microbiol. 3, 115-123
13. Ohsaki, M., Urakawa, M., Niidome, T., and Aoyagi, H. (1999) Pept. Sci. 1998, 453-456
14. Ibrahim, G. F., Fleet, G. H., Lyons, M. J., and Walker, R. A. (1985) J. Clin. Microbiol. 22, 1040-1044
15. Vorderviszt, F., Kanto, S., Aizawa, S. I., and Namba, K. (1989) J. Mol. Biol. 209, 127-133
16. Singh, P. K., Jia, P. K., Wiles, K., Hesselberth, J., Liu, L., Conway, B. A. D., Greenberg, E. P., Valore, E. P., Welsh, M. J., Ganz, T., Tack, B. F., and McCray, P. B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14961-14966
17. O'Neil, D. A., Porter, E. M., Elewaut, D., Anderson, G. M., Eckmann, L., Ganz, T., and Kagnoff, M. F. (1999) J. Immun. 163, 6718-6724
18. Harder, J., Meyer-Hoffer, U., Teran, L. M., Schwichtenberg, L., Bartels, J., Maune, S., and Schroder, J.-M. (2000) Am. J. Respir. Cell Mol. Biol. 22, 714-721
19. Ciacci-Woolwine, F., Blomfield, I. C., Richardson, S. H., and Mizel, S. B. (1998) Infect. Immun. 66, 1127-1134
20. Ciacci-Woolwine, F., McDermott, P. F., and Mizel, S. B. (1999) Infect. Immun. 67, 5176-5185
21. Wyant, T. L., Tanner, M. K., and Sztein, M. B. (1999) Infect. Immun. 67, 1338-1346
22. Wyant, T. L., Tanner, M. K., and Sztein, M. B. (1999) Infect. Immun. 67, 3619-3624
23. Feldman, M., Bryan, R., Rajan, S., Scheffler, L., Brunnert, S., Tang, H., and Prince, A. (1998) Infect. Immun. 66, 43-51
24. Steiner, T. S., Nataro, J. P., Poteet-Smith, C. E., Smith, J. A., and Guerrant, R. L. (2000) J. Clin. Inv. 105, 1769-1777
25. Gewirtz, A. T., Rao, A. S., Simon Jr, P. O., Merlin, D., Carnes, D., Madara, J. L., and Neish, A. S. (2000) J. Clin. Inv. 105, 79-92
26. Eaves-Pyles, T., Szabo, C., and Salzman, A. L. (1999) Infect. Immun. 67, 800-804
27. Hayashi, F., Smith, K. D., Ozinsky, A., Hawn, T. R., Yi, E. C., Goodlett, D. R., Eng, J. K., Akira, S., Underhill, D. M., and Aderem, A. (2001) Nature 410, 1099-1103

Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 MicrobiologyHome page
K.-i. Uchiya and T. Nikai
Salmonella virulence factor SpiC is involved in expression of flagellin protein and mediates activation of the signal transduction pathways in macrophages
Microbiology, November 1, 2008; 154(11): 3491 - 3502.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C.-Y. Kao, C. Kim, F. Huang, and R. Wu
Requirements for Two Proximal NF-{kappa}B Binding Sites and I{kappa}B-{zeta} in IL-17A-induced Human {beta}-Defensin 2 Expression by Conducting Airway Epithelium
J. Biol. Chem., May 30, 2008; 283(22): 15309 - 15318.
[Abstract] [Full Text] [PDF]

Home page
 MicrobiologyHome page
S. M. Eswarappa, K. K. Panguluri, M. Hensel, and D. Chakravortty
The yejABEF operon of Salmonella confers resistance to antimicrobial peptides and contributes to its virulence
Microbiology, February 1, 2008; 154(2): 666 - 678.
[Abstract] [Full Text] [PDF]

Home page
 Innate ImmunityHome page
J. Harder, R. Glaser, and J.-M. Schroder
Review: Human antimicrobial proteins effectors of innate immunity
Innate Immunity, December 1, 2007; 13(6): 317 - 338.
[Abstract] [PDF]

Home page
 Infect. Immun.Home page
C. Adriaensen, H. De Greve, J. Q. Tian, S. De Craeye, E. Gubbels, V. Eeckhaut, F. Van Immerseel, R. Ducatelle, M. Kumar, and J.-P. Hernalsteens
A Live Salmonella enterica Serovar Enteritidis Vaccine Allows Serological Differentiation between Vaccinated and Infected Animals
Infect. Immun., May 1, 2007; 75(5): 2461 - 2468.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
M. Schlee, J. Wehkamp, A. Altenhoefer, T. A. Oelschlaeger, E. F. Stange, and K. Fellermann
Induction of Human {beta}-Defensin 2 by the Probiotic Escherichia coli Nissle 1917 Is Mediated through Flagellin
Infect. Immun., May 1, 2007; 75(5): 2399 - 2407.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
S. M. Ivison, N. R. Graham, C. Q. Bernales, A. Kifayet, N. Ng, L. A. Shobab, and T. S. Steiner
Protein Kinase D Interaction with TLR5 Is Required for Inflammatory Signaling in Response to Bacterial Flagellin
J. Immunol., May 1, 2007; 178(9): 5735 - 5743.
[Abstract] [Full Text] [PDF]

Home page
 J. Nutr.Home page
P. Winkler, D. Ghadimi, J. Schrezenmeir, and J.-P. Kraehenbuhl
Molecular and Cellular Basis of Microflora-Host Interactions
J. Nutr., March 1, 2007; 137(3): 756S - 772S.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
K. Ouhara, H. Komatsuzawa, H. Shiba, Y. Uchida, T. Kawai, K. Sayama, K. Hashimoto, M. A. Taubman, H. Kurihara, and M. Sugai
Actinobacillus actinomycetemcomitans Outer Membrane Protein 100 Triggers Innate Immunity and Production of {beta}-Defensin and the 18-Kilodalton Cationic Antimicrobial Protein through the Fibronectin-Integrin Pathway in Human Gingival Epithelial Cells
Infect. Immun., September 1, 2006; 74(9): 5211 - 5220.
[Abstract] [Full Text] [PDF]

Home page
 Appl. Environ. Microbiol.Home page
S. C. J. De Keersmaecker, K. Braeken, T. L. A. Verhoeven, M. Perea Velez, S. Lebeer, J. Vanderleyden, and P. Hols
Flow Cytometric Testing of Green Fluorescent Protein-Tagged Lactobacillus rhamnosus GG for Response to Defensins.
Appl. Envir. Microbiol., July 1, 2006; 72(7): 4923 - 4930.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Microbiol. Rev.Home page
V. Lievin-Le Moal and A. L. Servin
The Front Line of Enteric Host Defense against Unwelcome Intrusion of Harmful Microorganisms: Mucins, Antimicrobial Peptides, and Microbiota
Clin. Microbiol. Rev., April 1, 2006; 19(2): 315 - 337.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. Sharma, S. Tesfay, F. L. Tomson, R. P. Kanteti, V. K. Viswanathan, and G. Hecht
Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G685 - G694.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. Voss, J. Wehkamp, K. Wehkamp, E. F. Stange, J. M. Schroder, and J. Harder
NOD2/CARD15 Mediates Induction of the Antimicrobial Peptide Human Beta-defensin-2
J. Biol. Chem., January 27, 2006; 281(4): 2005 - 2011.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
Y. S. Lopez-Boado, L. M. Cobb, and R. Deora
Bordetella bronchiseptica Flagellin Is a Proinflammatory Determinant for Airway Epithelial Cells
Infect. Immun., November 1, 2005; 73(11): 7525 - 7534.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. T. Abreu, M. Fukata, and M. Arditi
TLR Signaling in the Gut in Health and Disease
J. Immunol., April 15, 2005; 174(8): 4453 - 4460.
[Abstract] [Full Text] [PDF]