Originally published In Press as doi:10.1074/jbc.M103735200 on July 26, 2001
J. Biol. Chem., Vol. 276, Issue 39, 36303-36310, September 28, 2001
p53 Phosphorylation at Serine 15 Is Required for Transcriptional
Induction of the Plasminogen Activator Inhibitor-1 (PAI-1) Gene by the
Alkylating Agent
N-Methyl-N'-nitro-N-nitrosoguanidine*
Maribel
Parra
§,
Mercè
Jardí§,
Magdalena
Koziczak¶,
Yoshikuni
Nagamine¶, and
Pura
Muñoz-Cánoves
From the
Institut de Recerca Oncologica, Center
d'Oncologia Molecular, Aut. Castelldefels, km 2.7, L'Hospitalet
Ll., E-08907 Barcelona, Spain, and the ¶ Friedrich Miescher
Institute, CH-4002 Basel, Switzerland
Received for publication, April 26, 2001, and in revised form, July 13, 2001
 |
ABSTRACT |
The alkylating agent
N-methyl-N'-nitro-N-nitrosoguanidine
(MNNG) is a widely spread environmental carcinogen that causes
DNA lesions leading to cell killing. MNNG can also induce a
cell-protective response by inducing the expression of DNA
repair/transcription-related genes. We recently demonstrated that
urokinase-type plasminogen activator, an extracellular protease
to which no DNA repair functions have been assigned, was induced
by MNNG. Here, we show that the physiological inhibitor of
urokinase-type plasminogen activator, PAI-1, is also
induced by MNNG in a p53-dependent fashion, because MNNG induced PAI-1 in p53-expressing cells but not in p53
/
cells. MNNG induced p53 phosphorylation at serine 15, resulting in
stabilization of the p53 protein, and this phosphorylation event was
central for p53-dependent PAI-1 transcription. Finally, we
showed that PAI-1 transcriptional induction by MNNG required a
p53-responsive element located at
136 base pairs in the PAI-1
promoter, because specific mutation of this site abrogated the
induction. Because PAI-1 is a prognostic factor in many metastatic
cancers, being involved in the control of tumor invasiveness, our
finding that a genotoxic agent induces the PAI-1
gene via p53 adds a new feature to the role of the
tumor-suppressor p53 protein. Our results also suggest the
possibility that genotoxic agents contribute to tumor metastasis by
inducing PAI-1 without involving genetic modification.
 |
INTRODUCTION |
The plasminogen system is composed of an inactive zymogen,
plasminogen, that is converted to its active enzyme, plasmin, by two
physiological plasminogen activators
(PAs),1 tissue-type
plasminogen activator and urokinase-type plasminogen activator (uPA).
Their activity is controlled by plasminogen activator inhibitors
(PAIs), of which PAI-1 is the predominant physiological inhibitor
(reviewed in Ref. 1). The plasminogen/PA system plays a key role in
cancer progression, presumably via mediating extracellular matrix
degradation and tumor cell invasion. It is accepted that uPA initiates
a cascade of proteolysis at the cell surface, which leads to the
degradation of the extracellular matrix and thereby promotes cellular
migration. This is supported by the fact that uPA and its specific cell
surface receptor, uPAR, are highly expressed by invasive tumor cells or
by surrounding stromal cells, and they are both independent prognostic
indicators in human cancer. PAI-1 is the primary physiological
inhibitor of uPA. It regulates both the proteolytic activity of uPA as
well as the level of uPA-uPA receptor complex by promoting its
endocytosis (2, 3). Alternatively, PAI-1 may inhibit
vitronectin-mediated cell adhesion and migration through its avid
interaction with vitronectin (4-6). In agreement with this, the
transfection of PAI-1 gene in tumor cell lines such as human
prostate carcinoma PC-3 cells resulted in a decrease in primary tumor
size and decreased metastasis in vivo (7). Surprisingly,
however, high levels of PAI-1 are a bad prognostic factor in a number
of tumors including carcinomas of the lung, ovarium, breast, kidney,
gastric system, and colon (8-14). Furthermore, PAI-1-deficient
mice have been shown to be resistant to cancer invasion and
vascularization (15). In accordance with this observation, the
administration of exogenous PAI-1 to these mice was found to
promote tumor growth and angiogenesis. Very recently, several reports
have shed some light into the apparent paradox that PAI-1 promotes
tumor invasion. Bajou et al. (16) have demonstrated that PA/plasmin proteolysis, although essential, must be tightly controlled by PAI-1 during tumor angiogenesis, probably to allow vessel
stabilization and maturation. Other studies have shown that PAI-1 may
promote tumor growth through the inhibition of apoptosis, suggesting a
novel function for PAI-1 (17). Because it seems that PAI-1 plays
multiple roles, either beneficial or deleterious, in tumor progression,
the involvement of PAI-1 in cancer deserves further investigation.
Reports from over a decade ago indicated that environmental carcinogens
such as the alkylating agents mechlorethamine and N-methyl-N'-nitro-N-nitrosoguanidine
(MNNG) could induce the production of plasminogen activator in U-87MG
cells, an alkylation repair-deficient (Mer
) human glioblastoma
strain, at much higher levels than in alkylation repair-proficient
(Mer+) U-178MG cells (18). It was concluded that plasminogen activator
induction in alkylation repair-deficient human cells was caused by
unrepaired DNA damage and may represent a eukaryotic SOS-like function.
In fact, most of the MNNG-inducible genes identified in mammalian cells
seem to be involved in DNA repair in a way similar to that of the
bacterial SOS response. We have shown recently that DNA-damaging agents
such as MNNG induce the expression of uPA, an extracellular protease to
which no DNA repair functions have been assigned thus far, and
determined the mechanisms responsible for this induction (19). However,
the involvement of the uPA inhibitor, PAI-1, in the cell-inductive response to DNA-damaging agents has never been investigated.
Monofunctional alkylating agents such as MNNG and
methyl-methanesulfonate (MMS) are widely distributed environmental
mutagens and carcinogens that upon activation react with DNA and
proteins generating adducts (20-22). Among the adducts,
O-6-alkyl guanine (generated by N-alkylation of
the DNA base) is the predominant cytotoxic and mutagenic lesion because
of its mispairing properties, which eventually leads to chromosomal
aberrations, point mutations, and cell killing (23, 24). This lesion
also appears to be involved in tumor induction in particular gastric
carcinogenesis (25-28). However, monofunctional alkylating agents not
only cause cell destruction but also induce the transcription of many
genes including genes coding for transcriptions factors such as
c-fos, c-jun, junB, and
junD (29), for cell cycle regulatory proteins such as p53,
p21, and adenomatous polyposis coli (APC) tumor suppressor (30-33),
for growth arrest and DNA damage (GADD) proteins (34, 35), and for DNA
repair proteins such as
O-6-methylguanine-DNA-methyltransferase (MGMT) and DNA
polymerase
(
-pol) (36, 37). Recent evidence suggests that the
response to DNA-damaging agents may have a protective function other
than DNA repair (38, 39). The main effect of genotoxic agents on the
cell was believed to be chromosomal DNA damage, which in turn would
provide the primary signal triggering the response (40, 41). However,
genomic DNA has been ruled out as an absolute prerequisite for the
induction of certain cytoplasmic signaling molecules including c-Jun
N-terminal kinase activation in response to UV or MMS, because this
induction was also detected in enucleated cells (38, 42, 43). Wherever
generated, the alkylating signal, similar to the UV-induced signal,
seems to activate specific molecules that act as sensors of damage and initiate the cellular response to genotoxic stress (reviewed in Ref.
44).
The tumor suppressor p53 is considered to be a sensor of DNA damage. It
plays a central role in preserving genomic integrity by arresting cell
cycle progression or activating apoptosis after genotoxic stress
(reviewed in Refs. 45-47). The regulation of p53 is complex and
includes post-translational events such as phosphorylation and
acetylation (48). Phosphorylation at several different serine and
threonine residues in p53 has been shown to occur after cells are
exposed to DNA-damaging agents. The phosphorylation of serine 392 after
UV exposure may be important for p53 oligomerization (48), whereas
phosphorylation of N-terminal residues, in particular serine 15, after
both ionizing and UV radiation is important for stabilizing p53
(49-53). Chemopreventing agents such as restreverol and DNA-damaging
therapeutic agents such as cisplatin have also been shown to induce
serine 15 and serine 33 phosphorylation, and carcinogenic arsenic
derivatives can also induce p53 phosphorylation of serine 15 (54, 55). Although the exact functions of specific phosphorylation
events remain controversial, evidence indicates that they probably
contribute to both the stabilization and activation of p53. N-terminal
serine phosphorylations are believed to contribute to p53 stabilization
by preventing the binding of its negative regulator MDM2 and rendering
p53 more resistant to MDM2 (56, 57). In addition to potentially
regulating MDM2 binding, the phosphorylation of N-terminal serines may
be important for p53 interactions with the transcriptional coactivators
CBP/p300 and PCAF, thus potentiating the transcription of target genes
(58-60). Nevertheless, the picture of p53 phosphorylation at
N-terminal sites in response to genotoxic stress is incomplete. Certain
reports have shown that alkylating agents such as MMS, MNNG, and
mitomycin C, can induce an increase in p53 protein levels
(33, 61, 62); however, the mechanisms underlying this effect (including
phosphorylation) have not been understood fully. A recent study
proposed that MMS and mitomycin C, but not MNNG, caused down-regulation
of MDM2, which resulted in p53 stabilization (63). With this limited understanding, the mechanisms by which specific alkylating agents induce an increase in p53 need further investigation.
In the present study we show that the monofunctional alkylating agent
MNNG induces p53 phosphorylation at serine 15 but not at serine 392, correlating with the MNNG-induced stabilization of p53. We also
demonstrate that MNNG is a potent inducer of PAI-1 gene
expression. Specifically, we show that the PAI-1 gene is induced by MNNG in p53-expressing cells but not in cells lacking p53.
This induction required a p53-responsive element, located at
136 bp
in the PAI-1 promoter. Altogether, we provide a mechanism linking
external MNNG stimulation with the induction of the endogenous PAI-1 gene via phosphorylation of p53 at serine 15. Our
results suggest that genotoxic agents may contribute to tumor
metastasis by inducing PAI-1 without involving genetic modification.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
The murine NIH3T3 cell line was obtained from
the American Type Culture Collection and grown in Dulbecco's modified
Eagle's medium containing 10% FBS. p53
/
and p53+/+ 3T3 cell lines
were provided kindly by Dr. E. F. Wagner. For MNNG stimulation,
the cells were kept in Dulbecco's modified Eagle's medium containing 0.5% FBS for 16 h. The next day, cells were treated with MNNG (70 µM) for different periods of time. Alternatively, cells
were UV-irradiated at 254 nm (30 J/m2). MNNG was purchased
from Sigma and dissolved in a small amount of Me2SO
and diluted with sterile water according to Kaina et al.
(36); the MNNG stocks were stored in batches at
80 °C for up to 2 weeks.
Northern Analysis--
Total RNA was extracted from cells using
the commercial Ultraspec RNA isolation system (Biotecx) based on the
Chomczynski and Sacchi method (64). RNAs were size-fractionated by
electrophoresis on 1% agarose gels, transferred to nylon membranes by
capillarity, and UV cross-linked. Membrane prehybridization, probe
hybridization, washes, and autoradiography were performed as described
(65). cDNA probes used for RNA hybridizations were labeled with
[
-32P]dCTP by a standard random oligo-primed reaction
using the commercial Megaprime DNA labeling system (Amersham Pharmacia
Biotech).
Plasmids--
PAI-1 promoter-luciferase reporter plasmids,
p1500-Luc, p800-Luc, p187-Luc, and p100-Luc (kindly provided by
Drs. D. J. Loskutoff and A. J. van Zonneveld), contain
1500, 800, 187, and 100 bp, respectively, of the PAI-1 promoter region
and 72 bp of 5'-untranslated region (+72) as described (66).
p800-Luc(mt p53), containing a mutated PAI-1 p53-responsive element,
was generated using the QuikChange site-directed mutagenesis kit
(Stratagene) on p800-Luc according to the manufacturer protocol. The
p53-responsive element of the PAI-1 promoter, located at position
136, was mutated from ACACATGCCTCAGCAAGTCC to
ACACATGCCTCAGAAATTCC. The pPG13-Luc plasmid contains 13 copies of a synthetic consensus p53-binding site linked to
the polyoma virus early promoter (60). pCMV-p53 and pCMV-p53(S15A) plasmids, expressing p53 wild type and p53 containing an alanine in
position 15, respectively, were provided kindly by Dr. D. W. Meek.
Western Blotting--
Cells were cultured in 0.5% FBS, and at
the indicated time points post-treatment, whole-cell extracts (WCEs)
were prepared by lysing the cells in 20 mM HEPES, pH 7.5, 10 mM EGTA, 40 mM
-glycerophosphate, 1%
Nonidet P-40, 2.5 mM MgCl2, 2 mM
orthovanadate, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, and 1 µg/ml
leupeptin. p53 protein was detected using a p53 antibody (FL-393) from
Santa Cruz Biotechnology (sc-6243-G). To detect phosphorylated p53, the
cell pellet was incubated 10 min at room temperature in 3 packed
volumes of phospho-extraction buffer (20 mM Tris-HCl, pH
7.5, 20 mM p-nitrophenylphosphate, 1 mM EGTA, 50 mM sodium fluoride, 50 µM sodium orthovanadate, 5 mM benzamidine,
100 mM NaCl, and 5 mM MgCl2
supplemented with 40 µg/ml DNase I and 1 µg/ml protease
inhibitors) and sonicated. After incubation with the sample buffer for
5 min at 95 °C, samples were loaded and separated on a 10%
SDS-polyacrylamide gel electrophoresis. Alternatively, phosphorylated
p53 was detected using anti-phospho-p53 (serine 15) and
anti-phospho-p53 (serine 392) antibodies (Cell Signaling-NEB, 9284S and
9281S, respectively). Immunoblots were developed using the ECL
detection system (Amersham Pharmacia Biotech).
Transfections Assays--
For transient transfection assays,
reporter plasmids were transfected using the liposome-mediated
transfection reagent
N-[-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (Roche Molecular Biochemicals). 1.5 × 105 cells were seeded overnight on 6-well dishes. The next
day, cells were cotransfected with 1 µg of PAI-1-luciferase plasmid
and 0.5 µg of RSV-
Gal, as internal control. After transfection,
the cells were cultured in Dulbecco's modified Eagle's medium
containing 0.5% FBS for 16 h before MNNG stimulation (70 µM), and reporter activities were analyzed after 8 h
of MNNG treatment. When indicated, the cells were cotransfected with
1 µg of reporter plasmid and 5 or 500 ng of p53 expression
plasmids or empty vector alone together with 0.5 µg of internal
control. Firefly luciferase activities were standardized for
-galactosidase activity used as internal control. All
transfection/reporter assays were repeated at least three times,
showing less than 25% variability. A Student's t test was
used to validate the results.
For stable transfection assays, NIH3T3 cells were seeded at
106 cells/100-mm dish in duplicate cultures and
cotransfected the following day with 10 µg of PAI-1-Luc constructs
and 1 µg of pRSV-neo plasmid using
N-[-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate transfection reagent. Two days later, G418 (Sigma) was
added to the culture medium, and selection proceeded for 15 days. More
than 300 colonies were pooled for each construct, expanded, and
analyzed for luciferase activity, which was standardized to the
transfection efficiency of each plasmid. To assess transfection efficiency, the gene copy number was measured by Southern blotting. Briefly, DNA was extracted, digested with SalI and
XbaI, size-fractionated, and blotted. Hybridization was
performed with
-32P-labeled luciferase probe as
described in Ref. 67.
Electrophoretic Mobility Shift Assays (EMSAs)--
Nuclear
extracts were obtained from NIH3T3 cells before and after MNNG
treatment. The extraction of nuclear proteins was performed as
described by Miralles et al. (68). Briefly, the cells were washed twice in cold PBS and scraped, and the cellular pellet was
resuspended in 10 mM HEPES, pH 7.9, 10 mM KCl,
1.5 mM MgCl2, 0.1 mM EGTA, and 0.5 mM dithiothreitol on ice. The cells were passed five times
through a 26-gauge needle and centrifuged to collect nuclei, which were
subsequently resuspended in an equal volume of 10 mM HEPES,
pH 7.9, 0.4 M NaCl, 1.5 mM MgCl2,
0.1 mM EGTA, 0.5 mM dithiothreitol, and 5%
glycerol to allow the elution of nuclear proteins by gentle shaking at
4 °C for 30 min. The nuclei were pelleted at 14,000 rpm for 5 min at
4 °C, and the supernatant was aliquoted, snap-frozen in liquid
nitrogen, and stored at
80 °C until use. All solutions contained
the protease inhibitors leupeptin and aprotinin at 1 µg/ml,
phenylmethylsulfonyl fluoride (0.5 mM), and benzamidine (1 mM). A Bio-Rad protein assay was used to determine the
protein concentration. For electrophoretic mobility shift assays, 10 µg of nuclear extracts were incubated in 50 mM Tris-HCl,
pH 7.9, 12.5 mM MgCl2, 1 mM EDTA, 1 mM dithiothreitol, 20% glycerol, 0.5 mM
phenylmethylsulfonyl fluoride, and 2 µg of poly(dI-dC) for 10 min at
room temperature to titrate out nonspecific binding before the addition
of 15,000-20,000-cpm labeled oligonucleotide, and the reaction was
further incubated for 20 min at 30 °C. When indicated, nuclear
extracts were incubated with 0.2 µg of anti-p53 antibody pAb421
(Calbiochem, Ab-1). When unlabeled competing oligonucleotides were added, nuclear extracts were pre-incubated for 30 min at room
temperature before the addition of the labeled probe. Samples were
loaded on a pre-run 5% polyacrylamide gel (29:1 in 0.25× TBE) and
electrophoresed at 200 V. The gels were dried and autoradiographed at
80 °C.
The sequences of the sense strands of the oligonucleotides used in the
EMSAs are: p53-PAI-1, 5'-ACACACATGCCTCAGCAAGTCCCAGA-3' and IgkB,
5'-CAGAGGGGACTTTCCGAG-3'.
 |
RESULTS |
MNNG Induces PAI-1 mRNA Expression--
We recently
demonstrated the inducibility of the uPA gene by the
alkylating agent MNNG (19). In this study, we investigated the
inducibility of the uPA physiologic inhibitor, PAI-1, in the NIH3T3
fibroblast cell line. As shown in Fig.
1A, treatment of NIH3T3 cells
with MNNG increased PAI-1 transcript levels. PAI-1 mRNA induction
was not caused by an unspecific up-regulation of RNA synthesis, because
MNNG did not significantly modify the levels of
glyceraldehyde-3-phosphate dehydrogenase mRNA in these cells. The
increase in PAI-1 gene induction was
time-dependent, reaching its maximum 2-4 h after MNNG
treatment and decreasing thereafter (Fig. 1A,
upper). To gain an insight into the mechanisms leading to
increased PAI-1 mRNA expression in MNNG-treated cells, we studied the effects of RNA and protein synthesis inhibitors on the PAI-1 transcript level in cells that were stimulated with the alkylating agent. The protein synthesis inhibitor cycloheximide did not inhibit PAI-1 mRNA induction by MNNG in NIH3T3 cells (Fig. 1B);
moreover, cycloheximide by itself induced PAI-1 mRNA, suggesting
that MNNG stimulation of PAI-1 mRNA did not require de
novo protein synthesis (Fig. 1B and data not shown). In
contrast, PAI-1 mRNA induction by MNNG was abrogated in cells
treated with the RNA synthesis inhibitor actinomycin D (Fig.
1B). These data suggested that increased PAI-1
transcription, rather than message stabilization, was the mechanism
responsible for the MNNG-induced effect.

View larger version (59K):
[in this window]
[in a new window]
|
Fig. 1.
MNNG induces PAI-1 gene
expression. A, analysis of PAI-1 mRNA expression in
MNNG-stimulated NIH3T3 cells. Cells were cultured in 0.5% FBS for
16 h and then treated with MNNG (70 µM). Total RNA
was extracted at the indicated time points (in hours) after MNNG
stimulation and analyzed by Northern blotting using PAI-1 and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA
probes, respectively, as indicated. B, the effect of RNA and
protein synthesis inhibitors on MNNG-stimulated PAI-1 expression.
NIH3T3 cells were treated for 2 h with MNNG as described for
A except that cells were grown in the presence (+) or
absence ( ) of actinomycin D (ACT, 5 µg/ml) or
cycloheximide (CHX, 10 µg/ml), which were added 30 min
prior to the addition of MNNG.
|
|
PAI-1 Transcriptional Induction by MNNG Requires a p53-responsive
Element in the PAI-1 Promoter--
We next examined the effect of MNNG
on the activity of the PAI-1 gene promoter. First, a PAI-1
genomic fragment (
1500 kilobases to +72 bp) ligated upstream of the
luciferase reporter gene, p1500-Luc (66), was stably transfected in
NIH3T3 cells. From this construct, MNNG induced luciferase activity
4.5-fold (Fig. 2A), indicating that the murine PAI-1 promoter contains MNNG-responsive sequences that
might account, at least in part, for the MNNG-mediated induction of
PAI-1 in NIH3T3 cells. 5'-Deletion analysis of this construct using
identical stable transfection assays showed that p187-Luc retained full MNNG inducibilility, while a further deletion to p100-Luc
abrogated the induction completely (Fig. 2A). This result clearly indicated that cis element(s) responsible for MNNG
induction in these cells resided between
100 and
187 bp of the
PAI-1 promoter.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
MNNG induces PAI-1 transcription in NIH3T3
cells: requirement for a p53-responsive element in the PAI-1
promoter. A, the transcriptional induction of the PAI-1
promoter/luciferase-containing cell lines by MNNG. NIH3T3 cells were
stably transfected with different PAI-1 promoter-deletion mutants
containing 1500, 800, 187, and 100 bp, respectively. For each
PAI-1-luciferase plasmid transfection, neomycin-resistant colonies were
pooled, chimerical plasmid insertion was normalized by Southern blot
analysis with a luciferase DNA probe as described under "Experimental
Procedures," and the corresponding cell lines were treated or not
with MNNG for 8 h. The luciferase activities for each cell line
are expressed relative to the activity found in the corresponding
untreated cells, which was given a value of 1. Values represent the
mean value of four experiments. B, A p53-responsive element
in the PAI-1 promoter is required for MNNG transcriptional induction.
NIH3T3 cells stably transfected with the PAI-1 p800-Luc construct
containing a wild-type or a mutated p53 site (p800-Luc and p800-Luc(mt
p53), respectively) were treated or not with MNNG for 8 h. The
luciferase activity for each cell line is expressed relative to the
activity found in the untreated cells, which was given a value of 1. All normalized activities represent a minimum of four experiments,
showing less than 25% variability.
|
|
Within this region, a potential p53-responsive element has been
described (69); however, its functionality in mediating PAI-1 induction
in response to external stimuli has never been determined. Because MNNG
is a DNA-damaging agent and p53 is activated upon DNA damage,
suggesting a functional link between the two, we considered the
possibility that the PAI-1 p53-responsive element mediates the effect
of MNNG on the PAI-1 promoter. To address this possibility, we
generated a PAI-1-promoter-luciferase construct containing a specific
mutation in the p53-responsive element (p800-Luc(mt p53)), and the
luciferase inducibility by MNNG between this mutation-containing construct and its corresponding wild type was compared. Fig.
2B shows that mutation of the p53 site totally abrogated
luciferase induction by MNNG in NIH3T3 cells. This result demonstrated
the requirement of the p53 recognition site for PAI-1 transcriptional activation by MNNG.
p53 Protein Binding to the p53-responsive Element of the PAI-1
Promoter Is Induced by MNNG--
We next investigated whether the p53
site of the PAI-1 promoter showed increased p53 binding activity after
treatment of the cells with MNNG (Fig.
3). Nuclear extracts of nontreated and
MNNG-treated NIH3T3 cells were prepared at 0, 0.5, 1, 3, and 6 h
after treatment, and protein binding to the sequence of the PAI-1 p53
site was analyzed by EMSA. Detection of specific binding of endogenous p53 protein to p53 consensus sites by EMSA has proven to be difficult (70); however, the presence of an antibody against the C terminus of
the p53 molecule can enhance and stabilize p53 DNA binding (70, 71).
Accordingly, EMSA was performed with NIH3T3 nuclear extracts in the
absence or presence of the p53 antibody pAb421 (an antibody raised
against the C terminus of p53 amino acids 370-378). As shown in Fig.
3A, in the presence of the anti-p53 antibody, binding of p53
to the PAI-1 p53 site was enhanced and supershifted in
MNNG-treated NIH3T3 cells but not in untreated cells. When a cold
oligonucleotide of the same sequence was used as a specific competitor,
the formation of the corresponding antibody-protein-DNA complex was
prevented (Fig. 3B); in contrast, excess of an
oligonucleotide of an unrelated sequence (the
B site of the Ig
enhancer, Ig
B) did not affect the formation of the complex (Fig.
3B), further demonstrating the specificity of the
DNA-protein interaction. Altogether, these results demonstrated that
MNNG induces p53 binding to the PAI-1 promoter. They also indicated
that p53 may influence PAI-1 promoter activity after binding to the
PAI-1 p53 site. Therefore, we hypothesized that p53 might be mediating
endogenous PAI-1 gene activation by MNNG.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 3.
MNNG induces binding of p53 protein to the
p53-responsive element of the PAI-1 promoter. An EMSA was
performed to determine protein-DNA complex formation. A, the
induction of p53 protein binding to the PAI-1 p53 site. NIH3T3 cells
were grown in 0.5% FBS for 16 h and either treated (+) or not
( ) with MNNG (70 µM) for the indicated time points
(0-6 h). Nuclear extracts were prepared and incubated with 20,000 cpm
of the 32P-labeled p53 probe corresponding to the
p53-responsive element of the PAI-1 promoter in the absence or presence
of the anti-p53 antibody pAb421, which has been shown previously to
increase p53 binding to p53 sites. B, specificity of the
induced PAI-1 p53 binding activity. Nuclear extract induced for 3 h with MNNG was incubated with the labeled PAI-1 p53 oligonucleotide in
the presence of a 150-fold molar excess of the indicated competitors.
As described for A, all reactions contained the pAb421
antibody. The arrow indicates specific pAb421-p53-binding
complex. The photographs of the autoradiograms are representative of
three independent experiments.
|
|
Induction of Endogenous PAI-1 Gene by MNNG Depends on Wild-type p53
Expression--
The involvement of the p53 protein in the
activation of the endogenous PAI-1 gene by MNNG could be
verified by analyzing the inducibility of this gene in different
fibroblast cell lines varying in their p53 status. In particular, we
used p53
/
3T3 and p53+/+3T3 fibroblasts, established from
p53-deficient mice and from the corresponding wild-type parental mice,
respectively (72, 73), and the NIH3T3 cell line. First, we determined
the level of the p53 protein in all three cell lines before and after
2 h of stimulation with MNNG. As shown in Fig.
4A, p53 protein accumulated in
both NIH3T3 and in p53+/+3T3 fibroblasts after MNNG treatment but not in p53
/
3T3 cells, clearly confirming that these cells are
p53-deficient.

View larger version (67K):
[in this window]
[in a new window]
|
Fig. 4.
Induction of endogenous PAI-1
gene expression by MNNG depends on a functional p53.
A, induction of p53 protein levels by MNNG in different
fibroblast cell lines. WCEs were prepared as detailed under
"Experimental Procedures" from cells differing in p53 content
(cells derived from p53-deficient 3T3 mice (p53 / 3T3) and from
parental mice (p53+/+3T3) as well as from NIH3T3 cells), before and
after 2 h of stimulation with MNNG. 100 µg of WCEs were
analyzed by Western blotting using an anti-p53 antibody.
B, Northern analysis of PAI-1 induction by MNNG in cells
containing or lacking functional p53. Cells expressing wild-type p53,
p53+/+3T3, and cells derived from p53-deficient mice, p53 / 3T3, were
cultured in 0.5% FBS for 16 h and then treated with 70 µM MNNG for different lengths of time. Total RNA was
extracted at the indicated time points (in hours) after MNNG
stimulation and analyzed by Northern blotting using the PAI-1 cDNA
and the 18S oligonucleotide as probes.
|
|
To investigate whether the presence of p53 has any effect on the
induction of the endogenous PAI-1 gene product, we analyzed PAI-1 mRNA induction by MNNG in p53+/+ and p53
/
3T3 cells. As shown in Fig. 4B, in p53+/+3T3 fibroblasts, PAI-1 mRNA
was induced after MNNG treatment, being the induction maximal after
2 h; in contrast, no significant increase in PAI-1 mRNA levels
was observed in p53-deficient fibroblasts under identical MNNG
treatment. These results clearly demonstrated that p53 expression is
required for induction of the PAI-1 gene by MNNG.
Overexpression of Wild-type p53 Can Mimic MNNG-induced PAI-1
Promoter Activity--
We have observed that the levels of p53 protein
are augmented after MNNG treatment in NIH3T3 and p53+/+3T3 cells
(Fig. 4A). Similarly, PAI-1 promoter activity and gene
expression were increased after MNNG treatment in these cells (Figs.
1A, 2A, and 4B). These results are
consistent with the idea that p53 levels are limiting in these cells
and that increased levels of p53 may be necessary for induced PAI-1
transcriptional activity. If this is the case, then overexpression of
p53 should mimic the effect of MNNG treatment on the transcriptional
activity of the PAI-1 promoter. To test this idea, p53
/
cells were
transiently transfected with p800-Luc with or without two amounts of
the p53 expression vector pCMV-p53, and PAI-1 promoter activity was
determined by luciferase measurement after MNNG stimulation. As
expected, no PAI-1 promoter induction by MNNG was observed in p53
/
cells. However, transfection of 5 ng of pCMV-p53 was sufficient to
restore the inducibility of the PAI-1 promoter by MNNG. Moreover,
overexpression of p53 (by cotransfection of 500 ng of pCMV-p53) was
able to induce PAI-1 promoter activity to levels similar to those
obtained after MNNG treatment. These results demonstrated that an
increase in p53 protein level is required for PAI-1 transcriptional
induction after DNA damage.
Wild-type p53 Can Induce PAI-1 Promoter Activity in p53-deficient
Cells--
To evaluate further whether p53 can regulate PAI-1
transcriptional activity in p53-negative cells, p53
/
3T3 cells were
transiently transfected with different PAI-1 promoter-reporter
constructs with or without the p53 expression vector pCMV-p53, and the
PAI-1 promoter activity was determined by luciferase measurement. As expected, luciferase activities generated by the different PAI-1 promoter constructs, whether containing or lacking the intact p53 site,
were not significantly different in the absence of p53. However, in the
presence of p53 (by cotransfection of 500 ng of pCMV-p53), a 6-8-fold
increase of luciferase expression was observed from the constructs
containing the p53 binding site (p187-Luc and p800-Luc) but not from
the constructs with a mutated or without the p53 site (p800-Luc(mt p53)
and p100-Luc, respectively), strongly indicating the
p53-dependent transactivation of the PAI-1 promoter (Fig.
5B).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5.
Induction of PAI-1 promoter activity by MNNG
depends on a functional p53. A, overexpression of
wild-type p53 mimics MNNG-induced PAI-1 promoter activity: requirement
of p53 for MNNG induction of PAI-1. p53 / 3T3 cells were transiently
transfected with p800-Luc in the absence or presence of pCMV-p53 at two
different concentrations (5 ng and 500 ng, respectively). After
transfection, the cells were treated with 70 µM MNNG for
8 h. Luciferase activities are expressed relative to the activity
of p800-Luc in nontreated cells in the absence of transfected p53, and
this activity has been given an arbitrary value of 1.). B,
p53-dependent transcriptional activity of the PAI-1
promoter. p53 / 3T3 cells were transiently cotransfected with
different PAI-1 promoter luciferase constructs (containing or lacking
an intact p53-responsive element) with or without a p53 expression
plasmid (pCMV-p53) (500 ng). Luciferase activities are expressed
relative to the activity of each PAI-1-Luc construct in the absence of
transfected pCMV-p53. The results obtained represent the average of at
least three independent experiments.
|
|
Taken together, these results demonstrate that increased p53 protein
levels are sufficient to induce PAI-1 promoter activity, mimicking the
MNNG-induced effect. They also show that MNNG induces the
PAI-1 gene by augmenting p53 levels.
Induction of p53 Phosphorylation at Serine 15 by MNNG--
We have
shown above that MNNG treatment augments the levels of p53 protein in
NIH3T3 and p53+/+3T3 cells (Fig. 4A). To unravel the
underlying molecular mechanism, we first analyzed the effect of MNNG on
p53 mRNA levels in p53+/+3T3 and in p53
/
3T3 cells. As shown in
Fig. 6A (left
panel), the levels of full-length p53 mRNA were not modified
by MNNG treatment in p53+/+3T3 cells, indicating that MNNG was not
affecting the rate of p53 gene transcription or p53 mRNA
stability (Fig. 6A, left). Similar results were
obtained with NIH3T3 cells (data not shown). Nevertheless, the level of p53 protein increased time-dependently after MNNG treatment
in these cells, being maximal at 3 h after treatment (Fig.
6B). As expected, a faster migrating p53 mRNA species
corresponding to the neo-p53 transgene was detected in
p53
/
3T3 cells, confirming that these cells are p53-deficient (Fig.
6A, right). These results suggested that the
regulation of p53 protein stability, rather than mRNA levels, was
the mechanism responsible for the MNNG-induced increase in p53 protein
levels (see Fig. 4A).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 6.
MNNG induces p53 phosphorylation at serine
15. A, analysis of p53 mRNA expression in
MNNG-stimulated 3T3 cells. 3T3 cells containing wild-type p53 (p53+/+)
or a truncated p53 gene (p53 / ) were treated with 70 µM MNNG for up to 8 h, and RNA levels corresponding
to wild-type p53 and transgenic p53 (neo-p53) were analyzed
by Northern blotting using a p53 cDNA probe. The 18S
oligonucleotide was used to reprobe RNA blots as an internal loading
control. B, MNNG induces stabilization of the p53 protein.
NIH3T3 cells were either treated with 70 µM MNNG or
irradiated with UV-C (254 nm, 30 J/m2), and WCEs were
prepared at the indicated time points post-stimulation (0, 1, 2, 3, and
6 h, respectively) and analyzed by Western blotting using an
anti-p53 antibody. C, MNNG induces p53 phosphorylation at
serine 15 but not at serine 392. NIH3T3 cells were treated either with
MNNG or UV-C as described for B, and WCE analyzed by Western
blotting using antibodies specific to the phosphorylated serine 15, or
serine 392, of p53, respectively (P-Ser15-p53 and
P-Ser392-p53).
|
|
It has been reported that phosphorylation of p53 is associated with its
stabilization (reviewed in Ref. 46). Because serine 15 and serine 392 phosphorylation of p53 has been implicated in cellular responses to
several types of DNA damage, including UV irradiation (49, 56), we
investigated whether p53 was phosphorylated in vivo at those
two residues in NIH3T3 cells treated with MNNG. The phosphorylated
status at serine 15 and serine 392 was analyzed in these cells by
Western blotting using phospho-specific antibodies that recognized p53
phosphorylated at serine 15 (P-Ser15-p53) and at serine 392 (P-Ser392-p53). As shown in Fig. 6C, MNNG caused phosphorylation of p53 at serine 15 but not at serine 392 in NIH3T3 cells. In contrast, high levels of phosphorylation of both residues were observed in these cells after 6 h of UV-C treatment (used as
control) (Fig. 6C), which were accompanied also by high
levels of p53 protein (Fig. 6B). The phosphorylation of p53
at serine 15 was maximal 3 h after MNNG treatment (Fig.
6C), coinciding with the time course of maximal accumulation
of the p53 protein after treatment with this alkylating agent. These
results strongly suggest that the increase in p53 protein levels that
occurs on MNNG treatment in NIH3T3 cells is associated with
phosphorylation of serine 15 but not of serine 392.
Mutation of p53 at Serine 15 Reduces PAI-1 Promoter Induction by
MNNG--
To determine whether the modification of serine 15 could
influence p53-dependent transactivation of the PAI-1
promoter in response to MNNG, we compared the effects of overexpression
of wild-type p53 and mutant p53 (p53S15A), in which serine 15 was converted to alanine, on luciferase expression from transiently transfected p800-Luc. As shown in Fig. 7,
in response to MNNG wild-type p53 was more potent than the mutant in
activating PAI-1 promoter in p53-deficient cells. As a control of
template, we employed the luciferase reporter gene pPG13-Luc
(60), which contained 13 copies of a p53-responsive element in the
promoter. As shown for p800-Luc, wild-type p53 was also more potent
than p53S15A in inducing luciferase activity in response to MNNG
from the pPG13-Luc control template, because the differences in
MNNG-inducibility are very similar. The levels of expression of the
full-length wild-type p53 and S15A mutant were similar as indicated by
Western analysis using an anti-p53 antibody (data not shown). This
result demonstrated the relevance of p53 phosphorylation at serine 15 for PAI-1 transcriptional induction by MNNG.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of p53 mutation at serine 15 on the
transcriptional activation of the PAI-1 promoter by MNNG.
p53 / 3T3 cells were transiently transfected either with the PAI-1
promoter luciferase construct, p800-Luc, or with pPG13-Luc (containing
13 copies of a consensus p53-responsive element) together with 5 ng of
pCMV-p53 wild type or 5 ng of pCMV-p53(S15A), containing serine 15 mutated by alanine or 5 ng of vector DNA alone (as control). After
transfection, cells were treated with 70 µM MNNG for
8 h, and promoter activities were determined by luciferase
measurement. Luciferase activity corresponding to MNNG-stimulated
p800-Luc (or MNNG-stimulated pPG13-Luc) in the presence of wild-type
pCMV-p53 was assigned 100% activity. The results obtained represent
the average of at least three independent experiments showing less than
20% variability.
|
|
 |
DISCUSSION |
Genotoxic agents such as UV light irradiation and monofunctional
alkylating carcinogens cause cytotoxic and mutagenic lesions, which
lead eventually to chromosomal aberrations, point mutations, and cell
killing (23, 24). These agents also trigger a rapid, highly regulated
adaptative response known as the cellular stress response, which
involves coordinate control of signaling events leading to the
induction of many genes. The gene-inductive response to UV has been
analyzed extensively, and it is known to promote the transcription of
genes coding for transcription factors, growth factors, viral proteins,
and proteases (reviewed in Ref. 44). However, less is known about the
inductive response to alkylating agents such as MMS and MNNG. These
agents induce the early expression of several proto-oncogenes including
c-fos, c-jun, junB, and
junD, although to different levels (29). They also induce
the level of cell cycle regulatory/tumor suppressor proteins such as
p53, p21, and adenomatous polyposis coli (30-33) and of DNA repair
proteins such as O-6-methylguanine-DNA methyltransferase and
DNA polymerase
(36, 37) as well as growth arrest and DNA
damage-inducible proteins (34, 35). However, no additional cellular
targets of alkylating agents other than those related to gene
transcription or DNA repair processes have been identified in mammalian
cells. Interestingly, we recently found that the expression of uPA, an extracellular serine protease to which no DNA repair function has been
assigned thus far, can be induced both by UV and the alkylating agent
MNNG via a mechanism involving c-Jun N-terminal kinase activation of
activator protein 1 (19, 68). Here, we have shown that PAI-1, the
physiological inhibitor of uPA proteolytic activity, the known activity
of which is also exerted extracellularly, is also transcriptionally
induced by MNNG. This induction is mediated by an enhanced level of p53
protein, which is brought about by its increased stability caused by
the phosphorylation of serine 15. Cotransfection of a mutated form of
p53 at serine 15 resulted in reduced PAI-1-promoter activation by MNNG
compared with the wild-type p53, confirming the importance of serine 15 phosphorylation in the activation of the PAI-1 gene.
Finally, we found that a p53-responsive element located in the proximal
promoter region of the PAI-1 promoter is required for transcriptional
induction by MNNG, because specific mutation of this element abrogated
the induction. Taken together, this is the first functional dissection of a transcription-coupled signal transduction pathway activated by
MNNG involving p53.
It has been established that the p53 tumor suppressor protein plays a
pivotal role in cellular responses to DNA-damaging events (reviewed in
Refs. 46 and 74). Our work showed that this is also the case in MNNG
induction of the PAI-1 gene in NIH3T3 cells. Several forms
of DNA damage have been shown to activate p53, including those
generated by ionizing radiation, chemotherapeutic drugs, UV radiation,
and alkylating agents (reviewed in Refs. 46, 54, 55, and 74); however,
the effects of these later agents on p53 are much less understood (33,
61, 62). p53 accumulation seems to occur mainly through alterations of
p53 protein stability, although changes in p53 gene
expression have also been reported (reviewed in Ref. 46). Accordingly,
we observed that MNNG treatment did not change the level of p53
mRNA but increased the level of p53 protein in NIH3T3 cells,
providing an arguement for this being the mechanism operating in the
induction of the PAI-1 gene in these cells. Several reports
have shown that stabilization of the p53 protein results from specific
phosphorylation events; in particular, the phosphorylation of different
N-terminal serine and threonine residues located within or very close
to the MDM2-binding domain of p53 have been shown to contribute to p53
stabilization by preventing the binding of its negative regulator MDM2
and rendering p53 more resistant to MDM2-mediated degradation (46, 74). Other studies highlight the serine 15 of p53, among several N-terminal phosphorylated residues, as the key phosphorylation target in response
to DNA damage (49-53). In this study, we found that MNNG induces p53
phosphorylation at serine 15 in conjunction with MNNG-induced stabilization. Although it had been shown that alkylating agents could
induce p53 phosphorylation at serine 392 in a human lymphoblastoid cell
line (62), we did not detect any phosphorylation at this position in
response to MNNG in NIH3T3 cells, possibly because of cell-specific
differences. However, we observed phosphorylation at serine 392 after
UV-C irradiation in NIH3T3 cells, as reported previously by other
groups (48, 52, 75-77). These data demonstrate that MNNG induces p53
stabilization through the phosphorylation of serine 15 but not serine
392 in NIH3T3 cells.
It has been shown that, besides increasing protein stability, serine 15 phosphorylation of p53 stimulates the transactivation activity of p53
through its increased binding to the p300/CBP coactivator proteins
(58-60). In accordance with this, we observed in transient
transfection assays that the p53S15A mutant is less potent than
wild-type p53 in mediating MNNG-induced PAI-1 promoter activity (or in
mediating MNNG-induced activity of a synthetic promoter harboring 13 copies of a p53 binding site). Our results show that the loss of serine
15 in the p53 protein resulted in a significant reduction of PAI-1
induction by MNNG. These results are in agreement with those of Dumaz
and Meek (60) showing that serine 15 mutation of p53 resulted in
partial inhibition, but not in a complete loss, of transactivation
activity. These data demonstrate that the phosphorylation of p53 at
serine 15 is clearly relevant for PAI-1 transcriptional induction by
p53. Furthermore, the finding that MNNG induces phosphorylation of p53
at serine 15 adds to the emerging idea that serine 15 is a focal point
for stress-targeted activation of p53.
Reports from over a decade ago indicate that the alkylating agents
mechlorethamine and MNNG could induce the production of plasminogen
activator in U-87MG cells, an alkylation repair-deficient (Mer
) human
glioblastoma strain, at much higher levels than in alkylation
repair-proficient (Mer+) U-178MG cells (18). It was concluded that
plasminogen activator induction in alkylation repair-deficient human
cells is caused by unrepaired DNA damage and may represent a eukaryotic
SOS-like function. In fact, most of the MNNG-inducible genes identified
in mammalian cells seem to be involved in DNA repair in a way similar
to that of the bacterial SOS response. However, several reports have
suggested that the mammalian stress response to genotoxic agents was
involved in a protective function other than DNA repair. In particular,
c-fos
/
cells are hypersensitive to MMS and MNNG (39), suggesting
that MMS/MNNG-induced c-Fos/activator protein 1 is an essential
component of the cellular defense mechanism against the cytotoxic
effects of alkylating agents. The results shown in this study indicate
that the alkylating carcinogen MNNG induces the expression of the
extracellular protease inhibitor PAI-1. Then what is the physiological
significance of PAI-1 induction by genotoxic agents? Exposure of cells
to MNNG and most other DNA-damaging agents results not only in
damage to DNA but also in damage to other cellular components including
biomembranes and proteins either directly or after oxidative stress
(78). A simple protective mechanism against damage to such components would consist of replacing them with newly synthesized ones. As already
mentioned, exposure of cells to DNA-damaging agents can increase DNA
repair capacity and activate cell cycle checkpoints, but such exposures
may also induce enzymes that metabolize toxins to facilitate their
elimination from the organism or may activate programmed cell death
(apoptosis) to eliminate highly damaged cells. Accordingly, the
increased expression of the protease inhibitor PAI-1 after MNNG
treatment may alter the clearance of the damaged cell components by
PA-dependent proteolysis. The PAI-1 antiproteolytic properties, in conjunction with its interaction with cell adhesion proteins such as vitronectin, have a function in the degradation of the
extracellular matrix in conditions like wound healing, inflammation,
and cancer. PAI-1 is considered a bad prognostic factor for most human
cancers, and recent reports have demonstrated that PAI-1 may promote
tumor growth by inhibiting apoptosis in vitro (8-14, 17).
However, the role of PAI-1 in cancer progression remains controversial,
because PAI-1 may have both beneficial and deleterious roles during the
response to different pathological situations. The functional
significance of PAI-1 induction by alkylation agents remains to be
determined. At present, PAI-1-deficient mice are available (79, 80).
The sensitivity of PAI-1
/
cells to MNNG treatment is expected to
clarify the role of this protease inhibitor in the cellular response to
alkylating agents.
 |
ACKNOWLEDGEMENTS |
We are grateful to Drs. D. Loskutoff, A.-J.
van Zonneveld, Z. Ronai, D. Meek, B. Vogelstein, S. de la Luna, E. Wagner, and R. Perona for generously providing us with various reagents.
 |
FOOTNOTES |
*
This work was supported by Ministerio Educación y
Cultura (MEC) Grant PM97-0088, European Union 1999/C361/06, and
Fundació La Marató-TV3.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by a predoctoral fellowship from the Fundación
Española contra el Cáncer.
To whom correspondence should be addressed. Tel.:
34-93-260-7402; Fax: 34-93-260-7776; E-mail: pmunoz@iro.es.
Published, JBC Papers in Press, July 26, 2001, DOI 10.1074/jbc.M103735200
 |
ABBREVIATIONS |
The abbreviations used are:
PA, plasminogen activator;
uPA, urokinase-type PA;
PAI-1, PA inhibitor 1;
MNNG, N-methyl-N'-nitro-N-nitrosoguanidine;
MMS, methyl-methanesulfonate;
MDM2, murine double minute 2;
bp, base pair(s);
FBS, fetal bovine serum;
WCE, whole-cell extract;
EMSA, electrophoretic mobility shift assay;
UV-C, 254-nm UV.
 |
REFERENCES |
| 1.
|
Irigoyen, J. P.,
Munoz-Canoves, P.,
Montero, L.,
Koziczak, M.,
and Nagamine, Y.
(1999)
Cell. Mol. Life Sci.
56,
104-132
|
| 2.
|
Conese, M.,
and Blasi, F.
(1995)
Biol. Chem. Hoppe-Seyler
376,
143-155
|
| 3.
|
Blasi, F.
(1997)
Immunol. Today
18,
415-417
|
| 4.
|
Deng, G.,
Curriden, S. A.,
Wang, S.,
Rosenberg, S.,
and Loskutoff, D. J.
(1996)
J. Cell Biol.
134,
1563-1571
|
| 5.
|
Stefansson, S.,
and Lawrence, D. A.
(1996)
Nature
383,
441-443
|
| 6.
|
Loskutoff, D. J.,
Curriden, S. A.,
Hu, G.,
and Deng, G.
(1999)
APMIS
107,
54-61
|
| 7.
|
Soff, G. A.,
Sanderowitz, J.,
Gately, S.,
Verrusio, E.,
Weiss, I.,
Brem, S.,
and Kwaan, H. C.
(1995)
J. Clin. Invest.
96,
2593-2600
|
| 8.
|
Pedersen, H.,
Brunner, N.,
Francis, D.,
Osterlind, K.,
Ronne, E.,
Hansen, H. H.,
Dano, K.,
and Grondahl-Hansen, J.
(1994)
Cancer Res.
54,
4671-4675
|
| 9.
|
Pedersen, H.,
Grondahl-Hansen, J.,
Francis, D.,
Osterlind, K.,
Hansen, H. H.,
Dano, K.,
and Brunner, N.
(1994)
Cancer Res.
54,
120-123
|
| 10.
|
Casslen, B.,
Bossmar, T.,
Lecander, I.,
and Astedt, B.
(1994)
Eur. J. Cancer
30,
1302-1309
|
| 11.
|
Grondahl-Hansen, J.,
Christensen, I. J.,
Rosenquist, C.,
Brünner, N.,
Mouridsen, H. T.,
Dano, K.,
and Blichert-Toft, M.
(1993)
Cancer Res.
53,
2513-2521
|
| 12.
|
Hofmann, R.,
Lehmer, A.,
Buresch, M.,
Hartung, R.,
and Ulm, K.
(1996)
Cancer
78,
487-492
|
| 13.
|
Nekarda, H.,
Siewert, J. R.,
Schmitt, M.,
and Ulm, K.
(1994)
Lancet
343,
117 (abstr.)
|
| 14.
|
Sier, C. F.,
Vloedgraven, H. J.,
Ganesh, S.,
Griffioen, G.,
Quax, P. H.,
Verheijen, J. H.,
Dooijewaard, G.,
Welvaart, K.,
van de Velde, C. J.,
Lamers, C. B.,
et al..
(1994)
Gastroenterology
107,
1449-1456
|
| 15.
|
Bajou, K.,
Noel, A.,
Gerard, R. D.,
Masson, V.,
Brunner, N.,
Holst-Hansen, C.,
Skobe, M.,
Fusenig, N. E.,
Carmeliet, P.,
Collen, D.,
and Foidart, J. M.
(1998)
Nat. Med.
4,
923-928
|
| 16.
|
Bajou, K.,
Masson, V.,
Gerard, R. D.,
Schmitt, P. M.,
Albert, V.,
Praus, M.,
Lund, L. R.,
Frandsen, T. L.,
Brunner, N.,
Dano, K.,
Fusenig, N. E.,
Weidle, U.,
Carmeliet, G.,
Loskutoff, D.,
Collen, D.,
Carmeliet, P.,
Foidart, J. M.,
and Noel, A.
(2001)
J. Cell Biol.
152,
777-784
|
| 17.
|
Kwaan, H. C.,
Wang, J.,
Svoboda, K.,
and Declerck, P. J.
(2000)
Br. J. Cancer
82,
1702-1708
|
| 18.
|
Brdar, B.
(1986)
Cancer Res.
46,
2282-2284
|
| 19.
|
Parra, M.,
Lluis, F.,
Miralles, F.,
Caelles, C.,
and Munoz-Canoves, P.
(2000)
Blood
96,
1415-1424
|
| 20.
|
Peto, R.,
Gray, R.,
Brantom, P.,
and Grasso, P.
(1985)
IARC Scientific Publication no. 57
, pp. 627-655, International Agency for Research on Cancer, Lyon, France
|
| 21.
|
Singer, B.,
and Grunberger, D.
(1983)
Molecular Biology of Mutagens and Carcinogens
, Plenum Publishing Corp., New York
|
| 22.
|
Singer, B.
(1975)
Prog. Nucleic Acid Res.
15,
219-284
|
| 23.
|
Loveless, A.
(1969)
Nature
223,
206-207
|
| 24.
|
Eadie, J. S.,
Conrad, M.,
Toorchen, D.,
and Topal, M. D.
(1984)
Nature
308,
201-203
|
| 25.
|
Kleihues, P.,
and Margison, G. P.
(1974)
J. Natl. Cancer Ins.
53,
1839-1841
|
| 26.
|
Saffhill, R.,
Margison, G. P.,
and O'Connor, P. J.
(1985)
Biochim. Biophys. Acta
823,
111-145
|
| 27.
|
Thomale, J.,
Huh, N. H.,
Nehls, P.,
Eberle, G.,
and Rajewski, M. F.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
9883-9887
|
| 28.
|
Tsujii, M.,
Kawano, S.,
Tsuji, S.,
Takei, Y.,
Tamura, K.,
Fusamoto, H.,
and Kamada, T.
(1995)
Carcinogenesis
16,
563-566
|
| 29.
|
Dosch, J.,
and Kaina, B.
(1996)
Oncogene
13,
1927-1935
|
| 30.
|
Fritsche, M.,
Haessler, C.,
and Brandner, G.
(1993)
Oncogene
8,
307-318
|
| 31.
|
Di Leonardo, A.,
Linke, S. P.,
Clarkin, K.,
and Wahl, G. M.
(1994)
Genes Dev.
8,
2540-2551
|
| 32.
|
Barak, Y.,
Juven, T.,
Haffner, R.,
and Oren, M.
(1993)
EMBO J.
12,
461-468
|
| 33.
|
Narayan, S.,
and Jaiswal, A. S.
(1997)
J. Biol. Chem.
272,
30619-30622
|
| 34.
|
Jackman, J.,
Alamo, I. J.,
and Fornace, A. J. J.
(1994)
Cancer Res.
54,
5656-5662
|
| 35.
|
Luethy, J. D.,
and Holbrook, N. J.
(1994)
Cancer Res.
54,
1902-1906
|
| 36.
|
Kaina, B.,
Fritz, G.,
Mitra, S.,
and Coquerelle, T.
(1991)
Carcinogenesis
12,
1857-1867
|
| 37.
|
Ochs, K.,
Sobol, R. W.,
Wilson, S. H.,
and Kaina, B.
(1999)
Cancer Res.
59,
1544-1551
|
| 38.
|
Devary, Y.,
Gottlieb, R. A.,
Smeal, T.,
and Karin, M.
(1992)
Cell
71,
1081-1091
|
| 39.
|
Kaina, B.,
Haas, S.,
and Kappes, H.
(1997)
Cancer Res.
57,
2721-2731
|
| 40.
|
Sachsenmaier, C.,
Radler-Pohl, A.,
Muller, A.,
Herrlich, P.,
and Rahmsdorf, H. J.
(1994)
Biochem. Pharmacol.
47,
129-136
|
| 41.
|
Stein, B.,
Rahmsdorf, H. J.,
Steffen, A.,
Litfin, M.,
and Herrlich, P.
(1989)
Mol. Cell. Biol.
9,
5169-5181
|
| 42.
|
Devary, Y.,
Rosette, C.,
DiDonato, J. A.,
and Karin, M.
(1993)
Science
261,
1442-1445
|
| 43.
|
Wilhelm, D.,
Bender, K.,
Knebel, A.,
and Angel, P.
(1997)
Mol. Cell. Biol.
17,
4792-4800
|
| 44.
|
Bender, K.,
Blattner, C.,
Knebel, A.,
Iordanov, M.,
Herrlich, P.,
and Rahmsdorf, H. J.
(1997)
J. Photochem. Photobiol. B Biol.
37,
1-17
|
| 45.
|
Levine, A. J.
(1997)
Cell
88,
323-331
|
| 46.
|
Oren, M.
(1999)
J. Biol. Chem.
274,
36031-36034
|
| 47.
|
Prives, C.,
and Hall, P. A.
(1999)
J. Pathol.
187,
112-126
|
| 48.
|
Sakaguchi, K.,
Herrera, J. E.,
Saito, S.,
Miki, T.,
Bustin, M.,
Vassilev, A.,
Anderson, C. W.,
and Appella, E.
(1998)
Genes Dev.
12,
2831-2841
|
| 49.
|
Siliciano, J. D.,
Canman, C. E.,
Taya, Y.,
Sakaguchi, K.,
Appella, E.,
and Kastan, M. B.
(1997)
Genes Dev.
11,
3471-3481
|
| 50.
|
Banin, S.,
Moyal, L.,
Shieh, S.,
Taya, Y.,
Anderson, C. W.,
Chessa, L.,
Smorodinsky, N. I.,
Prives, C.,
Reiss, Y.,
Shiloh, Y.,
and Ziv, Y.
(1998)
Science
281,
1674-1677
|
| 51.
|
Tibbetts, R. S.,
Brumbaugh, K. M.,
Williams, J. M.,
Sarkaria, J. N.,
Cliby, W. A.,
Shieh, S. Y.,
Taya, Y.,
Prives, C.,
and Abraham, R. T.
(1999)
Genes Dev.
13,
152-157
|
| 52.
|
Chao, C.,
Saito, S.,
Anderson, C. W.,
Appella, E.,
and Xu, Y.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
11936-11941
|
| 53.
|
She, Q. B.,
Chen, N.,
and Dong, Z.
(2000)
J. Biol. Chem.
275,
20444-20449
|
| 54.
|
Sanchez-Prieto, R.,
Rojas, J. M.,
Taya, Y.,
and Gutkind, J. S.
(2000)
Cancer Res.
60,
2464-2472
|
| 55.
|
Yih, L. H.,
and Lee, T. C.
(2000)
Cancer Res.
60,
6346-6352
|
| 56.
|
Shieh, S.-Y.,
Ikeda, M.,
Taya, Y.,
and Prives, C.
(1997)
Cell
91,
325-334
|
| 57.
|
Unger, T.,
Juven-Gershon, T.,
Moallem, E.,
Berger, M.,
Vogt Sionov, R.,
Lozano, G.,
Oren, M.,
and Haupt, Y.
(1999)
EMBO J.
18,
1805-1814
|
| 58.
|
Avantaggiati, M. L.,
Ogryzko, V.,
Gardner, K.,
Giordano, A.,
Levine, A. S.,
and Kelly, K.
(1997)
Cell
89,
1175-1184
|
| 59.
|
Lambert, P. F.,
Kashanchi, F.,
Radonovich, M. F.,
Shiekhattar, R.,
and Brady, J. N.
(1998)
J. Biol. Chem.
273,
33048-33053
|
| 60.
|
Dumaz, N.,
and Meek, D. W.
(1999)
EMBO J.
18,
7002-7010
|
| 61.
|
Grombacher, T.,
Eichhorn, U.,
and Kaina, B.
(1998)
Oncogene
17,
845-851
|
| 62.
|
Duckett, D. R.,
Bronstein, S. M.,
Taya, Y.,
and Modrich, P.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
12384-12388
|
| 63.
|
Inoue, T.,
Geyer, R. K., Yu, Z. K.,
and Maki, C. G.
(2001)
FEBS Lett.
490,
196-201
|
| 64.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
|
| 65.
|
Munoz-Canoves, P.,
Miralles, F.,
Baiget, M.,
and Felez, J.
(1997)
Thromb. Haemostasis
77,
526-534
|
| 66.
|
van Zonneveld, A. J.,
Curriden, S. A.,
and Loskutoff, D. J.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
5525-5529
|
| 67.
|
Miralles, F.,
Ibanez-Tallon, I.,
Parra, M.,
Crippa, M.,
Blasi, F.,
Besser, D.,
Nagamine, Y.,
and Munoz-Canoves, P.
(1999)
Thromb. Haemostasis
81,
767-774
|
| 68.
|
Miralles, F.,
Ron, D.,
Baiget, M.,
Felez, J.,
and Munoz-Canoves, P.
(1998)
J. Biol. Chem.
273,
2052-2058
|
| 69.
|
Kunz, C.,
Pebler, S.,
Otte, J.,
and Von der Ahe, D.
(1995)
Nucleic Acids Res.
23,
3710-3717
|
| 70.
|
Bian, J.,
and Sun, Y.
(1997)
Mol. Cell. Biol.
17,
6330-6338
|
| 71.
|
Bian, J.,
Jacobs, C.,
Wang, Y.,
and Sun, Y.
(1996)
Carcinogenesis
17,
2559-2562
|
| 72.
|
Sabapathy, K.,
Klemm, M.,
Jaenisch, R.,
and Wagner, E. F.
(1997)
EMBO J.
16,
6217-6229
|
| 73.
|
Schreiber, M.,
Kolbus, A.,
Piu, F.,
Szabowski, A.,
Mohle-Steinlein, U.,
Tian, J.,
Karin, M.,
Angel, P.,
and Wagner, E. F.
(1999)
Genes Dev.
13,
607-619
|
| 74.
|
Giaccia, A. J.,
and Kastan, M. B.
(1998)
Genes Dev.
12,
2973-2983
|
| 75.
|
Huang, C.,
Ma, W. Y.,
Maxiner, A.,
Sun, Y.,
and Dong, Z.
(1999)
J. Biol. Chem.
274,
12229-12235
|
| 76.
|
Lu, H.,
Taya, Y.,
Ikeda, M.,
and Levine, A. J.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
6399-6402
|
| 77.
|
Kapoor, M.,
and Lozano, G.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
2834-2837
|
| 78.
|
Angel, P.
(1995)
in
Inducible Gene Expression and Cytoplasmic/Nuclear Signal Transduction
(Baeuerle, P., ed)
, pp. 62-92, Birkhauser Verlag, Boston
|
| 79.
|
Carmeliet, P.,
Kieckens, L.,
Schoonjans, L.,
Ream, B.,
van Nuffelen, A.,
Prendergast, G.,
Cole, M.,
Bronson, R.,
Collen, D.,
and Mulligan, R. C.
(1993)
J. Clin. Invest.
92,
2746-2755
|
| 80.
|
Carmeliet, P.,
Stassen, J. M.,
Schoonjans, L.,
Ream, B.,
Van den Oord, J. J.,
De Mol, M.,
Mulligan, R. C.,
and Collen, D.
(1993)
J. Clin. Invest.
92,
2756-2760
|
Copyright © 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
