![]()
|
|
||||||||
J. Biol. Chem., Vol. 276, Issue 38, 35243-35246, September 21, 2001
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
§,
,
, and
From the
INSERM U504, Glycobiologie et Signalisation
Cellulaire, 16 Avenue Paul-Vaillant-Couturier, 94807 Villejuif Cedex,
France and the ¶ Department of Biochemistry, Academic Medical
Centre University of Amsterdam, 1105AZ Amsterdam, The
Netherlands
Received for publication, June 12, 2001, and in revised form, July 13, 2001
| |
ABSTRACT |
|---|
|
|
|---|
The tumor suppressor PTEN is a dual protein and
phosphoinositide phosphatase that negatively controls the
phosphatidylinositol (PI) 3-kinase/protein kinase B (Akt/PKB) signaling
pathway. Interleukin-13 via the activation of the class I PI 3-kinase
has been shown to inhibit the macroautophagic pathway in the human
colon cancer HT-29 cells. Here we demonstrate that the wild-type PTEN
is expressed in this cell line. Its overexpression directed by an
inducible promoter counteracts the interleukin-13 down-regulation of
macroautophagy. This effect was dependent upon the phosphoinositide
phosphatase activity of PTEN as determined by using the mutant G129E,
which has only protein phosphatase activity. The role of Akt/PKB in the
signaling control of interleukin-13-dependent
macroautophagy was investigated by expressing a constitutively active
form of the kinase (MyrPKB). Under these conditions a
dramatic inhibition of macroautophagy was observed. By contrast a high
rate of autophagy was observed in cells expressing a dominant negative
form of PKB. These data demonstrate that the signaling control of
macroautophagy overlaps with the well known PI 3-kinase/PKB survival
pathway and that the loss of PTEN function in cancer cells inhibits a
major catabolic pathway.
Macroautophagy, a multistep process responsible for the
degradation of long-lived proteins and organelle renewal, starts
with the formation of an autophagosome, which ultimately fuses with the
endosomal/lysosomal compartment (1, 2). This pathway is known to be
important in the maintenance of cell functions during period of
nutrient deprivation (3). However, recent data have shed light on the
importance of autophagy in human pathologies, including some forms of
cardiomyopathy (Danon's disease) (4) and breast cancer (5).
The recent discovery of apg and aut genes in
yeast and the identification of orthologous genes in human cells have
increased our knowledge of the molecular machinery responsible for the
formation of autophagic vacuoles (6, 7). A better understanding of the
control of macroautophagy is also dependent upon the identification of
signal transduction pathways that control the formation of autophagosomes (8-10).
The drug 3-methyladenine
(3-MA),1 which inhibits the
formation of autophagic vacuoles (11), has been shown to target enzymes of the phosphatidylinositol 3'-kinase family (12, 13). Class I and III
PI 3-Ks act antagonistically at different steps of autophagy (13).
Class III PI 3-K is probably engaged in the control of the formation of
autophagic vacuoles by association with other proteins recruited to
cytoplasmic membrane as suggested recently for its yeast homolog VPS34
(14). By contrast, the plasma membrane-associated class I PI 3-K would
be required to transduce a negative signal for the biogenesis of the
autophagic vacuole (13).
The tumor suppressor PTEN is a dual protein/lipid phosphatase mutated
in a variety of cancers (15-17), which has been shown to
dephosphorylate the 3' position of the class I PI 3-K product phosphatidylinositide (3,4,5)P3 (18) and consequently
down-regulates PI 3-K/PKB pathway (19). In the present work we
demonstrate that PTEN is expressed in human colon cancer HT-29 cells
and negatively regulates IL-13-dependent PI 3-K/PKB
signaling. Moreover PTEN, via its lipid phosphatase activity, is
involved in the signaling control of autophagy, together with the
downstream acting Akt/PKB. These results add a new function to the PI
3-K/PTEN/PKB pathway and also provide a new link between the control of
autophagy and tumor progression.
Cells and Material--
HT-29 cells were cultured as described
previously (20). 3-MA, metrizamide, and other chemical products were
from Sigma. Nitrocellulose membranes and the bicinchoninic acid (BCA)
protein assay kit were purchased from Schleicher and Schuell (Dassel, Germany) and Pierce, respectively. Enzymes, synthetic oligonucleotides, and cell culture reagents such as Geneticin (G418) and hygromycin B
were purchased from Life Technologies, Inc. (Eragny, France). The
SuperfectTM transfection kit was from Qiagen (Courtaboeuf,
France). Pfu DNA polymerase, the LacSwitch®
II-inducible mammalian expression system, and
isopropyl- Expression Plasmids and Transfections--
The full-length PTEN
cDNA was synthesized from total RNA derived from HT-29 cells by PCR
using pfu DNA polymerase and primers that add a 5'
BamHI site (5'-CGCGGATCCATGACAGCCATCATCAAAGAGATCGTTAGC) and
a 3' XbaI site (5'-CGCTCTAGATG*ACTTTTGTAATTTGTGTATGC
containing a mutated stop codon (*)). The resulting cDNA was
subcloned into pcDNA6/V5-His, and the sequence was verified by
automated sequencing using several pairs of primers at position 1-400,
365-800, 770-1000, and 980-1300. Histidine-tagged PTEN cDNA was
then amplified by PCR and subcloned into pOPRSVI/MCS operator vector
from the LacSwitch® II-inducible mammalian expression system.
Histidine-tagged C124S and G129E PTEN mutants were generated by
PCR-based site-directed mutagenesis and subcloned into the pOPRSVI/MCS
operator vector. In a first set of experiments, HT-29 cells were
transfected with 5 µg of Lac-repressor-expressing vector and selected
in the presence of 400 µg/ml hygromycin B. In a second set of
experiments, stable Lac-repressor-expressing HT-29 cells were
transfected with 5 µg of each pOPRSVI/MCS operator vector
constructions, including the empty vector, His-tagged wt-PTEN, C124S,
and G129E PTEN mutants, and selected in the presence of 800 µg/ml
G418 and 200 µg/ml hygromycin B. Under these conditions, expression
of inserted cDNA is repressed until inducer (5 mM IPTG)
is added to the media for 16 h.
HT-29 cells were transfected with 5 µg each of pCMV6-HA-tagged,
myristoylated, and dominant negative Akt/PKB and selected in the
presence of 800 µg/ml G418.
Immunoblotting--
Before and after IPTG induction for 16 h, cells were washed twice with ice-cold phosphate-buffered NaCl
solution and lysed in cold lysis buffer (20 mM Tris-HCl (pH
7.4), 150 mM NaCl, 1% Triton X-100, 0.5% Nonidet P-40, 1 mM EDTA, 1 mM EGTA, 5 µM
phenylmethylsulfonyl fluoride, 5 µg/ml of leupeptin, pepstatin A, and
aprotinin, 1 mM Na3VO4, 2 mM NaF, and 2 mM
Na4PO7) for 30 min on ice. After centrifugation
the protein concentration of cell lysates was determined using the BCA
reagent. One-hundred µg of protein were resolved by 10%
SDS-polyacrylamide gel electrophoresis and transferred onto a
nitrocellulose membrane. The membranes were blocked with 5% nonfat dry
milk in TBST (10 mM Tris-HCl (pH 8.0), 100 mM
NaCl, and 005% Tween 20) for 1 h at room temperature and then
incubated with the appropriate primary antibody for 1 h at room
temperature or overnight at 4 °C, followed by incubation with
horseradish peroxidase-conjugated secondary antibody at 1:3000 dilution
for 1 h at room temperature. The polyclonal anti-PTEN,
anti-phospho-Akt/PKB (Thr308), anti-Akt/PKB,
anti-phospho-GSK-3 Measurements of Autophagic Parameters--
Autophagic
sequestration of LDH and measurement of the degradation of long-lived
proteins were determined as reported previously (21). Cells were
cultured in complete medium containing 5 mM IPTG for
16 h and then chased for 4 h in nutrient-free medium (without
amino acids and in the absence of fetal calf serum) containing 5 mM IPTG. When used, 3-MA (10 mM) and IL-13 (30 ng/ml) were added to the cells at the beginning of the chase period.
PTEN Controls the IL-13-dependent Activation of PKB in
HT-29 Cells--
As the PTEN phosphatase tumor suppressor is
frequently inactivated in several cancer cells and in a series of
related disorders that are characterized by a predisposition to cancer
(15-17), we have first determined whether wt-PTEN is expressed in
HT-29 cells. As shown in Fig. 1, a rabbit
polyclonal antibody raised against a C-terminal peptide of PTEN
recognized a Mr 56,000 protein in HT-29 cells.
To investigate the presence of mutations of endogenous PTEN, we
analyzed its cDNA amplified by RT-PCR. After total sequencing, no
mutation was detected on PTEN, including the region corresponding to
the common phosphatase P loop motif (HCXXGXXR
located at the position 123-130). To determine whether increased
levels of wt-PTEN or inactive phosphatase mutants had effects on
Akt/PKB activation in HT-29 cells, full-length cDNAs were subcloned
into an eucaryotic expression pcDNA6/V5/His vector.
Preliminary attempts to select clones of HT-29 cells overexpressing
wt-PTEN were unsuccessful, probably because of the induction of cell
death induced by the forced expression of PTEN as reported previously
(22). To circumvent this difficulty, His-tagged constructs expressing
either wt-PTEN or an inactive phosphatase mutant (C124S) or the G129E
phosphoinositide phosphatase-deficient mutant were transfected after
insertion into the IPTG-inducible pOPRSVI/MCS operator vector together
with a Lac-repressor-expressing vector. HT-29 cells overexpressing the
pOPRSVI/MCS operator vector with no insert were used as a control.
G418- and hygromycin B-resistant clones were selected, and PTEN
expression was measured at different times after the addition of 5 mM IPTG. After 16 h of induction, expression of PTEN
in the selected clones was detected by immunoblotting using a
monoclonal antibody directed against the polyhistidine tag (Fig.
2A). Under these conditions no
detectable signs of cell death were observed, and a 2.5-fold increase
of PTEN proteins was detected using an anti-PTEN antibody (data not
shown). IL-13 is known to activate Akt/PKB in HT-29 cells in a class I
PI 3-K-dependent manner (13, 23). When wt-PTEN-expressing
cells were challenged with IL-13 after IPTG addition, we observed a
decrease in Akt/PKB phosphorylation when compared with the control
cells (Fig. 2B). In contrast, a robust Akt/PKB
phosphorylation was observed either in C124S- or G129E-expressing cells
after IPTG addition. Whatever the cell population considered no
modification of the PI 3-K activity was observed in presence or absence
of IPTG (data not shown), demonstrating that PTEN functions downstream
of PI 3-K as expected.
Up-regulation of Autophagy Is Dependent upon the Lipid Phosphatase
Activity of PTEN--
We have shown previously that stimulation of
class I PI 3-K by IL-13 decreased the autophagic capacities of HT-29
cells (13) in a similar way to that observed after treatment with 3-MA,
an inhibitor of autophagy (11). By contrast, in wt-PTEN-overexpressing cells autophagy was no longer sensitive to IL-13 treatment but still
sensitive to 3-MA as determined by the degradation of
[14C]valine-labeled long-lived proteins (Fig.
3) and the rate of sequestration of the
cytosolic enzyme LDH into autophagic vacuoles (Table
I). The increase of autophagic capacity
observed in wt-PTEN-overexpressing cells after treatment with IL-13
could be due to the reduction of basal level of phosphatidylinositide
(3,4,5)P3 in this cell population. As expected autophagy
was reduced by IL-13 in C124S PTEN-expressing cells in the presence of
IPTG. More importantly IL-13 also decreased the rate of autophagy in
cells expressing the G129E mutant, which has only retained the protein
phosphatase activity of PTEN. From these results we concluded that the
lipid phosphatase activity of PTEN is required to control
autophagy.
Activation of Akt/PKB Negatively Regulates the Autophagic
Signaling--
To demonstrate the role of Akt/PKB in the control of
autophagy, HT-29 cells were stably transfected with the HA-tagged
constitutively active form of Akt/PKB (MyrPKB) or the
HA-tagged dominant negative mutant of Akt/PKB (kdPKB), and
expression of both proteins was detected using a monoclonal antibody
raised against the HA-tag and a polyclonal anti-Akt/PKB antibody (Fig.
4A). Moreover, the
constitutive active form of Akt/PKB was operative as determined by the
analysis of the phosphorylation of GSK-3 The results presented here demonstrate that the signaling control
of autophagy depends upon the activity of the tumor suppressor PTEN.
Somatic mutations or deletion of PTEN are frequently
observed in a large variety of cancers either at early or late stages
of development (15, 25). Similarly to other colon cancer cell lines,
HT-29 cells express wt-PTEN (26). This result is in line with the
observation that PTEN's loss of function is not a common event in
colorectal cancers (27, 28). Our data may explain why in contrast to
most cancer cells, autophagy is not down-regulated in HT-29 colon
cancer cells. However, alterations in PTEN expression and function is
not the only cause for the low rate of autophagy in cancer cells.
Recently, the protein Beclin 1 has been reported to stimulate autophagy
and to suppress tumorigenesis in breast cancer cells (5).
Interestingly, Beclin 1 interacts with the class III PI 3-K in
mammalian cells (29), suggesting that it is probably part of the
machinery engaged in the formation of autophagic vacuoles. Together
these data show that PTEN and Beclin 1, two proteins with
tumor-suppressive properties, control autophagy at different levels,
i.e. signaling and autophagosome formation, respectively.
The role of PTEN in controlling autophagy is dependent upon its lipid
phosphatase activity, which antagonizes the inhibitory effect of the PI
3-K/PKB pathway on the autophagic sequestration. These results point to
a molecular connection existing between autophagy and cell death,
because it is now well established that cell survival signaling is
operative through the activation of Akt/PKB (30). Conversely,
expression of wt-PTEN or its forced expression counteracts the
Akt/PKB-dependent cell survival (26, 31). Although the role
of autophagy in the execution of a programmed cell death remains to be
elucidated, several studies have pointed to its importance in the type
II cell death (autophagic cell death) (32) as well as in the modulation
of type I cell death (apoptosis) (33). The recent demonstration that
PTEN is essential for embryonic development (34) and that a high
expression of PTEN was detected in different tissues during human
development (35) give credit to the idea that autophagy is instrumental
during development (36) and could utilize some regulatory mechanisms
common with those of apoptosis (37).
The role of Akt/PKB in the negative control of autophagy is compatible
with the IL-13 signal transduction pathway and the effect of PTEN.
Among the known targets of Akt/PKB several lines of evidence indicate
that the kinase target of rapamycin (TOR) occupies a central position
in the signaling cascade of autophagy in eucaryotic cells (38-40).
However amino acids, which are physiological inhibitors of autophagy
(reviewed in Ref. 41), activate mTOR by an Akt/PKB-independent
mechanism in different models including HT-29 cells (42,
43).2 Further studies are
needed to elucidate the mechanism involved in the control of autophagy
by the PI 3-K/PTEN/PKB pathway. Nevertheless the data reported here
point to the molecular connection between the control of a major
catabolic route and that of a signaling pathway frequently altered in
human cancers.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-thiogalactopyranoside (IPTG) were
from Stratagene (La Jolla, CA). Monoclonal antibody directed against
polyhistidine tag (C terminus), blasticidin and pcDNA6/V5-His A, B,
C vectors were from Invitrogen (Carlsbad, CA). Monoclonal antibody
against the HA epitope was from Roche Molecular Biochemicals
(Mannhein, Germany). Rabbit anti-PTEN, rabbit anti-actin, rabbit
anti-phospho-Akt/PKB (Thr308), sheep anti-Akt/PKB,
sheep anti-phospho-GSK-3
, and sheep anti-GSK-3
antibodies were
from Upstate Biotechnology (Lake Placid, NY). IL-13 and cDNA
encoding for the myristoylated and dead forms of HA-tagged Akt/PKB were
kindly provided by A. Minty (Sanofi Elf Biorecherche, Labege,
France), Dr. T. F. Franke (Columbia University, New York, NY), and
Dr. P. N. Tsichlis (Fox Chase Cancer Center, Philadelphia, PA),
respectively. L-[U-14C]valine (specific
activity: 288.5 mCi/mmol) and enhanced chemiluminescence detection kit
were from Amersham Pharmacia Biotech (Les Ulis, France).
, and anti-GSK-3
antibodies were used at 1:1000
dilution. The monoclonal anti-His and anti-HA antibodies were used at
1:2500 and 1:3000 dilution, respectively.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (21K):
[in a new window]
Fig. 1.
HT-29 cells express the wild-type form of
PTEN. Expression of the endogenous PTEN protein in HT-29 cells.
Western blot (WB) analysis using a polyclonal anti-PTEN
antibody on whole cell lysates of HT-29 cells.

View larger version (21K):
[in a new window]
Fig. 2.
Effect of overexpression of PTEN on
IL-13-dependent phosphorylation of Akt/PKB in HT-29
cells. A, induction of PTEN expression in
HT-29-Lac-repressor-expressing cells containing IPTG-inducible
pOPRSVI/MCS PTEN cDNA expression constructs (His-tagged wt-PTEN,
C124S, and G129E PTEN mutants). Expression levels were compared after
16-h culture in the presence (+) or absence (
) of 5 mM IPTG by Western blot using a monoclonal anti-His
antibody (top). HT-29-Lac-repressor-expressing cells
containing IPTG-inducible pOPRSVI/MCS operator vector with no insert
were used as control (vector). Control blot with antibody
against actin was performed (bottom). B, effect
of PTEN on Akt/PKB phosphorylation. Cell populations were first induced
for 16 h with 5 mM IPTG and then cultured in the
presence (+) or absence (
) of 30 ng/ml IL-13 for 4 h. Levels of
phosphorylated (top) and total (bottom) Akt/PKB
protein were measured by Western blot using an anti-phospho-Akt/PKB
(Thr308) antibody and a pan-Akt/PKB antibody that
recognizes Akt/PKB independent of its phosphorylation status. Note that
the phosphorylation of Akt/PKB is dependent on PTEN expression and
functional phosphatase activity.

View larger version (18K):
[in a new window]
Fig. 3.
The phosphatidylinositide phosphatase
activity of PTEN is required to control autophagy in HT-29 cells.
HT-29-Lac-repressor-expressing cells containing IPTG-inducible
pOPRSVI/MCS PTEN cDNA expression constructs (His-tagged wt-PTEN,
C124S, and G129E PTEN mutants) were radiolabeled with 0.2 µCi/ml
[14C]valine for 16 h in complete medium containing 5 mM IPTG and chased for 4 h in nutrient-free medium
containing 5 mM cold valine and 5 mM IPTG. When
used 3-MA (10 mM) and IL-13 (30 ng/ml) were present during
the chase period. The values reported are the means of three
independent experiments ± S.D.
Autophagic sequestration of LDH in HT-29 cell populations
using a polyclonal
phospho-GSK-3
antibody, a direct substrate of Akt/PKB (24). As shown
in Fig. 4B, GSK-3
was phosphorylated in cells transfected
with the MyrPKB construct, whereas phosphorylation of
GSK-3
was not detected in cells transfected with the
kdPKB construct or in control cells. Autophagic parameters
(proteolysis, see Fig. 4C, and the rate of LDH
sequestration, see Table I) were dramatically decreased in
MyrPKB-expressing cells when compared with control cells.
By contrast, 3-MA-sensitive autophagy was up-regulated in
kdPKB-expressing cells, demonstrating that activation of
Akt/PKB negatively regulates the autophagic signaling pathway.

View larger version (16K):
[in a new window]
Fig. 4.
Activation of Akt/PKB negatively regulates
the autophagic pathway. A, HT-29 cells were
transfected with HA-tagged pCMV6 Akt/PKB expression constructs
(constitutive active form of Akt/PKB (MyrPKB) or dominant
negative mutant of Akt/PKB (kdPKB)). HA-tagged pCMV6 with
no insert was used as control (vector). Levels of
transfected Akt/PKB proteins were measured by Western blot using an
anti-HA antibody (top) and pan-Akt/PKB antibody
(bottom). Note that this latter antibody recognizes both
endogenous and HA-tagged Akt/PKB proteins. B, measurement of
Akt/PKB activity. Levels of phospho-GSK-3
and total GSK-3
were measured by Western blot using an anti-phospho-GSK-3
antibody
and a pan-GSK-3
antibody. C, measurement of
[14C]valine long-lived protein degradation in cells
transfected without (vector) or with Akt/PKB construct in
the presence (+) or in absence (
) of 10 mM 3-MA was
performed as described in the legend of Fig. 3. Data are the means of
three independent experiments ± S.D.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
| |
ACKNOWLEDGEMENTS |
|---|
We thank A. Minty (Sanofi Elf Biorecherche, Labege, France), T. F. Franke (Columbia University, New York, NY), and P. N. Tsichlis (Fox Chase Cancer Center, Philadelphia, PA) for the gifts of IL-13, MyrPKB and kdPKB, respectively. We also thank Dr. S. E. H. Moore for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by institutional funding from the INSERM and by grants from the Association pour la Recherche sur le Cancer (5831), Vaincre les Maladies Lysosomales, and the Ligue Nationale contre le Cancer. This work is part of a bilateral project of INSERM/NWO.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Present address: Dept. of Biochemistry, Sciences II, University of Geneva, 30 quai Ernest Ansermet, 12114 Geneva, Switzerland.
To whom correspondence should be addressed: INSERM U504,
Glycobiologie et Signalisation Cellulaire, 16 Avenue
Paul-Vaillant-Couturier, 94807 Villejuif Cedex, France. Tel.:
33-1-45-59-50-41; Fax: 33-1-46-77-02-33; E-mail:
codogno@vjf.inserm.fr.
Published, JBC Papers in Press, July 26, 2001, DOI 10.1074/jbc.C100319200
2 S. Arico, A. Petiot, C. Bauvy, P. F. Dubbelhuis, A. J. Meijer, P. Codogno, and E. Ogier-Denis, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are:
3-MA, 3-methyladenine;
Akt/PKB, protein kinase B;
GSK-3
, glycogen synthase
kinase-3
;
HA, hemagglutinin;
His, polyhistidine;
IL, interleukin;
IPTG, isopropyl-
-D-thiogalactopyranoside;
kd, kinase
dead;
LDH, lactate dehydrogenase;
Myr, myristoylated;
PCR, polymerase
chain reaction;
PI 3-K, phosphatidylinositol 3-kinase;
wt, wild-type.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Dunn, W. A., Jr. (1994) Trends Cell Biol. 4, 139-143 |
| 2. | Bohley, P., and Seglen, P. O. (1992) Experientia (Basel) 48, 151-157 |
| 3. | Mortimore, G. E., and Kadowaki, M. (1994) in Cellular Proteolytic Systems (Ciechanover, A. J. , and Schwartz, A. L., eds) , pp. 65-87, Wiley-Liss, New York |
| 4. | Tanaka, Y., Guhde, G., Suter, A., Eskelinen, E. L., Hartmann, D., Lullmann-Rauch, R., Janssen, P. M. L., Blanz, J., von Figura, K., and Saftig, P. (2000) Nature 406, 902-906 |
| 5. | Liang, X. H., Jackson, S., Seaman, M., Brown, K., Kempkes, B., Hibshoosh, H., and Levine, B. (1999) Nature 402, 672-676 |
| 6. | Klionsky, D. T., and Ohsumi, Y. (1999) Annu. Rev. Cell Dev. Biol. 15, 1-32 |
| 7. | Ohsumi, Y. (2001) Nat. Rev. Mol. Cell. Biol. 2, 211-216 |
| 8. | Blommaart, E. F. C., Luiken, J. J. F. P., and Meijer, A. J. (1997) Histochem. J. 29, 365-385 |
| 9. | Codogno, P., Ogier-Denis, E., and Houri, J. J. (1997) Cell. Signal. 9, 125-130 |
| 10. | Klionsky, D. J., and Emr, S. D. (2000) Science 290, 1717-1721 |
| 11. | Seglen, P. O., and Gordon, P. B. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 1889-1892 |
| 12. | Blommaart, E. F. C., Krause, U., Schellens, J. P. M., Vreeling-Sindelárová, H., and Meijer, A. J. (1997) Eur. J. Biochem. 243, 240-246 |
| 13. | Petiot, A., Ogier-Denis, E., Blommaart, E. F. C., Meijer, A. J., and Codogno, P. (2000) J. Biol. Chem. 275, 992-998 |
| 14. | Kihara, A., Noda, T., Ishihara, N., and Ohsumi, Y. (2001) J. Cell Biol. 152, 519-530 |
| 15. | Di Cristofano, A., and Pandolfi, P. P. (2000) Cell 100, 387-390 |
| 16. | Li, J., Yen, C., Liaw, D., Podsypania, K., Bose, S., Wag, S. I., Puc, J., Miliaresis, C., Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C., Ittmann, M., Tycko, B., Hibshoosh, H., Wigler, M. H., and Parsons, R. (1997) Science 275, 1943-1947 |
| 17. | Myers, M. P., Stolarov, J. P., Eng, C., Li, J., Wang, S. I., Wigler, M. H., Parsons, R., and Tonks, N. K. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 9052-9057 |
| 18. | Maehama, T., and Dixon, J. E. (1998) J. Biol. Chem. 273, 13375-13378 |
| 19. | Wu, X. Y., Senechal, K., Neshat, M. S., Whang, Y. E., and Sawyers, C. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 15587-15591 |
| 20. | Ogier-Denis, E., Couvineau, A., Maoret, J. J., Houri, J. J., Bauvy, C., Destefanis, D., Isidoro, C., Laburthe, M., and Codogno, P. (1995) J. Biol. Chem. 270, 13-16 |
| 21. | Ogier-Denis, E., Houri, J. J., Bauvy, C., and Codogno, P. (1996) J. Biol. Chem. 271, 28593-28600 |
| 22. | Weng, L. P., Smith, W. M., Dahia, P. L. M., Ziebold, U., Gil, E., Lees, J. A., and Eng, C. (1999) Cancer Res. 59, 5808-5814 |
| 23. | Wright, K., Kolios, G., Westwick, J., and Waed, S. G. (1999) J. Biol. Chem. 274, 18515-18523 |
| 24. | Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovic, M., and Hemmings, B. A. (1995) Nature 378, 785-789 |
| 25. | Cantley, L. C., and Neel, B. G. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 4240-4245 |
| 26. | Li, J., Simpson, L., Takahashi, M., Miliaresis, C., Myers, M. P., Tonks, N., and Parsons, R. (1998) Cancer Res. 58, 5667-5672 |
| 27. | Wang, Z. J., Taylor, F., Churchman, M., Norbury, G., and Tomlinson, I. (1998) Am. J. Pathol. 153, 363-366 |
| 28. | Guanti, G., Resta, N., Simone, C., Cariola, F., Demma, I., Fiorente, P., and Gentile, M. (2000) Hum. Mol. Genet. 9, 283-287 |
| 29. | Kihara, A., Kabeya, Y., Ohsumi, Y., and Yoshimori, T. (2001) EMBO Rep. 2, 330-335 |
| 30. | Vanhaesebroeck, B., and Alessi, D. R. (2000) Biochem. J. 346, 561-576 |
| 31. | Wang, X., Gjörloff-Wingren, A., Saxena, M., Pathan, N., Reed, J. C., and Mustelin, T. (2000) J. Immunol. 164, 1934-1939 |
| 32. | Zakeri, Z., Bursch, W., Tenniswood, M., and Lockshin, R. A. (1995) Cell Death Diff. 2, 83-92 |
| 33. | Lemasters, J. J., Nieminen, A. L., Qian, T., Trost, L. C., Elmore, S. P., Nishimura, Y., Crowe, R. A., Cascio, W. E., Bradham, C. A., Brenner, D. A., and Herman, B. (1998) Biochim. Biophys. Acta 1366, 177-196 |
| 34. | Di Cristofano, A., Pesce, B., Cordon-Cardo, C., and Pandolfi, P. P. (1998) Nat. Genet. 19, 348-355 |
| 35. | Gimm, O., Attie-Bitach, T., Lees, J. A., Vekemans, M., and Eng, C. (2000) Hum. Mol. Genet. 9, 1633-1639 |
| 36. | Clarke, P. G. H. (1990) Anat. Embryol. 181, 195-213 |
| 37. | Lee, C.-Y., and Baehrecke, E. H. (2001) Development (Camb.) 128, 1443-1455 |
| 38. | Blommaart, E. F. C., Luiken, J. J. F. P., Blommaart, P. J. E., Vanwoerkom, G. M., and Meijer, A. J. (1995) J. Biol. Chem. 270, 2320-2326 |
| 39. | Noda, T., and Ohsumi, Y. (1998) J. Biol. Chem. 273, 3963-3966 |
| 40. | Rohde, J., Heitman, J., and Cardenas, M. E. (2001) J. Biol. Chem. 276, 9583-9586 |
| 41. | van Sluijters, D. A., Dubbelhuis, P. F., Blommaart, E. F. C., and Meijer, A. J. (2000) Biochem. J. 351, 545-550 |
| 42. | Hara, K., Yonezawa, K., Weng, Q.-P., Kozlowski, M. T., Belham, C., and Avruch, J. (1998) J. Biol. Chem. 273, 14484-14494 |
| 43. | Kimball, S. R., Shantz, L. M., Horetsky, R. L., and Jefferson, L. S. (1999) J. Biol. Chem. 274, 11647-11652 |
This article has been cited by other articles:
![]() |
X. Zeng and T. J. Kinsella Mammalian Target of Rapamycin and S6 Kinase 1 Positively Regulate 6-thioguanine-Induced Autophagy Cancer Res., April 1, 2008; 68(7): 2384 - 2390. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Verma, S. Guha, H. Wang, J. Y. Fok, D. Koul, J. Abbruzzese, and K. Mehta Tissue Transglutaminase Regulates Focal Adhesion Kinase/AKT Activation by Modulating PTEN Expression in Pancreatic Cancer Cells Clin. Cancer Res., April 1, 2008; 14(7): 1997 - 2005. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Newman, Y. Kondo, T. Yokoyama, S. Dixon, C. Cartwright, D. Chan, M. Johansen, and Peiying Yang Autophagic Cell Death of Human Pancreatic Tumor Cells Mediated by Oleandrin, a Lipid-Soluble Cardiac Glycoside Integr Cancer Ther, December 1, 2007; 6(4): 354 - 364. [Abstract] [PDF] |
||||
![]() |
E. Y. W. Chan, S. Kir, and S. A. Tooze siRNA Screening of the Kinome Identifies ULK1 as a Multidomain Modulator of Autophagy J. Biol. Chem., August 31, 2007; 282(35): 25464 - 25474. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Aoki, Y. Takada, S. Kondo, R. Sawaya, B. B. Aggarwal, and Y. Kondo Evidence That Curcumin Suppresses the Growth of Malignant Gliomas in Vitro and in Vivo through Induction of Autophagy: Role of Akt and Extracellular Signal-Regulated Kinase Signaling Pathways Mol. Pharmacol., July 1, 2007; 72(1): 29 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamatake, M. Maeda, T. Kadowaki, R. Takii, T. Tsukuba, T. Ueno, E. Kominami, S. Yokota, and K. Yamamoto Role for Gingipains in Porphyromonas gingivalis Traffic to Phagolysosomes and Survival in Human Aortic Endothelial Cells Infect. Immun., May 1, 2007; 75(5): 2090 - 2100. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Akar, B. Ozpolat, K. Mehta, J. Fok, Y. Kondo, and G. Lopez-Berestein Tissue Transglutaminase Inhibits Autophagy in Pancreatic Cancer Cells Mol. Cancer Res., March 1, 2007; 5(3): 241 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jin, R. S. DiPaola, R. Mathew, and E. White Metabolic catastrophe as a means to cancer cell death J. Cell Sci., February 1, 2007; 120(3): 379 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kissova, L.-T. Plamondon, L. Brisson, M. Priault, V. Renouf, J. Schaeffer, N. Camougrand, and S. Manon Evaluation of the Roles of Apoptosis, Autophagy, and Mitophagy in the Loss of Plating Efficiency Induced by Bax Expression in Yeast J. Biol. Chem., November 24, 2006; 281(47): 36187 - 36197. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cao, T. Subhawong, J. M. Albert, K. W. Kim, L. Geng, K. R. Sekhar, Y. J. Gi, and B. Lu Inhibition of Mammalian Target of Rapamycin or Apoptotic Pathway Induces Autophagy and Radiosensitizes PTEN Null Prostate Cancer Cells. Cancer Res., October 15, 2006; 66(20): 10040 - 10047. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Li, E. Capan, Y. Zhao, J. Zhao, D. Stolz, S. C. Watkins, S. Jin, and B. Lu Autophagy Is Induced in CD4+ T Cells and Important for the Growth Factor-Withdrawal Cell Death J. Immunol., October 15, 2006; 177(8): 5163 - 5168. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Hippert, P. S. O'Toole, and A. Thorburn Autophagy in Cancer: Good, Bad, or Both? Cancer Res., October 1, 2006; 66(19): 9349 - 9351. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Shen, N. S. Brown, P. F. Finn, J. F. Dice, and H. A. Franch Akt and Mammalian Target of Rapamycin Regulate Separate Systems of Proteolysis in Renal Tubular Cells J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2414 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Corcelle, M. Nebout, S. Bekri, N. Gauthier, P. Hofman, P. Poujeol, P. Fenichel, and B. Mograbi Disruption of Autophagy at the Maturation Step by the Carcinogen Lindane Is Associated with the Sustained Mitogen-Activated Protein Kinase/Extracellular Signal-Regulated Kinase Activity. Cancer Res., July 1, 2006; 66(13): 6861 - 6870. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. N. Hait, S. Jin, and J.-M. Yang A Matter of Life or Death (or Both): Understanding Autophagy in Cancer. Clin. Cancer Res., April 1, 2006; 12(7): 1961 - 1965. [Full Text] [PDF] |
||||
![]() |
G. Lavieu, F. Scarlatti, G. Sala, S. Carpentier, T. Levade, R. Ghidoni, J. Botti, and P. Codogno Regulation of Autophagy by Sphingosine Kinase 1 and Its Role in Cell Survival during Nutrient Starvation J. Biol. Chem., March 31, 2006; 281(13): 8518 - 8527. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pattingre and B. Levine Bcl-2 inhibition of autophagy: a new route to cancer? Cancer Res., March 15, 2006; 66(6): 2885 - 2888. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lindmo and H. Stenmark Regulation of membrane traffic by phosphoinositide 3-kinases J. Cell Sci., February 15, 2006; 119(4): 605 - 614. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Ellington, M. A. Berhow, and K. W. Singletary Inhibition of Akt signaling and enhanced ERK1/2 activity are involved in induction of macroautophagy by triterpenoid B-group soyasaponins in colon cancer cells Carcinogenesis, February 1, 2006; 27(2): 298 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. KELEKAR Autophagy Ann. N.Y. Acad. Sci., December 1, 2005; 1066(1): 259 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Paglin, N.-Y. Lee, C. Nakar, M. Fitzgerald, J. Plotkin, B. Deuel, N. Hackett, M. McMahill, E. Sphicas, N. Lampen, et al. Rapamycin-Sensitive Pathway Regulates Mitochondrial Membrane Potential, Autophagy, and Survival in Irradiated MCF-7 Cells Cancer Res., December 1, 2005; 65(23): 11061 - 11070. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhou, J. B. Trudeau, K. J. Schoonover, J. I. Lundin, S. M. Barnes, M. J. Cundall, and S. E. Wenzel Interleukin-13 augments transforming growth factor-{beta}1-induced tissue inhibitor of metalloproteinase-1 expression in primary human airway fibroblasts Am J Physiol Cell Physiol, February 1, 2005; 288(2): C435 - C442. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shintani and D. J. Klionsky Autophagy in Health and Disease: A Double-Edged Sword Science, November 5, 2004; 306(5698): 990 - 995. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kissova, M. Deffieu, S. Manon, and N. Camougrand Uth1p Is Involved in the Autophagic Degradation of Mitochondria J. Biol. Chem., September 10, 2004; 279(37): 39068 - 39074. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Daido, T. Kanzawa, A. Yamamoto, H. Takeuchi, Y. Kondo, and S. Kondo Pivotal Role of the Cell Death Factor BNIP3 in Ceramide-Induced Autophagic Cell Death in Malignant Glioma Cells Cancer Res., June 15, 2004; 64(12): 4286 - 4293. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Scarlatti, C. Bauvy, A. Ventruti, G. Sala, F. Cluzeaud, A. Vandewalle, R. Ghidoni, and P. Codogno Ceramide-mediated Macroautophagy Involves Inhibition of Protein Kinase B and Up-regulation of Beclin 1 J. Biol. Chem., April 30, 2004; 279(18): 18384 - 18391. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Opipari Jr., L. Tan, A. E. Boitano, D. R. Sorenson, A. Aurora, and J. R. Liu Resveratrol-induced Autophagocytosis in Ovarian Cancer Cells Cancer Res., January 15, 2004; 64(2): 696 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yue, S. Jin, C. Yang, A. J. Levine, and N. Heintz Beclin 1, an autophagy gene essential for early embryonic development, is a haploinsufficient tumor suppressor PNAS, December 9, 2003; 100(25): 15077 - 15082. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Melendez, Z. Talloczy, M. Seaman, E.-L. Eskelinen, D. H. Hall, and B. Levine Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in C. elegans Science, September 5, 2003; 301(5638): 1387 - 1391. [Abstract] [Full Text] [PDF] |
||||
|
|