![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 36, 33375-33383, September 7, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Lilly Research Laboratories, Department of Gene Regulation, Bone and Inflammation Research, Eli Lilly and Company, Indianapolis, Indiana 46285
Received for publication, February 19, 2001, and in revised form, May 25, 2001
| |
ABSTRACT |
|---|
|
|
|---|
We previously cloned and characterized thyroid
hormone receptor-binding protein (TRBP) as an
LXXLL-containing general coactivator that associates with
coactivator complexes through its C terminus. To identify protein
cofactors for TRBP action, a Sos-Ras yeast two-hybrid cDNA library
was screened using TRBP C terminus as bait. A novel coactivator was
isolated, coactivator activator (CoAA), that specifically associates
with TRBP. Human CoAA is composed of 669 amino acids with a
TRBP-interacting domain and two highly conserved RNA recognition motifs
(RRM) commonly found in ribonucleoproteins. A splice variant lacking
the entire TRBP-interacting domain was also isolated as a coactivator
modulator (CoAM), a 156-amino acid protein containing only the RRM
region. Human CoAA and CoAM mRNAs are encoded by a single gene
located on chromosome 11q13; alternative splicing in exon 2 of CoAA
yields CoAM. CoAA interacts with both TRBP and p300 in
vitro. In addition, CoAA potently coactivates transcription
mediated by multiple hormone-response elements and acts synergistically
with TRBP and CREB-binding protein (CBP). Furthermore, CoAA is
associated with the DNA-dependent protein
kinase-poly(ADP-ribose) polymerase complex. Strikingly, CoAM, which
lacks a TRBP-interacting domain, strongly represses both TRBP and CBP
action suggesting that CoAM may modulate endogenous CoAA function.
These data suggest that CoAA may serve as a mediator of coactivators
such as TRBP in gene activation.
Hormone-induced gene activation plays a central role in key
biological phenomena such as cell proliferation, differentiation, apoptosis, and early development. Liganded nuclear receptors
participate in a number of these processes by interacting with specific
hormone response elements as well as transcriptional cofactors and
permitting polymerase II complex to access target genes. A number of
coactivators have been isolated and characterized. These include the
general cointegrator
CBP1/p300 (1), three members
of nuclear receptor coactivator SRC-1 family (2, 3), cold-inducible
coactivator PGC-1 (4, 5), arginine transmethylase CARM1 (6), steroid
receptor RNA activator SRA (7), and the general coactivator, thyroid
hormone receptor binding protein TRBP (8), also known as
ASC-2/RAP250/PRIP/NRC (9-12). Coactivators are typified by their
transactivation capability and distinct interacting or functional
domains. Multiple transcription factor-interacting domains were first
discovered in CBP/p300. Subsequently, the LXXLL motifs that
mediate ligand-dependent nuclear receptor interaction were
found in many coactivators including the SRC-1 family, PGC-1 and TRBP.
Amplification of genes encoding coactivators AIB1 (SRC-3) and AIB3
(TRBP/ASC-2/RAP250/PRIP/NRC) has been observed in assorted cancers (9,
13). Histone acetyltransferase is another important activity present in
many but not all coactivators, whereas arginine transmethylase in SRA
and the RNA recognition motif (RRM) in PGC-1 are other functional
domains potentially important for coactivator function (5, 6). However,
the mechanism by which coactivators regulate target genes with pol II-containing transcriptional machinery is still poorly understood. It
is conceivable that a multifunctional coactivator complex is required
to integrate input from many sources in this process.
However, substantial, if not conclusive, evidence derived from nuclear
structure sheds light on our understanding of this process (for reviews
see Refs. 14-19). RNA polymerase II (pol II) complexes, as detected by
association with newly synthesized mRNA, are relatively immobile
and morphologically recognizable as discrete foci in cell nucleus (18).
Nuclear receptors and their coactivators, in contrast, are mobile and
migrate or relocate during transcription activation. Activation or
repression of a gene is correlated with its movement between different
zones or locations inside the nucleus (19). In addition, such changes
in its localization in the nucleus are correlated with various
physiological events such as hormone induction, apoptosis, and
spermatogenesis (20). These findings raise the possibility that
coactivators serve to recruit the cofactor-bound gene to the territory
of pol II machinery rather than vice versa. On the other hand, mRNA
synthesis and mRNA processing are colocalized and are apparently
functionally coupled within the same transcription complex, which is
composed largely of nuclear RNAs that associate with nuclear
ribonucleoproteins (RNPs) (21-23). The distribution of nuclear RNPs
has recently been shown to play an important role in transcription.
Thus, identification of the components of the transcriptional machinery
that are responsible for the action of coactivators is critical.
Our efforts have focused on coactivator function and have taken
advantage of our work with the general coactivator TRBP. TRBP is a high
molecular weight (2063 amino acids), ubiquitously expressed coactivator
(8-12). Although devoid of intrinsic histone acetyltransferase activity, TRBP can recruit this activity by associating with CBP/p300 (8, 9, 12). TRBP not only enhances nuclear receptor-mediated transcription but also stimulates the activities of multiple
transcriptional factors including AP-1 and NF We report here the isolation and characterization of a coactivator
activator (CoAA) and its splice variant coactivator modulator (CoAM).
CoAA stimulates transcription through its interactions with TRBP and
RNA-containing transcriptional complexes. CoAM, which is unable to
interact with TRBP, competes with CoAA and modulates CoAA function.
Both CoAA and CoAM contain conserved RNA recognition motifs (RRMs) and
thus may belong to the RNP family, which structurally and functionally
may serve as integral components of the transcriptional machinery.
Plasmids--
Mouse CBP, p300, human TRBP and its derived
plasmids have been described previously (8). Full-length human CoAA and
CoAM were generated by PCR and inserted into the
HindIII/XhoI sites of pcDNA3. GST-CoAA (aa
307-584) and GST-CoAM were subcloned into EcoRI/XhoI sites of pGEX-4T-2 (Amersham Pharmacia
Biotech). Mouse mammary tumor virus (MMTV) promoter luciferase reporter
was generated by inserting MMTV promoter with
HindIII/BglII sites into PXP2 vector.
pCMV-TR Yeast Two-hybrid Screen and CoAA and CoAM cDNA
Cloning--
The Sos-Ras yeast two-hybrid system was described
previously (25-27). Human TRBP-C (aa 1641-2063) was inserted in-frame
with the C terminus of human Sos as bait for screening a rat pituitary cDNA library (25). A partial rat cDNA containing the
TRBP-interacting region was isolated, and human sequence information
was obtained from GenBankTM. Based on the human sequence
data, a full-length cDNA encoding human CoAA was isolated by 5'-
and 3'-RACE using HeLa mRNA. Human CoAM was obtained by RT-PCR
according to the manufacturer's protocol (Life Technologies, Inc.).
The primers used for RT-PCR are as follows: F1, gactgccggtcgtcggacgtc;
F2, tgcctgtcgctggaggagagg; F3, aaggtggctgcggcgacaaaatg; F4,
aagatattcgtgggcaacgt; B1, cgcagatctagagccagtagcaagat; B2,
acaaagtaggttactgccgaacact; B3, cccacatggtagagggcatgaa; B4, gggtggggagaggcgggtacg; and B5, ggtcggaaccatacccttggt. The human CoAA
gene structure was obtained by comparison of cDNA and genomic DNA
sequences derived from GenBankTM using the BLAST htg
search. Introns and spliced regions were identified by comparison of
gene and cDNA sequences and noting the presence of GT-AG
consensus sequence.
Recombinant Protein Binding Assays--
The GST and GST fusion
proteins (TRBP-C, CoAA, and CoAM) were produced in Escherichia
coli BL21(DE3) and purified by glutathione-Sepharose resin
(Amersham Pharmacia Biotech). In vitro binding assays were performed by incubating GST resin (20 µl, 2 µg) and
[35S]methionine-labeled, in vitro translated
proteins (5 µl) produced by rabbit reticulocyte lysate (Promega).
Proteins were incubated at room temperature for 1 h in the binding
buffer (20 mM HEPES, pH 7.4, 50 mM NaCl, 75 mM KCl, 1 mM EDTA, 0.05% Triton X-100, 10%
glycerol, 1 mM dithiothreitol). Bound proteins were washed 3 times with binding buffer and subjected to SDS-PAGE and
autoradiography. For Ku70 and PARP interaction studies, GST resin was
incubated with 200 µl of GH3 nuclear extract at 4 °C
for 16 h in the binding buffer as above with additional 10 µg/ml
leupeptin, 10 µg/ml aprotinin, and 10 µg/ml trypsin inhibitor.
Bound proteins were detected by Western blotting (ECL). Anti-Ku86
monoclonal antibodies were obtained from NeoMarkers and anti-PARP
monoclonal antibody from Transduction Laboratories.
Northern Analysis--
Human multiple tissue and human cancer
cell line Northern blots were obtained from
CLONTECH. The CoAA probe was prepared with random-primed 32P-labeled CoAA cDNA (aa 307-584).
Northern analysis was performed according to the manufacturer's protocol.
Cell Culture and Transient Transfection--
CV-1 cells were
maintained in Dulbecco's modified Eagle's medium supplemented with
10% fetal bovine serum and 0.1 µg/µl penicillin/streptomycin in
5% CO2 at 37 °C. Cells were plated in 24-well plates 2 days before transfection. CV-1 cells were transfected using
LipofectAMINE reagent according to the manufacturer's protocol (Life
Technologies, Inc.). Cells were incubated with fresh medium containing
the indicated concentrations of ligands 16-24 h after transfection.
After another 24 h, cells were harvested, and luciferase
activities were determined as described (8). Total amounts of DNA for
each well were equalized by adding vector pcDNA3 (Invitrogen). Data
are shown as means of triplicate transfections ± S.E.
Cloning of CoAA and CoAM--
The nuclear receptor coactivator
TRBP has been shown previously to be a potent general coactivator that
stimulates transcription mediated by multiple hormone-response
elements. Further evidence suggested that the C terminus of TRBP may
interact with protein complexes involved in the transcription
machinery. In order to identify protein factors that directly associate
with TRBP, a rat pituitary cDNA library was screened with a
modified Sos-Ras yeast two-hybrid system using the C terminus of TRBP
(aa 1641-2063) as bait. In a temperature-sensitive yeast strain (Cdc
25), protein-protein interactions activate the Ras pathway resulting in
yeast survival at the restrictive temperature. Thus, protein
interactions can be detected by proliferation of yeast (25-27). A
partial rat cDNA was isolated that encodes a TRBP-interacting
protein that interacts specifically with TRBP in yeast (Fig.
1). When this rat cDNA sequence was
compared with sequences from GenBankTM, the presence of a
previously uncharacterized and related human cDNA was revealed.
Based on the human data, the full-length human cDNA was obtained
employing 5'- and 3'-RACE with mRNA from HeLa cells. Further RT-PCR
analysis revealed an additional shorter splice variant. Based on their
functional characteristics described below, we designated the
full-length clone as coactivator activator, CoAA, and the short splice
variant as coactivator modulator, CoAM.
The CoAA cDNA contains 2781 nucleotides and encodes a protein of
669 amino acids with an estimated molecular mass of 69 kDa (Fig.
2). CoAA belongs to the family of
RNA-binding proteins because of the presence of two well characterized
RNA recognition motifs (RRMs) within its N terminus (aa 3-68 and
81-144) (Figs. 2 and 3A).
Each of the RRMs is composed of two conserved RNP-1 and RNP-2 consensus
motifs (Fig. 3B). The crystal structure of RRM has suggested (28, 29) that the RRM motif consists of four anti-parallel
The alternative splice form, CoAM, was repeatedly and consistently
detected by RT-PCR from various tissues and cells (see below).
Comparison of CoAA and CoAM sequences indicates the absence of
nucleotides 544-1897 in CoAM relative to CoAA cDNA and suggests an
alternative splicing of the primary transcript (Fig. 2). The splicing
event results in the absence of the TRBP-interacting domain in CoAM
(Fig. 2 and 3A). The boundaries of the spliced nucleotide
sequence present in CoAA were flanked by consensus splice acceptor and
donor GT-AG sequences. This splicing event generates a frameshift at
amino acid 150 with the subsequent early termination of translation
(Fig. 2). The deduced protein sequence of CoAM contains 156 amino
acids, with a calculated molecular mass of 17 kDa. It mostly contains
the two RNA recognition motifs that are shared with CoAA.
Genomic Structure of the Human CoAA/CoAM Gene--
The cDNA
sequences obtained by 5'- and 3'-RACE were used to identify the human
CoAA/CoAM genomic sequences from the GenBankTM htg data
base. The human CoAA/CoAM gene is located on chromosome 11q13 and
contains three exons spanning ~11 kilobase pairs (Fig. 3C). Alternative splicing of exon 2 (cDNA nucleotides
544-1897) results in the lack of the TRBP-interacting domain and the
formation of CoAM-encoding mRNA. Hence, CoAM is largely composed of
two RRM domains.
CoAM mRNA Is a Natural Transcript--
Several lines of
evidence support the conclusion that CoAM is a naturally occurring
splice variant and not a PCR artifact. First, several different primer
sets yielded nine CoAM RT-PCR products derived from HeLa cell mRNA
that correctly corresponded to their predicted sizes, suggesting the
RT-PCR results of CoAM were not accidental (Fig.
4, A and B).
Second, comparison of the sequences derived from 3'- and 5'-RACE of
CoAA with the RT-PCR results for CoAM reveals that the splice site is
flanked by splice donor and acceptor consensus GT-AG at nucleotides
544-1897 of the CoAA cDNA sequence (Fig. 2). Third, alternative
splicing at nucleotide 1897 corresponds precisely to the splice site at
the boundary of the intron and exon 3 when genomic sequence was
compared, consistent with alternative splicing at nucleotide 1897 as a
naturally occurring event (Fig. 3C). Fourth, the same CoAM
sequence was obtained from different sources of human tissues including
ovary and liver (Fig. 4C). Finally, a primer crossing the
junction of the splice site (B5), which only hybridizes with CoAM but
not CoAA, was able to detect the CoAM sequence by RT-PCR (Fig.
4C). All together, these data demonstrate that CoAM is a
naturally existing transcript.
CoAA Interacts with the General Coactivators TRBP and CBP/p300 in
Vitro--
In vitro GST pull-down analyses were performed
with recombinant GST fusion proteins and
[35S]methionine-labeled in vitro translated
proteins. Six GST-TRBP fragments were generated in order to map the
region(s) required for CoAA interaction (Fig.
5A). The TRBP C terminus (aa
1242-2063 and 1641-2063) and the LXXLL-containing region
(aa 719-999), but not GST alone or other regions of TRBP, interacts
with CoAA (Fig. 5B). Although the interaction between CoAA
and the TRBP LXXLL-containing region was unexpected, CoAA
did strongly interact with the TRBP C-terminal regions present in both
TRBP-5 and TRBP-6. In addition, this interaction was CoAA-specific
since CoAM did not interact with TRBP under the same conditions (Fig.
5B). The protein domain(s) involved in the interaction with
CoAA is currently unknown. Thus, it is unclear whether multiple
CoAA-interacting domains might be present in TRBP. However, the data
were consistent with the yeast assay showing that the TRBP C terminus
is capable of interacting with CoAA (Fig. 1). Similar positive
interaction results were also obtained when GST-CoAA (Fig.
5C, left panels) or GST-CoAM (Fig. 5C,
right panels) was used together with in vitro
translated TRBP-6. Luciferase served as a negative control, which did
not bind to either. Furthermore, CoAA was able to interact with p300 (Fig. 5D). The interaction of CoAA with p300 requires the
C-terminal region of p300. These results suggested that CoAA directly
interacts with coactivator TRBP and CBP/p300 in vitro. CoAM,
which contains the two RNA recognition motifs but not the
TRBP-interacting domain, was not able to bind to TRBP. This indicates
that the major C-terminal region of CoAA, which includes the
TRBP-interacting domain and is composed of multiple
XYXXQ motifs, is largely responsible for the
interaction between TRBP and CoAA.
Ubiquitous Expression of CoAA--
We examined the expression
pattern of endogenous CoAA mRNA using human Northern blots
containing different tissues and cell lines. The blots were probed with
a cDNA encoding the CoAA-specific TRBP-interacting domain. A
predominant 3.0-kilobase pair transcript was detected, which was
present in all the human tissues tested including brain, heart,
skeletal muscle, colon, thymus, spleen, kidney, liver, small intestine,
placenta, lung, and peripheral blood lymphocytes (Fig.
6). CoAA was also present at comparable levels in HL-60, HeLa, K-562, MOLT-4, Raji, SW480, A549, and G-361 human cancer cells (Fig. 6). As general coactivators such as TRBP and
CBP/p300 are ubiquitously expressed, the wide distribution of CoAA
suggests a potential function of CoAA in modulation of the general
transcriptional machinery.
CoAA Acts as a Potent Coactivator for Nuclear Receptors--
Given
that CoAA interacts with the nuclear receptor coactivator TRBP, we
investigated the role of CoAA in nuclear receptor-mediated transcriptional regulation. The mouse mammary tumor virus promoter (MMTV) luciferase reporter was tested in CV-1 cells with the
glucocorticoid receptor (GR) in the presence or absence of
dexamethasone (Dex). CoAA transactivated the MMTV promoter 10-fold
greater than the vector control (Fig.
7A). This activation was
Dex-inducible and GR dose-dependent, suggesting that CoAA
action is mediated by GR (Fig. 7, A and B). The
activation by CoAA was also CoAA dose-dependent (Fig.
7C). The potency of CoAA activation was similar when
compared with coactivators TRBP and CBP, and the actions of these three coactivators were strongly synergized when transfection conditions were
optimized (Fig. 7D). Consistent with the previous binding data, these results suggest that CoAA is a potent nuclear receptor coactivator and might enhance transcription through other coactivators such as TRBP and CBP/p300.
TRBP-interacting Domain Is Required for CoAA Activation--
In
order to map the domains required for CoAA transactivation function, we
generated CoAA deletion mutants in which RRMs and TRBP-interacting
region were selectively deleted. CoAA and CoAM were compared with
several CoAA deletion mutants in a transient transfection assay. As
shown in Fig. 8, while CoAA stimulated Dex-regulated transcription, CoAM strongly repressed transcription to a
level below that of the vector control. Deletion of the two RRM domains
(CoAA-1) completely abolished the CoAA activity indicating that the
RRMs are required for CoAA activation. The TRBP-interacting domain
itself (CoAA-2) was not active, suggesting that the loss of function
was due to the absence of RRMs, rather than the presence of an
inhibitory element close to the TRBP-interacting region. Deletion of
the TRBP-interacting region reduced but did not abolish the CoAA
activity (CoAA-3), whereas further deletion to remove an additional
XYXXQ-containing region (CoAA-4) almost fully
abolished the activity of CoAA. From a protein structural point of
view, and the sequence of CoAA (Fig. 2), we hypothesized that the
XYXXQ-containing region (~201-584 aa) might be
a single domain that is responsible for the coactivator interaction.
Indeed, the TRBP-interacting domain is likely larger than the region
obtained from the yeast two-hybrid screen (aa 307-584). Deletion of
the entire domain (aa 201-584) (CoAA-4) impaired the function of CoAA,
suggesting that the TRBP-interacting domain (aa 201-584) is important
for CoAA transactivation in addition to the RRMs. Taken together, the
above data suggest that both RRMs and the TRBP-interacting domain are
required for full function of CoAA.
CoAM Modulates the Transcriptional Activities of Coactivators
Including CoAA, TRBP, and CBP--
Strikingly, lacking a
TRBP-interacting domain, CoAM dramatically repressed transcription in a
similar transient transfection system (Figs. 7A, 8, and 9).
In Fig. 9A, CoAM shows a
dose-dependent repression of transcription when compared
with the vector control. These data indicate that CoAM might repress
the function of endogenous coactivators. When CoAA was cotransfected
with increasing amounts of CoAM, CoAM also had a
dose-dependent repression of CoAA-stimulated transactivation (Fig. 9B), suggesting that CoAM may compete
with CoAA with regard to RRM function. Furthermore, in cotransfection studies where CoAA, TRBP, CBP, and CoAM were coexpressed, CoAM significantly repressed TRBP or CBP activity to or below the basal level (Fig. 9C). This indicates that TRBP and CBP may
require other activities, possibly including the endogenous CoAA, in
order to function as coactivators. CoAA activity was regulated by CoAM, which shares two RRMs with CoAA. CoAA was repressed by CoAM to a lesser
extent when compared with TRBP and CBP (Fig. 9C), presumably because overexpression of CoAA overcomes the competition with CoAM to a
greater extent than for TRBP and CBP.
CoAA Functions as a General Coactivator on Multiple Hormone
Response Elements--
The general coactivator TRBP activates nuclear
receptors as well as other transcription factors such as AP-1 and
NF CoAA Interacts with the DNA-PK·PARP Complex--
One of the
interesting features of coactivator TRBP is that its C-terminal region
associates with the DNA-PK·PARP complex and can be phosphorylated by
DNA-PK (8). Accumulating evidence suggests that nuclear complexes
involved in transcription, DNA recombination, and DNA repair are
colocalized in vivo and share components such as DNA-PK and
PARP (30). Since CoAA is an active component associated with TRBP, we
examined whether CoAA might be one of the factors in this complex.
Pull-down assays using GH3 nuclear extract show that CoAA
interacts with the DNA-PK regulatory subunit Ku86 and PARP (Fig.
11), although the interactions may be
either direct or indirect in vivo. These results are
consistent with CoAA playing an important role in the regulation of
general transcription.
The Sos-Ras two-hybrid system detects protein-protein interactions
in yeast cytoplasm rather than the nucleus (25-27). This may confer an
advantage over the conventional yeast two-hybrid system when
identifying proteins with transactivation domains. This system has
significantly facilitated the search for novel coactivators. We have
successfully obtained several coactivators including TRBP using this
system (8). TRBP is notable for its large size, high potency in
transient transfections, unique structural features, and low in
vivo abundance. Like CBP, TRBP appears to be promiscuously active
on multiple response elements. We also have demonstrated that TRBP
associates with nuclear components including CBP/p300, suggesting its
close linkage with the common transcriptional apparatus and its
critical role in nuclear function. Hence, as a TRBP-interacting
coactivator, CoAA may also play an important role in transcription.
It is noteworthy that the coactivator CoAA belongs to a
ribonucleoprotein family. Ribonucleoproteins are RNA-binding proteins that have long been known to be important for nuclear function (21,
22). In fact, together with nuclear RNAs, they are major contributors
to nuclear structure. Heterogeneous nuclear ribonucleoproteins (hnRNPs)
are a family of RNA-binding proteins that were originally named based
on their heterogeneous size. hnRNPs bind to hnRNAs and pre-mRNA
derived from nascent pol II transcripts and are involved in mRNA
processing and turnover. Most biochemically identified hnRNPs are
abundant proteins that interact with RNA and serve as "RNA
histones" and shuttle between the nucleus and cytoplasm. Some hnRNPs
have also been shown to play roles, although less defined, in
transcription, DNA replication, and recombination (17).
Historically, hnRNPs are purified as a nuclear complex and identified
using two-dimensional gels. Inasmuch as most coactivators are not
sufficiently abundant to detect in this manner, CoAA may represent a
new class of low abundance hnRNPs that were not identified previously.
Recent studies suggest that hnRNP-containing nuclear complexes are
associated with various cell functions such as transcription control
(20). PGC-1 is a coactivator that regulates adaptive thermogenesis and
contains an RRM (4). The RRM in PGC-1 has been demonstrated to be
important for the colocalization of the coactivators with splicing
factors (5), which are functionally coupled with the transcriptional
complex. In addition, the previously identified coactivator SRA (7),
which is a RNA, further suggests that a subset of RNA and
RNA-interacting proteins may be important players in transcription.
Thus, CoAA, a ribonucleoprotein itself, might bridge coactivators and
RNP-containing transcription complexes.
When the GenBankTM data base was searched with the
CoAA and CoAM sequences, an uncharacterized human homolog termed
SYT-interacting protein was found. Synovial sarcoma translocation (SYT)
is a proto-oncoprotein that is commonly expressed in synovial sarcoma.
Chromosome translocation leads to fusion of the coactivator SYT
with the synovial sarcoma X break point 1/2 and is associated with
tumorigenesis (31). Whether CoAA interacts with SYT directly is not
clear. However, it has been shown that p300 interacts with SYT in
vivo (32). Moreover, our results show that CoAA interacts with
p300 (Fig. 3). Taken together, in addition to the interactions with
TRBP, CoAA might mediate the interactions between other coactivators such as p300 and SYT.
Well characterized RRMs composed of 90-100 amino acids are present in
one or more copies in many hnRNPs (22, 29). CoAA possesses two RRMs.
The RRM is an ancient domain that is evolutionarily conserved from
bacteria to higher eukaryotes. The crystal structure of a consensus RRM
shows that it is composed of four anti-parallel The other well known feature of hnRNPs is the existence of splice
variants. CoAM mRNA is an alternative splice form of the CoAA
transcript and encodes a protein with two RRMs identical to those
present in CoAA but without the TRBP-interacting domain. We have
provided several lines of evidence suggesting that CoAM mRNA is a
result of a natural splicing event. Although the relative amounts of
endogenous CoAA and CoAM proteins in tissues are not known, the balance
of CoAA and CoAM in vivo could be physiologically relevant
and determine transcriptional activities of target genes in each
tissue. Transient transfection studies showed that CoAA stimulates, and
CoAM represses, TRBP-mediated transcription (Fig. 9). These data not
only suggest that CoAA interaction with TRBP is important for CoAA
activation but also indicate that putative RNA binding through its RRMs
of CoAA may be important for transcriptional activation. In this
instance, CoAM completely prevented TRBP and CBP/p300-mediated
transcriptional activation, presumably blocking CoAA action (Fig.
9C). Inasmuch as CoAA effects were not promoter-specific, the involvement of RNA via coactivators could be a common mechanism underlining an aspect of transcription regulation. On the other hand,
CoAA appears not to contain the LXXLL motif or a binding domain for other transcription factors, suggesting CoAA might represent
another class of coactivators that are functionally distinguishable
from TRBP and CBP/p300.
Collectively, the above data suggest that CoAA might exert its
transactivation activity through its putative interaction with an
RNA-containing complex via the RRM domains and interaction with
coactivators via the TRBP-interacting domain. On the other hand, CoAM
might compete with endogenous CoAA and other putative RRM-containing
endogenous coactivators for the binding of an RNA-containing transcriptional complex. This, in turn, may inhibit transcriptional activation. The general coactivators TRBP and CBP may require CoAA to
interact with the transcriptional machinery. In this case, blocking the
interaction sites would prevent coactivator access to the
transcriptional complex. Taken together, CoAM apparently acts as a
dominant negative regulator for CoAA and may modulate CoAA function
in vivo.
The machinery for transcription, DNA replication, and recombination
have been proposed to be colocalized with functional overlap (18). The
association of CoAA with DNA-PK and PARP complexes further suggests
that CoAA might be localized within the same nuclear machinery. Like
most other biological phenomena, transcriptional regulation is likely a
sequential process that involves multiple components and steps. In this
view, CoAA may be an important player in this event.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
B (8, 9). The TRBP gene
is also amplified in human breast and other cancers (9). Unlike the
cointegrator CBP/p300, which is composed of multiple
protein-interacting domains, TRBP is composed largely of activation
domains that are also found in proteins such as VP16, CBP, or SRC-1
(24). In addition, the C terminus of TRBP has been shown to interact
with nuclear DNA-dependent protein kinase (DNA-PK) and
poly(ADP-ribose) polymerase (PARP) complexes that are implicated in
transcription regulation (8). These data suggest that TRBP might be
targeted to the transcriptional complex via its C terminus. Thus, we
searched for TRBP-interacting proteins by a yeast two-hybrid screen
using TRBP C terminus as bait.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1, pCMV-ER
, F2/TRE, and 2×ERE luciferase reporters were
described previously (8). A 2× GRE reporter was generated by
PCR with NheI/XbaI sites of pTAL-Luc
(CLONTECH). pCMV-GR was generated by inserting GR
into the BamHI/XhoI sites of pcDNA3 (Invitrogen). The 7×AP-1 and 5×NF
B luciferase reporters and MEK kinase (MEKK) plasmids were obtained from Stratagene.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (42K):
[in a new window]
Fig. 1.
CoAA interacts with TRBP in yeast. CoAA
was tested with Sos/TRBP (aa 1641-2063) as bait in the Sos-Ras yeast
two-hybrid system. Fos and Sos/Jun DNA binding domain and empty vectors
were used as positive and negative controls, respectively. Protein
interaction was detected by yeast proliferation on galactose plates at
36 °C. A glucose plate at 24 °C was used as a control to indicate
the presence of each clone.
-strands
and two
-helices that collectively serve as an RNA binding platform.
In addition, CoAA also contains a TRBP-interacting domain (aa 307-584)
outside the RNA recognition motif (Figs. 2 and 3). Rat and human
primary sequences of these regions have 98% identity. The primary
sequence of the TRBP-interacting domain of CoAA is serine-, alanine-,
glycine-, and tyrosine-rich, and the secondary structure analyzed by
the program Jpred/PHD predicts mostly coiled coil structure, an
uncharacterized feature shared among many coactivator molecules.
Interestingly, a unique XYXXQ motif (X
denotes a small amino acid residue including G, A, S, and P) is present
with >20 copies throughout the domain. The function of this motif
remains to be further elucidated. However, evidence suggests that the
interspersed aromatic residue repeats among the small residues are
important for protein-protein interactions between hnRNP proteins (33,
34). This also implies that the entire TRBP-interacting region may be a
single functional domain. Thus, the XYXXQ motif
might be important for the interaction between TRBP and CoAA.

View larger version (52K):
[in a new window]
Fig. 2.
Nucleotide and amino acid sequences of human
CoAA and CoAM. CoAA/CoAM cDNA nucleotide and deduced amino
acid sequences are shown. Numbers on the left
indicate nucleotides, and numbers in parentheses
on the right indicate amino acids. The asterisks
indicate the stop codons. The TRBP-interacting domain homologous to the
rat sequence obtained from the library screen is indicated by the
box. The two RRMs of CoAA/CoAM are underlined.
CoAM is related to CoAA by alternative splicing, and the splice donor
and acceptor sequences at 544 and 1896 positions (gt-ag) are
highlighted. The splicing event results in a frameshift resulting in
CoAM with a predicted protein sequence containing 156 amino acids as
shown in bold. Multiple XYXXQ
sequences (where X is a small amino acid residue including
G, A, S and P) primarily located in the TRBP-interacting domain are
indicated with tyrosines (Y) circled.

View larger version (34K):
[in a new window]
Fig. 3.
Comparison of CoAA and CoAM.
A, schematic representation of CoAA and CoAM structures in
which RRMs are shown as hatched boxes and the
TRBP-interacting domain as a black box. The diagram
illustrates the region missing in CoAM when compared with CoAA (aa
150-602). The C-terminal six amino acids in CoAM differ from those of
CoAA as a result of the frameshift that occurred in the splicing event.
Numbers indicate positions of the amino acids. B,
sequence alignment of RRMs. RRMs from the primary sequences of hnRNP
A1, U1 snRNP A, and CoAA/CoAM were aligned. Secondary structural
features are shown above. RNP1 and -2 are shown
below. C, structure of human CoAA/CoAM gene. Both
CoAA and CoAM are shown. Introns are shown as lines, and
exons as boxes. Coding regions are depicted in
black and non-coding regions in white.
Numbers indicate nucleotide positions within CoAA
cDNA.

View larger version (38K):
[in a new window]
Fig. 4.
CoAM is a natural transcript present in
different human tissues. A, schematic representation of
CoAA and CoAM with depiction of the primers for RT-PCR. Primer B5
encompasses the splice site junction that will bind CoAM selectively.
B, RT-PCR analysis of CoAM using HeLa mRNA and primer
sets shown in A. Sequences of the primers are described
under "Experimental Procedures." C, PCR analysis of CoAA
and CoAM using first strand cDNAs from human ovarian and liver
tissues. CoAM cDNA and HeLa first strand cDNA were used as
positive controls. CoAA cDNA was used as a negative control for the
CoAM selectivity of primer B5. Primer sets are shown in A. M denotes a 1-kilobase pair ladder of nucleotide
markers.

View larger version (37K):
[in a new window]
Fig. 5.
CoAA interacts with TRBP and p300 in
vitro. GST fusion proteins (TRBP, CoAA, and CoAM) were
incubated with in vitro translated,
[35S]methionine-labeled CoAA, CoAM, TRBP, or p300. Bound
proteins or fragments were resolved by SDS-PAGE and detected by
autoradiography. CoAA and CoAM were full-length, and TRBP and p300 were
fragments as indicated. GST alone and luciferase were used as negative
controls. A, schematic diagram illustrating the regions of
TRBP used for mapping of the CoAA-interacting domain.
Numbers indicate positions of amino acids. B,
[35S]methionine-labeled CoAA and CoAM were tested with
GST-TRBP fragments. Input is 10%. C, GST-CoAA
and GST-CoAM were tested with [35S]methionine-labeled
TRBP-6 (aa 1641-2063). Luciferase was used as a negative control.
D, GST-CoAA was tested with
[35S]methionine-labeled p300 fragments, as indicated. GST
alone served as a negative control.

View larger version (42K):
[in a new window]
Fig. 6.
Endogenous expression of CoAA mRNAs.
Northern analysis of mRNAs from various human tissues and human
cancer cell lines probed with a partial CoAA cDNA containing
TRBP-interacting domain to detect CoAA-specific mRNAs.

View larger version (22K):
[in a new window]
Fig. 7.
CoAA is a potent coactivator. CV-1 cells
were cotransfected with MMTV luciferase reporter (100 ng) together with
human CoAA, CoAM, TRBP, or mCBP (200 ng or as indicated in C
or as described in D), and with GR (10 ng or as indicated in
A). Cells were grown in the presence or absence of 100 nM dexamethasone (DEX) or with concentrations
described in B. Total amounts of DNA for each well were
equalized with additional vector pcDNA3. A, CoAA but not
CoAM stimulates GR-dependent transcription on the MMTV
promoter. Transfections were performed with increasing amounts of GR
(0, 0.1, 1, and 10 ng). B, coactivation of MMTV promoter
activity by CoAA is ligand-dependent. Cells were grown with
increasing amounts of Dex (0, 10
11, 10
10,
10
9, 10
8 and 10
7
M). C, coactivation by CoAA is CoAA
dose-dependent. Cells were cotransfected with increasing
amounts of CoAA (0, 100, 200, and 400 ng). D, CoAA
synergizes with TRBP and CBP. CV-1 cells were cotransfected with
combinations of CoAA, TRBP, and/or CBP (150 ng).

View larger version (24K):
[in a new window]
Fig. 8.
TRBP-interacting domain is required for the
transcriptional activity of CoAA. CV-1 cells were cotransfected
with MMTV luciferase reporter (100 ng), GR (10 ng), control vector
pcDNA3 (V, 200 ng), or wild-type CoAA, CoAM, or CoAA
deletion mutants (CoAA1-4). The schematic diagram
below the graph illustrates the various wild-type CoAA and
deletion mutants. Numbers indicate positions of amino acids
in CoAA. Cells were grown in the presence or absence of 100 nM dexamethasone (DEX).

View larger version (17K):
[in a new window]
Fig. 9.
CoAM modulates coactivator-mediated
transcription. CV-1 cells were cotransfected with MMTV luciferase
reporter (100 ng), GR (10 ng), and additional plasmids as described
below. Cells were grown in the presence or absence of 100 nM dexamethasone (DEX). A, CoAM
inhibits endogenous level of transcription. Cells were cotransfected
with increasing amounts of CoAM (0, 10, 20, 50, 100, 200, and 400 ng)
as indicated. B, CoAM inhibits CoAA-mediated
transactivation. Cells were cotransfected with increasing amounts of
CoAM (0, 75, 150, and 300 ng) and a constant amount of CoAA (150 ng).
C, inhibition of activities of coactivators TRBP and CBP by
CoAM. Cells were cotransfected with 150 ng of CoAA, CoAM, TRBP, or CBP
as indicated.
B (8). We speculated that CoAA, through its interaction with TRBP,
might possess a similar ability to activate multiple hormone response elements. To examine this possibility, CoAA and TRBP were tested with a
number of luciferase reporters containing GRE, TRE, ERE, AP-1,
and NF
B enhancer binding sites. The results indicate that CoAA and
TRBP are synergistic on all of these elements (Fig.
10). Thus, CoAA also functions as a
general coactivator for transcription mediated by nuclear receptors and
other transcriptional factors.

View larger version (15K):
[in a new window]
Fig. 10.
CoAA acts as a general coactivator.
CV-1 cells were transfected with the indicated luciferase reporters
containing different minimal enhancer and hormone-response elements
(2× GRE, 2×ERE, F2 TRE, 7×AP-1, 5×NF
B) (100 ng). CoAA, TRBP (200 ng), GR, ER
, or TR
1 (10 ng) and inducer plasmid MEKK (20 ng) were
also cotransfected as indicated. Cells were grown in the presence or
absence of 3,3',5-triiodo-L-thyronine
(T3; 100 nM), 17
-estradiol
(E2, 1 µM), or DEX (100 nM).

View larger version (61K):
[in a new window]
Fig. 11.
CoAA interacts with nuclear DNA-PK and
PARP. GST-CoAA fusion or GST control proteins were incubated with
GH3 nuclear extract. Bound proteins were resolved by
SDS-PAGE and subjected to Western blotting. DNA-PK regulatory subunit
Ku86 and PARP were detected by anti-Ku86 and anti-PARP monoclonal
antibodies, respectively. Molecular mass (kDa) markers are indicated at
the left.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-strands and two
-helices. The RNP1 and RNP2 (
-sheet) provide a large surface for
interaction with nucleic acids. The interaction of RRM with its cognate
RNA hairpin loop is hypothesized to occur via an induced fit mechanism
(28). Another structural feature of many hnRNPs, in addition to RRMs,
is a Gly-rich domain with interspersed aromatic residue repeats, which
has been shown to be responsible for protein-protein interactions among
hnRNPs (33, 34). CoAA has two RRMs and a TRBP-interacting domain that
together structurally resemble key features of hnRNP. The
TRBP-interacting domain of CoAA contains a significant number of
repeats of tyrosines nested among the small amino acid residues such as
alanine, serine, and glycine. This feature may serve as a
coactivator-binding motif, analogous to Gly-rich domains in hnRNPs.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Thomas P. Burris for helpful comments on this manuscript. We acknowledge Ami Aronheim and Michael Karin for providing the Sos-Ras yeast two-hybrid system. We also thank Keith R. Stayrook and Xin Bu for technical assistance.
| |
FOOTNOTES |
|---|
* This work was supported by Lilly postdoctoral research fellowships.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF315632, AF315633, and AF327567.
To whom correspondence should be addressed: Eli Lilly and Company,
Lilly Corporate Center, Bldg. 98/C, Drop Code 0434, Indianapolis, IN
46285. Tel.: 317-433-5237; Fax: 317-276-1414; E-mail:
kol@lilly.com.
Published, JBC Papers in Press, July 6, 2001, DOI 10.1074/jbc.M101517200
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
CBP, CREB-binding
protein;
TRBP, thyroid hormone receptor-binding protein;
CoAA, coactivator activator;
CoAM, coactivator modulator;
RNP, ribonucleoprotein;
hnRNPs, heterogeneous nuclear ribonucleoproteins;
RRM, RNA-recognition motif;
PGC-1, PPAR
-coactivator-1;
DNA-PK, DNA-dependent protein kinase;
PARP, poly(ADP-ribose)
polymerase;
pol II, RNA polymerase II;
RACE, rapid amplification of
cDNA ends;
RT-PCR, reverse transcription-polymerase chain reaction;
GST, glutathione S-transferase;
Dex, dexamethasone;
SYT, synovial sarcoma translocation;
MEK, mitogen-activated protein
kinase/extracellular signal-regulated kinase kinase;
MEKK, MEK kinase;
MMTV, mouse mammary tumor virus;
PAGE, polyacrylamide gel
electrophoresis;
aa, amino acids;
GR, glucocorticoid receptor;
GRE, glucocorticoid response element;
SRC-1, steroid receptor coactivator-1;
CARM1, coactivator-associated arginine methyl-transferase 1;
SRA, steroid receptor RNA activator.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Kwok, R. P., Lundblad, J. R., Chrivia, J. C., Richards, J. P., Bachinger, H. P., Brennan, R. G., Roberts, S. G., Green, M. R., and Goodman, R. H. (1994) Nature 370, 223-226 |
| 2. | Onate, S. A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1995) Science 270, 1354-1357 |
| 3. | Leo, C., and Chen, J. D. (2000) Gene (Amst.) 245, 1-11 |
| 4. | Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegelman, B. M. (1998) Cell 20, 829-839 |
| 5. | Monsalve, M., Wu, Z., Adelmant, G., Puigserver, P., Fan, M., and Spiegelman, B. M. (2000) Mol. Cell 6, 307-316 |
| 6. | Chen, D., Ma, H., Hong, H., Koh, S. S., Huang, S. M., Schurter, B. T., Aswad, D. W., and Stallcup, M. R. (1999) Science 284, 2174-2177 |
| 7. | Lanz, R. B., McKenna, N. J., Onate, S. A., Albrecht, U., Wong, J., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1999) Cell 97, 17-27 |
| 8. | Ko, L., Cardona, G. R., and Chin, W. W. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6212-6217 |
| 9. | Lee, S. K., Anzick, S. L., Choi, J. E., Bubendorf, L., Guan, X. Y., Jung, Y. K., Kallioniemi, O. P., Kononen, J., Trent, J. M., Azorsa, D., Jhun, B. H., Cheong, J. H., Lee, Y. C., Meltzer, P. S., and Lee, J. W. (1999) J. Biol. Chem. 274, 34283-34293 |
| 10. | Caira, F., Antonson, P., Pelto-Huikko, M., Treuter, E., and Gustafsson, J. Å. (2000) J. Biol. Chem. 275, 5308-5317 |
| 11. | Zhu, Y., Kan, L., Qi, C., Yashpal, S., Kanwar, Y. S., Anjana, V., Yeldandi, A. V., Sambasiva Rao, M., and Reddy, J. K. (2000) J. Biol. Chem. 275, 13510-13516 |
| 12. | Mahajan, M. A., and Samuels, H. H. (2000) Mol. Cell. Biol. 20, 5048-5063 |
| 13. | Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X. Y., Sauter, G., Kallioniemi, O. P., Trent, J. M., and Meltzer, P. S. (1997) Science 277, 965-968 |
| 14. | Barrett, T. J., and Spelsberg, T. C. (1999) Vitam. Horm. 55, 127-163 |
| 15. | Bode, J., Schlake, T., Rios-Ramirez, M., Mielke, C., Stengert, M., Kay, V., and Klehr-Wirth, D. (1995) Int. Rev. Cytol. 162, 389-454 |
| 16. | Nickerson, J. A., and Blencowe, B. J. (1995) Int. Rev. Cytol. 162, 67-123 |
| 17. | Berezney, R., Mortillaro, M. J., Ma, H., Wei, X., and Samarabandu, J. (1995) Int. Rev. Cytol. 162, 1-65 |
| 18. | Cook, P. R. (1999) Science 284, 1790-1795 |
| 19. | Lamond, A. I., and Earnshaw, W. C. (1998) Science 280, 547-553 |
| 20. | Biggiogera, M., and Pellicciari, C. (2000) FASEB J. 14, 828-834 |
| 21. | Dreyfuss, G., Matunis, M. J., Pinol-Roma, S., and Burd, C. G. (1993) Annu. Rev. Biochem. 62, 289-321 |
| 22. | Krecic, A. M., and Swanson, M. S. (1999) Curr. Opin. Cell Biol. 11, 363-371 |
| 23. | Burd, C. G., and Dreyfuss, G. (1994) Science 265, 615-621 |
| 24. | Triezenberg, S. J. (1995) Curr. Opin. Genet. & Dev. 5, 190-196 |
| 25. | Aronheim, A., Zandi, E., Hennemann, H., Elledge, S. J., and Karin, M. (1997) Mol. Cell. Biol. 17, 3094-3102 |
| 26. | Hubsman, M., Yudkovsky, G., and Aronheim, A. (2001) Nucleic Acids Res. 29, e18 |
| 27. | Broder, Y. C., Katz, S., and Aronheim, A. (1998) Curr. Biol. 8, 1121-1124 |
| 28. | Shamoo, Y., Krueger, U., Rice, L. M., Williams, K. R., and Steitz, T. A. (1997) Nat. Struct. Biol. 4, 215-222 |
| 29. | Nagai, K., Oubridge, C., Ito, N., Avis, J., and Evans, P. (1995) Trends Biochem. Sci. 20, 235-240 |
| 30. | Jeggo, P. A. (1997) Mutat. Res. 384, 1-14 |
| 31. | Clark, J, Rocques, P. J., Crew, A. J., Gill, S., Shipley, J., Chan, A. M., Gusterson, B. A., and Cooper, C. S. (1994) Nat. Genet. 7, 502-508 |
| 32. | Eid, J. E., Kung, A. L., Scully, R., and Livingston, D. M. (2000) Cell 15, 839-848 |
| 33. | Cartegni, L., Maconi, M., Morandi, E., Cobianchi, F., Riva, S., and Biamonti, G. (1996) J. Mol. Biol. 259, 337-348 |
| 34. | Biamonti, G., Ruggiu, M., Saccone, S., Della Valle, G., and Riva, S. (1994) Nucleic Acids Res. 22, 1996-2002 |
This article has been cited by other articles:
![]() |
Q. Li, M.-J. Chu, and J. Xu Tissue- and Nuclear Receptor-Specific Function of the C-Terminal LXXLL Motif of Coactivator NCoA6/AIB3 in Mice Mol. Cell. Biol., December 1, 2007; 27(23): 8073 - 8086. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Mahajan, A. Murray, D. Levy, and H. H. Samuels Nuclear Receptor Coregulator (NRC): Mapping of the Dimerization Domain, Activation of p53 and STAT-2, and Identification of the Activation Domain AD2 Necessary for Nuclear Receptor Signaling Mol. Endocrinol., August 1, 2007; 21(8): 1822 - 1834. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Qiu, N. Shimokawa, T. Iwasaki, I. S. Parhar, and N. Koibuchi Alteration of Cerebellar Neurotropin Messenger Ribonucleic Acids and the Lack of Thyroid Hormone Receptor Augmentation by staggerer-Type Retinoic Acid Receptor-Related Orphan Receptor-{alpha} Mutation Endocrinology, April 1, 2007; 148(4): 1745 - 1753. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, Y. Sui, S. Xiong, S. S. Liour, A. C. Phillips, and L. Ko Switched alternative splicing of oncogene CoAA during embryonal carcinoma stem cell differentiation Nucleic Acids Res., March 4, 2007; 35(6): 1919 - 1932. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun, L. Ding, H. Zhang, J. Han, X. Yang, J. Yan, Y. Zhu, J. Li, H. Song, and Q. Ye Potentiation of Smad-mediated transcriptional activation by the RNA-binding protein RBPMS Nucleic Acids Res., December 4, 2006; 34(21): 6314 - 6326. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kuwahara, A. Ikei, Y. Taguchi, Y. Tabuchi, N. Fujimoto, M. Obinata, S. Uesugi, and Y. Kurihara PSPC1, NONO, and SFPQ Are Expressed in Mouse Sertoli Cells and May Function as Coregulators of Androgen Receptor-Mediated Transcription Biol Reprod, September 1, 2006; 75(3): 352 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. H. Kasper, T. Fukuyama, M. A. Biesen, F. Boussouar, C. Tong, A. de Pauw, P. J. Murray, J. M. A. van Deursen, and P. K. Brindle Conditional Knockout Mice Reveal Distinct Functions for the Global Transcriptional Coactivators CBP and p300 in T-Cell Development Mol. Cell. Biol., February 1, 2006; 26(3): 789 - 809. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Perani, P. Antonson, R. Hamoudi, C. J. E. Ingram, C. S. Cooper, M. D. Garrett, and G. H. Goodwin The Proto-oncoprotein SYT Interacts with SYT-interacting Protein/Co-activator Activator (SIP/CoAA), a Human Nuclear Receptor Co-activator with Similarity to EWS and TLS/FUS Family of Proteins J. Biol. Chem., December 30, 2005; 280(52): 42863 - 42876. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Fox, C. S. Bond, and A. I. Lamond P54nrb Forms a Heterodimer with PSP1 That Localizes to Paraspeckles in an RNA-dependent Manner Mol. Biol. Cell, November 1, 2005; 16(11): 5304 - 5315. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Iwasaki, N. Koibuchi, and W. W. Chin Synovial Sarcoma Translocation (SYT) Encodes a Nuclear Receptor Coactivator Endocrinology, September 1, 2005; 146(9): 3892 - 3899. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Auboeuf, D. H. Dowhan, M. Dutertre, N. Martin, S. M. Berget, and B. W. O'Malley A Subset of Nuclear Receptor Coregulators Act as Coupling Proteins during Synthesis and Maturation of RNA Transcripts Mol. Cell. Biol., July 1, 2005; 25(13): 5307 - 5316. [Full Text] [PDF] |
||||
![]() |
Y. Masuhiro, Y. Mezaki, M. Sakari, K.-i. Takeyama, T. Yoshida, K. Inoue, J. Yanagisawa, S. Hanazawa, B. W. O'Malley, and S. Kato Splicing potentiation by growth factor signals via estrogen receptor phosphorylation PNAS, June 7, 2005; 102(23): 8126 - 8131. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Mahajan and H. H. Samuels Nuclear Hormone Receptor Coregulator: Role in Hormone Action, Metabolism, Growth, and Development Endocr. Rev., June 1, 2005; 26(4): 583 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
|