 |
INTRODUCTION |
Retroviruses are characterized by a diploid, positive sense RNA
genome. After entry into the host cell, the viral reverse transcriptase
(RT)1 copies it into
double-stranded DNA by a process utilizing both DNA polymerase and
RNase H activities. Completion of synthesis of both minus and plus
strand DNA involves template switching events in which the strong stop
DNA is transferred from the original template to a complementary
sequence at the 3' end of either the same or a second homologous copy
of the template (1). In addition to these obligatory transfers, strand
transfers involving internal regions of the RNA or complementary DNA
have also been demonstrated to occur during replication (2-4). These
include both intrastrand (resulting in deletions or duplications)
and interstrand transfers (resulting in recombination).
The presence of two RNA copies provides a functional advantage during
reverse transcription, allowing RT to switch templates should it
encounter a break or damage within the RNA strand being copied. The
forced copy-choice model of recombination (5) predicts that the process
occurs during minus strand DNA synthesis. However, because template
switching also occurs in the absence of breaks in the RNA and may not
always be forced, the process fits the more generalized copy-choice
model (6). Such interstrand template switching involving two
co-packaged nonidentical RNAs would then result in a recombinant
provirus. Recombination during plus strand synthesis is described by
the strand displacement-assimilation model (7, 8) which proposes that
two minus strand DNAs are made by one virion and that plus strand
synthesis is discontinuous. Although recombination does occur during
both minus and plus strand DNA synthesis, studies indicate that minus
strand synthesis is the predominant pathway (9-13).
Recombination occurs at a high rate during retroviral replication (2,
14-17). The process is predominantly homology driven and can also
involve exogenous and endogenous viral RNAs (18-20). In the case of
HIV, reverse transcription-mediated recombination provides an important
source of genetic diversity, contributing to the generation of
quasispecies within the infected individual (21-23). It disperses
resistance mutations arising during drug therapy (24, 25) as well as
those randomly introduced by the highly error-prone RT. Furthermore,
the process can yield mosaic genomes carrying genetic information from
different subtypes (26-28). Recombination also serves as a rescue
mechanism for the virus in situations where RT encounters a damage or
defect within the genome. Direct evidence for this is the rescue of
replication-defective virus through recombination with endogenous
retroviral sequences (18, 20, 29-31).
In retroviruses, the diploid genome is noncovalently linked near the 5'
end and is packaged within the virion in this dimeric state (32). After
release of the particle from the host cell, it is maintained in a
mature and stable dimeric form via interactions with the nucleocapsid
protein (33, 34). The dimeric state of the retroviral genome is thought
to play an important role at several steps in the life cycle, including
packaging (35, 36), translation (35, 37), and recombination (4, 20, 38,
39). The primary linkage structure referred to as the dimerization
initiation sequence (DIS) is presented as a hairpin that exposes a
palindromic sequence within the loop (40-43). This structure is
located between the primer-binding site (PBS) and splice donor (SD)
site within the 5'-UTR. Dimerization initiates through Watson-Crick
base pairing between the autocomplementary loop sequences of two DIS
hairpins, an interaction referred to as kissing (40, 41, 43-45).
Subgenomic RNAs containing this region of the HIV-I genome dimerize
spontaneously and efficiently in vitro in the absence of
viral and cellular proteins (37, 46, 47). Disruption of the palindromic
loop sequence or deletions of the DIS stem loop obstruct dimerization
(41, 48). The viral nucleocapsid protein, although dispensable for RNA
dimerization, can enhance the process (46, 49). The DIS hairpin is
dispensable for virus replication, although deletion of the element is
associated with reduced encapsidation, minus strand synthesis, and
infectivity, as well as altered replication kinetics (50, 51). In
addition to the DIS hairpin, the HIV-I 5' leader sequence encodes
multiple cis-acting elements, including the packaging signal
(
) and splice donor site, that regulate distinct steps in the virus
life cycle (52) (Fig. 1). Whereas the dimeric state of the genome
allows for recombination events during reverse transcription, the
specific role of template-template interaction sites and genome
dimerization in reverse transcription and recombination begs a more
detailed analysis.
Studies presented by the Pedersen group have shown
recombination-mediated rescue of PBS-defective murine leukemia virus
through template switching within the dimer linkage structure (20,
53-55). These results prompted us to examine strand transfers within
the highly structured HIV-I 5' leader sequence and the effect of DIS in
promoting the process. We hypothesized that direct template-template interactions serve as an important determinant in promoting transfers by bringing homologous regions of the RNA into close proximity. Using
RNA templates comprising the dimerizing HIV-I leader sequence and a
control nondimerizing pol sequence, we have addressed the role of
kissing interactions in facilitating transfers by examining template
dimerization, transfer efficiencies, and crossover distribution. The
UTR templates supported a high efficiency of crossovers, with a
clustering of transfers around the dimerization site. Inhibition of
donor-acceptor interactions through deletion of the DIS sequence resulted not only in a suppression of the hot spot but, more
significantly, in an overall reduction in transfers across the whole
template. Parallel experiments with the pol templates, in which
the presence of the DIS sequence induced template dimerization and
enhanced transfer efficiency, further verified these observations.
Results give insights into the role of template dimerization as a
determinant in promoting template switching during minus strand
synthesis by HIV-I RT.
| |
MATERIALS AND METHODS |
Reagents--
Recombinant HIV-I RT (specific activity, 40,000 units/mg) was supplied by the Genetics Institute (Cambridge, MA). T7
RNA polymerase, T4 polynucleotide kinase, DNase I, deoxynucleoside
triphosphates, ribonucleoside triphosphates, and RNase inhibitor
were purchased from Roche Molecular Biochemicals. The following
reagents were obtained through the AIDS Research and Reference Reagent
Program (Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health): pNL4-3 (obtained from Dr.
Malcom Martin) and pYK-JRCSF (obtained from Drs. Irvin S. Y. Chen
and Yoshio Koyanagi). DNA primers were chemically synthesized by
Integrated DNA Technologies (Coralville, IA).
Plasmid Constructs--
Genomic sequences from the NL4-3 and
JRCSF strains of HIV-I were amplified by PCR and cloned into
pBluescript II KS(+) (Stratagene) to create donor and acceptor
constructs for generation of RNA templates. The following PCR primer
sets were used in the construction of the various constructs:
(a) 5'-UTR donor construct pNL187-384, primers
SacI/PBS-187 (5'-CTGGAGCTCCCGAACAGGGAC
TTGAAAGCG) and BamHI/384
(5'-GTGGGATCCCCCATTTATCTAATTCTCCCC), (b) 5'-UTR
acceptor construct pJRC150-363, primers SacI/PBS-150
(5'-CTGGAGCTCCCTTTTGTCAGTGTGGAAAATCTC) and
BamHI/363 (5'-GTGGGATCCCGCTTAATACCGACGCTGTCG),
(c) pol donor construct pNL-RT3612-3773, primers
SacI/RT-3612 (5'-GACGGAGCTCGCAAGAATGAAGGGTGC) and BamHI/RT-3773
(5'-GCCAGGATCCGCTTGCCAATACTCTGTCC), and (d) pol
acceptor construct pJRC-RT3541-3753, primers SacI/RT-3541 (5'-GACGAGCTCCAGGGGCAAGGCCAATG) and
BamHI/RT-3753 (5'-
GCACGGATCCCCATGCTTCCCATGTTTCC). Restriction enzyme sites
within the primers are underlined. PCR fragments were
digested with SacI and BamHI and cloned into
pBluescript II KS(+) (Stratagene).
The DIS mutant JRCSF acceptor, p
DIS-NL43 donor, DIS-pol, and
DIS-2-pol constructs were generated using the overlap PCR approach. For
the DIS mutant JRCSF acceptor, primers SacI/PBS-150 and
JRCSF-5'-UTR/DIS
(5'-CCACGCCTCTTGCTGTGCGCGCTTCAGCAAGCCGTGTCC)
were used to generate the 5' 200-base pair fragment, whereas primers BamHI/363 and JRCSF-5'UTR/DIS+
(5'-GGACACGGCTTGCTGAAGCGCGCACAGCAAGAGGCGTGG) were used to amplify the 100-base pair fragment from the 3' end. Sequences in bold indicate substitutions, whereas
underlined sequences represent regions of overlap between
the two fragments. Amplified fragments were purified and used as
templates in a second round of PCR with primers SacI/PBS-150
and BamHI/363. A similar approach was used for the rest of
the constructs, using the following primer sets: (a)
pDIS-NL43, primers SacI/PBS-187 and NL4-3DIS()
(5'-CCTCGCCTCCGAGTCCTGCGTCGAGAGATCTCC) and primers
BamHI/384 and NL4-3DIS(+)
(5'-GGACTCGGAGGCGAGGGGCGGCG), (b) DIS-pol donor,
primers SacI/RT-3612 and NL4-3 RT/DIS()
(5'-CCTCTTGCCGTGCGCGCTTCAGCAAGCCGTGGCTATTTTTTGTACTGCC) and
primers BamHI/RT-3773 and NL4-3 RT/DIS(+)
(5'-GGCTTGCTGAAGCGCGCACGGCAAGAGGAGAAAGCATAGTAATATGGG), (c) DIS-pol acceptor, primers SacI/RT-3541 and
JRCSF RT/DIS() (5'-CCTCTTGCTGTGCGCGCTTCAGCAAGCCTTGGCTATTTTTTGCACTGCC) and
primers BamHI/RT-3753 and JRCSF RT/DIS(+)
(5'-GGCTTGCTGAAGCGCGCACAGCAAGAGGTGAAAGCATAGTAATATGGG), (d) DIS-2-pol donor, primers SacI/RT-3612 and
NL4-3 RT/DIS() (5'-CTCGCCTCTTGCCGTGCGCGCTTCAGCAAGCCGAGGTGGCTATTTTTTGTACTGCC) and primers BamHI/RT-3773 and NL4-3 RT/DIS(+)
(5'-CTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGAGAAAGCATAGTAATATGGG), and (e) DIS-2-pol acceptor, primers SacI/RT-3541
and JRCSF RT/DIS() (5'-CTCGCCTCTTGCTGTGCGCGCTTCAGCAAGCCGAGTTGGCTATTTTTTGCACTGCC) and primers BamHI/RT-3753 and JRCSF RT/DIS(+)
(5'-CTCGGCTTGCTGAAGCGCGCACAGCAAGAGGCGAGTGAAAGCATAGTAATATGGG). Underlined sequences represent regions of overlap between
the two fragments in the second round of PCR. Final PCR fragments were
cloned into pBluescript II KS(+) as described earlier. All constructs
were transformed into Escherichia coli DH5
cells and sequenced to confirm wild type or mutant sequence.
RNA Templates--
RNA templates were generated by in
vitro run-off transcription from BamHI linearized
plasmids using T7 RNA polymerase as per the manufacturer's protocol.
Internally labeled transcripts were generated by including
[-32P]CTP (3000 Ci/mmol) (NEN Life Technologies) in
the transcription mix. All full-length transcripts were purified on a
6% denaturing polyacrylamide gel. All RNA preparations were labeled
with 32P and analyzed by denaturing polyacrylamide gel
electrophoresis to ensure intactness of the templates.
Substrate Preparation--
DNA primers MB20 (5'-CCCATTTATCTA
ATTCTCCC) and MB22 (5'-GCTTGCCAATACTCTGTCC), complementary to the 3'
terminus of the UTR and pol donor RNA templates, respectively, were
used to initiate synthesis. Primers were 5' end-labeled using T4
polynucleotide kinase and [
-32P]ATP (6000 Ci/mmol).
Labeled primer (50 fmol) was mixed with donor (25 fmol) and acceptor
(100 fmol) RNAs in 50 mM Tris-HCl, pH 8.0, 1 mM
EDTA, and 50 mM KCl. Mixtures were incubated at 80 °C
for 1 min and slow-cooled to room temperature to facilitate primer
annealing and refolding of the RNA templates.
Reverse Transcriptase Assays--
All RT assays were performed
in a 12-µl final reaction volume. For transfer assays, 2 units (50 ng) of HIV-I RT were preincubated for 2 min at room temperature with 2 nM template termini of primer-template and 8 nM
acceptor in 50 mM Tris-HCl, pH 8.0, 80 mM KCl,
and 1 mM dithiothreitol. Acceptor RNA was excluded in donor
extension assays. Reactions were initiated by the addition of
MgCl2 and deoxynucleoside triphosphates at a final
concentration of 6 mM and 50 µM,
respectively. After incubation at 37 °C, reactions were terminated
at the indicated times by the addition of 12 µl of termination buffer
(90% formamide, 10 mM EDTA, pH 8.0, and 0.1% each of
xylene cyanole and bromphenol blue). Reaction products were resolved on
6% polyacrylamide-urea gels and visualized by phosphorimaging using
ImageQuant software (Molecular Dynamics).
Analysis of Transfer Products--
Transfer assays were
performed for 1 h, and then transfer products were purified by
polyacrylamide gel electrophoresis and isolated as described previously
(56). Alternately, transfer reactions in triplicate were treated with 2 units of E. coli RNase H (Life Technologies, Inc.) to remove
residual RNA, phenol chloroform-extracted, and ethanol-precipitated.
Transfer products were amplified by PCR using primers
SacI/150 (5' acceptor primer) and BamHI/384 (3'
donor primer) for the 5'-UTR products and primers
SacI/RT-3541 (5' acceptor primer) and
BamHI/RT-3773 (3' donor primer) for the pol products.
Purified fragments were cloned into pBluescript II KS(+) and plated to
yield clones representing the transfer recombinants. Individual clones
were sequenced using M13 (20) primers by automated sequencing to
identify crossover sites within the recombinants. Both approaches
yielded similar results upon sequence analysis.
RNA Dimerization Assays--
15 ng of internally labeled RNAs in
RT reaction buffer were incubated at 80 °C for 1 min and slow-cooled
to room temperature. Refolded RNA samples were mixed with 2 µl of
50% glycerol, resolved on 4% nondenaturing polyacrylamide gels, and
visualized and analyzed by phosphorimaging using ImageQuant software.
| |
RESULTS |
Because dimerization interactions within the 5' leader sequence
bring homologous regions of the two RNAs into close proximity, we
hypothesized that this would create a favorable site for template switching by RT during minus strand synthesis. We therefore examined reverse transcription through the HIV-I 5' leader sequence using donor
and acceptor RNAs comprising the genomic sequence from the PBS to the
start of the gag coding region.
Template Switching Is Supported by the 5' Leader Sequence--
The
HIV-I 5'-UTR sequence chosen here to examine strand transfers spans the
region from the PBS to the start of the gag coding region.
This structure simulates the natural replication intermediate during
completion of minus strand DNA synthesis. The donor and acceptor
templates share a 177-nt-long region of homology (Fig. 1). Synthesis was initiated on the donor
RNA using the 5' end-labeled MB20 DNA primer that annealed to the 3'
end of the donor, but not to the acceptor. Transfers result when the
extending primer terminus, following release from the donor template,
anneals to the homologous acceptor template and completes
synthesis.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic of the 5'-UTR RNA templates and the
predicted secondary structure of the HIV-I 5' leader sequence
(52). Regions and nucleotide positions in the genomic RNA that
correspond to the donor and acceptor RNA templates are indicated.
Bold lines represent the NL4-3 donor (black) and
JRCSF acceptor (gray) RNA templates. Hatched
lines at the template ends denote plasmid-derived sequences on the
templates. Open circles on the templates correspond to
relative positions of natural, single-nucleotide base differences
between the two templates and are designated as markers
1-6. Markers 5 and 6 each comprise
two nucleotide variations. Synthesis was primed from the 20-nucleotide
DNA primer MB20 (black arrow) annealed to the 3' end of the
donor.
|
|
To test for recombination events, primer extension on the donor was
compared in the absence (Fig.
2A) and presence (Fig.
2B) of acceptor template. Full-length donor-directed
synthesis yielded a 214-nt product, which was detected as early as 1 min (Fig. 2A). In the presence of acceptor RNA, an
additional band corresponding to the expected 250-nt transfer product
was also visible (Fig. 2B). At 60 min, 18-20% of
full-length products were the result of synthesis completed on the
acceptor after transfer, indicating efficient strand transfer synthesis
on the UTR templates. In contrast to the rapid generation of donor
extension products, a substantial delay was evident in the appearance
of transfer products, which were detectable only by 5 min (Fig.
2B, lane 1). The stable secondary structures and sequence
characteristics of this template (57, 58) most likely induce the
observed pause sites during synthesis.
View larger version (69K):
[in this window]
[in a new window]
|
Fig. 2.
Minus strand synthesis catalyzed by HIV-I RT
on the 5'-UTR leader sequence. Synthesis was initiated on the
donor template using a 5' end-labeled MB20 DNA primer in the absence
(A) and presence (B) of acceptor RNA. Reactions
were terminated at various time points as indicated, and products were
resolved on a 6% polyacrylamide gel under denaturing conditions.
Full-length synthesis on the donor resulted in a 214-nt donor extension
product (A and B), whereas products resulting
from template switching and synthesis on the acceptor generated a
250-nt transfer product (B). Pause sites corresponding to
the SD and DIS elements are indicated. Lane M, 10-base DNA
ladder.
|
|
We note here that the 250-nt product would consist of transfer products
generated from single and odd numbers of crossovers, where synthesis
was completed on the acceptor. Sequence analysis of transfer products
revealed that the majority of products resulted from single crossovers.
An average of 1 in 20 recombinants was the product of triple
crossovers. Recombinants resulting from double and even numbers of
transfers would complete synthesis on the donor template and would
therefore be indistinguishable from donor extension products. Sequence
analysis of donor extension products, however, did not detect even
number transfer products. Apparently, such products, if generated, are
undetectable among the large excess of products of uninterrupted
synthesis on the donor template.
Template Switching Occurs Predominantly within the DIS Hairpin
Region--
Because frequent template switching was evident within the
leader sequence, we could then correlate the distribution of transfer sites with structural features of the sequence. Cell culture studies in
a murine leukemia virus-based system have shown recombination-mediated rescue of PBS-defective virions in which crossovers map to hairpins within the dimerization domain. If transfers at this site were promoted
by a specific mechanism involving RNA sequence or structure within this
region, we could anticipate a preferred site of template switching or a
recombination hot spot within the HIV-I leader sequence. To determine
this, the transfer products were cloned and analyzed by sequencing.
Donor and acceptor RNAs were generated from HIV-I strains NL4-3 and
JRCSF, respectively, allowing the use of natural sequence variations
within the homologous region as markers in mapping crossovers. This
approach circumvents the need to introduce base substitution markers
that might disrupt natural structural features in the RNA that
contribute to the pattern of recombination.
The transfer distribution, as analyzed from a total of 90 clones from
two independent experiments, is presented in Fig.
3A. As discussed previously,
the majority of transfer products (~95%) resulted from single
template switching events. Only single crossover products were used in
the analysis, although the inclusion of multiple crossover products did
not change transfer distribution. The six sequence markers distributed
across the region of homology were used in determining crossover sites
within the transfer products. Transfers occurred across the length of
the template between all of the markers, suggesting that almost any
region within the template had the potential to support homologous
recombination. A highly preferred region of template switching,
however, was clearly evident between markers 3 and 4. A striking 53%
of transfers occurred within this 48-nt region. In contrast, adjoining
sequences within the template supported a significantly lower but
almost uniform frequency of transfers. The three template segments,
namely, the 58-nt sequence downstream to marker 1, the 40-nt
sequence between markers 1 and 3, and the 30-nt sequence past marker 4, each supported an average transfer frequency of 15-17%. This
corresponds to a third of the transfer frequency observed in the
segment between markers 3 and 4. To account for the uneven distances
between the markers, transfer frequencies within marker segments were
corrected by adjusting for the distance between the markers (Fig.
3B). Transfer frequency within a given marker segment was
divided by the length of that segment, giving a normalized value that
relates to transfer frequency in percentage/10 nt. It is evident from
the raw and adjusted distributions (Fig. 3, A and
B) that the higher transfer frequency is not a simple
consequence of increased marker length. The segment between markers 3 and 4 had three times the potential to promote transfers relative to
its neighboring regions.
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 3.
Distribution of transfers within the
5'-UTR. Template description is same as that in Fig. 1. The region
corresponding to the 35-nt DIS hairpin is indicated. Numbers
1-6 represent marker positions in the templates. A,
hatched bars between markers represent the average transfer
frequencies within the marker segment and correspond to the total
transfers detected within a given marker segment calculated as a
percentage of the total transfers analyzed on the template.
Corresponding numerical values are indicated above the bars.
Values were averaged from two independent experiments of about 45 sequences each and consisted of products resulting from single
crossover events. Transfer efficiency of 18-20% on the template was
determined as the percentage of transfer products over the transfer and
donor extension products combined. B, hatched bars between
markers represent transfer frequencies normalized for the distance
between two markers. Numerical values are indicated above
the bars and were calculated by dividing the crossover frequencies
measured in A by the length of the respective marker
segment. Marker segments are highlighted by parenthesis,
with the segment length in nucleotides indicated in
italic.
|
|
Interestingly, the preferred region for transfers, defined by markers 3 and 4, includes a major part of the DIS hairpin, the structural element
involved in genome dimerization. The template also harbors several
other well-characterized structural elements, including the SD hairpin
between markers 2 and 3 and the 
and AUG hairpins downstream of
marker 1 (Fig. 1). The presence of these structural elements in the
donor and acceptor RNAs was confirmed using an RNA folding algorithm
(59). Whereas these regions contributed to transfers, they did not
create a significant peak of transfers, unlike the DIS. Also, the
loop-loop kissing interaction characteristic of the DIS hairpin is not
promoted by any of the other hairpin elements within the leader
sequence. The biased transfer distribution within the UTR suggests a
hierarchy within secondary structures in facilitating transfers.
Structural features of the DIS hairpin, including those related
to dimerization, appear to be more effective than hairpins in adjacent
sequences at promoting recombination.
To test for PCR-mediated recombination, separate extension reactions
were performed using NL4-3 and JRCSF acceptor RNAs. Samples from the
two extension reactions were mixed, amplified by PCR, and cloned.
Sequence analysis revealed that ~1 in 24 amplification products was
recombinant (~4%), and these did not distribute with a noticeable
trend. Recall that all experimental amplification products derived from
the transfer product band were recombinants. This control experiment
indicates that artifacts from PCR amplification were not significant
enough to skew analysis of the transfer products.
DIS Mutant Acceptor--
The 98-nt sequence downstream of marker
3, comprising the first half of the template and carrying the AUG, ,
and SD hairpins, contributed to only 33% of the total internal
transfers on the template (Fig. 3). In comparison, the 88-nt region
between markers 1 and 4 carrying the DIS and SD stem loops contributed
to about 70% of the total internal transfers on the template,
three-fourths of which occurred within a short 48-nt sequence harboring
the kissing hairpin. The template segment harboring the DIS sequence thus appears to have a pronounced effect in promoting transfers. We
hoped that a finer analysis of transfer distributions at this preferred
region would provide insights into the mechanism of the transfer
process. To address this, the JRCSF DIS mutant acceptor carrying an
additional set of markers 3a and 3b at the base of the DIS stem loop
was generated (Fig. 4A). To
minimize possible structural distortions, this was done by substituting
the U-A base pair at the base of the stem with A-U, so that the
stability of the DIS hairpin was minimally compromised. Use of the RNA
folding algorithm (59) revealed similar folding potentials for both wild type (WT) and DIS mutant acceptor templates. Transfer assays were
performed using the NL4-3 donor and JRCSF DIS mutant acceptor, and
transfer efficiency and distribution were analyzed as described previously.
View larger version (11K):
[in this window]
[in a new window]
|
Fig. 4.
Schematic of the mutant DIS hairpin and its
effect on transfer distribution. A, schematic of the
secondary structure and sequence of the DIS hairpin, indicating the
base pair substitution introduced to create markers 3a and 3b
(filled circles in B) in the DIS mutant acceptor
template. The natural marker at position 3 is also indicated.
B, crossover distribution in the 5'-UTR using the DIS mutant
acceptor. The description is the same as that in Fig. 3A.
Values were averaged from two independent experiments of 62-70
sequences each and consisted of products resulting from single
crossover events.
|
|
Transfer efficiency measured on the mutant acceptor was similar to that
measured on the WT acceptor. Fig. 4B shows the distribution of crossovers supported by the mutant acceptor. Data were averaged from
two independent experiments, each consisting of 65-70 single crossover
products. The new markers (3a and 3b) effectively flank the DIS hairpin
and distinguish transfers within and outside of this structure (Fig.
4A). Several interesting conclusions are evident. Firstly,
the overall distribution of transfers on the mutant acceptor showed a
trend almost identical to that on the WT acceptor (compare Figs. 3 and
4B). The preferred site between markers 3 and 4 supported
49% of the transfers, whereas transfers at other regions were
relatively uniform and low. Compared with transfers on the WT acceptor,
a slight decrease in transfer frequency was observed between markers 3 and 4 on the mutant acceptor, and a slight increase was observed
between markers 2 and 3 and within the 31-nt sequence 5' of marker 4. This could be due to structural changes induced by the base
substitutions in the mutant acceptor. However, the variation was
minimal and did not change the overall trend.
Secondly, in examining the original hot spot between markers 3 and 4, we noted that of the 49% of transfers that mapped within this region,
two-thirds occurred just past the kissing hairpin (between 3b and 4),
whereas only one-third occurred within the hairpin itself (between
markers 3 and 3b). Similarly, of the 20% transfers between markers 2 and 3, only 5% mapped within the DIS 3' stem sequence, and the
remaining 15% occurred outside of the DIS. Contrary to our
expectations, the preferred site did not map within the DIS hairpin
(between 3a and 3b). Instead, crossovers were predominantly detected
within the region immediately 5' of the kissing stem loop. The data
clearly suggest that transfer of the primer terminus occurred after
synthesis through the kissing hairpin. Two simple transfer mechanisms
can be envisioned in this scenario: one in which the transfer process
is initiated at the primer terminus, and a second in which the transfer
process is initiated via primer-acceptor interactions behind RT and the
primer terminus.
Deletion of the DIS Element Impedes Dimerization and Lowers
Transfer Efficiency--
If the dimerization signal were directly
responsible for creating the observed preferred site for template
switching, then deletion of this signal should have a noticeable effect
on both dimerization and transfers. To put this argument to the test
and therefore address the role of the DIS hairpin in promoting
transfers, the DIS donor template was constructed. In this template,
a 23-nt sequence comprising the upper stem loop region of the hairpin was deleted.
Wild type and modified templates were assayed for dimerization
efficiency by heating the individual templates and slow-cooling them
(Fig. 5A). As observed, both
wild type donor and acceptor templates dimerized with similar
efficiencies between 18% and 20% (Fig. 5A, lanes 1 and
2). The base-exchanged DIS mutant acceptor template was also
able to dimerize, albeit with a slightly lower efficiency than the WT
templates (Fig. 5A, lane 3). Unfortunately, the close sizes
of the donor and acceptor RNAs made it difficult to distinguish
donor-acceptor heterodimers from homodimers by this analysis. However,
because both templates are almost identical in sequence, their ability
to self-dimerize is indicative of their potential to heterodimerize
with each other. As anticipated, deletion of the dimerization signal
impeded the ability of the DIS template to self-dimerize (Fig.
5A, lane 4). This is in agreement with previous studies
characterizing the role of the DIS hairpin in promoting the
dimerization of the UTR region (48).
View larger version (76K):
[in this window]
[in a new window]
|
Fig. 5.
Dimerization and transfer efficiencies of the
5'-UTR and DIS UTR templates.
A, internally labeled RNAs were individually folded under
standard reaction conditions and resolved by polyacrylamide gel
electrophoresis under native conditions (see "Materials and
Methods" for details). The slower migrating (upper) bands
observed with the UTR WT donor (lane 1), WT acceptor
(lane 2), DIS mutant acceptor (lane 3), and
DIS donor (lane 4) correspond to RNA homodimers, whereas
the faster migrating bands correspond to the monomer forms.
Dimerization efficiencies are indicated below each lane and
were calculated as the percentage of dimer from the total of dimer and
monomer. The fraction of homodimers formed by the DIS UTR template
(lane 4) was significantly lower. B and
C, minus strand DNA synthesis and strand transfer catalyzed
by HIV-I RT on the DIS UTR donor. Synthesis was initiated on the
donor template using the 5' end-labeled MB20 DNA primer in the absence
(B) and presence (C) of WT acceptor RNA.
Reactions were terminated at the indicated time points, and products
were resolved on a 6% polyacrylamide gel under denaturing conditions.
Full-length synthesis on the donor resulted in a 191-nt donor extension
product (B and C), whereas products resulting
from template switching and synthesis on the acceptor generated
transfer products of two different sizes (C), shown in
detail in D. The larger, 250-nt product resulted from
transfers occurring before the deletion site on the donor, whereas the
227-nt product resulted from template switching after the deletion
site. Lane M, 10-base DNA ladder. D, enlarged
view of transfer product accumulation in assays containing the WT UTR
donor template (left panel) and the DIS donor template
(right panel). Both assays contained WT acceptor RNA.
Reactions were sampled at 5, 10, 15, 30, 45, and 60 min. Donor
extension and transfer products are indicated. The two different-sized
transfer products (250 and 227 nt) observed in the DIS donor assays
resulted from crossovers occurring before and after the deletion site
in the donor template, as indicated by the schematics to the
right. When template switching occurred before the deletion
site, the DIS region was copied from the acceptor, generating the
250-nt transfer product. Transfers occurring after the deletion site
generated the shorter, 227-nt product lacking the DIS sequence. The sum
of both products was used in calculating the transfer efficiency.
Transfer efficiencies measured on the two templates are indicated at
the bottom of each panel.
|
|
To address the role of the dimerization signal in promoting transfers,
we performed transfer assays using the DIS donor in the presence and
absence of WT acceptor (Fig. 5, B and C).
Transfer products of two different sizes were generated, with the size depending on the region where transfers occurred. Primers that transferred before the deletion site on the donor generated the 250-nt
product, whereas those that transferred after the deletion site
produced the shorter, 227-nt transfer product (Fig. 5, C and
D). Whereas the dimerizing template promoted efficient
transfers (18-20%), a 4-fold reduction in transfer efficiency
(5-6%) was observed when synthesis was initiated on the nondimerizing
DIS donor (Fig. 5D). In addition to the overall decrease
in transfer efficiency, a significant delay in accumulation of transfer
products was also noticeable with the DIS donor as compared with the
WT donor (Fig. 5, C and D). Taken together, these
results demonstrate a positive correlation between the DIS-mediated
dimerization and recombination potential within the UTR templates.
Deletion of the DIS Element Results in Suppression of the Hot
Spot--
Deletion of the DIS hairpin reduced both the ability of the
template to dimerize and the ability of the template to promote transfers. To test how these effects impacted the transfer
distribution, transfer products were amplified from the whole reaction
mix, cloned, sequenced, and analyzed as described previously.
Fig. 6A summarizes the
transfer distribution as analyzed from two independent experiments. In
the WT donor, about one-third of the total transfers were concentrated
within a short region adjacent to the DIS and therefore contributed to
one-third of the 18% transfer efficiency measured on the template
(Fig. 4B). On the DIS deletion donor, two template segments
(a segment before marker 1 and the -4 segment) each accounted for
about one-third of the total transfers. Considering the 5-6% transfer
efficiency promoted on the entire DIS, each of these segments
represents only about 1.5-2% transfer efficiency. In the absence of
the DIS, the hot spot was clearly subdued, and a more even distribution of transfers was noticed. As observed from the transfer distribution and crossover frequencies, the reduced transfer efficiency measured on
the DIS template could not be accounted for by the simple loss of
the hot spot. The absence of the DIS hairpin appears to have reduced
transfers across the whole length of the template in addition to
suppressing the original hot spot 5' to DIS.
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Transfer distribution on the
DIS UTR template. A, average
transfer frequencies within the template segments as determined from
two independent experiments. The data represent the number of clones
that indicated a transfer event at a given segment presented as a
fraction of the total number of single crossover clones analyzed.
B, corrected transfer frequencies after normalizing the raw
distribution from A for distance and the 3.5-fold lower
transfer efficiency of DIS compared with WT UTR (Fig. 5C;
18-20% for WT versus 5-6% for DIS; see "Results"
section for details). Numbers in A were divided by the
respective segment length to give transfer frequency/10 nt. These were
as follows: segment 1, 6.1; 2-D, 5; D-4, 9.9; and after 4, 4.9. These
numbers were then divided by 3.5 to arrive at the data presented in
B. This allowed comparison of recombination frequency
between templates containing and lacking the DIS sequences (represented
in Figs. 3B and 6B, respectively). Values were
averaged from two independent experiments of about 40 clones each and
were based on products resulting from single crossover events.
Description and calculations are similar to those discussed in the Fig.
3 legend.
|
|
To adjust for the nonuniform marker distances, transfer frequencies
within each marker segment in Fig. 6A were divided by the
length of the segment. The corrected transfer frequency in percentage/10 nucleotides would then be 6.1 (59-nt segment before marker 1), 5 (segment 2-), 9.9 (segment -4), and 4.9 (segment 4).
Although the region 5' to the deletion site showed a higher frequency
of transfers, it was only about 50% higher than the region upstream of
marker 1. In contrast, comparing the same segments in the UTR template,
the segment 5' to the DIS displayed a 3.7-fold higher frequency of
transfers. The effect of the DIS deletion became more apparent and more
distinct when the transfer efficiency was also taken into account. To
account for the 3.5-fold lower transfer efficiency supported by the
DIS UTR as compared with the WT UTR, we divided the
distance-adjusted numbers by 3.5 (Fig. 6B). The data
representation in Fig. 6B thus allows comparison of
recombination frequency between templates containing and lacking the
DIS sequences (represented in Figs. 3B and 6B,
respectively) after correcting for both marker spacing and transfer
efficiency. Whereas in the WT template, transfer frequencies were high
around the dimerization site and peaked at the DIS, the DIS showed
an overall low frequency of transfers across the templates, with a
redistribution of transfers and suppression of the original preferred
site. Thus, a comparison of the transfer efficiencies and regional
crossover frequencies among the various WT and mutant UTR sequences
strongly suggests that the DIS sequence contributes to creating a
preferred transfer site within the HIV-I 5'-UTR.
The DIS Hairpin Induces Efficient Dimerization of the Ectopic pol
Templates--
To test the potency of the DIS hairpin and to allow
comparison with the dimerizing UTR templates, we generated a set of
control donor and acceptor templates using the pol coding
region of the genome. Whereas this region of the genome has no known
role in genome dimerization, it would have its own flavor of sequence and secondary structures. The pol donor and acceptor templates share a
140-nt region of homology, with nucleotide base differences distributed
at seven positions within this region (Fig. 8A). To test the
competence of DIS-induced dimerization in promoting transfers, we
presented it within this ectopic pol sequence. The DIS-pol donor and
acceptor (Fig. 8C) contain the upper stem loop (28 nt; Fig.
4A) of the kissing hairpin, whereas the DIS-2-pol template set (Fig. 8D) contains the entire kissing hairpin (35 nt).
Wild type and DIS insertion pol templates were assayed for dimerization
efficiency by heating the internally labeled templates individually and
slow-cooling them (Fig. 7A).
As tested under RT assay buffer conditions, the pol donor dimerized
very inefficiently (<1%), whereas ~10% of the acceptor existed as
dimer (Fig. 7A, lanes 1 and 2). In contrast, both
the DIS-pol and DIS-2-pol templates dimerized with very high
efficiencies (Fig. 7A, lanes 3-6). In all template sets,
the acceptor dimerized with higher efficiency than the donor.
Structures or sequences within the extended 5' region of the acceptor
most likely contribute to this effect. When donor and acceptor RNAs
were present in equimolar concentrations, both the DIS-pol and
DIS-2-pol templates also formed heterodimers in addition to the
homodimers (Fig. 7A, lanes 8 and 9), suggesting that DIS-induced dimerization was facilitated within the ectopic pol
sequence. In the absence of the kissing hairpin, no detectable levels
of heterodimers were observed with the WT pol templates (Fig. 7A,
lane 7). Unlike the UTR templates, the significant size differences between the pol donor and acceptor templates made it
possible to distinguish donor-acceptor heterodimers from
homodimers.
View larger version (61K):
[in this window]
[in a new window]
|
Fig. 7.
Dimerization and transfer efficiencies
supported by the pol and DIS-containing pol templates.
A, internally labeled donor (lanes 1, 3, and
5) and acceptor (lanes 2, 4, and 6)
RNAs were individually refolded under standard transfer assay
conditions and subjected to native polyacrylamide gel electrophoresis
(see "Materials and Methods" for details). The slower migrating
bands (upper bands) observed with the pol (lanes
1 and 2), DIS-pol (lanes 3 and
4), and DIS-2-pol (lanes 5 and 6)
templates correspond to RNA homodimers, whereas the faster migrating
bands correspond to the monomer fractions. Dimerization efficiencies
are indicated below each lane and were calculated as the
percentage of dimer from the total of dimer and monomer. Equimolar
concentrations of donor and acceptor templates were mixed and refolded
together (lanes 7-9) to examine heterodimer formation by
the pol (lane 7), DIS-pol (lane 8), and DIS-2-pol
(lane 9) templates. Products corresponding to the homodimer,
heterodimer, and monomer forms are indicated. B D, strand
transfer catalyzed by HIV-I RT on pol (B), DIS-pol
(C), and DIS-2-pol (D) in the presence of the
acceptor RNA. Reactions were terminated at the indicated time points,
and products were resolved on a 6% polyacrylamide gel under denaturing
conditions. Full-length donor extension products on the pol (177 nt),
DIS-pol (205 nt), and DIS-2-pol (212 nt) are indicated. Strand transfer
products resulting from template switching and synthesis on the
acceptor generated 247-, 275-, and 282-nt transfer products with the
pol, DIS-pol, and DIS-2-pol templates, respectively. Pausing within the
inserted DIS sequences is indicated for the DIS-pol and DIS-2-pol
templates. Lane D is a 60-min control reaction without
acceptor. Lane M contains a radiolabeled 10-base pair DNA
ladder.
|
|
DIS-induced Dimerization Enhances Transfer Efficiency in the pol
Templates--
To address the role of the dimerization signal in
promoting transfers, we performed transfer assays using the WT and
DIS-containing pol template sets under assay conditions similar to
those used for the UTR templates (Fig. 7, B-D).
Quantitative analysis of transfer products yielded 6-7% transfer
efficiency for the pol templates, whereas the DIS-pol and DIS-2-pol
templates showed transfer efficiencies of 11-12% and 10-11%,
respectively, approximately doubling the efficiency. Insertion of the
28- and 35-nt DIS sequences increased homology length of the original
template by 16% and 25%, respectively. However, this cannot account
for the almost 200% increase in transfer efficiency. Additionally, as
observed previously with the UTR templates (Fig. 5C), an
increased delay in accumulation of transfer products was also observed
with the nondimerizing pol templates as compared with the dimerizing
templates (compare Fig. 7B with Fig. 7, C and
D). Quantitative analysis by phosphorimaging detected
transfer products by 2.5 min with both dimerizing templates, whereas in
the pol templates, transfer products were detectable only by 5 min.
With all three substrates, full-length donor extension products were
detectable as early as 1 min.
To better understand how the presence of the DIS sequence relates to
recombination, we sequenced the transfer products and analyzed transfer
distributions in the three sets of templates (Fig.
8). The unaltered raw transfer
distributions are presented as averaged from a minimum of two
independent experiments (Fig. 8, A, C, and D).
Transfer distributions within the various pol templates were normalized
for the unequal marker distances to examine the relative transfer
potentials of the different segments. To arrive at this, the transfer
frequencies (represented in percentages in Fig. 8, A,
C, and D) within marker segments were divided by the
segment lengths. To allow a vertical comparison between the templates,
the distance-corrected frequencies in the pol templates were
additionally normalized for the 2-fold lower transfer efficiency promoted by this template compared with the dimerizing DIS and DIS-2-pol templates (Fig. 8, B, E, and F). The
effectiveness of the DIS sequence in facilitating transfers, even when
presented within an ectopic region, clearly demonstrates a positive
correlation between DIS-mediated template dimerization and
recombination potential.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 8.
Transfer distribution on the pol and
DIS-containing pol templates. Details of the schematic are the
same as those described in the Fig. 1 legend. Nucleotide positions in
the genomic RNA that correspond to the donor and acceptor pol templates
are indicated (A). Synthesis was primed from the
19-nucleotide DNA primer MB22 (black arrow) annealed to the
3' end of the donor. Numbers 1-7 designate
single-nucleotide base differences between the donor and acceptor
templates. Marker 3 comprised a 2-base variation. A, C, and
D, transfer distribution showing the average transfer
frequencies within marker segments in the pol (A), DIS-pol
(C), and DIS-2-pol (D) templates as determined
from two independent experiments. Data represent the number of clones
that indicated a transfer event at a given segment presented as a
fraction of the total number of single crossover clones analyzed. The
28- and 35-nt DIS sequence insertions within marker 3 are indicated for
the DIS-pol (C and E) and DIS-2-pol (D
and F) templates, respectively. Marker D represents the
single-nucleotide base variation within the NL4-3 and JRCSF DIS
sequence. B, D, and E, corrected transfer
frequencies after normalizing the raw distribution from A,
C, and D, respectively, for marker distance and the
2-fold lower transfer efficiency of the pol template compared with
DIS-containing templates (6-7% for WT versus 11-12% for
DIS-pol and 10-11% for DIS-2-pol; see "Results" for details).
Corrected frequencies for DIS-pol (E) and DIS-2-pol
(F) templates were derived by simply dividing the
frequencies within the marker segments from C and
D by the respective segment length to give transfer
frequency/10 nt. Distance-corrected frequencies similarly derived for
the pol templates were as follows: segment 1, 1.2; 1-2, 3.4; 2-3, 11;
3-4, 13.6; 4-5, 5.7; and after 5, 9.7. To account for the almost
2-fold lower transfer efficiency of the pol template, these
distance-corrected numbers were further divided by 2 to arrive at the
data in B. This allowed comparison of recombination
frequency between the templates containing and lacking the DIS
sequences. Values were averaged from two to three independent
experiments of about 40 clones each and based on products resulting
from single crossover events. Description and calculations are similar
to those discussed in the Fig. 3 legend.
|
|
It is immediately apparent from the transfer distributions that unlike
the case of the UTR template (Fig. 3A), transfers within the
unaltered pol template did not highlight any preferred sites (Fig.
8A). About 40% of the extending primers transferred before marker 3. When transfer frequencies were normalized for distance, segment 3-4 stood out as the most recombinogenic segment, followed by
segment 2-3 and the end segment after 5 (Fig. 8B).
Insertion of either the partial or the full DIS hairpin caused some
changes in distribution (Fig. 8, C-F). Examination of the
normalized frequencies showed two concentrations of crossovers, one
centered around the DIS and the other at the 5' end of the segment
(Fig. 8, E and F). In both templates, the end
segments promoted the most transfers, followed by the D-3b (DIS loop
and 5' stem) segment. In the DIS-2-pol template, the 13-nt 3' DIS stem
does not appear as potent as the shorter, 9-nt stem in the DIS-pol.
This is most likely because the effect is diluted out in the longer
3a-D segment (5.6% in 9 nt versus 4.4% in 13 nt). As
observed with the WT UTR template, the presence of the DIS (both the
partial and full sequences) enhanced transfers across the whole
template. The concentration of crossovers near the DIS is also
consistent with the characteristics of the UTR template. Enhanced
transfers at the pol 5' end may be induced by an additional
template-template interaction site promoted in the presence of the DIS.
Overall, the ability of the DIS sequence to induce template
dimerization and the correlation with transfer efficiency and
distribution in both UTR and pol templates strongly suggest that
DIS-induced dimerization enhances recombination.
| |
DISCUSSION |
Extensive analyses both in cell culture and in
vitro have identified substrate and enzyme features that are
determinants in driving retroviral recombination. To date, several
studies have shown pausing as a strong facilitator of transfers during
minus strand synthesis (60-62). Stalling concentrates RT-associated
RNase H cuts. Invasion by the acceptor at the gap produced by RNase H
cleavage leads to displacement of the donor template and primer capture
(60, 63-65). Alternately, the nascent DNA may be released from the
donor, which can then interact with the acceptor from solution.
Conditions that promote pausing are therefore conducive to template
switching. Misincorporation during synthesis promotes strand transfers
primarily through such a pause and RNase H-mediated mechanism (66, 67).
Similarly, homopolymeric runs within the templates that are hot spots
for frameshift mutations (68, 69) also affect recombination (70). In
addition to pausing, the role of template-template interactions as an
alternate mechanism in driving transfers is becoming increasingly
evident (53, 56). The efficiency of such a mechanism is very
convincingly demonstrated at the dimerization site within the
retroviral genome (20, 53-55). Whereas structure and sequence features
of the template present favorable sites for template switching,
properties of RT are also critical in facilitating the process. The
absolute requirement for RT-associated RNase H in facilitating strand
transfers on heteropolymeric RNA templates has been demonstrated by a
number of independent studies (60, 63-65, 71).
Using the HIV-I TAR, Kim et al. (56) demonstrated
that stable hairpin structures promote recombination not only at the
pause site at the hairpin base but also within the stem loop. Lessons from the TAR hairpin provided the first clues for the possible role of
template-template interactions in driving recombination. To test this
more extensively, we chose a region of the HIV-I genome that is well
characterized for its ability to dimerize, the DIS containing 5' leader
RNA. Dimerization via DIS-mediated kissing interactions has been
demonstrated to be very efficient, stable, and promoted in the absence
of any protein components.
We initiated experiments with the UTR templates with the following
hypothesis: if template interactions facilitate transfers, then the
dimerization site should be a preferred region for recombination. In
fact, not only did the UTR templates support a high efficiency of
template switching during reverse transcription, but 53% of the
transfers were concentrated within a 48-nt segment encompassing the
dimerization signal, consistent with a template interaction-mediated transfer mechanism.
The effect of the DIS hairpin became more evident when transfer
efficiency and distribution were examined in the DIS deletion template
(DIS). In the absence of the kissing hairpin, the UTR sequence was
not only ineffective in dimerization but also displayed a striking
3-4-fold reduction in transfer efficiency when compared with the WT
template. 1 of every 5 of the extending primers transferred on the WT
UTR template, whereas only 1 in 18-20 of the extending primers
transferred on the nondimerizing DIS template. The 48-nt preferred
site in the WT template alone accounted for a transfer efficiency of
about 10% (53% of 18-20%, Fig. 3A), which was almost twice the transfer efficiency of the DIS template as a whole. The
segment 3' to marker 4 accounted for transfer efficiencies of 1.7% and
6.3% in the absence and presence of the DIS sequence (31.7% of
5.5%, Fig. 6A; compare with 33% of 19%, Fig.
4B). The combined data from Figs. 3, 4, and 6 clearly
demonstrate that the preferred transfer site is 5' to the DIS and
created only in the presence of the DIS sequence. Secondly, as
observed from the corrected frequencies, transfers were more evenly
distributed on the DIS template, which did not show any distinct hot
spots. Frequencies, in decreasing order, in the DIS template were
2.8, 1.7, 1.4, and 1.4, whereas in the WT template, they were 11, 4.6, 4.6, and 3. In the WT UTR, segment 3-4 was 2.4 times more
recombinogenic than the second most favorable site (segments 2-3 and
4-end) and 3.6 times more recombinogenic than segment 1. However, in
the DIS template, segment -4 was only 1.6 times more
recombinogenic than the second most favorable site, i.e. the
segment before marker 1. In the absence of the DIS sequence, there is a
redistribution of transfers with a suppression of the original hot spot.
Clearly, the 4-fold drop in transfer efficiency on the DIS cannot be
explained by the simple reduction of the hot spot. There is a decreased
frequency of crossovers across the whole template, thereby making the
whole region less conducive to recombination. This is clear from the
transfer frequencies normalized for distance and decreased transfer
efficiency (Fig. 6B). Whereas the distance-corrected frequencies allow comparison of transfer potentials of segments within
a given template, the additional correction for transfer efficiency
allows comparisons between templates differing in transfer efficiencies. Whereas this does not alter the profile within the given
template, it correctly represents the lower transfer potential within
the template.
Our conclusions on the role of the DIS sequence in mediating transfers
in the UTR templates are further substantiated by the transfer data
from the pol templates. The DIS sequence not only induced dimerization
of the pol templates but also caused an approximate doubling of
transfer efficiency. As with the DIS UTR templates, the change in
transfer efficiency cannot be attributed to the simple change in
template length. Clearly, it is the characteristics imparted by the DIS
sequence to the template, rather than its length, that is the important
determinant. In both sets of templates, dimerization makes the overall
region more recombinogenic. Whatever factors contribute to crossovers
within the individual segments of the template, be they sequence,
pausing, or structure-induced, DIS-induced dimerization helps to
accentuate them.
The requirement of RNase H for transfers has been demonstrated in a
number of previous studies (60, 63-65, 71). In our system as well, the
HIV-IRT E478Q mutant (72) lacking RNase H activity was ineffective in
producing detectable levels of transfer products with the UTR templates
(data not shown). Also, although the UTR template harbors several other
structural elements, including the SD, , and AUG hairpins, these did
not appear to be major promoters of transfers. Because the template RNA
is continually unwound, cleaved, and subjected to dynamic changes in
conformation as synthesis proceeds (73), transient conformations also
most likely contribute to the transfer process. Such factors, although difficult to ascertain, cannot be ignored.
Pausing is a strong facilitator of transfers (60-62). A previous study
(57) examining RT pause sites within the HIV-I leader sequence has
shown the strongest pausing within the A-U stretch 3' to the SD
hairpin, with weaker pause sites at other regions. In the present
study, weak pause sites were induced both within the poly(A) stretch
and start of the SD hairpin and within the DIS hairpin (Fig. 2).
Quantitative analysis of these pause sites showed that synthesis was
not significantly impeded within these regions, even at the dimer
interaction site. This suggests that although pausing is very likely an
important factor, it is not the sole facilitator of the transfer
mechanism within this region. Clearly, transfers are promoted through
the interaction of several factors. This also agrees with the
observations of Kim et al. (56), who found that transfers
within the TAR hairpin did not correlate with a strong pause site,
unlike the pause-induced transfers at the base of the hairpin.
Two interesting characteristics were observed with the transfers
promoted in the UTR. Firstly, contrary to our expectation, the
preferred site mapped to the region immediately 5' of the DIS hairpin.
Significantly, distribution data primarily indicate the region within
which synthesis is reinitiated on the acceptor after primer terminus
transfer. They do not reveal exact details of the transfer process
itself. Secondly, a noticeable delay was observed in the appearance and
accumulation of transfer products as compared with donor extension
products, which was further augmented in the nondimerizing DIS
template. Observed in previous analyses of strand transfer in
vitro (64), this lag in appearance of transfer products suggests
that one or more steps in the transfer mechanism limit the rate of
generation of transfer products. These steps could include formation of
a transfer intermediate, the primer transfer process itself, or
initiation of synthesis from the transferred primer terminus. Such
mechanistic details are currently poorly understood and require more
detailed analysis to address and dissect the steps in the transfer process.
Based on the observed crossover distribution within the UTR sequence,
together with our current understanding of transfer mechanisms, we
propose the following model for RT-mediated template switching at the
DIS. As synthesis proceeds, RT-associated RNase H cleaves the donor
RNA. The clustering of pause sites within the DIS sequence is
indicative of increased RNase H activity within this region. This
creates gaps within the hybrid behind the extending primer terminus,
where the acceptor-nascent DNA interactions are initiated. Once a
significant length of the DNA behind the RT has base-paired with the
acceptor, the primer terminus, which has now extended past the DIS, is
also forced to transfer, completing the process. Very likely, the
primer terminus is displaced from the donor via progressive invasion by
the acceptor (74, 75). DeStefano et al. (74) have shown the
nascent DNA to form initial interactions with the acceptor template
over several bases, forming a stable duplex before extension on the
acceptor. Such interactions can be favorably promoted within the DIS
region. Dimerization-induced proximity between primer donor and
acceptor thus increases the efficiency and frequency of transfers
around the dimerizing region relative to other regions.
A recent study in cell culture showed that an average of three
crossovers occur per replication cycle in HIV-I (12). The same study
also suggested that crossovers occur throughout the length of the
genome and with similar efficiency, and no obvious hot spots
were seen when large genome segments were compared. The 5'-UTR sequence
was not analyzed in that study. In our system, the DIS region appears
as a hot spot in the context of a short, 200-nt length of the genome
but is not likely to be a uniquely prominent hot spot in the context of
the 10-kb genome. Recombination events within UTR could serve to
correct for defects in regulatory elements such as the PBS and thereby
contribute to enhancing viability and fitness.
The focus of the current study was to ascertain the role of template
interactions in facilitating transfers and thereby add to our current
understanding of factors and determinants that promote recombination in
HIV. Based on the observations in this study, we propose that template
interactions offer an alternate mechanism for promoting recombination,
which is distinct from pause-mediated transfers. Both mechanisms may
contribute to creating the most active sites for crossovers. Whereas
significant progress has been made in identifying important
determinants for recombination, the actual mechanisms of template
switching are only just beginning to be understood. Gaining a better
insight into the "how and why" of template and enzyme features that
impede or promote template switching will allow us to better appreciate
recombination as a driving force in retroviral evolution and genetic variation.
,
TOP
ABSTRACT
INTRODUCTION
