HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 276, Issue 33, 30766-30772, August 17, 2001

This Article Abstract Full Text (PDF) All Versions of this Article: 276/33/30766    most recent M104039200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hohl, M. Articles by Fleck, O. Search for Related Content PubMed PubMed Citation Articles by Hohl, M. Articles by Fleck, O. Social Bookmarking                      What's this?

Binding and Repair of Mismatched DNA Mediated by Rhp14, the Fission Yeast Homologue of Human XPA^*

Marcel Hohl^§¶, Olaf Christensen^§, Christophe Kunz, Hanspeter Naegeli^**, and Oliver Fleck

From the  Institute of Cell Biology, University of Bern, Baltzerstrasse 4, CH-3012 Bern and the ^** Institute of Pharmacology and Toxicology, University of Zürich-Tierspital, August Forel-Strasse 1, CH-8008 Zürich, Switzerland

Received for publication, May 4, 2001, and in revised form, June 8, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Rhp14 of Schizosaccharomyces pombe is homologous to human XPA and Saccharomyces cerevisiae Rad14, which act in nucleotide excision repair of DNA damages induced by ultraviolet light and chemical agents. Cells with disrupted rhp14 were highly sensitive to ultraviolet light, and epistasis analysis with swi10 (nucleotide excision repair) and rad2 (Uve1-dependent ultraviolet light damage repair pathway) revealed that Rhp14 is an important component of nucleotide excision repair for ultraviolet light-induced damages. Moreover, defective rhp14 caused instability of a GT repeat, similar to swi10 and synergistically with msh2 and exo1. Recombinant Rhp14 with an N-terminal hexahistidine tag was purified from Escherichia coli. Complementation studies with a rhp14 mutant demonstrated that the tagged Rhp14 is functional in repair of ultraviolet radiation-induced damages and in mitotic mutation avoidance. In bandshift assays, Rhp14 showed a preference to substrates with mismatched and unpaired nucleotides. Similarly, XPA bound more efficiently to C/C, A/C, and T/C mismatches than to homoduplex DNA. Our data show that mismatches and loops in DNA are substrates of nucleotide excision repair. Rhp14 is likely part of the recognition complex but alone is not sufficient for the high discrimination of nucleotide excision repair for modified DNA.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In the course of nucleotide excision repair (NER)¹ of damaged bases, a preincision complex is assembled at the lesion. This complex contains XPA, RPA, XPC, hHR23B, and TFIIH in humans and homologous proteins in other eukaryotes (1-3). Subsequently, the damaged base is released from DNA in a 24-32-nucleotide-long oligomer after dual incision by XPG, incising 3' to the lesion, and ERCC1-XPF, incising 5' to the lesion. Finally, repair is completed by resynthesis of the gap and ligation. It is not exactly known whether one of the components of the preincision complex is the first damage recognition factor or whether the entire preincision complex is required. Specific binding to damaged DNA has been reported for XPA, RPA, and XPC (4-11). However, the single proteins as well as the complexes XPA-RPA and XPC-hHR23B exhibit only a moderate preference for damaged DNA. Thus, these factors likely contribute to recognition of damaged DNA but alone might not be sufficient for a high discrimination.

NER is able to repair a variety of bulky DNA adducts, like (6-4)photoproducts and cyclobutane pyrimidine dimers induced by UV radiation, intrastrand cross-links produced by cis-diamine-dichloroplatinum(II), and adducts formed by carcinogens such as benzo[a]pyrene diol epoxide (1, 12-14). In addition, nonbulky lesions such as methylated bases and apurinic/apyrimidinic sites and to a low level even G/A and G/G base-base mismatches are processed by NER (1, 12). In general, DNA that contains a lesion and some degree of helical distortion is processed more efficiently by NER than lesions without helical distortions or distortions alone (15-18).

Although NER incises mismatch-containing DNA rather poorly in vitro (12, 15-17), there is some evidence that NER factors have a function in correction of mismatched bases. Several mutations in the Saccharomyces cerevisiae gene RAD3, encoding a homologue of human XPD, cause increased spontaneous mutation rates (19, 20). A mutated mei-9 of Drosophila melanogaster, encoding a homologue of human XPF, results in increased postmeiotic segregation of genetic markers (21, 22). Elevated postmeiotic segregation frequencies are the consequence of non-repaired mismatches formed in heteroduplex DNA during meiotic recombination. In vitro mismatch correction is reduced in protein extracts of a Drosophila mei-9 mutant (23). Mutations in the Schizosaccharomyces pombe NER genes swi10 (ERCC1 homologue), rad16 (XPF homologue), and rhp14 (XPA homologue) cause a defect in repair of base-base mismatches, arising during vegetative growth and meiotic recombination (24).

This study intended to extend the analysis on mismatch correction by NER factors. We report the characterization of the fission yeast S. pombe Rhp14 with respect to its function in DNA repair. A rhp14 gene disruption mutant was constructed and tested for sensitivity to UV light and for stability of a GT repeat. In addition, recombinant Rhp14 was purified and analyzed for its capacity to bind to base-base mismatches and small loops.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

S. pombe Strains-- S. pombe strains were derived either from Ru39 (h^- msh2::his3⁺ his3-D1) (25), SK15 (h⁹⁰ swi10::ura4⁺ ura4-D18) (26), OL455 (h^- swi10::kanMX his3-D1 leu1-32 ura4-D18),² sp217 (h^- rad2::ura4⁺ ade6-704 leu1-32 ura4-D18) (27), OL142 (h⁺ cmb1::his3⁺ his3-D1) (28), Ru42 (h^- exo1::ura4⁺ ura4-D18) (29, 30), or OL456 (h^- rhp14::kanMX his3-D1 leu1-32 ura4-D18; this study). The ade6-485 mutation was described by Schär and Kohli (31) and ade6-[(GT)₈-1397] by Mansour et al. (32).

OL456 was constructed by transforming MAB031 (h his3-D1 leu1-32 ura4-D18) with a polymerase chain reaction (PCR) fragment containing the kanMX cassette flanked by sequences homologous to the 5'- and 3'-flanking sites of the rhp14⁺ gene. The PCR fragment was obtained with primers DR14-5, 5'-TCATTTCTAACAATAGCCATTCTCATTTTGGATTATTATTTGATTTTTTGAATTATCATACTAGGGAAATAAAATAAAAAAACTTCCGTACGCCAGCTGAAGCTTCGTAC-3', and DR14-3b, 5'- ACCCGATTTTTGAAGAAATCTGATAGCATTTACATTGAAAAAAGTTAGGTGTGCAAATCCAAAGTCTAAAAAACAAAGACCATCGATGAATTCGAGCTCG-3'. PCR included 20 pmol of each of the two primers, 5 units of Taq polymerase, 0.15 mM each dNTP and ~50 ng of pFA6a-kanMX6 (33) as template in a standard reaction buffer (Amersham Pharmacia Biotech). Conditions were as follows: 5 min 94 °C; 3 cycles with 45 s at 94 °C, 45 s at 45 °C, 2 min at 72 °C; 30 cycles at 94 °C, 45 s at 55 °C, 2 min at 72 °C, and a final 10-min step at 72 °C.

S. pombe Media-- S. pombe media YEA (yeast extract agar, complete medium), YEL (yeast extract liquid), MEA (malt extract agar, sporulation medium), and MMA (minimal medium) were prepared as described (34, 35). EMM (Edinburgh minimal medium) without thiamine (36) was used for expression of rhp14 and inserted in derivatives of pREP42 or pREP82 (see below). In these vectors rhp14 is under the control of the nmt promoter, which is transcribed in the absence of thiamine (37, 38).

Expression and Purification of His₆-Rhp14 from E. coli-- The rhp14⁺ gene was amplified by PCR with primers ER14-5, 5'-CACCATATGGAAAATTCGTCAATTGTC-3', and ER14-3, 5'-GTGGGATCCTTAAATTTCCAGCTGCTCAA-3' and genomic S. pombe DNA as template in a standard reaction buffer containing 10 pmol of each of the primers, 0.1 mM each dNTP, 5 units of Taq polymerase (Amersham Pharmacia Biotech). Amplification was done by 5 min 94 °C, 30 cycles of 45 s 94 °C, 45 s 47 °C, 1 min 72 °C, and a final 10-min step at 72 °C. The PCR fragment was digested with NdeI/BamHI and ligated with digested pET28c (Novagen). Plasmids containing rhp14⁺ fused to a His₆ tag at the 5' end were identified by restriction digests and checked for mutations by DNA sequencing.

For expression, the plasmid pET28c-His₆Rhp14 was transformed into Escherichia coli strain BL21/DE3. One liter of LB medium containing kanamycin (30 mg/l) was inoculated with a 25-ml stationary phase culture and incubated at 37 °C until an A₆₀₀ of about 0.8 was reached. Isopropylthio--D-galactoside (1 mM) and ZnCl₂ (10 µM) were added, and incubation was continued for 4 h at 25 °C. Cells were harvested by a 7-min centrifugation at 8300 × g and suspended in 30 ml of buffer K (50 mM K₂HPO₄, pH 8.0, adjusted with KH₂PO₄ at room temperature, 100 mM KCl, 10% glycerol (v/v), 0.1 mM phenylmethylsulfonyl fluoride, 5 mM -mercaptoethanol). Cells were shock-frozen in liquid nitrogen and were allowed to thaw on ice overnight.

For preparation of crude protein extracts, cells were sonicated on ice by 10 30-s intervals, with at least 2 min of cooling on ice between each interval. Subsequently, the supernatant (116 mg of protein in 24 ml) was separated by centrifugation for 20 min at 10,000 × g and 4 °C. The supernatant was loaded at a flow rate of 2.3 ml/h on a Ni-NTA-agarose column (Qiagen, 0.2 cm² × 6 cm) previously equilibrated with buffer K. After washing with buffer K, bound proteins were eluted by a 40-ml gradient of 0-70 mM imidazole in buffer K. His₆-Rhp14 started to elute at ~50 mM imidazole. Later fractions (~60-70 mM imidazole), containing His₆-Rhp14 but only low amounts of contaminating E. coli proteins, were pooled (3.2 mg in 4 ml), dialyzed against buffer K, and loaded at a flow rate of 7 ml/h on a double-stranded DNA cellulose column (U. S. Biochemical Corp., 0.64 cm² × 4.7 cm). After washing with buffer K, bound proteins were eluted by a 50-ml gradient of 100-600 mM KCl in buffer K. Most of the His₆-Rhp14 protein eluted between 100 and 160 mM KCl. In these fractions, no other proteins were detectable on 12% SDS-polyacrylamide gels stained either with Coomassie Blue (Fig. 4) or with silver nitrate (data not shown). Fractions were pooled and dialyzed against buffer K containing 50% (v/v) glycerol. Dialyzed fractions (1 mg of protein in 1.8 ml) were stored in aliquots at 20 °C.

His₆-Rhp14 was detected by a Western blot according to the instructions of the manufacturer using mouse penta-His antibody (Qiagen) and horseradish peroxidase-conjugated anti-mouse IgG (DAKO, Denmark) as secondary antibody.

Preparation of S. pombe Crude Protein Extracts-- S. pombe strains were grown to stationary phase in 1 liter YEL, harvested by centrifugation, washed with 15 ml of buffer A (25 mM Tris-HCl (pH 7.5, adjusted at room temperature), 150 mM NaCl, 1 mM EDTA, 0.5 mM spermidine, 5 mM -mercaptoethanol, 0.1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol), and suspended in the same buffer. Aliquots (1 g cells/2 ml) were shock-frozen in liquid nitrogen and stored at 70 °C.

For preparation of crude protein extracts, cells were thawed on ice, mixed with an equal volume of glass beads, and disrupted in a Fastprep FP 120 (Savant Instruments, Inc.) by eight 30-s intervals, with 1 min of cooling on ice between each interval. Proteins in the supernatant were removed from cell debris after 20 min of centrifugation at 4 °C.

Bandshift Analysis-- Oligonucleotides were 5' end-labeled by T4 polynucleotide kinase (MBI Fermentas) in the presence of [-³²P]ATP and separated from unreacted ATP using Sephadex G-25 (Amersham Pharmacia Biotech). Oligonucleotides were annealed with the complementary strands in 10 mM Tris-HCl (pH 8.0), 10 mM MgCl₂, 80 mM NaCl by heating to 80 °C and slow cooling to room temperature. Oligonucleotides were in the sequence context of either M13mp9 (39) or ade6-485 (Fig. 1).

View larger version (15K): [in this window] [in a new window]   Fig. 1.   Substrates used to test DNA binding by bandshift assays. Substrates were in the context of ade6-485 (31). Complementary oligonucleotides were combined by annealing resulting in double-stranded DNA with defined base-base mismatches, unpaired nucleotides, or correctly paired bases at the position X/Z, the site of the 485 mutation (a C to G transversion).

Bandshift assays with S. pombe extracts (~50 µg of protein) were performed in 20-µl reactions containing 20 fmol of radiolabeled substrate, a 40-fold excess of unlabeled homoduplex DNA as competitor, 25 mM Tris-HCl (pH 7.5), 100 mM NaCl, 25 mM KCl, 0.01 mM ZnCl₂, 0.5 mM dithiothreitol, 4 mM spermidine, and 10% glycerol (v/v). Bandshift assays with His₆-Rhp14 (0.5-0.75 µg), purified from E. coli, were performed in 20-µl reactions containing 40 fmol of radiolabeled substrate, a 60-fold excess of unlabeled competitor, 25 mM Tris-HCl (pH 7.5), 50 mM KCl, 0.01 mM ZnCl₂, 0.5 mM dithiothreitol, 4 mM spermidine, 10% glycerol, and 1 µg of bovine serum albumin. Bandshift assays with purified XPA (0.4 µg) were performed in 20-µl reactions, containing 20 fmol of radiolabeled substrate, a 40-fold excess of unlabeled homoduplex, 25 mM Tris-HCl (pH 7.5), 25 mM KCl, 0.01 mM ZnCl₂, 0.5 mM dithiothreitol, 4 mM spermidine, and 10% glycerol.

Reactions including S. pombe crude extracts were incubated for 20 min at 4 °C and subsequently loaded on 6% non-denaturing polyacrylamide gels. Reactions with purified His₆-Rhp14 or XPA were incubated for 30 min at 4 °C and loaded on 5% non-denaturing polyacrylamide gels. Electrophoresis was performed in 40 mM Tris acetate (pH 7.5) at 90 V and 4 °C. XPA with an N-terminal His₆ tag was purified as described previously (5).

For quantification of DNA binding, gels were exposed to a PhosphorImager and subsequently analyzed using ImageQuant software (Molecular Dynamics). The percentage of bound substrate was calculated from the intensity of shifted bands relative to the sum of bound and free radioactively labeled oligonucleotides. A reaction mix without protein was loaded on the gels to normalize the background level of radioactivity at the position of the shifted bands in protein-containing reactions as well as to serve as a control for estimation of the total amount of substrates (see Fig. 6A, lane 1). A smear in the gels between free and bound substrates was usually detected when reactions contained either Rhp14 or XPA. The smear likely reflects loss of protein-DNA interaction during electrophoresis and was not included in the calculation.

Construction of Plasmids for Expression of Rhp14 in S. pombe-- In a first step pREP42 and pREP82 (38) derivatives were constructed, which contain the polylinker 5'-CATATGGCCATGGCTAGCCCTCGAGGTCGACATGCATGGATCCCCGGG-3', harboring the restriction sites NdeI-NcoI-NheI-XhoI-SalI-NsiI-BamHI-SmaI, resulting in pREP42L and pREP82L. Subsequently, the 0.9-kilobase pair NcoI-BamHI fragment from pET28c-His₆Rhp14 was ligated with digested pREP42L or pREP82L, resulting in pHis₆Rhp14 plasmids. In these plasmids, the rhp14 gene is under control of the nmt promoter and, as in pET28c-His₆Rhp14, expressed as a fusion protein with an N-terminal His tag. pRhp14 derivatives, expressing Rhp14 without His tag, were obtained after digestion of pHis₆Rhp14 plasmids with NdeI and religation. Plasmids were transformed into S. pombe strains PRS69 (h^- ura4-D18 ade6-485) and OL549 (h^- rhp14::kanMX ura4-D18 ade6-485). For expression of Rhp14, transformants were propagated in EMM liquid medium supplemented with adenine (100 mg/liter).

UV Sensitivity Tests-- For quantitative determination of survival of UV-irradiated cells (Fig. 2), strains were grown in YEL to stationary phase at 30 °C, and appropriate dilutions were plated on YEA. Cells were irradiated in a UV Stratalinker (Stratagene) and incubated for 5 days at 30 °C. Survival was determined from the number of cells able to grow to colonies relative to unirradiated controls.

View larger version (19K): [in this window] [in a new window]   Fig. 2.   UV sensitivity of NER and rad2 mutants. Strains were irradiated with the indicated UV doses, and cell survival was determined after 5 days of growth by the ability of cells to form colonies. Data are mean values and standard deviations from three experiments. Strains were wild type (), rad2 (), rhp14 (), swi10 (), rhp14 swi10 (), and rhp14 rad2 ().

For the complementation test (Fig. 5A), strains were grown to stationary phase in liquid EMM supplemented with adenine (100 mg/liter). 10 µl of serial 1:10 dilutions were dropped on EMM + adenine. Plates were UV-irradiated (20-100 J/m²) in a UV Stratalinker (Stratagene) and incubated together with an unirradiated control plate for 3 days at 30 °C.

Determination of Mitotic Mutation Rates-- Reversion rates per cell division were calculated from the median number of Ade⁺ per total cell number of cultures (40). For fluctuation tests, either ade6-(GT)₈ or ade6-485 was used. The ade6-(GT)₈ allele represents a (GT)₈ repeat, which was constructed by insertion of seven GT units at an existing GT site (32). Nine colonies grown on YEA were each inoculated in 5 ml of YEL and grown to stationary phase. Appropriate amounts were plated on MMA for selection of revertants and on MMA supplemented with adenine for determination of cell titers. Plates were incubated for 7 days at 30 °C.

Determination of reversion rates of 485 (a C to G transversion) was carried out with wild type (h ura4-D18 ade6-485) containing empty vector (pREP42L or pREP82L) and with an rhp14 mutant (h rhp14::kanMX ura4-D18 ade6-485) transformed with empty vector, pRhp14, or pHis₆Rhp14. Nine colonies, grown on EMM supplemented with adenine, were inoculated in 5 ml of liquid EMM (+ adenine) and grown to stationary phase. Cells were harvested by centrifugation, suspended in 600 µl of 0.85% NaCl, and plated on EMM. Appropriate dilutions were plated on EMM (+ adenine) for cell titer determination. Plates were incubated for 12 days at 30 °C. For each strain background, experiments were carried out at least three times.

Identification of Deletions and Insertions in the (GT)₈ Repeat-- Mutational changes in the (GT)₈ repeat were determined by DNA sequencing of PCR products and by visual inspection of colony colors as described (32). Revertants with deletions of GT units, which retain the open reading frame of ade6 ((GT)₄ or (GT)₇), form white colonies, whereas revertants with insertion of four nucleotides ((GT)₁₀) form pink colonies. Other repeat tract changes were not identified by DNA sequencing (Ref. 32 and data not shown).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Rhp14 Is Involved in the NER Pathway for UV-induced Damages-- The S. pombe rhp14 gene was identified by the S. pombe Genome Sequencing Project (www.sanger.ac.uk/Projects/S_pombe/). The deduced amino acid sequence shows 33% identity to human XPA and 39% identity to Rad14 of S. cerevisiae, which are involved in the damage recognition step of NER (1-3). An rhp14 gene disruption strain was constructed as described under "Experimental Procedures" and was tested for cell survival after irradiation with different doses of UV light (Fig. 2). rhp14 cells were highly sensitive to UV light, to a similar extent as swi10, defective in the NER 5'-endonuclease (26, 41, 42), and somewhat more affected than rad2 cells, defective in the second Uve1-dependent pathway for repair of UV damages in S. pombe (43, 44). The rhp14 swi10 double mutant showed similar sensitivity to UV as either single mutant, whereas the rhp14 rad2 double mutant was clearly more sensitive (Fig. 2). Thus, Rhp14 is an important factor of NER of UV-induced damages but is not a component of the Uve1-dependent pathway.

GT Repeat Stability Is Affected in the rhp14 Mutant-- The long-patch mismatch repair (MMR) system of S. pombe efficiently corrects base-base mismatches, except C/C, as well as one to several unpaired nucleotides (24, 25, 30-32, 35, 45). A genetic test system was developed that allows measuring instability of GT repeats (32). Loss of MMR by a mutation in msh2, msh6, or pms1 resulted in dramatically increased instability of GT repeats. Exo1 is likely involved in MMR-dependent repair of base-base mismatches (29, 30) but has only a minor and rather MMR-independent function in GT repeat stability (32).

It has been shown previously that NER factors of S. pombe are involved in MMR-independent short-patch repair of base-base mismatches arising during meiotic recombination and vegetative growth (24). Here we tested the consequences of mutations in the NER factors rhp14 and swi10 on Ade⁺ reversions of a (GT)₈ repeat introduced into the ade6 gene. In addition, epistasis analysis, including msh2 and exo1, was performed (Table I). ade6-(GT)₈ originated from an insertion of seven GT units at an existing GT site and thus represents a frameshift mutation causing adenine auxotrophy (32). Reversions to Ade⁺, which restore the reading frame, can either occur by deletions of 2 or 8 bp (1 or 4 GT units) or by insertions of 4 bp (two GT units).

In repair-proficient wild type a reversion rate of 3 × 10⁹ was measured (Table I). With a 1.8 × 10⁴-fold increased rate, the (GT)₈ repeat was highly destabilized in the msh2 mutant, as expected from the previous study (32). Reversion to Ade⁺ occurred 12 times more frequently in exo1 cells than in wild type. A similar increase was found with the NER mutants rhp14 and swi10. Compared with respective single mutants, a further increase of reversion rates was found in the double mutants msh2 rhp14, msh2 swi10, rhp14 exo1, and swi10 exo1, but not with rhp14 swi10. Thus, Rhp14 and Swi10 act in the same pathway for maintaining GT repeat stability and independent of Msh2 and Exo1.

The relative distribution of deletions versus insertions of GT units can be easily determined by inspection of the colony color of revertants (32). As confirmed by DNA sequencing, revertants forming white colonies contain (GT)₄ or (GT)₇ repeats (deletion of 8 and 2 bp, respectively), whereas revertants forming pink colonies contain a (GT)₁₀ repeat (insertion of 4 bp). In wild type and the exo1 mutant, most of the Ade⁺ revertants were pink and thus originated from 4-bp insertions (Table II). In contrast, almost all of the revertants in msh2 background produced white colonies (Table II), and sequencing of 11 of them exclusively identified a (GT)₇ repeat and thus a 2-bp deletion (32). In rhp14 and swi10 mutants, about 70% of revertants formed pink colonies. Thus, (GT)₈ mainly reverted to Ade⁺ by insertions of 4 bp (Table II). Among the white revertants, both (GT)₄ and (GT)₇ repeats were identified by sequencing (data not shown). Thus, the mutation spectra of rhp14 and swi10 are similar to that of wild type.

C/C Mismatch Binding by Cmb2 Is Not Affected in rhp14 Cells-- Since Rhp14 of S. pombe is a component of MMR-independent repair of mismatched DNA (Ref. 24 and this study), it is conceivable that Rhp14 specifically recognizes mismatched or unpaired nucleotides. The defect in correction of base-base mismatches in NER mutants is most pronounced for C/C mismatches, which are not substrates of MMR (24, 30, 31). The Cmb1 protein was recently identified as a recognition factor for C/C and other cytosine-containing mismatches (28). In crude protein extracts of a cmb1 disruption strain, binding to cytosine-containing mismatches was abolished, with the exception of C/C, where some binding was still detected. The gene encoding the second C/C binding activity, Cmb2, was not yet identified. Therefore, we started our mismatch binding studies on Rhp14 with the analysis of the C/C binding capacity of crude extracts of rhp14 mutants, either additionally mutated in cmb1 or not (Fig. 3). In crude extracts of wild type cells, specific binding to C/C and T/C was detectable. In cmb1 cells, binding to C/C by Cmb2 remained. Binding by either Cmb1 or Cmb2 was not affected in rhp14 extracts, and C/C binding by Cmb2 was still present in extracts of the rhp14 cmb1 double mutant. Thus, Cmb2 is not encoded by the rhp14 gene.

View larger version (97K): [in this window] [in a new window]   Fig. 3.   Mismatch binding in crude extracts of S. pombe strains. Specific binding to C/C and T/C is detectable in extracts from wild type and rhp14 cells (marked with an arrow). Deletion of cmb1 abolished binding to T/C but not of binding to C/C by Cmb2. This activity is also present in rhp14 cmb1 extracts, demonstrating that Cmb2 is not encoded by rhp14. Oligonucleotides were in the M13mp9 context (39). Conditions of the bandshift assay are described under "Experimental Procedures."

Purification of Recombinant Rhp14 from E. coli-- The rhp14 gene was overexpressed in E. coli BL21/DE3 as a fusion protein with an N-terminal His₆ tag as described under "Experimental Procedures." His₆-Rhp14 was purified by chromatography through binding on Ni-NTA agarose and double-stranded DNA-cellulose columns (see under "Experimental Procedures"). His₆-Rhp14 started to elute from the Ni-NTA-agarose column in the presence of ~50 mM imidazole together with five additional peptides in considerable amounts. In later fractions, which eluted by ~60-70 mM imidazole, His₆-Rhp14 was still present in high amounts, whereas the E. coli proteins were at much lower concentrations. Rhp14 in the later fractions was successfully separated from the remaining proteins using a double-stranded DNA cellulose column (Fig. 4A). The E. coli proteins were detected in the flow-through fractions, whereas most of Rhp14 bound to the column and eluted in the presence of ~100-160 mM NaCl. That the purified protein was indeed His₆-Rhp14 was proved by a Western using a His tag-specific antibody as probe (Fig. 4B).

View larger version (46K): [in this window] [in a new window]   Fig. 4.   Purification of His6-Rhp14 from E. coli. A, Coomassie-stained 12% SDS-polyacrylamide gel containing fractions passed through a double-stranded DNA cellulose column. The position of His6-Rhp14 is marked by an arrow. M, broad range marker (Bio-Rad) with numbers presenting sizes in kDa. Load, sample of the pooled fractions of proteins that eluted from the Ni-NTA column and that were loaded on the double-stranded DNA-cellulose column. FT, flow-through, containing proteins not bound to the column. B, Western blot of samples containing pooled fractions 5-10 shown in A. Different amounts of protein were used as indicated and were probed with penta-His antibody. E. coli, crude extracts of the E. coli strain BL21/DE3 not containing Rhp14.

His₆-Rhp14 Is Active in DNA Repair in Vivo-- To test whether the His₆ tag interferes with the function of Rhp14, complementation of DNA repair defects caused by mutated rhp14 was studied. Therefore, an S. pombe rhp14 mutant strain was transformed with plasmids derived from pREP42L either containing rhp14 (pRhp14) or tagged rhp14 (pHis₆Rhp14). As controls wild type and rhp14 strains were transformed with the empty vector pREP42L. Both complementation of UV sensitivity and of increased mitotic mutation rates were tested.

The rhp14 mutant containing pREP42L (Fig. 5A) or pREP82L (data not shown) was extremely sensitive to UV light. When transformed either with pRhp14 or pHis₆Rhp14, survival rates were retained to ~40% that of wild type cells. That the defect in damage repair was not completely compensated is likely due to negative effects of overexpressed Rhp14, which is under control of the strong nmt promoter (37, 38). However, because no difference to cells containing untagged Rhp14 was found, it is likely that His₆-Rhp14 is fully active in UV damage repair in vivo. In addition, increase of the reversion rate at the ade6-485 locus, caused by mutated rhp14, was completely compensated by pHis₆Rhp14 (Fig. 5B). Thus, His₆-Rhp14 is also functional in mismatch correction.

View larger version (43K): [in this window] [in a new window]   Fig. 5.   His6-tagged Rhp14 is active in DNA repair in vivo. A, complementation of UV sensitivity of defective rhp14 by plasmids expressing Rhp14 or His6-tagged Rhp14. Wild type and rhp14 strains containing the indicated plasmids were serially diluted, and drops containing ~105, 104, 103, and 100 cells were spotted on EMM plates. Plates were irradiated with 0, 20, 50, or 100 J/m2 and were incubated for 3 days at 30 °C. Shown are the unirradiated control and the plate irradiated with 50 J/m2. B, complementation of the mutator effect of defective rhp14 by plasmids expressing Rhp14 or His6-tagged Rhp14. Wild type and rhp14 strains containing the indicated plasmids were tested for reversion rates of the ade6 allele 485. Columns represent mean values of reversion rates to Ade+ per 109 cell divisions with standard deviations.

Binding of Rhp14 to Base-Base Mismatches and DNA Loops-- Rhp14 is based on its homology to XPA and Rad14, likely involved in the recognition step of NER, and might therefore have some preference in binding to modified over homoduplex DNA. In addition, Rhp14 is required for mismatch correction (see Ref. 24 and Fig. 5B) and to some degree for GT repeat stability (Table I). Therefore, we tested whether purified Rhp14 can specifically bind to substrates containing base-base mismatches or unpaired nucleotides by a bandshift assay. The oligonucleotides were in the sequence context of ade6-485 (see Fig. 1), which is known to be substrate of NER in vivo (24). Substrates containing C/T, C/C, or C/ mismatches were about two times better bound than homoduplex DNA (Fig. 6). A similar affinity was found for T/G and T/T (data not shown), whereas binding to C/A was only slightly stronger and not significantly different to homoduplex binding.

View larger version (24K): [in this window] [in a new window]   Fig. 6.   Binding of Rhp14 to mismatched DNA. A, binding of Rhp14 to homoduplex DNA and to the mismatches C/A, C/T, C/C, and C/ was tested by a bandshift assay as described under "Experimental Procedures." In the 1st lane, a reaction mix containing C/ substrate without Rhp14 was loaded. Substrates were in the ade6-485 context (Fig. 1). The position of the Rhp14-DNA complex is indicated by an arrow. B, quantitative expression of DNA binding by Rhp14. Columns represent the mean percentages of bound substrates with standard deviations, which were calculated from three bandshift gels.

Rhp14 also showed increased affinity to substrates containing loops with one, two, or four nucleotides (Fig. 7). Tendentiously, the loops with four unpaired nucleotides (GTGT and ACAC) were bound stronger than loops with two (GT and AC) or one unpaired nucleotide.

View larger version (56K): [in this window] [in a new window]   Fig. 7.   Binding of Rhp14 to DNA loops. A, binding of Rhp14 to homoduplex DNA (:) and to substrates containing one (/C, /G, /A, /T), two (GT/, /AC), or four ((GT)2/, /(AC)2) unpaired nucleotides. Substrates were in the ade6-485 context (Fig. 1). The position of the Rhp14-DNA complex is indicated by an arrow. B, quantitative expression of DNA binding by Rhp14. Columns represent the mean percentages of bound substrates from three bandshift gels with standard deviations.

Binding of Human XPA to Base-Base Mismatches-- Since NER in S. pombe is involved in MMR-independent mismatch correction (24) and because Rhp14 showed some specific affinity to mismatched DNA (Fig. 6), we were interested to know whether mismatch processing by NER is a general feature in eukaryotes. Therefore, we tested the ability of human XPA to recognize base-base mismatches (Fig. 8). Compared with homoduplex DNA, increased binding was observed with substrates containing a C/C, A/C, or T/C mismatch. These data indicate that mismatches are specifically recognized by XPA. Similar to Rhp14, only a slightly higher affinity than to homoduplex DNA was detected.

View larger version (67K): [in this window] [in a new window]   Fig. 8.   Binding of human XPA to mismatched DNA. Bandshift assays were performed as described under "Experimental Procedures." Substrates were in the M13mp9 context (39). The position of the XPA-DNA complex is marked by an arrow. Percentage of binding is given below the gel as average of two experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

This study reports the characterization of Rhp14 with respect to its function in repair of UV damages and mismatched DNA, as well as its ability to bind specifically to base-base mismatches and small insertion/deletion loops. Rhp14 is, based on its homology to human XPA and S. cerevisiae Rad14, likely involved in the recognition step of NER.

In the initial experiment we found that the rhp14 mutant was as sensitive to UV light as the swi10 mutant, defective in the NER 5'-endonuclease, and UV sensitivity was not further increased in the rhp14 swi10 double mutant (Fig. 2). Thus, Rhp14 plays indeed an important role in NER. Consistently, the rhp14 rad2 mutant was more sensitive to UV than either single mutant, showing that Rhp14 is not involved in the Uve1-dependent pathway.

Since NER factors in S. pombe have an MMR-independent role in repair of base-base mismatches (24), we analyzed the effects of mutated rhp14 and swi10 on the stability of a GT repeat, a common type of microsatellite in eukaryotic genomes. Reversions of the (GT)₈ repeat occurred with high frequency in msh2 cells, defective in MMR (Table I). Compared with wild type, about 12-14-fold increased reversion rates were observed with exo1, rhp14, and swi10 mutants. Epistasis analysis with double mutants revealed that Rhp14 and Swi10 act in the same pathway for maintaining GT repeat stability and distinct from Msh2 and Exo1. The distribution of insertions and deletions of GT units was similar to that of wild type (Table II), whereas in the msh2 mutant, most reversions occurred by deletion of 2-bp (see Ref. 32 and Table II). The data confirm previous studies (32, 46-49), which showed that MMR plays a dominant role in stability of GT repeats and other microsatellites and further suggest that NER contributes to maintaining the tract length of a (GT)₈ repeat in S. pombe. Thus, NER might serve as a backup system for stabilization of microsatellites. Consistently with the genetic analysis, Rhp14 showed an ~2-fold preference to substrates with either a GT, (GT)₂, AC, or (AC)₂ loop (Fig. 7). Such loops can be formed in GT repeats by strand slippage during replication.

DNA binding capacity was studied with Rhp14 containing an N-terminal His₆ tag. To ensure that the tag did not interfere with the function of the protein, we tested complementation of DNA repair defects caused by mutated rhp14. Both UV sensitivity and increased ade6-485 reversion rates were complemented to the same degree by His₆-tagged Rhp14 and by untagged Rhp14 expressed on a plasmid (Fig. 5). Thus, His₆-Rhp14 is functional in vivo.

In bandshift assays the Rhp14 protein showed preferential binding to substrates containing base-base mismatches or loops with unpaired nucleotides (Figs. 6 and 7). Our recent study revealed that mutated rhp14 and swi10 caused elevated mitotic mutation rates of the ade6-485 allele (a C to G transversion), likely due to the failure to repair C/C mismatches (24). In addition, short-patch repair of C/C mismatches formed during meiotic recombination was strongly affected in the NER mutants. We found no significant difference in binding of Rhp14 to C/C and other types of mismatches (Fig. 6). Thus, the observation that NER predominantly repairs C/C is rather due to the fact that C/C mismatches are not processed by MMR, and are likely not a consequence of preferential recognition of C/C. Consistently, in the absence of MMR, NER can also process other types of mismatches (24). However, it should be noted that S. pombe contains two activities, Cmb1 and Cmb2, that recognize C/C (28). Cmb1 also binds to other types of cytosine-containing mismatches, whereas Cmb2 exclusively binds to C/C. Generally, only weak effects on DNA repair were found in a cmb1 mutant,³ which might be due to redundant functions with Cmb2, whose gene was not yet identified. Since binding to C/C remained in the protein extract of a rhp14 cmb1 mutant, the rhp14 gene does not encode for Cmb2 (Fig. 3). The role of Cmb1 and Cmb2 in DNA repair is not yet understood. One possibility is that they act as accessory factors in DNA repair.

Binding of Rhp14 to mismatches and loops was about 2-fold stronger than to homoduplex. A similar specific affinity was found for binding to C/C, A/C, and T/C mismatches by XPA (Fig. 8). A recent study revealed that XPA shows an ~2-fold higher affinity to (6-4)photoproducts than to unmodified homoduplex (10). The preference for damaged and mismatched DNA might be due to local melting of the double helix. In fact, XPA binds with similar affinities to substrates containing either a bubble with three mispaired nucleotides or a benzo[a]pyrene adduct (14). It was suggested that XPA recognition requires sites in DNA with disrupted base pairing. To serve as recognition signal for XPA, the helical distortion should be in the context of duplex DNA, since single-stranded DNA is not better bound than double-stranded unmodified DNA (14).

The observation that NER is able to correct mismatches in S. pombe suggests that mismatches are actively recognized by NER factors. Rhp14 likely contributes to discrimination between modified and unmodified DNA, but for efficient recognition additional factors are likely required. An interesting question is whether correction of mismatches and loops by NER is a special situation in S. pombe and maybe in a few other organisms or whether it is a general feature of eukaryotes. Only a limited set of data are available so far supporting the latter possibility, and there are clearly more experiments necessary to answer this question.

	ACKNOWLEDGEMENT

We thank Richard D. Wood for plasmid pET15b-XPA.

	FOOTNOTES

^* This work was supported by the Swiss National Science Foundation Grant 31-58'840.99.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Both authors contributed equally to this work.

^¶ Present address: Institute of Medical Radiobiology, University of Zürich, August Forel Strasse 7, CH-8008 Zürich, Switzerland.

Present address: Institute of Microbiology, ETH-Zürich, Schmelzbergstrasse 7, CH-8092 Zürich, Switzerland.

To whom correspondence should be addressed. Tel.: 41-31-631-4656; Fax: 41-31-631-4684; E-mail: fleck@izb.unibe.ch.

Published, JBC Papers in Press, June 14, 2001, DOI 10.1074/jbc.M104039200

² C. Kunz and O. Fleck, manuscript in preparation.

³ C. Kunz, K. Zurbriggen, and O. Fleck, manuscript in preparation.

	ABBREVIATIONS

The abbreviations used are: NER, nucleotide excision repair; UV, ultraviolet; Rhp14, Rad14 homologue pombe; His₆, hexahistidine; PCR, polymerase chain reaction; MMR, long-patch mismatch repair; bp, base pair(s); Ni-NTA, nickel-nitrilotriacetic acid.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				K. M. Lee, S. Nizza, T. Hayes, K. L. Bass, A. Irmisch, J. M. Murray, and M. J. O'Connell Brc1-Mediated Rescue of Smc5/6 Deficiency: Requirement for Multiple Nucleases and a Novel Rad18 Function Genetics, April 1, 2007; 175(4): 1585 - 1595. [Abstract] [Full Text] [PDF]

				R. Muheim-Lenz, T. Buterin, G. Marra, and H. Naegeli Short-patch correction of C/C mismatches in human cells Nucleic Acids Res., December 21, 2004; 32(22): 6696 - 6705. [Abstract] [Full Text] [PDF]

				T. M. Marti, C. Kunz, and O. Fleck Repair of Damaged and Mismatched DNA by the XPC Homologues Rhp41 and Rhp42 of Fission Yeast Genetics, June 1, 2003; 164(2): 457 - 467. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 276/33/30766    most recent M104039200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hohl, M. Articles by Fleck, O. Search for Related Content PubMed PubMed Citation